Aquaculture 533 (2021) 736070

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Antibacterial spectrum of synthetic herbal-based polyphenols against Vibrio

parahaemolyticus isolated from diseased Pacific whiteleg shrimp (Penaeus
vannamei) in Thailand
Tran Huu Tinh a, Sivaramasamy Elayaraja a, d, *, Mahmoud Mabrok b, d,
Putu Cri Devischa Gallantiswara a, Varaporn Vuddhakul c, Channarong Rodkhum a, d, *
a
Department of Veterinary Microbiology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, 10330, Thailand
b
Department of Fish Diseases and Management, Faculty of Veterinary Medicine, Suez Canal University, Egypt
c
Departments of Microbiology, Faculty of Science, Prince of Songkla University, Songkhla 90110, Thailand
d
Fish Infectious Diseases Research Unit (FID RU), Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand

A R T I C L E I N F O A B S T R A C T

Keywords: Acute hepatopancreatic necrosis disease (AHPND) was first reported as a new shrimp disease in 2009, which
Penaeus vannamei caused serious disease in shrimp culture with global economic losses and high rates of mortality. Vibrio para­
AHPND haemolyticus (VP) was recently identified as the leading causative agent of AHPND that contains Pir toxin bearing
Vibrio parahaemolyticus
plasmid coding toxins (PirA and PirB). Classic antibiotic treatments have been used for the control of infections,
Polyphenols
Antibacterial susceptibility
however, the frequent use of antibiotics has led to the emergence of antibiotic-resistant bacterial strains of public
health concern. The present study aimed to investigate the potential use of synthetic herbal-based polyphenols
compounds as natural, eco-friendly antimicrobial agents for disease control. Polyphenols and their active in­
gredients were investigated against 96 VP isolates retrieved from Pacific whiteleg shrimp (Penaeus vannamei) in
Thailand and compared with various commercial antibiotics using a broth microdilution method, time-kill assay,
and scanning electron microscope (SEM). All VP isolates were identified using conventional bacteriology and
molecular-based tools. Bacteriological examination revealed that all isolates harbored toxR gene with specific
amplicons of 368 bp. Only 56 isolates were positive to AP3, a toxin-encoding gene of AHPND-VP with a fragment
size of 336 bp. In terms of susceptibility, all isolates were entirely resistant to ampicillin and amoxicillin, whereas
they showed different susceptibility patterns to the other tested antibiotics. Among the polyphenols, there was no
apparent activity of syringic acid and rutin, while vanillic acid showed higher bactericidal activity against VP
isolates at MICs and MBCs of 1024–2048 μg mL− 1. Pyrogallol exhibited the strongest antibacterial activity even
at very low concentrations with a MIC and MBC of 32–256 μg mL− 1, and the majority of cells showed disruption
and an indistinguishable cell wall structure by SEM analysis. The present study offers pyrogallol as a potential
synthetic herbal-based antimicrobial agent for the adoption of inventory management practices and control of
V. parahemolyticus causing AHPND in shrimp producing sectors.

1. Introduction
The Pacific whiteleg shrimp (Penaeus vannamei) is one of the most
popular farmed species in Asia and Latin America (Kongchum et al.,
2016). The production of P. vannamei has dramatically increased
worldwide in the past few decades from 1.31 to 3.75 million metric
tonnes (MT) in 2018 with an estimated production of 4.00 million MT
for 2021 (Anderson et al., 2019). Global shrimp trade was estimated at
USD 45 billion in 2018 with an expected annual growth rate of 5.7%
during the forecast period, 2019–2024 (Halwart, 2020). Thailand is one
of the main world’s leading producers of shrimp (sixth largest producer),
which accounts for nearly 7.5% of global shrimp production. Specif­
ically, whiteleg shrimp production in Thailand was estimated at
approximately 329,636 tons in 2017 (FAO, 2017). Recently, global
shrimp production review reported that Thailand was one of the biggest
shrimp producing sectors with an annual production of ~0.4 million MT
(Anderson et al., 2019).
One of the main factors limiting the sustainability of shrimp farming

* Corresponding authors at: Department of Veterinary Microbiology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, 10330, Thailand.
E-mail addresses: elayabact@yahoo.com (S. Elayaraja), channarong.r@chula.ac.th (C. Rodkhum).

https://doi.org/10.1016/j.aquaculture.2020.736070
Received 1 June 2020; Received in revised form 10 October 2020; Accepted 16 October 2020
Available online 21 October 2020
0044-8486/© 2020 Elsevier B.V. All rights reserved.
T.H. Tinh et al.
in Thailand is the weak economic return from the investment, not the
lack of production technology. As capture fisheries production is not
expected to increase significantly, the focus is on the ability of the
producing sectors to provide increased amounts of shrimp through
intensification to satisfy the increasing demand (Sampantamit et al.,
2020). Consequently, the intensification of shrimp leads to outbreaks of
disease-causing massive mortality of cultured shrimp (Bondad-Reantaso
et al., 2012). Among the serious pathogens, V. parahaemolyticus is the
main threatening bacterial pathogen affecting some cultured shrimp
species and causes acute hepatopancreatic necrosis disease (AHPND)
with high mortality and severe economic losses (Sivaramasamy et al.,
2016; Peña-Navarro et al., 2020).
Vibrio parahaemolyticus is a halophilic bacterium that affects a wide
range of marine hosts (Ghenem et al., 2017) and the identified patho­
genic isolates have caused serious economic damages to shrimp culture
(Flegel, 2012). The bacteria have presently received much attention not
only for their huge economic losses but also for their public health
concerns (Thongjun et al., 2013; Okoh et al., 2015). Vibrio para­
haemolyticus is a rapidly growing microorganism that can multiply every
8–9 min in ideal conditions (Daniels et al., 2000). The estimated losses in
the shrimp aquaculture sector in Asia due to the outbreak of
V. parahaemolyticus 11 billion in Thailand and 45 billion in Asia from
2009 to 2016 (De Schryver et al., 2014; Shinn et al., 2018). AHPND was
first reported in China in 2009, then spread to other neighbouring
countries including Vietnam, Malaysia, and Thailand (Flegel, 2012), and
recently appeared in Mexico in early 2013 (Nunan et al., 2014).
The pathogenic bacteria-induced several pathopnomonic lesions,
including lethargy, milky stomach, atrophied HP, empty GIT, and soft
shells (Tran et al., 2013). The pathogenic strains have 69 kp plasmid,
containing two homologous insect-related toxins Photorhabdus (pirA
and pirB) (Yang et al., 2014; Han et al., 2015a). Injections of PirA and
PirB-like proteins into shrimp and immersion bioassays using the
depleting pirA and pirB genes to depress bacteria unambiguously
showed that PirA and PirB-like toxins are the causative agents of AHPND
(Han et al., 2015b).
Antibiotics have been traditionally applied to treat and/or control
the AHPND disease-causing pathogen, which can subsequently lead to
the development of antibiotic-resistant bacterial strains in the aquatic
environment, and failure in the treatment of this infection (Di Cesare
et al., 2013; Okocha et al., 2018). Moreover, there is considerable
disquiet about the risk of transmission of resistance determinants to
wildlife bacteria and human pathogens and the entity of antibiotic res­
idues in aquaculture by-products that pose public health threats (Da
Costa et al., 2013; Watts et al., 2017). Hence the antibiotic treatment
alternatives are ultimately required for the sustainability of aquaculture
and to ensure that the product is safe for human consumption (Kong­
chum et al., 2016).
Recently, many scientific researchers have considered the possible
application and adoption of natural compounds of potent antibacterial
activity, including synthetic and organic plant derivatives, biologically
synthesized nanocomposites for the treatment of aquatic animal diseases
(Talpur, 2014; Baba et al., 2016; Mabrok and Wahdan, 2018; Wahdan
et al., 2020; Elayaraja et al., 2020). Herbs are repositories and sources of
the typically safest and cheapest chemicals (Van Hai, 2015). Herbal
derivatives, including polyphenols, phenols, alkaloids, and peptides
provide potential activity alternatives to antibiotics and other synthetic
compounds (Citarasu, 2010). Polyphenols are herbal-derived products
that are commonly found in fruits, vegetables, and plant-derived bev­
erages, and were bactericidal to many bacterial insults (Nakamura et al.,
2015; Wickramasingha et al., 2018). Polyphenols contain a benzene
ring, a carboxylic compound and one or more hydroxyl and/or methoxyl
groups in their molecules, which provide potential antimicrobial and
2
Aquaculture 533 (2021) 736070
Table 1
List of primers used in the present study.
Primer Sequence (5′ -3′ ) Amplicon Reference
(bp)
toxR F GTCTTCTGACGCAATCGTTG 368 Kim et al.,
R ATACGAGTGGTTGCTGTCATG 1999
AP3 F ATGAGTAACAATATAAAACATGAAAC 336 Sirikharin
R GTGGTAATAGATTGTACAGAA et al., 2014
antioxidant properties (Bravo, 1998).
Among the polyphenols, pyrogallol (Lima et al., 2016), syringic acid
(Carvajal et al., 2012), vanillic acid (Pu et al., 2017), and rutin (Dong
et al., 2020) prescribed to treat numerous diseases due to their antiox­
idant and bactericidal activities. These compounds have been reported
to enhance growth performance, stimulate appetite, and fortify the
immune response of fish and shrimp (Baruah et al., 2015; Van Hai, 2015;
Sattanathan et al., 2020).
Although several studies have briefly elucidated the antimicrobial
effects of polyphenols on V. parahaemolyticus (Taguri et al., 2004; Yano
et al., 2006; Liu et al., 2017), most of them were conducted with the
crude extracts which often contain many active ingredients like syringic
acid and pyrogallol (Carvajal et al., 2012). The present study aimed to
find a natural and eco-friendly antibacterial agent and to verify its
components that have potential antibacterial activity against AHPND
and non-AHPND causing isolates of V. parahaemolyticus for eventual use
as a surrogate for many commercial antibiotics and overcoming the
emergence of antibiotic-resistant phenomena.
2. Materials and methods
2.1. Samples collection
A total of 50 Pacific whiteleg shrimp (Penaeus vannamei) were
collected randomly from shrimp earthen pond farms located in the
central provinces (Chanthaburi, Nakhonpathom, and Ratchaburi) of
Thailand with a previous history of AHPND disease over the period from
October-2013 to August-2014. Shrimp samples were transferred alive in
aerated plastic bags filled with pond water to the Department of Vet­
erinary Microbiology, Faculty of Veterinary Science, Chulalongkorn
University, Thailand, for further clinical and bacteriological
examinations.
2.2. Bacteriological assay
Upon arrival, all shrimp were immersed in ice-water for stunning,
externally sterilized with 70% ethanol, and dissected to separate the
intestine and hepatopancreas. Subsequently, a loopful of fresh speci­
mens was aseptically streaked onto thiosulfate-citrate-bile salts-sucrose
(TBCS) agar (Difco™, USA) and left incubated at 30 ◦ C for 24 h. Sus­
pected colonies (non-sucrose fermenting colonies) were then harvested
and sub-cultured on tryptic soy agar (TSA) (DifcoTM, USA) supple­
mented with 1% sodium chloride (NaCl) for further morphological and
biochemical characterization as described elsewhere by (Alsina and
Blanch, 1994).
2.3. Molecular identification of V. parahaemolyticus
The gDNA extraction was carried out by the boiling method ac­
cording to Croci et al. (2007) with slight modifications. Briefly, the pure
suspected colonies were collected and inoculated into tryptic soy broth
T.H. Tinh et al. Aquaculture 533 (2021) 736070

Table 2
Geographic origins of Vibrio parahaemolyticus isolates (n = 96) used in this study.
Geographic origins AHPND Non-AHPND
Central provinces 9 21
Southern provinces 47 19
Total 56 40
(TSB) (Difco™, USA) supplemented with 1% NaCl for 24 h at 30 ◦ C.
Subsequently, 1 mL of overnight bacterial cultured was centrifuged for
3 min at 9000 rpm to collect the bacterial pellets, which were later
suspended in 200 μL of DNAse treated water and boiled at 100 ◦ C for 10
min. The supernatant was then collected after 5 min of centrifugation at
9000 rpm. Genomic DNA samples with a purification ratio of 1.8–2.1 at
260/280 nm were quantified using a Nanodrop (Nanodrop 1000,
Thermo Scientific, UK), adjusted to 100 ng μL− 1, and frozen at − 70 ◦ C
until use as templates for PCR.
To ensure that all isolates belonged to V. parahaemolyticus, one set of
species-specific primers targeting the toxR gene of V. parahaemolyticus
was selected based on the previous study of Kim et al. (1999). The
primers sequences are given in Table 1. PCR reaction mixtures of 25 μL
containing 2 μL of gDNA templates, 2 μL of each primer, 6.5 μL of Elix
water, and 12.5 μL of MasterMix (Promega, USA) were amplified in a
thermal cycler (Life Express, China). The samples were subjected to 5
min of initial denaturation at 94 ◦ C, followed by 20 cycles of denatur­
ation at 94 ◦ C for 1 min, annealing at 63 ◦ C for 1.5 min, and extension
and signal acquisition at 72 ◦ C for 1.5 min. A reference strain of
V. parahaemolyticus with a Genbank accession number DMST21243 was
kindly provided by the Department of Microbiology, Chulalongkorn
University and used as a positive control, while DNA free template was
used as a negative control. The amplified PCR products were visualized
by horizontal 1% (w/v) agarose gel electrophoresis (iNtRON Biotech­
nology, Korea) for 30 min at 100 V in 0.5× tris-borate-EDTA (TBE)
electrophoresis buffer, photographed under UV transilluminator (Syn­
gene, USA). A gene ruler 100 bp plus DNA ladder (Thermo scientific)
was run parallel as molecular weight marker, where the DNA band of
approximately 368 bp was considered as positive for
V. parahaemolyticus.
2.4. Molecular differentiation between AHPND and non-AHPND
V. parahaemolyticus
For molecular differentiation between AHPND and non-AHPND
V. parahaemolyticus, one set of primers targeting the AP3 toxin-
encoding gene for AHPND was selected according to Sirikharin et al.
(2014) and their oligonucleotides sequences are given in Table 1. PCR
reaction mixtures of 25 μL were amplified and visualized using the same
Total ingredients and tools mentioned above. The thermal protocol included
5 min of denaturation at 94 ◦ C, followed by 30 cycles of denaturation at
30
66 94 ◦ C for 30 s, annealing at 53 ◦ C for 30 s, and extension and acquisition
96 at 72 ◦ C for 40 s. The DNA template of AHPND V. parahaemolyticus
provided by Center of Excellence for Shrimp Molecular Biology and
Biotechnology (Centex Shrimp, Bangkok, Thailand) was used as a pos­
itive control, while the DNA free template was used as a negative con­
trol. The DNA ladder (Promega, USA) was run parallel as molecular
weight marker, where AHPND positive samples gave a positive band at
336 bp.
2.5. Antimicrobial susceptibility testing
The susceptibility of 96 isolates of V. parahaemolyticus to eight com­
mercial antibiotics and four synthetic herbal-based polyphenols were
evaluated using minimal inhibitory concentration (MIC) and minimal
bactericidal concentration (MBC) assays following the standard protocols
of (CLSI, 2006a). Only 30 out of 96 isolates was retrieved from the diseased
whiteleg shrimp in the present study and was molecularly differentiated
into 9 AHPND and 21 non-AHPND V. parahaemolyticus, while the
remaining 66 isolates (47 AHPND and 19 non-AHPND V. parahaemolyticus
isolates) were obtained from the culture collection of Faculty of Science,
Prince of Songkla University, and previously isolated from shrimp farms in
Pattani and Songkhla provinces, the southern part of Thailand, during
natural outbreaks of AHPND (Kongrueng et al., 2014).
A summary of isolates number and their geographic origins are
illustrated in Table 2. For inoculum preparation, each strain was sub-
cultured overnight at 30 ◦ C on TSA supplemented with 1% NaCl. Sub­
sequently, the suspension of pure colonies in normal saline (0.85%
NaCl) was adjusted to a final concentration of 108 CFU mL− 1 (corre­
sponding to approximately 0.5 McFarland standards) using a Helber-
type bacterial counting chamber (Marienfeld, Germany). The stan­
dardized suspension was then diluted 1:100 with Mueller Hinton Broth
(MHB) (DifcoTM, USA) supplemented with 2% NaCl to obtain the
working concentration of 106 CFU mL− 1. The tested antibiotics, except
fluorbenzol, have all been approved by the Fisheries Department in
Thailand for use in aquaculture. All antibiotics and polyphenols were
purchased from Sigma-Aldrich Company (St. Louis, MO, USA) and their
stock solutions were prepared with the appropriate solvents and diluents
described in Table 3. Two-fold dilution was then performed to obtain the
highest concentration of 1024 μg mL− 1 and the lowest concentration of
0.125 μg mL− 1. Stock solutions were stored in − 20 ◦ C until being used.

Table 3
List of antibiotics and polyphenols and their suitable diluents used for preparation.
Types Names Solvents Diluents
− 1
Antibiotics AMP Phosphate buffer, pH 8, 0.1 mol L Phosphate buffer, pH 6, 0.1 mol
AMX Phosphate buffer, pH 6, 0.1 mol L− 1 L− 1
ENR ½ volume of water, then 1 mol L− 1 NaOH drop-wise to dissolve Water
OA
FLO 100% methanol
OTC 95% ethanol
TMP/SMX (1:19) - 0.05 mol L− 1 hydrochloric acid, 10% final volume - ½ volume of water, minimal amount of 2.5 mol L− 1

NaOH to dissolve
Polyphenols Pyrogallol (98%) Water
Syringic acid Water
(95%)
Vanillic acid Water
(97%)
Rutin (94%) DMSO 10% DMSO 10%

AMP, Ampicillin; AMX, Amoxicillin; ENR, Enrofloxacin; OA, Oxolinic acid; FLO, Florfenicol; OTC, Oxytetracycline; TMP/SMX, trimethoprim/sulfamethoxazole.

3
T.H. Tinh et al.
Fig. 1. Gel electrophoresis of products of toxR primers (Lane M: DNA marker, Lanes 1–7: representative samples, Lane (− -): Negative-control (DNA free template),
Lane (+): Positive-control (Vibrio parahemolyticus DMST21243).
2.6. Time-kill curve assay
The assay was performed to investigate the bactericidal activity of
the most potential polyphenolic compounds following a previously
described (Verma, 2007). Briefly, two representative isolates, one from
AHPND and one from non-AHPND V. parahaemolyticus that showed no
turbidity at MIC90 of the polyphenol were selected for the current assay.
The bacterial suspensions of those isolates were adjusted as described
above to obtain the final concentrations of 106 CFU mL− 1. The stock
solution of the polyphenols was diluted with appropriate diluents to
obtain 4×, 2×, and 1× of MIC90. Subsequently, equal volumes (5 mL) of
the adjusted polyphenols and tested bacterial suspensions were thor­
oughly mixed in sterile experimental tubes and incubated at 30 ◦ C for
different sampling points (0, 2, 4, 6, 8, 12, 16, and 24 h). The negative
control tubes were prepared by mixing equal volumes of bacterial sus­
pensions and corresponding diluents of the polyphenols. To magnitude,
the effect of polyphenols with a commonly used antibiotic (oxytetra­
cycline), equal amounts of bacterial suspensions of AHPND and non-
AHPND were mixed with Oxytetracycline at MIC90 of 1 μg mL− 1 and
2 μg mL− 1, respectively and served as a positive control.
At each sampling point, 100 μL of the mixture was 10 fold serially
diluted with normal saline. The diluted samples were then streaked on
TSA supplemented with 1% NaCl, and incubated at 30 ◦ C overnight to
calculate the number of viable cells, which were expressed as colony-
forming units (CFUs). The test was performed in duplicate, and means
and standard deviation versus times were plotted in a logarithmic graph.
Bactericidal activity was defined as a ≥ log10 CFU mL− 1 (99.9%)
reduction from the initial bacterial count.
Fig. 2. Gel electrophoresis of products of AP3 primers (Lane M: 100 bp DNA marker, Lanes 1–11: representative isolates of AHPND Vibrio parahaemolyticus, Lanes
12–21: representative isolates of non-AHPND Vibrio parahaemolyticus, Lane (− -): Negative-control (DNA free template), Lane (+): Positive-control (Vibrio para­
hemolyticus DMST21243).
4
Aquaculture 533 (2021) 736070
2.7. The potential influence of polyphenols on bacterial cells
Among the four polyphenols derivatives, only pyrogallol was
selected for the present assay as it showed potent bactericidal activity.
The effect of pyrogallol on the bacterial cell wall of one representative
isolate of AHPND V. parahaemolyticus was investigated by scanning
electron microscope (SEM) following the protocol detailed by Kawai and
Yamagishi (2009). Briefly, 5 mL of AHPND V. parahaemolyticus sus­
pension was mixed with pyrogallol at 4× MIC (512 μg mL− 1) for 6 h, the
duration at which a 3 log10 reduction of viable cells was observed. The
control tube was prepared by mixing equal volumes of bacterial sus­
pension and diluents-free pyrogallol. Following the incubation, the
bacterial pellets were harvested by centrifugation at 13,000 rpm for 20
min and thoroughly washed three times with phosphate-buffered saline
(PBS) to eliminate the residue of pyrogallol. Both treated and control cell
pellets were kept separately in PBS and analyzed using a scanning
electron microscope (JEOL Ltd., Japan).
2.8. Statistical analysis
The killing curve assay was conducted in duplicate. The data are
presented as mean ± standard error of the mean (SEM) and were
analyzed using the computer package STATISTICA 12 for Windows. The
Chi-square was used and the level of significance was p < 0.05.
3. Results and discussion
In the present study, all retrieved isolates belonged to
V. parahaemolyticus based on their morphological and biochemical
T.H. Tinh et al. Aquaculture 533 (2021) 736070

Table 4
Minimum inhibitory concentrations (MIC50 and MIC90; μg mL− 1) of several commercial antibiotics and four polyphenols derivatives against Vibrio parahaemolyticus
groups.
Antimicrobials VP (n = 96) AHPND VP (n = 56) Non-AHPND VP (n = 40)

MIC Range MIC50 MIC90 MIC Range MIC50 MIC90 MIC Range MIC50 MIC90

AMP 128 - >512 >512 >512 128 - >512 >512 >512 >512 >512 >512
AMX 32 - >512 >512 >512 32 - >512 >512 >512 128 - >512 >512 >512
ENR 0.25–1 0.25 0.5 0.25–1 0.25 0.5 0.25–0.5 0.25 0.5
OA 0.25–8 0.5 0.5 0.25–2 0.5 0.5 0.25–8 0.5 1
FLO 1–4 2 4 1–4 2 2 1–4 2 4
OTC 0.25–8 0.5 1 0.25–4 0.5 1 0.25–8 0.5 2
TMP/SMX (1:19) 0.06–2 0.25 0.5 0.06–1 0.25 0.5 0.06–2 0.12 1
Pyrogallol 32–256 64 128 32–128 64 64 32–256 64 128
Rutin >512 >512 >512 >512 >512 >512 >512 >512 >512
Syringic acid >512 >512 >512 >512 >512 >512 >512 >512 >512
Vanillic acid 1024–2048 1024 2048 1024–2048 1024 1024 1024–2048 1024 2048

AMP, Ampicillin; AMX, Amoxicillin; ENR, Enrofloxacin; OA, Oxolinic acid; FLO, Florfenicol; OTC, Oxytetracycline; TMP/SMX, trimethoprim/sulfamethoxazole; VP,
V. parahaemolyticus.

characteristics. The bacteria were Gram-negative, motile, sucrose non-
fermenting, rod-shaped bacilli and exhibited blue-green colonies on
TCBS medium, while showed yellow circular colonies on TSA. Our re­
sults were consistent with those of reported by Bisha et al. (2012), who
observed a typical, circular, opaque, green, or bluish V. parahaemolyticus
colonies on TCBS. The salt tolerance tests showed that all the recovered
strains required sodium ions for growth and grew better on media
supplemented with NaCl up to 8%, in agreement with Beleneva et al.
(2004). Biochemically all isolates were positive to catalase, oxidase,
lysine decarboxylase (LDC), ornithine decarboxylase (ODC), D-glucos­
amine, and citrate utilization tests, while they reacted negatively to VP
and ADH tests. The results were comparable to those obtained by Jones
et al. (2012).
The results of bacteriological examination revealed that the total
prevalence of V. parahaemolyticus among the examined shrimp was (20/
50, 40%), in line with Kongrueng et al. (2014) who demonstrated that
V. parahaemolyticus can be obtained from intestines and hepatopancreas.
Similarly, Pui et al. (2014) found a prevalence of V. parahaemolyticus
infection (41%) in Sarawak Malaysia shrimp farms. From the patho­
physiological point of view, these tissues inclination could be attributed
to some virulence tools encoded by bacteria, which promote their
septicemia. Gomez-Gil et al. (2014) demonstrated that plasmids of
V. parahaemolyticus harbored virulence factors, including type IV pili
proteins and conjugal transfer proteins, which have degenerative effects
on host tissues. Additionally, the production of Photorhabdus-related
insect toxins (Pir) such as PirAvp and PirBvp have been reported in the
cultured medium as well as in the hepatopancreas of infected shrimp
with V. parahaemolyticus AHPND (Lin et al., 2017; Xiao et al., 2017).
Regarding the molecular characterization, all isolates harbored toxR
gene with amplicons size of 368 bp and were tentatively identified as
V. parahaemolyticus (Fig. 1). Besides, the results of molecular differen­
tiation revealed that 56 out of 96 isolates were positive to AP3, toxin-
encoding gene of AHPND V. parahaemolyticus and gave a fragment size
of 336 bp (Fig. 2). The sensitivity of 56 AHPND and 40 non-AHPND
isolates to various commercial antibiotics as well as synthetic herbal-
based polyphenols was investigated using MIC and MBC assays, with a
special reference to MIC50 and MIC90 (Table 4). Further, the percentage
distribution of MIC, MBC against all tested pathogens was collectively
summarized in Table 5, while those against AHPND and non-AHPND
V. parahaemolyticus were briefly shown in Tables 6 and 7, respectively.
Currently, there are no recommended interpretive criteria (resistant,
intermediate, or susceptible breakpoints) of antimicrobial agents for
aquatic pathogens. Besides the MIC breakpoints data for most antibiotics
against V. parahaemolyticus are still unobtainable, therefore MIC and
MBC values for V. parahaemolyticus were calculated based on the
available MICs data of other antimicrobial agents of the same groups (i.e
chloramphenicol, ≤ 8 μg mL− 1; tetracycline, ≤ 4 μg mL− 1; ciprofloxa­
cin, ≤ 1 μg mL− 1) (CLSI, 2006b). The results revealed that all
V. parahaemolyticus isolates were entirely resistant to ampicillin and
amoxicillin at a concentration of >512 μg mL− 1, while they were highly
sensitive to florfenicol and enrofloxacin, where the MIC and MBC values
ranging from 0.25 to 8 μg mL− 1. Specifically, MIC ranges of ampicillin
and amoxicillin against AHPND group were lower than those against the
non-AHPND group. In contrast, the MIC range value of enrofloxacin
against AHPND was higher than that of the non-AHPND group, however,
the MIC90 of this agent showed no difference between AHPND and non-
AHPND groups.
The tested isolates showed different patterns of sensitivity to florfe­
nicol, oxytetracycline, oxolinic acid, and enrofloxacin, where the MIC
and MBC values were between 0.25 and 8 μg mL− 1. Likewise, Han et al.
(2015c) mentioned that Vibrio isolates retrieved from the United States
were only resistant to ampicillin (81%; MIC >16 μg mL− 1) but not to
other antibiotics, including cefotaxime, ceftazidime, chloramphenicol,
ciprofloxacin, gentamicin, imipenem, and tetracycline. Similar findings
have been reported in India, Italy, Malaysia, and Mexico following the
examination of Vibrio antibiotics susceptibility (Ottaviani et al., 2013;
Reyhanath and Kutty, 2014; Sahilah et al., 2014; de Jesus Hernandez-
Diaz et al., 2015). In terms of comparability, oxolinic acid, oxytetracy­
cline, and trimethoprim/sulfamethoxazole (1:19) showed lower MIC
ranges against AHPND than non-AHPND. In contrast to this, florfenicol
antibiotic displayed the same MIC ranges against both AHPND and non-
AHPND. Herein, the susceptibility of all V. parahemolyticus isolates to
florfenicol (≤ 8 μg mL− 1) was highly comparable to another study in
Thailand (Tipmongkolsilp et al., 2006), indicating that the resistance to
amphenicols, including chloramphenicol and florfenicol has not yet
developed and is usually limited to antibiotics used for human treat­
ment, which are prohibited for use in Thai aquaculture.
In this study, there was no record for multi-drug resistance of
V. parahaemolyticus, however, the onset of this phenomenon increased
significantly from 8.6% (2004–2010) to 22.93% (2011–2013; p < 0.05)
in Mexico (de Jesus Hernandez-Diaz et al., 2015). Indeed, multi-drug
resistant strains were encountered more often from water samples

5
 Table 5
Percent distribution of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of several commercial antibiotics and four polyphenols derivatives against Vibrio parahaemolyticus isolates
(n = 96).
T.H. Tinh et al.

Conc. (μg mL− 1) Antibiotics Polyphenols

AMP AMX ENR OA FLO OTC TMP/SMX Pyrogallol Rutin Syringic acid Vanillic acid

MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC

2048 – – – – – – – – – – – – – – – – – – – – 13.5 54.2

1024 – – – – – – – – – – – – – – – – – – – – 86.5 45.8
>512 83.3 85.4 61.5 71.9 – – – – – – – – – – – – 100 100 100 100 – –
512 15.6 13.5 25 21.9 – – – – – – – – – – – – – – – – – –
256 – 1.0 8.3 4.2 – – – – – – – – – – 2.1 12.5 – – – – – –
128 1 – 2.1 1 – – – – – – – – – 14.6 34.4 – – – – – –
64 – – 1 1 – – – – – – – – – 72.9 45.8 – – – – – –
32 – – 2.1 – – – – – – – – – – – 10.4 7.3 – – – – – –
>16 – – – – – – – – – – – – – 8.3 – – – – – – – –
16 – – – – – – – – – – – – – 2.1 – – – – – – – –
8 – – – – – – 2.1 2.1 – 6.3 2.1 4.2 – 7.3 – – – – – – – –
4 – – – – – – 1 1 11.5 24.0 4.2 10.4 – 7.3 – – – – – – – –
2 – – – – – – 1 3.1 51 49.0 4.2 26 1 3.1 – – – – – – – –
1 – – – – 1.0 4.2 1 3.1 37.5 20.8 25 18.8 7.3 17.7 – – – – – – – –
0.5 – – – – 14.6 24 54.2 72.9 – – 40 35.4 16.7 19.8 – – – – – – – –
0.25 – – – – 84.4 71.9 40.6 17.7 – – 24 5.2 27.1 22.9 – – – – – – – –
0.12 – – – – – – – – – – – – 35.4 9.4 – – – – – – – –
0.06 – – – – – – – – – – – – 12.5 2.1 – – – – – – – –

AMP, Ampicillin; AMX, Amoxicillin; ENR, Enrofloxacin; OA, Oxolinic acid; FLO, Florfenicol; OTC, Oxytetracycline; TMP/SMX, trimethoprim/sulfamethoxazole;. -, susceptibility is not determined at these concentrations.

6
Table 6
Percent distribution of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of several commercial antibiotics and four polyphenols derivatives against AHPND Vibrio parahaemolyticus
(n = 56).
Conc. (μg mL− 1) Antibiotics Polyphenols

AMP AMX ENR OA FLO OTC TMP/SMX Pyrogallol Rutin Syringic acid Vanillic acid

MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC

2048 – – – – – – – – – – – – – – – – – – – – 8.93 55.4

1024 – – – – – – – – – – – – – – – – – – – – 91.1 44.6
>512 71.4 75 51.8 67.9 – – – – – – – – – – – – 100 100 100 100 – –
512 26.8 23.2 28.6 23.2 – – – – – – – – – – – – – – – – – –
256 – 1.8 12.5 5.4 – – – – – – – – – – – 5.4 – – – – – –
128 1.8 – 1.8 1.8 – – – – – – – – – – 7.1 42.9 – – – – – –
64 – – 1.8 1.8 – – – – – – – – – – 83.9 44.6 – – – – – –
32 – – 3.6 – – – – – – – – – – 8.9 7.1 – – – – – –
>16 – – – – – – – – – – – – – 1.8 – – – – – – – –
16 – – – – – – – – – – – – – – – – – – – – – –
8 – – – – – – – – 5.4 1.8 – 10.7 – – – – – – – –
4 – – – – – – – – 7.1 14.3 3.6 8.9 – 8.9 – – – – – – – –
2 – – – – – – 1.8 1.8 57.1 55.4 3.6 30.4 – – – – – – – – –
1 – – – – 1.8 5.4 – 1.8 35.7 25 32.1 26.8 1.8 16.1 – – – – – – – –
0.5 – – – – 14.3 23.2 62.5 89.3 – – 42.9 25 12.5 28.6 – – – – – – – –
0.25 – – – – 83.9 71.4 35.7 7.1 – – 17.9 7.1 42.9 25 – – – – – – – –
0.12 – – – – – – – – – – – – 32.1 5.4 – – – – – – – –
0.06 – – – – – – – – – – – – 10.7 3.6 – – – – – – – –

AMP, Ampicillin; AMX, Amoxicillin; ENR, Enrofloxacin; OA, Oxolinic acid; FLO, Florfenicol; OTC, Oxytetracycline; TMP/SMX, trimethoprim/sulfamethoxazole;. -, susceptibility is not determined at these concentrations.
Aquaculture 533 (2021) 736070
T.H. Tinh et al. Aquaculture 533 (2021) 736070

Percent distribution of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of several commercial antibiotics and four polyphenols derivatives against non-AHPND Vibrio para­ than from shrimp in India (Reyhanath and Kutty, 2014). In China, more

AMP, Ampicillin; AMX, Amoxicillin; ENR, Enrofloxacin; OA, Oxolinic acid; FLO, Florfenicol; OTC, Oxytetracycline; TMP/SMX, trimethoprim/sulfamethoxazole;. -, susceptibility is not determined at these concentrations.
MBC
than half of the V. parahaemolyticus isolates (n = 87) showed multi-drug

52.5
47.5
Vanillic acid

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
resistance to at least 3 antibiotics, and mechanisms of which are related
to the presence of resistance genes, and/or mutations in targeted genes

MIC
(Jiang et al., 2014). Plasmid-mediated resistance genes were similar

20
80
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
among bacteria species, proposing the possible transfer of these genes
between the bacterial communities (Aedo et al., 2014). Regarding the
MBC

100
Syringic acid

susceptibility to polyphenols, syringic acid and rutin demonstrated the

–
–

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
lowest effects against V. parahaemolyticus, as all isolates grew and
showed coagulation of substances in the solution even when exposed to
MIC

100

higher concentrations (> 512 μg mL− 1). In contrary, vanillic acid (VA)
–
–

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
showed potent antibacterial activity at MIC and MBC values of
MBC

1024–2048 μg mL− 1.
100
–
–

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
Vanillic acid is a major phenolic acid derivative found in edible
plants and fruits that have shown strong antimicrobial and antioxidant
Rutin

MIC

100

activity and is also used as a flavouring agent and preservative in food

–
–

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
processing (Stanely et al., 2011). Our results are compatible to those
reported by Qian et al. (2019) who stated that VA showed antibacterial
MBC

22.5
22.5
47.5
7.5

activity against Enterobacter cloacae at MIC 600 μg mL− 1. Similar activity

Polyphenols

–
–
–
–

–
–
–
–
–
–
–
–
–
–
Pyrogallol

has been recorded against foodborne pathogens such as Staphylococcus

aureus and Escherichia coli (Mourtzinos et al., 2009). In this study, py­
27.5
57.5
12.5
MIC

2.5
–
–
–
–

–
–
–
–
–
–
–
–
–
–

rogallol showed the strongest bactericidal activity against

V. parahaemolyticus isolates, where the lowest MIC and MBC values were
MBC

17.5

recorded (32–256 μg mL− 1).

2.5

7.5

7.5
20

20
15
5

5
–
–
–
–
–
–
–
–

–
TMP/SMX

Our results are highly comparable to those observed by Cynthia et al.

(2018) who mentioned that pyrogallol had a potential antimicrobial
22.5
MIC

2.5

activity against S. aureus and E. coli at MICs 512 and 256 μg mL− 1,
15

40
15
5
–
–
–
–
–
–
–
–
–
–
–
–

respectively. Similarly, pyrogallol exhibited MIC 2.4–2500 μg mL− 1

against several disease-causing pathogens (Shahzad et al., 2015).
MBC

12.5
7.5

7.5

2.5
20

50

Furthermore, Taguri et al. (2006) reported that pyrogallol-based com­

–
–
–
–
–
–
–
–
–
–

–
–

pounds showed more potent antimicrobial activity against both Gram-

positive and Gram-negative bacteria than other polyphenolic com­
37.5
32.5
OTC

MIC

15
5
5
5
–
–
–
–
–
–
–
–
–
–

–
–

pounds such as catechol and resorcinol. From a comparative viewpoint,

the MIC ranges of rutin, syringic acid, and vanillic acid were the same
MBC

37.5

between AHPND and non-AHPND, while pyrogallol derivatives were

7.5

40
15
–
–
–
–
–
–
–
–
–
–

–
–
–
–

lower against AHPND compared to the non-AHPND group.

The antimicrobial effects of polyphenols against V. parahaemolyticus
17.5
42.5
MIC
FLO

were widely performed and showed promising results (Yano et al., 2006;
40
–
–
–
–
–
–
–
–
–
–
–

–
–
–
–

Carvajal et al., 2012). Most of these studies did not briefly explain the
role of the active ingredients in polyphenols crude extracts. Polyphenol
MBC

32.5
2.5

50

activities are often unpredictable and not specific to species, as previous

5

5
5
–
–
–
–
–
–
–
–
–
–

–
–

publications have shown no correlation between Gram-staining and

bacterial susceptibility to polyphenols (Taguri et al., 2006). In this
42.5
47.5
MIC
OA

2.5

2.5
5
–
–
–
–
–
–
–
–
–
–

–
–

study, we investigated the effects of four phenolic compounds (pyro­

gallol, rutin, syringic and vanillic acid) separately on
MBC

72.5

V. parahaemolyticus, and the only pyrogallol showed a potentially

2.5
25
–
–
–
–
–
–
–
–
–
–
–
–
–

–
–

promising result. Our findings are in line with those reported by Defoirdt
et al. (2013). The bactericidal activity (time-kill curve) of pyrogallol was
ENR

MIC

15
85

investigated against one representative isolate of AHPND and non-

–
–
–
–
–
–
–
–
–
–
–
–
–
–

–
–

AHPND group. It was noted that pyrogallol-treated AHPND presented

similar killing kinetics to the tested antibiotic and also showed a sig­
MBC

77.5

2.5
20

nificant reduction (p < 0.05) in the number of viable cells compared to

–
–

–
–
–
–
–
–
–
–
–
–
–
–
–

the negative control. Specifically, all bacterial cells were killed after 8 h
AMX

MIC

incubation with 2×, and 4× MICs of pyrogallol, while required a pro­

2.5
2.5
75
20
–
–

–
–
–
–
–
–
–
–
–
–
–
–

tracted time up to 12 h after exposure to 1× MIC of pyrogallol (Fig. 3A).

A similar trend of bacterial cells reduction was observed in non-AHPND
MBC

100

isolate following incubation with the same MICs of pyrogallol (Fig. 3B).
–
–

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
Antibiotics

Pyrogallol is the major active ingredients present in many plant species

with significant antimicrobial and anti-inflammatory activities (Gopi
AMP

MIC

100

et al., 2015; Khatua et al., 2015). The compound is readily soluble in

–
–

–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
haemolyticus (n = 40).

water, and it can pass through rapid oxidation in the presence of oxygen,
Conc. (μg mL− 1)

which subsequently produces peroxides and hydroperoxides of a strong

killing capacity (Marklund and Marklund, 1974).
In this study, the possible effect of pyrogallol on V. parahaemolyticus
Table 7

>512

cell wall was performed using scanning electron microscopy. The results
2048
1024

0.25
0.12
0.06
>16
512
256
128

0.5
64
32

16

revealed that untreated bacterial cells remained intact and showed tiny
8
4
2
1

7
T.H. Tinh et al.
Fig. 3. Time-kill curve of pyrogallol. A) against AHPND Vibrio parahaemolyticus; B) against non-AHPND V. parahaemolyticus.
coccoid cells aggregation (Fig. 4 A, B) as a sequential result of budding,
in agreement with Coutard et al. (2007). In contrast, a microscopic
image of the pyrogallol-treated cells showed the disruption of most
bacterial cells with an indistinguishable cell wall structure (Fig. 4 C, D).
Only a few cells remained intact after 6 h incubation with pyrogallol
(512 μg mL− 1), while long exposure (8 h) resulted in 100% of bacterial
cell death. The bactericidal effect of pyrogallol was mainly attributed to
peroxide production resulting from the autoxidation of the compound
(Defoirdt et al., 2013).
In conclusion, all recovered isolates showed substantial resistance to
ampicillin and amoxicillin, making them unsuitable for routine control
of disease outbreaks. Enrofloxacin, oxolinic acid, oxytetracycline, flor­
fenicol, and trimethoprim/sulfamethoxazole (1:19) showed high effi­
cacy against V. parahaemolyticus, all of which are effective in treating
this bacterial pathogen in shrimp culture. Among the polyphenols, py­
rogallol is the most potent ingredient that has caused cell disruption and
complete bacterial cell death at a concentration of 512 μg mL− 1. The
present study offers pyrogallol as a potential synthetic herbal-based
antimicrobial agent for the adoption of inventory management practices
and control of V. parahemolyticus in shrimp producing sectors. However,
a brief in vivo study is ultimately required to verify its potential anti­
microbial activity for widespread adoption in aquaculture fields.
8
Aquaculture 533 (2021) 736070
Author contribution
C.R., designed the study and drafted the manuscript. T.H.T., S.E., and
M.M., carried out the experiments; T.H.T., S.E., and M.M., performed the
data analysis, data accuracy, validation (Contributed equally). T.H.T., S.
E., M.M., and P.C.D.G., did the investigation, and the statistical analysis;
C.R., T.H.T., S.E., and M.M., Writing, Review & Editing. All authors have
read and agreed to the published version of the manuscript.
Data availability
The authors declare that they do not have any shared data available.
Short head
Polyphenols as a potential alternative antibacterial agent against
AHPND.
Declaration of Competing Interest
The authors declare that there are no conflicts of interest.
T.H. Tinh et al.
500 nm
500 nm
Fig. 4. Scanning electron microscope (SEM) observation of Vibrio parahaemolyticus. A) x10,000 and B) x30,000, control showing intact bacterial cells and aggre­
gations of tiny coccoid cells; C) and D) x10,000, treated cells with pyrogallol at 512 μg mL− 1 for 6 h showing disruption of the majority of bacterial cells with an
indistinguishable cell wall structure (yellow arrows). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of
this article.)
Acknowledgements
This research work was supported by The 90th Anniversary of
Chulalongkorn University Scholarship granted by Chulalongkorn Uni­
versity and the Second Century Fund (C2F, Batch 3/2019), Chula­
longkorn University, Bangkok, Thailand. We would like to thank staffs of
Department of Veterinary Microbiology, Faculty of Veterinary Science,
Chulalongkorn University, Thailand, and Departments of Microbiology,
Faculty of Science, Prince of Songkla University, Songkhla, Thailand for
their technical supports and equipment providing. We would like to
keep our love and good memory with Professor Dr. Varaporn Vuddhakul
who passed away.
References
Aedo, S., Ivanova, L., Tomova, A., Cabello, F.C., 2014. Plasmid-related quinolone
resistance determinants in epidemic Vibrio parahaemolyticus, uropathogenic
Escherichia coli, and marine bacteria from an aquaculture area in Chile. Microb. Ecol.
68, 324–328.
Alsina, M., Blanch, A.R., 1994. A set of keys for biochemical identification of
environmental Vibrio species. J. Appl. Bacteriol. 76, 79–85.
Anderson, J.L., Valderrama, D., Jory, D.E., 2019. GOAL 2019: Global shrimp production
review. Glob. Aquac. Advocate.
Baba, E., Acar, Ü., Öntaş, C., Kesbiç, O.S., Yılmaz, S., 2016. Evaluation of Citrus Limon
peels essential oil on growth performance, immune response of Mozambique tilapia
Oreochromis mossambicus challenged with Edwardsiella tarda. Aquaculture. 465,
13–18.
9
Aquaculture 533 (2021) 736070
100 nm
500 nm
Baruah, K., Phong, H.P.P.D., Norouzitallab, P., Defoirdt, T., Bossier, P., 2015. The
gnotobiotic brine shrimp (Artemia franciscana) model system reveals that the
phenolic compound pyrogallol protects against infection through its prooxidant
activity. Free Radic. Biol. Med. 89, 593–601.
Beleneva, I., Maslennikova, E., Magarlamov, T.Y., 2004. Physiological and biochemical
characteristics of the halophilic bacteria Vibrio parahaemolyticus and V. alginolyticus
isolated from marine invertebrates of Peter the Great Bay, sea of Japan. Russ. J. Mar.
Biol. 30, 96–100.
Bisha, B., Simonson, J., Janes, M., Bauman, K., Goodridge, L.D., 2012. A review of the
current status of cultural and rapid detection of Vibrio parahaemolyticus. Int. J. Food
Sci. Technol. 47, 885–899.
Bondad-Reantaso, M.G., Subasinghe, R.P., Josupeit, H., Cai, J., Zhou, X., 2012. The role
of crustacean fisheries and aquaculture in global food security: past, present and
future. J. Invertebr. Pathol. 110, 158–165.
Bravo, L., 1998. Polyphenols: chemistry, dietary sources, metabolism, and nutritional
significance. Nutr. Rev. 56 (11), 317–333.
Carvajal, A.E.S.S., Koehnlein, E.A., Soares, A.A., Eler, G.J., Nakashima, A.T.A.,
Bracht, A., Peralta, R.M., 2012. Bioactives of fruiting bodies and submerged culture
mycelia of Agaricus brasiliensis (A. blazei) and their antioxidant properties. LWT Food
Sci. Technol. 46, 493–499.
Citarasu, T., 2010. Herbal biomedicines: a new opportunity for aquaculture industry.
Aquac. Int. 18 (3), 403–414.
CLSI, C.A.L.S.I, 2006a. Methods for antimicrobial dilution and disk susceptibility testing
of infrequently isolated or fastidious bacteria. In: Approved standard (M45-A).
Clinical and Laboratory Standards Institute, Wayne, PA.
CLSI, C.A.L.S.I, 2006b. Methods for broth dilution susceptibility testing of bacteria
isolated from auatic animals. In: Approved guidline (M49-A). Clinical and
Laboratory Standards Institute, Wayne, PA.
Coutard, F., Crassous, P., Droguet, M., Gobin, E., Colwell, R.R., Pommepuy, M., Hervio-
Heath, D., 2007. Recovery in culture of viable but nonculturable Vibrio
parahaemolyticus: regrowth or resuscitation? ISME J. 1, 111–120.
Croci, L., Suffredini, E., Cozzi, L., Toti, L., Ottaviani, D., Pruzzo, C., Serratore, P.,
Fischetti, R., Goffredo, E., Loffredo, G., 2007. Comparison of different biochemical
T.H. Tinh et al.
and molecular methods for the identification of Vibrio parahaemolyticus. J. Appl.
Microbiol. 102, 229–237.
Cynthia, I.F., Hery, S., Akhmad, D., 2018. Antibacterial and antioxidant activities of
pyrogallol and synthetic pyrogallol dimer. Res. J. Chem. Environ. 22 (Special Issue
II).
Da Costa, P.M., Loureiro, L., Matos, A.J., 2013. Transfer of multidrug-resistant bacteria
between intermingled ecological niches: the interface between humans, animals and
the environment. Int. J. Environ. Res. Public Health 10, 278–294.
Daniels, N.A., Ray, B., Easton, A., et al., 2000. Emergence of a new Vibrio
parahaemolyticus serotype in raw oysters: a prevention quandary. J. Am. Med. Assoc.
284, 1541–1545.
de Jesus Hernandez-Diaz, L., Leon-Sicairos, N., Velazquez-Roman, J., Flores-
Villasenor, H., Guadron-Llanos, A.M., Martinez-Garcia, J.J., Vidal, J.E., Canizalez-
Roman, A., 2015. A pandemic Vibrio parahaemolyticus O3:K6 clone causing most
associated diarrhea cases in the Pacific northwest coast of Mexico. Front. Microbiol.
6, 221.
De Schryver, P., Defoirdt, T., Sorgeloos, P., 2014. Early mortality syndrome outbreaks: a
microbial management issue in shrimp farming? PLoS Pathog. 10, e1003919.
Defoirdt, T., Pande, G.S., Baruah, K., Bossier, P., 2013. The apparent quorum-sensing
inhibitory activity of pyrogallol is a side effect of peroxide production. Antimicrob.
Agents Chemother. 57, 2870–2873.
Di Cesare, A., Luna, G.M., Vignaroli, C., Pasquaroli, S., Tota, S., Paroncini, P.,
Biavasco, F., 2013. Aquaculture can promote the presence and spread of antibiotic-
resistant enterococci in earine sediments. PLoS One 8, e62838.
Dong, J., Zhang, L., Xu, N., Zhou, S., Song, Y., Yang, Q., Liu, Y., Yang, Y., Ai, X., 2020.
Rutin reduces the pathogenicity of Streptococcus agalactiae to tilapia by inhibiting the
activity of sortase A. Aquaculture. 530, 735743.
Elayaraja, S., Liu, G., Zagorsek, K., Mabrok, M., Ji, M., Ye, Z., Zhu, S., Rodkhum, C.,
2020. TEMPO-oxidized biodegradable bacterial cellulose (BBC) membrane coated
with biologically-synthesized silver nanoparticles (AgNPs) as a potential
antimicrobial agent in aquaculture (In vitro). Aquaculture. 530, 735746.
FAO, I., UNICEF, W, 2017. The State of Food Security and Nutrition in the World. Food
and Agriculture Organization of the United Nations, Rome, Italy.
Flegel, T.W., 2012. Historic emergence, impact and current status of shrimp pathogens in
Asia. J. Invertebr. Pathol. 110, 166–173.
Ghenem, L., Elhadi, N., Alzahrani, F., Nishibuchi, M., 2017. Vibrio parahaemolyticus: a
review on distribution, pathogenesis, virulence determinants and epidemiology.
Saudi J. Med. Med. Sci. 5, 93.
Gomez-Gil, B., Soto-Rodríguez, S., Lozano, R., Betancourt-Lozano, M., 2014. Draft
genome sequence of Vibrio parahaemolyticus strain M0605, which causes severe
mortalities of shrimps in Mexico. Genome Announc. 2 e00055-00014.
Gopi, K., Renu, K., Sannanaik Vishwanath, B., Jayaraman, G., 2015. Protective effect of
Euphorbia hirta and its components against snake venom induced lethality.
J. Ethnopharmacol. 165, 180–190.
Halwart, M., 2020. Fish Farming High on the Global Food System Agenda in 2020. FAO
Aquaculture Newsletter, II-III.
Han, J.E., Tang, K.F., Tran, L.H., Lightner, D.V., 2015a. Photorhabdus insect-related (Pir)
toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of
acute hepatopancreatic necrosis disease (AHPND) of shrimp. Dis. Aquat. Org. 113
(1), 33–40.
Han, J.E., Tang, K.F., Pantoja, C.R., White, B.L., Lightner, D.V., 2015b. qPCR assay for
detecting and quantifying a virulence plasmid in acute hepatopancreatic necrosis
disease (AHPND) due to pathogenic Vibrio parahaemolyticus. Aquaculture 442,
12–15.
Han, J.E., Mohney, L.L., Tang, K.F., Pantoja, C.R., Lightner, D.V., 2015c. Plasmid
mediated tetracycline resistance of Vibrio parahaemolyticus associated with acute
hepatopancreatic necrosis disease (AHPND) in shrimps. Aquacu. Rep. 2, 17–21.
Jiang, Y., Yao, L., Li, F., Tan, Z., Zhai, Y., Wang, L., 2014. Characterization of
antimicrobial resistance of Vibrio parahaemolyticus from cultured sea cucumbers
(Apostichopus japonicas). Lett. Appl. Microbiol. 59 (2), 147–154.
Jones, J.L., Lüdeke, C.H., Bowers, J.C., Garrett, N., Fischer, M., Parsons, M.B., Bopp, C.A.,
DePaola, A., 2012. Biochemical, serological, and virulence characterization of
clinical and oyster Vibrio parahaemolyticus isolates. J. Clin. Microbiol. 50,
2343–2352.
Kawai, M., Yamagishi, J., 2009. Mechanisms of action of acriflavine: electron
microscopic study of cell wall changes induced in Staphylococcus aureus by
acriflavine. Microbiol. Immunol. 53, 481–486.
Khatua, S., Dutta, A.K., Acharya, K., 2015. Prospecting Russula senecis: a delicacy among
the tribes of West Bengal. PeerJ. 3, e810.
Kim, Y.B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., Nishibuchi, M., 1999.
Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted
to the toxR gene. J. Clin. Microbiol. 37, 1173–1177.
Kongchum, P., Chimtong, S., Chareansak, N., Subprasert, P., 2016. Effect of green tea
extract on Vibrio parahaemolyticus inhibition in pacific white shrimp (Litopenaeus
vannamei) postlarvae. Agricu. Agricu. Sci. Procedia. 11, 117–124.
Kongrueng, J., Yingkajorn, M., Bunpa, S., Sermwittayawong, N., Singkhamanan, K.,
Vuddhakul, V., 2014. Characterization of Vibrio parahaemolyticus causing acute
hepatopancreatic necrosis disease in southern Thailand. J. Fish Dis. 38, 957–966.
Lima, V.N., Oliveira-Tintino, C.D., Santos, E.S., Morais, L.P., Tintino, S.R., Freitas, T.S.,
Geraldo, Y.S., Pereira, R.L., Cruz, R.P., Menezes, I.R., Coutinho, H.D., 2016.
Antimicrobial and enhancement of the antibiotic activity by phenolic compounds:
Gallic acid, caffeic acid and pyrogallol. Microb. Pathog. 99, 56–61.
Lin, S.-J., Hsu, K.-C., Wang, H.-C., 2017. Structural insights into the cytotoxic mechanism
of Vibrio parahaemolyticus PirAvp and PirBvp toxins. Marine Drugs. 15, 373.
10
Aquaculture 533 (2021) 736070
Liu, H., Zhang, W., Wu, Y., Sun, L., Wang, Y., Liu, Y., Zhang, X., Hong, P., Ji, H., 2017.
Synergistic antimicrobial effect and mechanism of lipopeptides and tea polyphenols
against Vibrio parahaemolyticus. Food Sci. 38, 14–19.
Mabrok, M.A.E., Wahdan, A., 2018. The immune modulatory effect of oregano (Origanum
vulgare L.) essential oil on Tilapia zillii following intraperitoneal infection with Vibrio
anguillarum. Aquac. Int. 26, 1147–1160.
Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the
autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J.
Biochem. 47, 469–474.
Mourtzinos, I., Konteles, S., Kalogeropoulos, N., Karathanos, V.T., 2009. Thermal
oxidation of vanillin affects its antioxidant and antimicrobial properties. Food Chem.
114 (3), 791–797.
Nakamura, K., Ishiyama, K., Sheng, H., Ikai, H., Kanno, T., Niwano, Y., 2015. Bactericidal
activity and mechanism of photoirradiated polyphenols against gram-positive and-
negative bacteria. J. Agric. Food Chem. 63, 7707–7713.
Nunan, L., Lightner, D., Pantoja, C., Gomez-Jimenez, S., 2014. Detection of acute
hepatopancreatic necrosis disease (AHPND) in Mexico. Dis. Aquat. Org. 111, 81–86.
Okocha, R.C., Olatoye, I.O., Adedeji, O.B., 2018. Food safety impacts of antimicrobial use
and their residues in aquaculture. Public Health Rev. 39, 1–22.
Okoh, A.I., Sibanda, T., Nongogo, V., Adefisoye, M., Olayemi, O.O., Nontongana, N.,
2015. Prevalence and characterisation of non-cholerae Vibrio spp. in final effluents of
wastewater treatment facilities in two districts of the eastern Cape Province of South
Africa: implications for public health. Environ. Sci. Pollut. Res. Int. 22, 2008–2017.
Ottaviani, D., Leoni, F., Talevi, G., Masini, L., Santarelli, S., Rocchegiani, E., Susini, F.,
Montagna, C., Monno, R., D’Annibale, L., Manso, E., Oliva, M., Pazzani, C., 2013.
Extensive investigation of antimicrobial resistance in Vibrio parahaemolyticus from
shellfish and clinical sources, Italy. Int. J. Antimicrob. Agents 42, 191–193.
Peña-Navarro, N., Castro-Vásquez, R., Vargas-Leitón, B., Dolz, G., 2020. Molecular
detection of acute hepatopancreatic necrosis disease (AHPND) in Penaeus vannamei
shrimps in Costa Rica. Aquaculture. 735190.
Pu, H., Li, X., Du, Q., Cui, H., Xu, Y., 2017. Research progress in the application of
chinese herbal medicines in aquaculture: a review. Engineering. 3 (5), 731–737.
Pui, C.F., Bilung, L.M., Zin, N.B.M., Abidin, N.N.B.Z., Micky, V., Kasing, A., 2014. Risk of
acquiring Vibrio parahaemolyticus in water and shrimp from an aquaculture farm.
Kuroshio Sci. 8-1, 59–62.
Qian, W., Fu, Y., Liu, M., Wang, T., Zhang, J., Yang, M., Sun, Z., Li, X., Li, Y., 2019. In
vitro antibacterial activity and mechanism of vanillic acid against carbapenem-
resistant Enterobacter cloacae. Antibiotics 8 (4), 220.
Reyhanath, P.V., Kutty, R., 2014. Incidence of multidrug resistant Vibrio parahaemolyticus
isolated from Ponnani, South India. Iranian J. Microbiol. 6, 60–67.
Sahilah, A.M., Laila, R.A., Sallehuddin, H.M., Osman, H., Aminah, A., Ahmad
Azuhairi, A., 2014. Antibiotic resistance and molecular typing among cockle
(Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction
(PCR)-based analysis. World J. Microbiol. Biotechnol. 30, 649–659.
Sampantamit, T., Ho, L., Van Echelpoel, W., Lachat, C., Goethals, P., 2020. Links and
trade-offs between fisheries and environmental protection in relation to the
sustainable development goals in Thailand. Water. 12, 399.
Sattanathan, G., Palanisamy, T., Padmapriya, S., Arumugam, V.A., Park, S., Kim, I.H.,
Balasubramanian, B., 2020. Influences of dietary inclusion of algae Chaetomorpha
aerea enhanced growth performance, immunity, haematological response and
disease resistance of Labeo rohita challenged with Aeromonas hydrophila. Aquacu.
Rep. 17, 100353.
Shahzad, M., Millhouse, E., Culshaw, S., Edwards, C.A., Ramage, G., Combet, E., 2015.
Selected dietary (poly) phenols inhibit periodontal pathogen growth and biofilm
formation. Food Funct. 6 (3), 719–729.
Shinn, A., Pratoomyot, J., Griffiths, D., Trong, T., Vu, N., Jiravanichpaisal, P., Briggs, M.,
2018. Asian shrimp production and the economic costs of disease. Asian Fish. Sci. 31,
29–58.
Sirikharin, R., Taengchaiyaphum, S., Sritunyalucksana, K., Thitamadee, S., Flegel, T.W.,
Mavichak, R., Proespraiwong, P., 2014. A new and improved PCR method for
detection of AHPND bacteria. In: Network of Aquaculture Centres in Asia-Pacific
(NACA), 7(9).
Sivaramasamy, E., Zhiwei, W., Li, F., Xiang, J., 2016. Enhancement of vibriosis resistance
in Litopenaeus vannamei by supplementation of biomastered silver nanoparticles by
Bacillus subtilis. J. Nanomed. Nanotechnol. 7 (352), 2.
Stanely, P., Rajakumar, S., Dhanasekar, K., 2011. Protective effects of vanillic acid on
electrocardiogram, lipid peroxidation, antioxidants, proinflammatory markers and
histopathology in isoproterenol induced cardiotoxic rats. Eur. J. Pharmacol. 668,
233–240.
Taguri, T., Tanaka, T., Kouno, I., 2004. Antimicrobial activity of 10 different plant
polyphenols against bacteria causing food-borne disease. Biol. Pharm. Bull. 27,
1965–1969.
Taguri, T., Tanaka, T., Kouno, I., 2006. Antibacterial spectrum of plant polyphenols and
extracts depending upon hydroxyphenyl structure. Biol. Pharm. Bull. 29,
2226–2235.
Talpur, A.D., 2014. Mentha piperita (peppermint) as feed additive enhanced growth
performance, survival, immune response and disease resistance of Asian seabass,
Lates calcarifer (Bloch) against Vibrio harveyi infection. Aquaculture. 420, 71–78.
Thongjun, J., Mittraparp-arthorn, P., Yingkajorn, M., Kongreung, J., Nishibuchi, M.,
Vuddhakul, V., 2013. The trend of Vibrio parahaemolyticus infections in southern
Thailand from 2006 to 2010. Tropical Med. Health. 41, 151–156.
Tipmongkolsilp, N., Limpanon, Y., Patamalai, B., Lusanandana, P., Wongtavatchai, J.,
2006. Oral medication with florfenicol for black tiger shrimps Penaeus monodon. Thai
J. Vet. Med. 36 (2), 39–47.
Tran, L., Nunan, L., Redman, R.M., Mohney, L.L., Pantoja, C.R., Fitzsimmons, K.,
Lightner, D.V., 2013. Determination of the infectious nature of the agent of acute
T.H. Tinh et al.
hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis. Aquat. Org. 105
(1), 45–55.
Van Hai, N., 2015. The use of medicinal plants as immunostimulants in aquaculture: a
review. Aquaculture. 446, 88–96.
Verma, P., 2007. Methods for Determining Bactericidal Activity and Antimicrobial
Interactions: Synergy Testing, Time-Kill Curves, and Population Analysis. CRC Press,
New York, NY, USA, pp. 275–290.
Wahdan, A., Fadel, A., Mabrok, M., 2020. New insights into the effect of origanum
extracts on the gene expression profiles of multidrug-resistant isolates of
Pseudomonas aeruginosa retrieved from Oreochromis niloticus. Turk. J. Fish. Aquat.
Sci. 20, 507–519.
Watts, J.E., Schreier, H.J., Lanska, L., Hale, M.S., 2017. The rising tide of antimicrobial
resistance in aquaculture: sources, sinks and solutions. Marine Drugs. 15, 158.
11
Aquaculture 533 (2021) 736070
Wickramasingha, W., Wijendra, W., Karunaratne, D., Liyanapathirana, V., Ekanayake, E.,
Jayasinghe, S., Karunaratne, V., 2018. Antibacterial, antifungal, antioxidant, brine
shrimp lethality and polyphenolic content of Holarrhena mitis (Vahl) R. Br. ex Roem.
and Schult. Ceylon J. Sci. 47, 269–274.
Xiao, J., Liu, L., Ke, Y., Li, X., Liu, Y., Pan, Y., Yan, S., Wang, Y., 2017. Shrimp AHPND-
causing plasmids encoding the PirAB toxins as mediated by pirAB-Tn903 are
prevalent in various Vibrio species. Sci. Rep. 7, 42177.
Yang, Y.T., Chen, I.T., Lee, C.T., Chen, C.Y., Lin, S.S., Hor, L.I., Tseng, T.C., Huang, Y.T.,
Sritunyalucksana, K., Thitamadee, S., Wang, H.C., 2014. Draft genome sequences of
four strains of Vibrio parahaemolyticus, three of which cause early mortality
syndrome/acute hepatopancreatic necrosis disease in shrimp in China and Thailand.
Genome Announcements 2 (5).
Yano, Y., Satomi, M., Oikawa, H., 2006. Antimicrobial effect of spices and herbs on Vibrio
parahaemolyticus. Int. J. Food Microbiol. 111, 6–11.