MEC954.
fm Page 1171 Thursday, July 6, 2000 7:03 PM
Molecular Ecology (2000) 9, 1171–1193
PRIMER NOTES
Blackwell Science, Ltd
Identification of microsatellite loci in
Graphicraft Limited, Hong Kong
1173
1171
olive (Olea europaea) and their
characterization in Italian and Iberian
olive trees
K . M . S E F C ,*‡ M . S . L O P E S ,* D . M E N D O N Ç A ,*
M . R O D R I G U E S D O S S A N T O S ,*
M. LAIMER DA CÂMARA MACHADO†
and A . D A C Â M A R A M A C H A D O *
*Universidade dos Açores, Departamento de Ciências Agrárias, Terra Chã,
9700 Angra do Heroismo, Açores, Portugal, †Institut für Angewandte
Mikrobiologie, Universität für Bodenkultur Wien, Nussdorfer Lände 11,
1190 Vienna, Austria
Keywords: Olea europaea, olive, microsatellite
Received 17 November 1999; revision received 31 January 2000;
accepted 5 February 2000
Correspondence: Artur da Câmara Machado. Fax: + 351 295332605;
E-mail: amachado@angra.uac.pt
‡Present address: Zentrum für Angewandte Genetik, Universität für
Bodenkultur Wien, Muthgasse 18, 1190 Vienna, Austria.
Olive (Olea europaea L. ssp. europaea) is one of the most
ancient cultivated fruit trees and an important oil-producing
crop in the Mediterranean basin. Feral olives and wild oleaster
forms add to the intraspecific variability of O. europaea and
the number of species within the genus Olea is high and con-
troversial. Genetic studies have already been used to address
and clarify Olea systematics (Angiolillo et al. 1999). The identifi-
cation of olive cultivars is a further application of genetic
markers in this crop (Fabbri et al. 1995). In this paper, we report
the development of microsatellite primers from O. europaea and
their polymorphism in olive trees from Italy and the Iberian
Peninsula.
For the construction of the genomic library, young leaves
and flower buds were harvested from an olive tree in Porto
Martins, Terceira, Açores. The DNA extraction protocol
described by Fabbri et al. (1995) was modified as follows: 5 g
plant material were ground in liquid nitrogen and incubated
in 20 mL CTAB buffer (100 mm Tris-HCl pH 8.0, 1.4 m NaCl,
20 mm EDTA, 2% CTAB, 1% PVP, 0.2% β-mercaptoethanol)
for one hour at 65 °C. After centrifugation, the supernatant
was extracted twice with chloroform–isoamyl alcohol (24 : 1),
and DNA was precipitated from the recovered aqueous
phase with 0.6 vol. isopropanol. The pellet was resuspended
in 4 mL H2O and proteins were precipitated with 0.5 vol.
7.5 m ammonium acetate. After ethanol precipitation of the
DNA, resuspension of the pellet in 4 mL H2O, RNase digest
and second protein precipitation, the supernatant was
extracted with phenol– chloroform–isoamyl alcohol (25 : 24 : 1).
DNA was precipitated from the aqueous phase with ethanol,
washed and resuspended in 1 mL H2O.
A size-selected genomic library of O. europaea was screened
© 2000 Blackwell Science Ltd
for (GA)n and (CA)n sequences as described previously
(Sefc et al. 1999). After two rounds of screening, plasmids
were isolated from positive Escherichia coli clones (Flexi-
Prep Kit, Amersham Pharmacia Biotech) and inserts
were sequenced using the dRhodamine Terminater Cycle
Sequencing Kit (PE Applied Biosystems) and an automated
sequencer (ABI Prism 310 Genetic Analyser, PE Applied
Biosystems).
For polymerase chain reaction (PCR), DNA was extracted
from leaves as described in Fabbri et al. (1995). PCR reactions
were carried out in a vol. of 20 µL, containing 50 ng DNA,
50 mm KCl, 10 mm Tris-HCl pH 9.0, 0.1% Triton X 100, 1.5 mm
MgCl2, 100 µm of each dNTP, 1 µm of each primer and 0.5 U
Taq DNA polymerase (Promega, Mannheim). The following
temperature regime was applied: 5 min denaturation at 95 °C,
35 cycles of 20 s denaturation at 95 °C, 30 s at the appropri-
ate annealing temperature (Table 1), 30 s elongation at 72 °C.
Electrophoresis was carried out using an automated
sequencer (ABI Prism 310 Genetic Analyser, PE Applied
Biosystems) and fragment lengths were determined with
the help of internal size standards (Genescan 350 TAMRA
Size Standard, PE Applied Biosystems).
Simultaneous screening with (GA)n and (CA)n probes
revealed 20 (GA) n, 4 (CA) n and 5 (CA) n-(GA) n com-
pound repeats. Primers could be designed for 28 loci, and
specific amplification was achieved at 15 microsatellite loci
(Table 1).
At locus ssrOeUA-DCA11, the size of the cloned allele was
179 bp, while amplification from the individual used for
library construction yielded a 125-bp band. Sequencing of
the 125 bp fragment revealed a microsatellite locus with
flanking sequences identical to those of the originally cloned
allele and a (GA)7 microsatellite. A 139-bp fragment ampli-
fied from another tree again showed the identical flanking
sequences and a (GA)12(GGGA)1 microsatellite. The repeat
motif in the originally cloned fragment is (GA) 26(GGGA)4.
However, two individuals showed alleles in the expected
size range of 177 and 179 bp. Possibly, the primers designed
for the cloned allele preferentially amplify a duplicated locus
with lower repeat numbers whenever this locus is present.
These amplification results were reproducible at various
annealing temperatures.
At locus ssrOeUA-DCA17, the amplified fragments
ranged from 101 bp to 183 bp, with 109 bp and 111 bp being
the most frequent fragment sizes. A comparison of the sequences
of the 111 bp and 183 bp fragments showed identical flanking
sequences, whereas the repeat sequence of the short allele dis-
played a deletion, which reduced the (GT)9(AT)7AGATA(GA)38
motif of the cloned 183 bp allele to (GT)7(GA)13 in the 111 bp
allele.
The markers were characterized in olive trees from the
Iberian Peninsula (n = 38) and from Italy (n = 9; Table 2). All
loci were polymorphic with 4 –15 alleles per locus.
MEC954.fm Page 1172 Thursday, July 6, 2000 7:03 PM

1172 P R I M E R N O T E S

Table 1 Olea europaea (GA)n and (CA)n microsatellite motifs, primer sequences (fluorescent labels indicated as FAM, TET or HEX), sizes
of cloned alleles and annealing temperatures (Ta)

Locus Repeat motif Primer sequence (5′–3′) Size of cloned allele (Size range) in bp Ta

(GA)n repeats
ssrOeUA-DCA1 (GA)22 FAM-cctctgaaaatctacactcacatcc 230 50 °C
AJ279853 atgaacagaaagaagtgaacaatgc (204–230)
ssrOeUA-DCA3 (GA)19 FAM-cccaagcggaggtgtatattgttac 250 50 °C
AJ279854 tgcttttgtcgtgtttgagatgttg (228–250)
ssrOeUA-DCA4 (GA)16 TET-cttaactttgtgcttctccatatcc 136 55 °C
AJ279855 agtgacaaaagcaaaagactaaagc (128–186)
ssrOeUA-DCA5 (GA)15 TET-aacaaatcccatacgaactgcc 211 50 °C
AJ279856 cgtgttgctgtgaagaaaatcg (195–211)
ssrOeUA-DCA7 (AG)19 TET-ggacataaaacatagagtgctgggg 147 60 °C
AJ279857 agggtagtccaactgctaatagacg (127–169)
ssrOeUA-DCA8 (GA)18 FAM-acaattcaacctcacccccataccc 135 55 °C
AJ279858 tcacgtcaactgtgccactgaactg (123–139)
ssrOeUA-DCA9 (GA)23 TET-aatcaaagtcttccttctcatttcg 191 55 °C
AJ279859 gatccttccaaaagtataacctctc (161–205)
ssrOeUA-DCA10 (TA)14(GA)17 HEX-cgtgaccacctaaatccgcccc 158 55 °C
AJ279860 ctgtccagagctaaaggtttcg (138–218)
ssrOeUA-DCA11 (GA)26(GGGA)4 HEX-gatcaaactactgcacgagagag 179 50 °C
AJ279861 ttgtctcagtgaacccttaaacc (125–161)
(CA)n repeats
ssrOeUA-DCA13 (CA)15 HEX-gatcagattaatgaagatttggg 136 55 °C
AJ279862 aactgaacctgtgtatcttgcatcc (116–153)
ssrOeUA-DCA14 (CA)18A6(TAA)7 TET-aattttttaatgcactataatttac 187 50 °C
AJ279863 ttgaggtctctatatctcccagggg (170–187)
ssrOeUA-DCA15 (CA)3G(AC)14 TET-gatcttgtctgtatatccacac 266 50 °C
AJ279864 tataccttttccatcttgacgc (242–266)
(GA)n and (CA)n
compound repeats
ssrOeUA-DCA16 (GT)13(GA)29 FAM-ttaggtgggattctgtagatggttg 178 50 °C
AJ279865 ttttaggtgagttcatagaattagc (120–178)
ssrOeUA-DCA17 (GT)9(AT)7AGATA(GA)38 FAM-gatcaaattctaccaaaaatata 183 50 °C
AJ279866 taatttttggcacgtagtattgg (101–183)
ssrOeUA-DCA18 (CA)4CT(CA)3(GA)19 TET-aagaaagaaaaaggcagaattaagc 178 50 °C
AJ279867 gttttcgtctctctacataagtgac (168–184)

Table 2 Characterization of the new

Locus No. alleles HE/HO markers in Italian and Iberian olive
trees. Number of alleles, gene diversity
It. Ib. T. Italian Iberian Total (HE, Nei 1978) and observed heter-
ozygosity (HO) are shown for Italian (It.)
ssrOeUA-DCA1 1 4 4 0/0 0.15/0.895 0.545/0.723 and Iberian (Ib.) olive trees separately
ssrOeUA-DCA3 6 8 9 0.758/1.000 0.795/0.974 0.815/0.979 and for the total sample (T.)
ssrOeUA-DCA4 5 9 11 0.804/0.778 0.623/0.395 0.691/0.468
ssrOeUA-DCA5 4 5 6 0.634/0.889 0.264/0.289 0.357/0.404
ssrOeUA-DCA7 6 7 9 0.771/0.778 0.556/0.237 0.656/0.340
ssrOeUA-DCA8 5 7 7 0.791/1.000 0.696/0.868 0.717/0.893
ssrOeUA-DCA9 6 9 11 0.863/0.889 0.826/0.974 0.838/0.957
ssrOeUA-DCA10 6 7 10 0.797/0.667 0.672/0.189 0.714/0.283
ssrOeUA-DCA11 5 8 9 0.771/0.333 0.671/0.447 0.732/0.426
ssrOeUA-DCA13 5 4 5 0.556/0.333 0.706/0.605 0.710/0.553
ssrOeUA-DCA14 4 4 4 0.699/0.778 0.466/0.579 0.516/0.617
ssrOeUA-DCA15 3 4 4 0.569/0.778 0.685/0.816 0.680/0.809
ssrOeUA-DCA16 9 12 15 0.836/1.000 0.829/0.974 0.859/0.979
ssrOeUA-DCA17 6 9 10 0.824/0.778 0.766/0.579 0.774/0.617
ssrOeUA-DCA18 7 9 10 0.843/0.889 0.775/0.947 0.795/0.936

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1173 Thursday, July 6, 2000 7:03 PM
Acknowledgements
This work has been supported by the Portuguese Ministério
da Ciência e Tecnologia and by the Assessoria para a Ciência e
Tecnologia da Presidência do Governo Regional da Região
Autónoma dos Açores. We wish to thank the Fábrica Torreana
de Azeites, S. A., Portugal, PLANSEL, Viveiros Jorge Böhm, LDa,
Portugal and Prof. V. Savino and Dr M. Saponari, University of
Bari, Italy, for the plant material.
References
Angiolillo A, Mencuccini M, Baldoni L (1999) Olive genetic
diversity assessed using amplified fragment length poly-
morphisms. Theoretical and Applied Genetics, 98, 411–421.
Fabbri A, Hormaza JI, Polito VS (1995) Random amplified poly-
morphic DNA analysis of olive (Olea europaea L.) cultivars. Journal
of the American Society for Horticultural Science, 120, 538 – 542.
Nei M (1978) Estimation of average heterozygosity and genetic
distance from a small number of individuals. Genetics, 89, 583 – 590.
Sefc KM, Regner F, Turetschek E et al. (1999) Identification of
microsatellite sequences in Vitis riparia and their applicability
for genotyping of different Vitis species. Genome, 42, 367–373.
982000 notes
968
PRIMER
Graphicraft
1174
1173 NOTES
Limited, Hong Kong
primer
Polymerase chain reaction primers for
microsatellite loci in the north European
water frogs Rana ridibunda and
R. lessonae
I N G A Z E I S S E T , G R A H A M R O W E and
TREVOR J. C. BEEBEE
School of Biology, University of Sussex, Brighton BN1 9QG, UK
Keywords: anuran, microsatellites, primer, Rana lessonae, Rana ridibunda
Received 3 February 2000; revision accepted 11 February 2000
Correspondence: T. J. C. Beebee. Fax: 01273 678433; E-mail:
T.J.C.Beebeesussex.ac.uk
The marsh frog Rana ridibunda, the pool frog R. lessonae and
their hybrid, the edible frog R. esculenta, are members of the
complex group of western palearctic water frogs. There has been
much interest in these amphibians because they exhibit hybrido-
genesis, a condition in which fertile hybrids persist with one
parental species over multiple generations (Schmidt 1993). So
far mainly allozymes have been used to unravel the complex
relationships of these frogs (Berger & Uzzell 1975) although
random amplified polymorphic DNA (RAPD) markers have
also been developed (Zeisset & Beebee 1998). However, in order
to study population genetics and hybridogenesis in more detail,
more sensitive markers are needed. We report in this paper the
characterization of nine polymorphic microsatellite loci, five of
which occur in R. lessonae and six in R. ridibunda.
For the construction of a genomic library R. esculenta was
chosen as it carries both the R. lessonae and the R. ridibunda
genomes (Graf & Polls Pelaz 1989) and we anticipated that
this would increase the chances of developing microsatellite
markers for both parental species. A genomic library was
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
P R I M E R N O T E S 1173
constructed in bluescript plasmids using DNA from a single
R. esculenta individual, after enrichment for dinucleotide
repeat loci as described by Armour et al. (1994). A total
of 1520 colonies were screened with 32P-labelled (AC)n
(AG)n and (GC)n probes. Seventy positives were identified
and sequenced using the M13 – 21 forward primer. Clones
containing suitable microsatellites (> 10 copies of uninterrupted
dinucleotide repeats) were also reverse sequenced. Primers
for 23 loci were designed using Primer Select (DNASTAR Inc.).
Polymerase chain reaction (PCR) conditions were optimized
for each primer pair. Reaction mixtures (20 µL total) contained
10 mm Tris-HCl pH 8.3, 50 mm KCl, 2 mm MgCl2, 0.2 µm of
each oligonucleotide, 100 µm dGTP, dCTP and dTTP, 6 µm
unlabelled dATP, 7.0 KBq [α33P]-dATP, 50– 200 ng R. ridibunda
or R. lessonae DNA and 0.5 –1.0 units of Taq polymerase
(Appligene). PCR reactions were performed using a Techne
PHC-3 or Genius thermal cycler. DNA was prepared from toes
or tadpole tails stored in 95% ethanol. DNA was extracted
using proteinase K and two phenol– chloroform extractions
followed by ethanol precipitation and resuspension in water.
Thermal cycling started with 4 min of denaturation at 94 °C
and ended with a 4 min elongation at 72 °C. All PCRs included
30 amplification cycles each with a 1 min denaturation at
94 °C, 1 min annealing and 1 min elongation at 72 °C. Two
types of ‘touchdown’ annealing protocols were used (Rowe
et al. 1997). The first consisted of two cycles of annealing at 64 °C,
followed by two cycles at 62 °C, two at 60 °C, two at 58 °C
and 22 at 55 °C. the second started with two cycles of annealing
at 62 °C, followed by two cycles at 60 °C, two at 58 °C, two at
55 °C, two at 53 °C and 20 at 50 °C. PCR products were analysed
by electrophoresis through standard sequencing gels (6% (w/v)
polyacrylamide), followed by autoradiography. M13 sequence
markers were used to estimate the size of PCR products.
The 23 primer pairs were tested with DNA from R. ridibunda
and R. lessonae individuals from widely separated locations
in Europe (Poland and Switzerland). Nine primer pairs ampli-
fied polymorphic loci, of which five were useful with R. lessonae
and six with R. ridibunda (see Table 1). Subsequently 12
populations of R. lessonae from across Europe were screened
with the five primer pairs and one to four populations of R.
ridibunda were screened with the six primer pairs. Observed
and expected heterozygosity at each locus was calculated
using the genepop software package (Raymond & Rousset
1995). There was substantial deficit of heterozygotes for Res3
in R. ridibunda (individuals from Switzerland). As this locus
did not amplify in British and Hungarian populations, it
seems likely that it has null alleles. Likewise Res6 did not
amplify a locus from some individuals, also indicating the
presence of null alleles. Res15 amplified two loci in both
species but only in R. ridibunda was the size difference
between them large enough to distinguish the loci. Only one
of these loci was deemed useful because the other again
exhibited a large number of null alleles. Res5, Res17 and
Res14 appear to be species-specific at this stage and only
produced a PCR product for one of the two parental species.
However, only a small number (n = 20) of individuals from
the other parent species were screened with these primers.
The development of microsatellite markers should prove
useful for the study of this group of amphibians and might
MEC954.fm Page 1174 Thursday, July 6, 2000 7:03 PM

1174 P R I M E R N O T E S

Table 1 Polymorphic microsatellite loci in Rana lessonae (RL) and R. ridibunda (RR)

No. of
Locus Species Repeat unit Primer sequence (5′−3′)∗ °C† Size (bp) alleles‡ HO‡ HE‡

Res3§ RL (CA)13 TTG AAG CCG GCT GAG AAA AAC 64 127–153 13 0.12 0.11
RR CAA CAA GGA GGT AAG CGG GGA TG 149–153 4 0.12 0.78
Res5 RL (GT)15 ATA CTG CCA ATA AGC TGG CAA TGT TTA GC 64 129–151 12 0.10 0.10
GGC CGA CTT CAA AGG GGT GCT C
Res6§ RL (TG)15 CCC CGC TCT CCA TCC TGA C 64 139–145 4 0.16 0.36
TGC CCT GCC ATC TCC CTA TC
Res14 RR (CA)14 GCC TAG CCA GCA CAA ATG 64 127–139 4 0.56 0.47
CTA AAC AGT ATG GGA GGT CAG A
Res15 RR (GT)20 TTT TTA TTG CTA ACT TGC CTG CTG TG 64 206–224 6 0.66 0.57
CAG CCC CTC TGG TAC ACC T
Res16 RL (CA)10 GAT CCT GAT TTC CTG CT 62 102–114 6 0.79 0.78
RR GTT TAT TTA CTC TGT TCG TCT T 102–114 3 0.54 0.57
Res17 RR (TG)12 CTG TGC TGG CTG GGT TAT TGT A 64 136–148 3 0.43 0.53
CAT CGG GTC TGT CTA TCT ATC CAC
Res20 RL (GT)17 AT (GT)3 TTT GTA AAT ATT CCG CTG GTA 62 82–124 21 0.69 0.84
CCG AGG TTG GCT GTC ATT A
Res22 RR (CA)24 ATA CAG GGC TTA GTG AAA TGA A 62 97–115 5 0.53 0.63
AAG GGG TTA AAG GTG TGA CTA T

*The full microsatellite sequences from which these primers were designed have been deposited in GenBank (Accession nos: AF195837,
AF195839, AF195840, AF195841, AF195842, AF195843, AF195844, AF195845 and AF195846, respectively).
†Initial annealing temperature in touchdown protocol (see text).
‡Heterozygosity values were calculated from one population (23–39 individuals) per primer pair whereas number of alleles and allele
size range represents data from all individuals screened (n = 23–221).
§Res3 (for R. ridibunda) and Res6 exhibited null alleles for some populations.

help unravel some of the complex relationships within Schmidt BR (1993) Are hybridogenetic frogs cyclical parthenogens?
this group. To date, cross-species amplification with other Trends in Ecology and Evolution, 8, 271– 273.
amphibians has not been investigated with these primers. Zeisset I, Beebee TJC (1998) RAPD identification of north
European water frogs. Amphibia-Reptilia, 19, 163 – 170.
982000 notes
967
PRIMER
Graphicraft
1176
1174
primer NOTES
Limited, Hong Kong

Acknowledgements
We thank V. V. Campbell and P. Ramseier for technical assistance,
L. Berger, T. Kovacs, K. Morgan, B. Schmidt, C. Snell, C. Vorburger and
J. Wycherley for providing tissue samples, and the John Maynard-
Smith studentship and English Nature for financial support.
References
Armour JAL, Neumann R, Gobert G, Jeffreys AJ (1994) Isolation
of human simple repeat loci by hybridization selection. Human
Molecular Genetics, 3, 599 – 605.
Berger L, Uzzell T (1975) Electrophoretic phenotypes of Rana
ridibunda, Rana lessonae and their hybridogenetic associate
Rana esculenta. Proceedings of the Academy of Natural Sciences of
Philadelphia, 127, 13 – 24.
Graf J-D, Polls Pelaz M (1989) Evolutionary genetics of the Rana
esculenta complex. Evolution and Ecology of Unisexual Verte-
brates. New York State Museum, Bulletin 466, 289 –301.
Raymond M, Rousset F (1995) genepop (Version 1.2): Population
genetic software for exact tests and ecumenicisms. Journal of
Heredity, 86, 248 – 249.
Rowe G, Beebee TJC, Burke T (1997) PCR primers for poly-
morphic microsatellite loci in the anuran amphibian Bufo
calamita. Molecular Ecology, 6, 401– 402.
Microsatellite primers and amplification
of aborted embryos in Platypodium
elegans J. Vogel (Fabaceae,
Papilionoideae)
K . M . H U F F O R D ,* G . K O C H E RT * and
J. L. HAMRICK†
*Department of Botany, and †Departments of Botany and Genetics, University of
Georgia, Athens, GA 30602–7223, USA
Keywords: Fabaceae, microsatellites, Platypodium, seed abortion
Received 8 January 2000; revision accepted 24 February 2000
Correspondence: K. M. Hufford. Fax: +1 706 542 1805; E-mail:
khufford@dogwood.botany.uga.edu
Early research to examine viability selection in plants often
discovered a strong heterozygote advantage and the dif-
ferential survival of genotypes (e.g. Clegg & Allard 1973).
Traditionally selection has been measured through analysis
of only two life cycle stages, mature seeds and adults.
However, genetic analyses at the mature seed stage may miss

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1175 Thursday, July 6, 2000 7:03 PM
Table 1 Locus names and GenBank accession nos, forward and reverse primer sequences, repeat size, optimal annealing temperatures
(Ta), PCR product size, number of alleles, and observed (HO) and expected (HE) heterozygosities of 86 adult trees for five microsatellite
loci in Platypodium elegans
Locus (Accession) Primer sequences (5′−3′) Repeat
PE2– 2 F: TAGCATCAGCAGAACCCAA (GA)28
(AF215640) R: GTTTCAGTTGTGATGCAATCTC
PE5 – 2 F: GTTCAAGAAAAGGGCTTTTGG (GA)14
(AF215641) R: GTCACTCGCTCACTCCATCA
PE5 – 4 F: CAAAAATGCTGTTGTCTTCAGC (GA)13
(AF215642) R: GCGTTCTTCAGTGAAGGGAG
PE6 –1 F: TTTTTCTCCTCCTCACCATCA (GA)28
(AF215643) R: CTCCAAGTTTAGGGAAAAGAGC
PE14 –1 F: AGTTTGGTGTGCGTTAAGGG (GA)18
(AF215644) R: ACAGACAGCACACACACGCT
previous selective events such as seed abortion. Abortion of
fertilized ovules prior to seed maturation has been documented
in large numbers of angiosperms, including many tree species
(Bawa & Webb 1984). Despite the selective potential of seed
abortion, studies of its consequences are often limited to
species with inflorescences accessible for hand-pollination
experiments or embryo rescue due to a lack of tissue needed
for allozyme markers. Genetic markers amplified by the
polymerase chain reaction (PCR) provide an alternative to
pollination studies and avoid the limitations of allozymes.
PCR requires only minute amounts of DNA, making genetic
analyses of embryos possible in species where a small
amount of remaining tissue is recovered from aborted seeds.
Platypodium elegans J. Vogel is a tropical tree with a geo-
graphical range from Panama through Brazil (Croat 1978).
Research has documented a 92% outcrossing rate and high
levels of intrapopulation gene movement in this species
(Hamrick & Murawski 1990). Trees exhibit a period of fruit
abortion late in fruit development that lasts for several
months. If fruits are selectively aborted, the outcrossing rate
estimated from germinated seeds of P. elegans would not
represent the outcrossing rate at fertilization and important
episodes of early selection may be missed. In this paper we
report the isolation of microsatellite markers in P. elegans and
successful amplification of aborted seeds for use in a study of
viability selection in this species.
Total genomic DNA was extracted from mature leaf tissue
using the modified DNA extraction protocol described in
Chavarriaga-Aguirre et al. (1998). DNA was digested with
Sau3AI and fragments from 400 to 800 bp were excised from
a 2.0% Metaphor agarose gel (FMC BioProducts) with a
QIAGEN QIAquick Gel Extraction Kit. Size-selected DNA
was ligated into the BamHI cloning site of the Zap Express
vector (Stratagene) and packaged with Gigapack III Gold
Packaging Extract (Stratagene) according to methods of
Rassmann et al. (1991). The small insert library was used to
infect XL1-Blue Escherichia coli cells and plaques were lifted
from top agar plates with nylon membranes (Amersham).
Membranes were baked at 80 °C and then screened with a
[γ 32P]-dATP (GA)10 probe end-labelled with T4 polynucleotide
kinase. A total of 15 plates with approximately 1 × 103 clones
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
P R I M E R N O T E S 1175
Ta Product size (bp) No. of alleles HO HE
57 122 13 0.76 0.75
56 220 5 0.56 0.58
56 123 17 0.86 0.88
61 166 21 0.92 0.91
57 184 8 0.76 0.80
each were screened. Putative microsatellites were screened a
second time at a lower plaque density (≈ 200 recombinant
clones per plate). Clones picked in the second screen were
amplified with M13 primers and products were purified with
PCR purification columns (QIAGEN).
PCR products were sequenced on an automated sequencer
with T3 and T7 primers using the ABI Dye Terminator Prism
Kit (ABI/Perkin Elmer). Primers were designed for eight
microsatellites with primer version 0.5 software (Whitehead
Institute for Biomedical Research). Of these eight, five had
sufficient polymorphism to be useful for population genetic
analyses. Reactions were performed in 20 µL volumes
containing 50 ng DNA, 10 mm Tris-HCl, 50 mm KCl, 2.0 mm
MgCl2, 0.125 mm dNTP mix, 0.8 pmol of 3′ primer, 0.8 pmol
of 5′ primer labelled with [γ 32P]-dATP, and 0.8 U AmpliTaq
DNA Polymerase (Perkin Elmer). Initial denaturation for
1 min at 94 °C was followed by 30 cycles of 0.5 min at 94 °C,
1 min at the optimal annealing temperature, and 2 min at
72 °C, with a final extension period of 5 min at 72 °C (Perkin
Elmer Cetus thermal cycler). Products were resolved by
electrophoresis on 6% denaturing polyacrylamide gels and
visualized by autoradiography.
Optimal PCR conditions and results of initial screening are
reported for 86 adult trees in Table 1. Analyses of genotyped
samples were performed with genepop software (Raymond &
Rousset 1995) and all but one locus had patterns of variation
consistent with Hardy–Weinberg expectations. Locus PE14 –1
had a significant deficit of heterozygotes (P < 0.02). Other
than this deficit, there is no evidence for null alleles at any of
the five loci. To test microsatellite markers on sample collec-
tions, frozen aborted embryos (4 – 20 mg) were ground with
liquid nitrogen in 1.5 µL microtubes with micropestles (Bel-Art)
and mixed with a pestle motor (Kontes) to ensure adequate
homogenization. Embryo DNA was extracted with a QIAGEN
DNeasy Plant Mini Kit and PCR amplification proceeded as
with leaf-extracted samples. Resulting embryo genotypic
arrays were consistent with genotypes of maternal trees. The
successful amplification of aborted embryos and the high
levels of polymorphism observed indicate that microsatellite
markers are ideal for selection component analyses of early
life stages in P. elegans.
MEC954.fm Page 1176 Thursday, July 6, 2000 7:03 PM
1176 P R I M E R N O T E S
Acknowledgements
We thank P. Aldrich and P. Chavarriagga-Aguirre for their assistance.
This work was funded by NSF/USDA/DOE Training Grant BIR-
9220329 (KMH).
References
Bawa KS, Webb CJ (1984) Flower, fruit and seed abortion in tropical
forest trees: implications for the evolution of paternal and mater-
nal reproductive patterns. American Journal of Botany, 71, 736 – 751.
Chavarriaga-Aguirre P, Maya MM, Bonierbale MW et al. (1998)
Microsatellites in Cassava (Manihot esculenta Crantz): discovery,
inheritance and variability. Theoretical Applied Genetics, 97,
493 – 501.
Clegg MT, Allard RW (1973) Viability versus fecundity selection
in the slender wild oat, Avena barbata L. Science, 181, 667–668.
Croat TB (1978) Flora of Barro Colorado Island. Stanford University
Press. Stanford.
Hamrick JL, Murawski DA (1990) The breeding structure of
tropical tree populations. Plant Species Biology, 5, 157–165.
Rassmann K, Schlotterer C, Tautz D (1991) Isolation of simple-
sequence loci for use in polymerase chain reaction-based DNA
fingerprinting. Electrophoresis, 12, 113–118.
Raymond M, Rousset F (1995) genepop (Version 1.2): Population
genetics software for exact tests and ecumenicism. Journal of
Heredity, 86, 248 – 249.
982000 notes
966
PRIMER
Graphicraft
1178
1176
primer NOTES
Limited, Hong Kong
Isolation and characterization of
dinucleotide microsatellite loci in
the Great White Shark, Carcharodon
carcharias
A M A N D A T. PA R D I N I , * C AT H E R I N E S .
JONES,* MICHAEL C. SCHOLL†‡
and L E S L I E R . N O B L E *
*Zoology Department, Aberdeen University, Tillydrone Avenue, AB24 2TZ, UK,
†South African White Shark Research Institute, PO Box 50775, V & A
Waterfront, Cape Town 8002, South Africa
Keywords: Carcharodon carcharias, dinucleotides, elasmobranch, genetic
markers, great white shark, microsatellites
Received 31 December 1999; revision accepted 2 March 2000
Correspondence: A. Pardini. Fax: + 44 1224 272396; E-mail:
a.pardini@abdn.ac.uk
‡Present address: PO Box 1258, Gansbaai 7220, Western Cape, South Africa.
The great white shark, Carcharodon carcharias is considered to
be a threatened species. The suspected decrease in numbers
(Bruce 1992) has prompted concern with several countries,
including South Africa, Australia and North America
(Wintner & Cliff 1999), instituting protective legislation.
However, these measures are considered pre-emptive largely
due to the lack of essential population dynamics data either
at a local or global level (Wintner & Cliff 1999). White sharks
occur worldwide preferring cold and warm temperate
waters off continental and insular shelves (Compagno 1984).
Within this distribution the extent of long range movements
between disjunct populations, for example Australia and South
Africa, is unknown. As a result white shark conservation
status remains uncertain, which is evident by the IUCN Red
List classification of white sharks as Category K ‘suspected but
not definitely known to be threatened’ (Compagno et al. 1997).
Future conservation management decisions need to be
underpinned by information on the dynamics of local move-
ments and interactions, and the extent to which these are
affected by larger scale movements. These data have proven
difficult to obtain through traditional methods of tracking,
tagging and observation largely due to the inherent difficul-
ties of working in a marine environment with an intractable,
elusive species, such as the great white shark. In this paper
we describe the isolation and characterization of the first
dinucleotide microsatellite loci in Carcharodon carcharias.
Microsatellite loci were isolated using a modified enrich-
ment protocol (Armour et al. 1994) following Piertney et al.
(1998). Total genomic DNA was extracted from muscle tissue
of eight individuals sampled in the region of Dyer Island, South
Africa, using standard proteinase K digestion and phenol–
chloroform extraction procedures following Sambrook et al.
(1989). Size selected (300 –1000 bp) Sau3AI digested DNA
fragments were ligated to a SAU linker molecule (made by
annealing equimolar amounts of SAU-L-A [5′-GCGGTAC-
CCGGGAAGCTTGG-3′] and SAU-L-B [5′-GATCCCAAGCT-
TCCCGGGTACCGC-3′] oligonucleotides). The resultant fraction
was denatured and hybridized to a 1 cm2 piece of Hybond N
membrane (Amersham) saturated with (CA)n and (GT)n poly-
mers in 2× SSC, 0.1% SDS at 65 °C. These polymers had a
ddATP ligated on the end using Terminal Dinucleotidyl Trans-
ferase according to the manufacturer’s instructions (Promega)
to prevent probe polymerization in subsequent amplifica-
tions. Filters were washed several times to remove non repetit-
ive DNA. The enriched microsatellite fragments were removed
by chemical stripping by incubating at room temperature
first with 50 mm NaOH, 0.01% SDS and followed by 50 mm
Tris-HCl (pH 7.5), 0.01% SDS. This fraction was ethanol precip-
itated from the combined wash solutions. The complement-
ary strands were reformed using the SAU-L-A linker as a primer
in a polymerase chain reaction (PCR) with 30 cycles of 90 °C
denaturation for 1 minute, 55 °C annealing for 1 minute, 72 °C
extension for 5 s and a final extension at 72 °C for 5 min. The
PCR product was ligated into a pGEM®-T vector (Promega),
transformed into JM109 high efficiency competent cells
(Promega) and grown overnight at 37 °C on Luria–Bertani
(LB) medium containing 50 mg/mL ampicillin and surface
streaked with 40 µL of 50 mg/mL X-gal and 10 µL 20% IPTG.
Recombinant colonies were gridded out onto duplicate, fresh
LB plates and regrown overnight. The colony streaks were
lifted onto Hybond-N membranes and fixed by UV cross-
linking. Recombinant colonies were screened for micro-
satellite repeats with α- 32P labelled CA and GT oligonucleotide
repeats using random priming (Sambrook et al. 1989). DNA
from positive clones were sequenced using an ABI 377 auto-
mated sequencer (cycle sequenced using Big Dye Terminator
Kit according to the manufacturer’s protocols). Primers were
designed using the program OLIGO™ Macintosh version 4.1
(National Biosciences Inc., USA) from the unique sequence
flanking the microsatellite repeats.
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
MEC954.fm Page 1177 Thursday, July 6, 2000 7:03 PM

P R I M E R N O T E S 1177

Table 1 Dinucleotide microsatellite loci from Carcharodon carcharias. GenBank accession nos for these sequenced clones are AF184087,
AF184089, AF216864–AF216866

Locus Primer sequence 5′– 3′ Repeat motif T °C Size (bp)* No. of alleles HE HO

Ccar1 F GCAGAGGTTGGGAAAGAGTT (AC)22 65–55 170 5 0.65 0.68

R GCTATTCCAGTGACACTCTCC
Ccar3.1 F CTTGTGCTCGCTGCTCTAC (AC)7 65–60 149 2 0.51 0.63
R GGTGGTTTGTGATTCTGTG
Ccar9 F AATGGGTTGTGATGGGAGTTT (TG)23 65–55 218 10 0.83 0.77
R CAAGTGGAAGTCAAGCAGGTT
Ccar13 F GCTGAGTGCTGGCTGACCT (TG)4TT(TG)9TT(TG)3TTTT(TG)23 65–55 288 7 0.79 0.95
R TATCCAGTTACCATCTCCAAAAA
Ccar19 F GCCAGACCGACACATCAGTAA (TG)16CG(TG)3 65–55 200 3 0.51 0.45
R GCAACGCCCACATCCCATAA

*Determined from sequenced clone.

T °C is the optimal (touchdown) annealing temperature; HE, expected heterozygosity; HO, observed heterozygosity.

Table 2 Success amplifying loci across

Species (n) Ccar1 Ccar3.1 Ccar9 Ccar13 Ccar19 other elasmobranch species (determined
on 6% acrylamide gels)
Scyliorhinus canicula (2) – – – • +
Cetorhinus maximus (2) + • • • +
Holohalealurus regani (1) – – – – •
Squalus mitsukurii (1) – – – – •
Squalus megalops (1) – – – – •
Notorynchus cepedianus (1) – – – – –
Galeorhinus galeus (1) – • – – •
Raja springeri (1) – – – – •
Raja caudospinosa (1) – – – – •
Curiraja parcomaculata (1) – – – – •
Heptranchias perlo (1) • • – – –
Galeocerdo cuvier (1) + • – – •
Carcharinus limbatus (1) – • – – •
Lamna nasus (8) • • + + •
Isurus oxyrinchus (1) + • – • •

+, indicates presence of scorable alleles.

• , alleles present but requires further optimization.
–, multiple bands, smear or no product.

DNA was extracted from muscle tissue of 20 white shark
samples (Dyer Island, South Africa) and from a variety of other
elasmobranch species (Table 2). Individuals were screened for
each microsatellite locus separately in 10 µL PCR reaction
volumes containing 20 ng template DNA, 1– 2.5 mm MgCl2,
0.2 mm of each nucleotide, 2.5 – 5 pmoles of primer (forward
primer end-labelled with [γ-32P] — ATP), 0.5 units of Taq DNA
polymerase (Bioline Inc.), and 1× NH4 buffer (Bioline Inc.).
PCR amplifications were performed on a Hybaid PCR express
using the ‘touchdown’ protocol (Don et al. 1991). Amplified
products were resolved on 6% denaturing polyacrylamide
gels and product sizes determined by comparison with a
M13 mp8 DNA sequence visualized using autoradiography.
Of the six primer pairs tested on this single population,
five were polymorphic (Table 1), with number of alleles
ranging from 2 to 10 and observed heterozygosities from 0.45
to 0.95. To our knowledge the only other published report
(Heist & Gold 1999) on microsatellite loci in elasmobranchs
(sandbar sharks Carcharinus plumbeus) found an overall
lower number of repeats per locus and low heterozygosity
values. Hence, preliminary results suggest our loci may
prove useful population genetic markers.
The utility of the polymorphic microsatellite primers was
examined in other elasmobranchs (Table 2). PCR conditions
used were the same as those given above except for a lower
touchdown temperature range of 60 – 50 °C. The presence of
microsatellites varied across the range of species tested, sug-
gesting amplification is species-dependent.
Acknowledgements
This work was supported by Aberdeen University Faculty funds
(ref. Z0004/98) and the Biotechnology and Biological Sciences
Research Council (Advanced Fellowship to CSJ, grant number
1/AF09056). We would also like to thank Brett Human, Rolf Wil-
liams and Andrew Martin for non white shark samples and

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1178 Thursday, July 6, 2000 7:03 PM
1178 P R I M E R N O T E S
Aiden Emery, Stuart Piertney, John Dallas, David Sims and Freda
Marshall for support and technical advice; White Shark Research
Institute are thanked for support facilities for MCS.
References
Armour JAL, Neumann R, Gobert S, Jeffreys AJ (1994) Isolation
of simple human repeat loci by hybridisation selection. Human
Molecular Genetics, 3, 599 – 605.
Bruce BD (1992) Preliminary observations on the biology of the
white shark, Carcharodon carcharias in South Australian waters.
Australian Journal of Marine and Freshwater Research, 43, 1–11.
Compagno LJV (1984) FAO species catalogue, volume 4. Sharks of
the world. An annotated and illustrated catalogue of shark spe-
cies known to date. Part 1. Hexanchiformes to Lamniformes.
FAO Fisheries Synopsis, (125), 4, Part 1, 238–241.
Compagno LJV, Marks MA, Fergusson IK (1997) Threatened
fishes of the world: Carcharodon carcharias (Linnaeus, 1758).
Environmental Biology of Fishes, 50, 61–62.
Don RH, Cox PT, Wainright BT, Baker K, Mattick JS (1991)
‘ Touchdown’ PCR to circumvent spurious priming during
gene amplification. Nucleic Acids Research, 19, 4008.
Heist EJ, Gold JR (1999) Microsatellite DNA variation in sandbar
sharks (Carcharhinus plumbeus) from the Gulf of Mexico and
Mid-Atlantic bight. Copeia, 1, 182 –186.
Piertney SB, Goostrey A, Dallas JF, Carss DN (1998) Highly poly-
morphic microsatellite markers in the great cormorant Phala-
crocorax carbo. Molecular Ecology, 7, 138–140.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a
Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory
Press, New York.
Wintner SP, Cliff G (1999) Age and growth determination of the
white shark, Carcharodon carcharias, from the east coast of
South Africa. Fishery Bulletin, 97, 153–169.
982000 notes
972
PRIMER
Graphicraft
1180
1178
primer NOTES
Limited, Hong Kong
Characterization of microsatellite loci in
Coffea arabica and related coffee species
M. C. COMBES,* S. ANDRZEJEWSKI,*
F. A N T H O N Y , † B . B E RT R A N D , ‡ P. R O V E L L I , §
G . G R A Z I O S I § and P. L A S H E R M E S *
*IRD, GeneTrop, BP 5045, F-34032, Montpellier, France, †CATIE, AP59, 7170
Turrialba, Costa Rica, ‡IICA/PROMECAFE, Ap. Postal 55, 2200, Coronado,
San José, Costa Rica, §Università deli Studi di Trieste, Dipartemento di biologia,
I-34148, Trieste, Italy
Keywords: Coffea, coffee tree, genetic diversity, microsatellites
Received 15 January 2000; revision received 8 February 2000;
accepted 5 March 2000
Correspondence: P. Lashermes. Fax: + 33 4 67 54 78 00; E-mail:
Philippe.Lashermes@mpl.ird.fr
Coffee trees (family Rubiaceae) are classified in two genera,
Coffea and Psilanthus. Particular attention has been paid to the
genus Coffea which includes two cultivated species of economic
importance, C. arabica L. and C. canephora Pierre. C. arabica
(2n = 4 × = 44) is an amphidiploid (Lashermes et al. 1999) while
other Coffea species are diploid (2n = 2 × = 22). Molecular
phylogenies of Coffea species have been successfully established
(Cros et al. 1998). Those analyses suggest several major clades,
which present a strong geographical correspondence (i.e.
west Africa, central Africa, east Africa and Madagascar).
Further steps would be to study the genetic structure of
populations and gene flow between species.
The aim of this present paper is to develop a set of molecular
genetic markers, known as simple sequence repeats (SSRs) or
microsatellites (Weber & May 1989), suitable for genetic studies
of coffee species. Eleven primer pairs that reliably detect
microsatellite loci are described. We assessed their potential
as genetic markers in the discrimination of C. arabica and
C. canephora genotypes, and examined cross-amplification in
various coffee species.
The plant material (55 individuals) resulted from several
collecting missions in Africa and Madagascar. The species
C. arabica are represented by 32 individuals sampled from
different locations in Ethiopia and Yemen, while C. canephora are
represented by 10 individuals collected in the Central African
Republic, Congo and Côte-d’Ivoire. A total of 13 Coffea taxa
were surveyed. The closely related genus Psilanthus was also
represented by two species, P. ebracteolatus and P. travencorensis.
DNA was isolated from lyophilized leaves through a nuclei
isolation step as described by Agwanda et al. (1997).
DNA clones from a partial genomic library (C. arabica
var. Caturra) enriched for (TG)13 motifs (Vascotto et al. 1999)
were sequenced using automated fluorescent technology
(ABI sequencer). Oligonucleotide primers complementary
to flanking regions of identified repeats were designed
for 11 sequences using the computer program Primer3
(Whitehead Institute for Biomedical Research). SSR assays
were carried out by means of the polymerase chain reaction
(PCR). Reaction mixtures for the PCR amplification of SSR
loci contained 25 ng of genomic DNA, 10 mm Tris-HCl,
pH 9.0, 0.1% Triton X-100, 1.5 mm of MgCl2, 0.2 pmol of
each primer, 0.2 mm of dCTP, dGTP, dTTP, 0.01 mm of
dATP, 0.8 mCi of [α33P]-dATP (Amersham Pharmacia), and
0.5 U of Taq DNA polymerase (Promega) in a 25-µL final
volume. Reactions were performed in a PTC-200 thermo-
cycler (MJ Research). The amplification cycle consisted of
an initial 2 min denaturation at 94 °C, followed by 5 cycles
of denaturation at 94 °C for 45 s, 1 min primer annealing at
60 °C with decreasing temperature of one degree at each cycle,
and 1 min 30 s elongation at 72 °C. Then, 30 cycles of 45 s at
90 °C, 1 min at 55 °C and 1 min 30 s at 72 °C were performed
and followed by a final 8 min elongation at 72 °C. Amplifica-
tion products were electrophoresed on 6% denaturing
polyacrylamide gel with 8 m urea and 1 × TBE. Radioactively
labelled 10-bp ladder DNA was used as a size standard.
The 11 primer pairs were successful in amplification of variable-
length fragments (Table 1). Only five of the 11 microsatel-
lite loci appeared to be polymorphic in C. arabica. This result
illustrated the very low genetic diversity present in C. arabica
as a consequence of its origin, reproductive biology, and evolution
(Lashermes et al. 1999). On the other hand, the microsatellite
loci showed a broad range of genetic diversity across the
accessions of C. canephora. The mean heterozygosity values were
0.04 and 0.47 in the predominantly autogamous C. arabica
and the self-incompatible species C. canephora, respectively.
Results of cross-species amplifications with the 11 primer
pairs are reported in Table 2. Although designed from sequences
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
MEC954.fm Page 1179 Thursday, July 6, 2000 7:03 PM

P R I M E R N O T E S 1179

Table 1 Oligonucleotide primer sequences, repeat motifs, PCR product sizes, allele number, and heterozygosity level of 11 microsatellite
loci isolated from Coffea arabica

Allele number/
Heterozygosity†
EMBL Product
Locus Accession no. Repeat motif* PCR primer sequence (5′ → 3′) size (bp) C. arabica C. canephora

M2a AJ250250 (GT)8/(GT)6/(GT)7 F: AGTGGTAAAAGCCGTTGGTG 205–218 2/0.00 3/0.40

R: GCGGTTGTTGGTGAGTTGAA
M3 AJ250251 (CA)6/(CA)3/(CA)3/(CA)3/(CA)4/ F: ATTCTCTCCCCCTCTCTGC 248–258 2/0.00 3/0.20
(CA)3/(CA)3/(CA)3 R: TGTGTGCGCGTTTTCTTG
M11 AJ250252 (GT)4/(GA)4/(GT)4/(GT)6 F: ACCCGAAAGAAAGAACCAAG 140–146 1/0.00 2/0.20
R: CCACACAACTCTCCTCATTC
M20 AJ250253 (GA)5(GT)8TT(GT)4TT(GT)7 F: CTTGTTTGAGTCTGTCGCTG 240–270 5/0.00 6/0.70
(GA)11(TC)2(CT)3GT R: TTTCCCTCCCAATGTCTGTA
M24 AJ250254 (CA)15 (CG)4CA F: GGCTCGAGATATCTGTTTAG 132–166 6/0.13 10/0.80
R: TTTAATGGGCATAGGGTCC
M25 AJ250255 (GT)5CT(GT)2/(GT)12 F: CCCTCCCTGCCAGAAGAAGC 160–170 3/0.03 3/0.30
R: AACCACCGTCCTTTTCCTCG
M27 AJ250256 (GT)11 F: AGGAGGGAGGTGTGGGTGAAG 118–134 2/0.00 4/0.60
R: AGGGGAGTGGATAAGAAGG
M29 AJ250257 (CTCACA)4/(CA)9 F: GACCATTACATTTCACACAC 103–122 3/0.00 3/0.20
R: GCATTTTGTTGCACACTGTA
M32 AJ250258 (CA)3/(CA)3/(CA)18 F: AACTCTCCATTCCCGCATTC 89–135 7/0.10 6/0.30
R: CTGGGTTTTCTGTGTTCTCG
M42 AJ250259 (GT)3/(GT)7 F: ATCCGTCATAATCCAGCGTC 72–103 2/0.00 5/0.70
R: AGGCCAGGAAGCATGAAAGG
M47 AJ250260 (CT)9 (CA)8/(CT)4/(CA)5 F: TGATGGACAGGAGTTGATGG 100–132 7/0.10 10/0.80
R: TGCCAATCTACCTACCCCTT

*Microsatellite motifs are sequenced alleles (C. arabica var. Caturra).

†Estimated among samples of 32 and 10 individuals of C. arabica and C. canephora, respectively.

Table 2 Cross-species amplification using primers designed for Coffea arabica. Assays producing amplification are indicated by ‘+’, no
amplification is indicated by ‘–’. One sample tree of each species was tested

Locus
Geographical
Species distribution* M2a M3 M11 M20 M24 M25 M27 M29 M32 M42 M47

C. liberica WC + + – + + + + + + + +
C. congensis WC + + + + + + + + + + +
C. eugenioides C + – + + + + + + + + +
C. sp. Moloundou C + + – + + + + + + + +
C. pseudozanguebariae E – – + + + + + + + + +
C. salvatrix E – – – + + – + – + + +
C. sessiliflora E – + + + + + + + + + +
C. resinosa M – – + + + + + + + + +
C. perrieri M – + – + + + + + + + +
C. bertrandi M – + + + + + + + + + +
C. dolychophylla M – – + + + + + + + + +
P. travencorensis I + + – + + + + + + + +
P. ebracteolatus W – + – + + + + + + + +

*Endemic geographical distribution of species is indicated by the following letters: ‘E’ (east Africa), ‘M’ (Madagascar),
‘WC’ (west and central Africa), ‘C’ (central Africa) and ‘I’ (India).

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1180 Thursday, July 6, 2000 7:03 PM
1180 P R I M E R N O T E S
isolated in C. arabica, these primers worked well for most of
the diploid coffee species. Representatives of the Psilanthus
genus consistently yielded amplification products from the
primer pairs supporting the hypothesis that species belonging
to the two genera, namely Coffea and Psilanthus, are closely
related (Cros et al. 1998).
Altogether, the primers described in this paper can pro-
vide useful markers to investigate levels of genetic variation
in coffee species with respect to germplasm management
and genetic study in natural plant populations.
Acknowledgements
This work was supported in part by the European Community
through the International Scientific Co-operation Programme
(INCO-DC Contract ERBIC18CT970181).
References
Agwanda C, Lashermes P, Trouslot P, Combes MC, Charrier A
(1997) Identification of RAPD markers for resistance to Coffee
Berry Disease, Colletotrichum kahawae, in Arabica coffee. Euphytica,
97, 241– 248.
Cros J, Combes MC, Trouslot P et al. (1998) Phylogenetic analysis
of chloroplast DNA variation in Coffea L. Molecular Phylogenetics
and Evolution, 9, 109 – 117.
Lashermes P, Combes MC, Robert J et al. (1999) Molecular
characterisation and origin of the Coffea arabica L. genome.
Molecular General Genetics, 261, 59 – 266.
Vascotto F, Degli Ivanissevich S, Rovelli P et al. (1999) Micro-
satellites in Coffea Arabica: construction and selection of two
genomic libraries. Proceedings of the III International Seminar on
Biotechnology in the Coffee Agroindustry. Londrina, Brazil.
Weber JL, May PE (1989) Abundant class of human DNA
polymorphism which can be typed using the polymerase
chain reaction. American Journal of Human Genetics, 44, 388–
396.
982000 notes
973
PRIMER
Graphicraft
1181
1180
primer NOTES
Limited, Hong Kong
Microsatellite loci from the marine fish
Nemadactylus macropterus (Perciformes:
Cheilodactylidae)
C . P. B U R R I D G E and A . J . S M O L E N S K I
School of Zoology, University of Tasmania, GPO Box 252–05, Hobart,
Tasmania 7001, Australia
Keywords: microsatellite, fish
Received 20 February 2000; revision accepted 21 February 2000
Correspondence: C. P. Burridge. Fax: + 1979 845 4096; E-mail:
cburridge@wfscgate.tamu.edu
Nemadactylus macropterus is a commercially exploited marine
fish of New Zealand and southern Australia. Population
genetic studies employing allozymes and mitochondrial
DNA (mtDNA) did not differentiate N. macropterus popula-
tions within southern Australia, and identified only slight
but significant differentiation between Australia and New
Zealand (Elliott & Ward 1994; Grewe et al. 1994). Microsatellite
analyses conducted on marine taxa have often identified
population differentiation not evident from other molecular
characteristics (Bentzen et al. 1996; O’Connell et al. 1998; Shaw
et al. 1999). Consequently, seven polymorphic microsatellite
loci were developed for the study of N. macropterus.
Genomic DNA was extracted from frozen liver tissue and
purified following a CTAB phenol– chloroform protocol (Hillis
et al. 1990), and the presence of high molecular weight (> 20 kb)
fragments was confirmed by agarose gel electrophoresis. DNA
was then digested with DpnII and 400– 600 bp fragments
were gel purified using the Geneclean Spin Kit (BIO 101, Inc.).
A pUC19 vector was similarly digested with BamHI,
dephosphorylated with calf intestinal alkaline phosphatase,
and gel purified. Ligations were performed in equal molar
ratios at 14 °C using T4 DNA ligase. Approximately 100 ng
of ligated DNA was transformed into 100 µL of XL1-Blue
heat competent cells (Stratagene). Cells were grown on LB
plates containing ampicillin, X-gal and IPTG.
Oligonucleotide [AC]16T was 3′ end-labelled with digoxygenin-
11-ddUTP using the DIG Oligonucleotide 3′ End-Labelling Kit
(Roche). Colony lifts employed Hybond-N nylon membranes
(Amersham), and were treated following the instructions for
the DIG Luminescent Detection Kit (Roche). Hybridization
was conducted at 50 °C for 6 –12 h with a probe concentration
of 10 pmol/mL, and chemiluminescent detection employed
CSPD substrate. Plasmids from 31 positive colonies were
miniprep purified (Sambrook et al. 1989). Insert sequences
were polymerase chain reaction (PCR) amplified using
M13 primers, gel purified and sequenced with the ABI
PRISM Dye Primer Cycle Sequencing Ready Reaction Kit
(Perkin-Elmer).
Seven PCR primer pairs (Table 1) were designed for micro-
satellite amplification using PrimerSelect (DNASTAR). One
primer for each locus was 5′ end-labelled with FAM or
HEX dye. The 3′ thymine-rich primer for locus Nma106
produced a nonspecific product of approximately 180 bp,
and therefore the opposite primer was labelled. Nma187 and
Nma245 were developed from the same clone. Other
sequences useful for the design of microsatellite-amplifying
PCR primers are available in GenBank (accession nos
AF125121–AF125138).
PCR amplifications of microsatellites were conducted indi-
vidually in 20 µL volumes comprising 67 mm Tris-HCl (pH 8.8),
16.6 mm (NH4)2SO4, 0.45% Triton X-100, 0.2 mg/mL gelatin,
0.2 mm dNTPs, 1.5 mm MgCl2, 0.5 units Taq F1 DNA polymerase
(Fisher Biotech), 0.4 mm of each oligonucleotide primer, and
approximately 20 ng of DNA. Thermal cycling conditions
comprised 35 cycles of 94 °C/30 s, 62.5 °C/30 s, and 72 °C/
60 s, using a Perkin-Elmer 9600 machine. An initial denatura-
tion of 94 °C/5 min and a final extension of 72 °C/10 min were
employed. PCR products were mixed in appropriate ratios
(Table 1) to achieve even peak heights when multiplexed on
an ABI 377 (Perkin-Elmer), and alleles were scored relative
to the GS500 size standard. The PCR primers were tested on
the following cheilodactylids and successfully amplified
homologous microsatellites: N. douglasii, N. valenciennesi, N.
bergi, Nemadactylus sp., Acantholatris monodactylus, and A. gayi.
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
MEC954.fm Page 1181 Thursday, July 6, 2000 7:03 PM

P R I M E R N O T E S 1181

Table 1 Clone repeat sequence, number of alleles (A), size range, observed and expected heterozgosity (HO, HE), GenBank accession, and
PCR primers for each of seven microsatellite loci developed for Nemadactylus macropterus. Locus names indicate the length of the
amplified product in the plasmid clone. Measures of variability are based on 55 individuals sampled from Tasman Island, Australia. The
dilution ratio of PCR products for multiplexing on an ABI 377 is indicated

Size range GenBank Dilution

Locus Clone repeat sequence A (base pairs) HO HE accession no. Primer sequences (5′–3′) ratio

Nma106 (AC)16 33 91–185 0.65 0.91 AF125115 GCACTTCATGTACATGCAGGGTTTT 3

TAAGCGGCATCTTGAGTGTCTGG*
Nma118 (TCA)9 7 112–133 0.42 0.50 AF125116 CAAAAAGCAGCTCTACAGTGACAG† 2
CAGAGACAGTTTAGGGAAGTGAAGAC
Nma187 (AC)13(AG)4 19 181–219 0.96 0.93 AF125117 GCAACTTCCCCGAGCATCATTA 2
AGAGCCTGCAATTAGAGTCAACCAA†
Nma230 (GT)15 21 219–267 0.91 0.91 AF125118 AGTTTCCCCCTGCCTACA 5
CCTGAACCACTGCGACACTG*
Nma245 (GT)21 18 219–259 0.69 0.80 AF125117 TTCTTAAAGGGCGAGTGATGCTA† 8
ATGAAAGATGAAGTGATGGAAACAGAC
Nma305 (GT)7AT(GT)9 23 289–343 0.84 0.95 AF125119 GATCAGGCTCTTCCAGTTGTCATTCC* 2
GTGTCGGCGTTCAGAGGCATCC
Nma311 (AT)8 8 297–328 0.45 0.56 AF125120 ACTCCGTCTGTACTCTTTGTTGA 2
CTCAGGCTGCAGGTGGTC†

*5′ end-labelled with FAM dye; †5′ end-labelled with HEX dye.

Acknowledgements Shaw PW, Pierce GJ, Boyle PR (1999) Subtle population struc-
turing within a highly vagile marine invertebrate, the veined
Sharon Appleyard, Bronwyn Innes, and Peter Grewe (CSIRO
squid Loligo forbesi, demonstrated with microsatellite DNA
Marine Laboratories, Hobart, Australia) provided operation of
markers. Molecular Ecology, 8, 407–417.
an ABI 377, while Nick Elliott and Peter Grewe (CSIRO) donated 982000 notes
974
PRIMER
Graphicraft
1183
1181
primer NOTES
Limited, Hong Kong

N. macropterus fish tissues and DNA. Funding for the development

of these markers was provided by an Australian Reasearch Council
Small Grant.
References
Bentzen P, Taggart CT, Ruzzante DE, Cook D (1996) Micro-
satellite polymorphism and the population structure of
Atlantic cod (Gadus morhua) in the northwest Atlantic. Canadian
Journal of Fisheries and Aquatic Sciences, 53, 2706–2721.
Elliott NG, Ward RD (1994) Enzyme variation in jackass
morwong, Nemadactylus macropterus (Schneider, 1801) (Teleostei:
Cheilodactylidae), from Australian and New Zealand waters.
Australian Journal of Marine and Freshwater Research, 45, 51–67.
Grewe PM, Smolenski AJ, Ward RD (1994) Mitochondrial
DNA diversity in jackass morwong (Nemadactylus macropterus,
Teleostei) from Australian and New Zealand waters. Canadian
Journal of Fisheries and Aquatic Sciences, 51, 1101–1109.
Hillis DM, Larson A, Davis SK, Kimmer EA (1990) Nucleic acids
III: Sequencing. In: Molecular Systematics (eds Hillis DM, Moritz C),
pp. 106 –122. Sinauer, Sunderland.
O’Connell M, Dillon MC, Wright JM, Bentzen P, Merkouris S,
Seeb J (1998) Genetic structuring among Alaskan Pacific
herring (Clupea pallasi) populations identified using microsatellite
variability. Journal of Fish Biology, 53, 150–163.
Sambrook J, Fritsch EP, Maniatis T (1989) Molecular Cloning: a
Laboratory Manual. 2nd edn. Cold Spring Harbour Laboratory
Press. New York.
Isolation and characterization of
microsatellite loci from the human
whipworm Trichuris trichiura
G U Y C . B A R K E R and D O N A L D A . P. B U N D Y
Wellcome Trust Centre for the Epidemiology of Infectious Disease, Department of
Zoology, University of Oxford, South Parks Road, Oxford, OX1 3FY, UK
Keywords: Helminth, Trichuris trichiura, microsatellite, genetic markers
Received 20 February 2000; revision accepted 7 March 2000
Correspondence: G. C. Barker. Fax: + 44 1865281245;
E-mail: guy.barker@ceid.ox.ac.uk
The human whipworm Trichuris trichiura, is one of the most
common geohelminths affecting humans today. Recent esti-
mates (Chan 1996), suggest that some 1000 million people
worldwide will be infected with this parasite, which can be
associated with considerable pathology especially in chil-
dren. Recently both the World Bank and World Health
Organization have supported the deworming of school age
children, however, such large-scale treatment programmes
are likely to have significant impact on the geohelmminth
parasite populations and may lead to the evolution of drug
resistance within such populations. T. trichiura is the most
resistant of the geohelminths to chemotherapy (Bennet &

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1182 Thursday, July 6, 2000 7:03 PM

1182 P R I M E R N O T E S

Guyatt 2000), which is likely, at least in part, to be due to its

Table 1 Characterization of six Trichuris trichiura microsatellite loci. The GenBank accession no., repeat structure, number of alleles, observed mean hetrozygosity (HO), expected

14

15

14

13

13
N
intracellular mode of attachment and feeding. Consequently
if drug resistance is to occur within the geohelminths

heterozygosity (HE), primer sequences, annealing temperature used (Ta), size in base pairs of the cloned allele and number of individuals sampled (N ) is presented for each locus
of humans then we are most likely to observe it first in

Size of cloned
T. trichiura populations.

allele (bp)
Surprisingly, little is known about the population genetic
structure of most nematode species. In the past isoenzymes,

240

182

367

189

103

188
mitochondrial variability, random amplified polymorphic DNA
(RAPD) and restriction length polymorphisms (RFLPs) have
all been used in investigations to rectify this situation. However,

Ta (°C)
all these techniques have disadvantages because either they
are limited due to a low degree of variability or there are

57

57

57

58

61

59
difficulties in reproducibility. Microsatellites offer substantial
allelic diversity in a large number of loci, are distributed
throughout the genome, inherited in a mendelian fashion, and

TTG CC
TGT G

ACT G
expressed codominantly. Their high variability makes them

TCG

TTT

CTA
GC
highly useful in genetic typing of individuals, population
studies and also for genetic mapping studies (Dietrich et al.

R: CGG TGC TCT CGT TCT TCG TTA

R: ATA ATT GGC CTT CAG TTC ACA

R: GCC AGA TTG TTT ACG CTC AGA

R: AGA TAT TGT TGT TTG TGA TGA

R: TCC ATC CTG CTC TGC CCT AAC

F: CCA CCC GGC CAA TAG GAC TGC

F: CAA TCA TGT TAA GTG ACC GAA

F: GAT CGT GCA ATA ACG ACA ACT

F: GGT CAG CTC CTT TGC CCT ACG

F: GGC GCT CCA ACT CAT CGT CA
1996). The isolation of microsatellite markers from the

Flanking primer sequences (5′–3′)

F: CCTAAGCCTAAGACTGAACATAAG
R: CAGCAACATTGGCCTCCGTAGTC
nematodes would thus provide tools with a higher resolv-
ing power than those currently available. In this study we
report on the first isolation of microsatellites from T. trichiura.
A library enriched for microsatellite repeats was prepared
using genomic DNA isolated from a pool of 100 T. trichiura
adults digested to give a range of DNA fragments between
300 and 700 bp in size. These were enriched for the presence
of CA dinucleoitide repeats and ligated into the PUC19 vector
using the method of Armour et al. (1994) and transfected into
Dh5α competent cells (Gibco). Following plating, clones were
picked at random and grown in LB medium containing 100 µg/
mL ampicillin overnight. DNA was isolated using miniprep
columns (Qiagen) and cycle sequenced in both direction
0.57

0.79

0.86

0.76

0.84

0.9
HE

using universal M13 primers, a BigDye dye-terminator kit

(Perkin Elmer), a PTC 200 DNA engine (MJ research) and
24 cycles of 96 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min
0.43

0.47

0.44

0.71

0.69

0.92
HO

according to the manufacturers’ protocol. The resulting sequences

were analysed using the DNAstar (Winstar) suite of pro-
grams. The clones isolated were found to contain all the
main types of microsatellites including perfect, imperfect,
No. of
allele

and composite repeats. Polymerase chain recation (PCR)

6

10

10

primer pairs were designed to the flanking regions of

microsatellites identified using the PrimerSelect program
(Winstar). One primer from each primer set was labelled
(GT)7(CT)2(GT)17
(CA)26(CG)5(CA)2

using [γ 33P]-ATP and T4 polynucleotide kinase according

Repeat motif

to the recommended protocol (New England Biolabs).

PCR reactions were set up using approx 20 – 40 ng DNA;
(CA)19

(TG)58

(TG)15

(CA)41

1× buffer (50mm KCL, 0.1% Triton X-100, 10 mm Tris-HC1,

pH 9.0); 1.5 mmol MgCl2, 200 µm dNTPs; 2.0 pmol of the
labelled and unlabelled primers; 0.25 units AmpliTaq GoldTM
DNA polymerase (PerkinElmer); the reaction volume
accession no.

was 20 µL. Amplification was carried out using a PTC 200

AF191284

AF191289

AF191258

AF191268

AF191270

AF191287
GenBank

DNA engine (MJ Research) using the following conditions;

94 °C for 8 mins, 1 cycle; 94 °C for 30 s; 59 °C for 60 s; 72 °C
for 60 s, repeated for 34 cycles; and then 94 °C for 30 s; 59 °C
for 60 s; 72 °C for 10 mins. The annealing temperature varied
according to the primers used (Table 1). Artificial stutter
TTLo14

TTLo15

TTLo34

TTLo41

TTLo49

bands caused by enzyme slippage during amplification were

TTLo 3
Locus

minimized by the use of a final 10 min incubation allowing

unambiguous allele designation. The resulting product was

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1183 Thursday, July 6, 2000 7:03 PM
analysed in 6% polyacrylamide gels and visualized by
autoradiography. Once conditions had been optimized vari-
ability was assessed using DNA isolated from 15 individual
worms collected from infected children in Jamaica. Alleles
were scored by length in base pairs.
Six out of the 17 loci isolated did not amplify using the
primers designed and a further five proved monomorphic.
The remaining six loci showed varying degrees of poly-
morphism with numbers of alleles ranging from 6 to 10. The
numbers of repeat units varied depending on locus from 15
to 58, however, the variability found appeared to be inde-
pendent of this. Observed heterozygosities (HO) varied from
0.43 (TTLo3) to 0.92 (TTLo49). In all loci the observed hetero-
zygosities were lower than the expected (HE) which may
reflect population subdivision in breeding or the presence of
null alleles. Microsatellites have been detected within other
nematodes but this is the first demonstration of their suitabil-
ity for studying the fine population genetic structure within
human species. We consider the understanding of such
structures to be critical if we are to understand the evolution-
ary processes acting on such populations and their ability to
respond to selection pressures such as chemotherapy.
Acknowledgements
We would like to thank the Wellcome Trust for funding this work
and Dr Ed Cooper (Tropical Metabolism Research Unit, Univer-
sity of West Indies, Jamaica) for kindly providing the worms.
References
Armour JAL, Neuman R, Gobert S, Jeffreys AJ (1994) Isolation
of human simple repeat loci by hybridization selection. Human
Molecular Genetics, 3, 599 – 565.
Bennet AB, Guyatt H (2000) Reducing Intestinal Nematode
Infection: Efficacy of Albendazole and Mebendazole. Parasitology
Today, 16, 71–77.
Chan M-S (1996) The global burden of intestinal nematode
infections-fifty years on. Parasitology Today, 13, 438–444.
Dietrich WF, Miller J, Steen R et al. (1996) A comprehensive genetic
map of the mouse genome. Nature, 380, 149–152.
9no issuenote
985
2000
PRIMER
Graphicraft
1184
1183
primer no.
NOTES
Limited, Hong Kong
Characterization of microsatellite loci in
the Australian Blacklip abalone (Haliotis
rubra, Leach)
B . E VA N S , * † ‡ R . W. G . W H I T E * and
N. G. ELLIOTT†
*School of Zoology, University of Tasmania, GPO Box 252–05, Hobart, Tasmania
7001, Australia, †CSIRO Marine Research, GPO Box 1538 Hobart, Tasmania 7001,
Australia, ‡Aquaculture CRC Ltd, PO BOX123, Broadway, NSW 2007, Australia
Keywords: abalone, aquaculture, genetic variation, Haliotis rubra,
microsatellites
Received 6 August 1999; revision accepted 22 January 2000
Correspondence: Brad Evans. Fax: +61 03 62325000; E-mail:
Brad.Evans@marine.csiro.au
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
P R I M E R N O T E S 1183
Abalone are gastropod molluscs of the genus Haliotis, a
commercially valuable food source. Wild stocks are harvested
throughout the world in temperate and tropical marine
systems by recreational and commercial fishers. The high
demand for abalone and the decline in many of the world’s
natural stocks has led to increasing aquaculture of this
genus, and a concurrent increase in the need for genetic
information. Haliotis rubra forms the basis of the world’s
largest wild abalone fishery. In south-eastern Australia it is the
subject of an expanding aquaculture industry. Polymorphic
microsatellite DNA markers in H. rubra are being developed
principally for population structure analysis and for pedigree
analysis, as well as future genetic mapping projects. Their
development will be beneficial to both wild fishery managers
and aquaculturists. We report here the isolation and charac-
terization of nine microsatellite loci in H. rubra.
A partial genomic DNA library was constructed from
DNA extracted from gill tissue of a single individual, using
a modified CTAB method (Grewe et al. 1993). DNA was
digested with Sau3A enzyme and the 500–700 bp fraction was
ligated into the dephosphorylated BamHI site of the vector
pGEM™-3Zf(+) (Promega) (Reilly et al. 1999). Ligated plas-
mids were transformed into XL-1 Blue Supercompetent cells
(Stratagene). Cells were plated onto selective media and
replicated onto uncharged nylon membrane filters (Boehringer
Mannheim).
This library was screened for microsatellite repeats with a
(CA)8RT probe. The probe was 3′ end-labelled with digoxy-
genin, and standard hybridization and wash conditions were
used (Boehringer Mannheim 1995). The nucleotide sequence
of 62 positive candidate clones was determined with ABI
Prism™ Dye Terminator Cycle Sequencing (Perkin Elmer)
using double-stranded plasmid DNA, prepared by the alkaline
lysis method (Sambrook et al. 1989). Sequencing products were
analysed on an ABI377 DNA autosequencer. Polymerase
chain reaction (PCR) primers were designed using the oligo®
computer software (Rychlick 1996), with one primer from
each pair labelled with a fluorescent dye. Primers are sum-
marized in Table 1.
PCR reactions were performed in a volume of 25 µL
consisting of 67 mm TrisHCl, pH 8.8; 16.6 mm (NH4)2SO4;
0.45% Triton X-100; 0.2 mg/mL gelatin; 2.5 mm MgCl2; 10
pmoles of each primer; 200 µm dNTPs; 0.5 U Taq F1 poly-
merase (Fisher Biotech); and ~ 20 ng genomic DNA template.
Amplification was in a Perkin Elmer 9600 thermocycler with
one cycle of 94 °C for 1 min, 52–58.5 °C for 15 s and 72 °C
for 1 min, followed by 30 cycles of 94 °C for 15 s, 50– 56.5 °C
for 15 s and 72 °C for 1 min. These cycles were followed by a
final extension step of 72 °C for 10 min. Amplification products
were initially visualized on 2% TBE agarose gels. They were
then diluted relative to amplification strength, mixed with
formamide, loading dye and Genescan Tamra 500 size standard
(ABI), denatured at 95 °C for 2 min, and loaded onto a
4% denaturing polyacrylamide gel. Samples were run on an
ABI377 DNA autosequencer and genotypes determined with
genotyper® software. Observed and expected heterozygo-
sity from at least 14 individuals are shown in Table 1.
The nine microsatellite markers retained for use exhibit
a range of variation. They will be used to examine stock
MEC954.fm Page 1184 Thursday, July 6, 2000 7:03 PM

1184 P R I M E R N O T E S

Table 1 Blacklip abalone (Haliotis rubra) microsatellite primer sequences, repeat descriptions, annealing temperatures (Ta) and expected
allele sizes. Observed (HO) and expected (HE) heterozygosity are shown for each locus, based on at least 14 individuals. The clone
sequences from which the primers were designed have GenBank accession nos AF194951–AF194954 and AF194956–AF194960

Primer sequence (5′–3′) Expected

Locus Repeat sequence (F-Forward, R-Reverse) n Ta °C HO HE Allele no. size (bp)

cmrHr1.11 (AC)15 F-ACTTTTTGATAGCCCCTC 14 50.0 0.43 0.41 2 172–176

R-GCTTAGATGAAAGCCTTAAC
cmrHr1.14 (GT)13TT(GT)2 F-CTACGTACACTTTAATGTGCTC 31 53.0 0.25 0.40 4 251–275
GA(GT)3 R-CTGCCTAAAAGTTCAATCC
cmrHr1.24 (AT)8 F-TCTAGCATGTCTGAGGGAGG 27 54.0 0.28 0.50 4 222 –228
R-TGTGTCATTGTGGTCGAAAG
cmrHr1.25 (CA)25(AT)6TT F-CATCTTGGCTGAACATTAC 14 54.0 0.14 0.83 9 291– 309
(AT)5(TG)3 R-AACGAACTCATTTCAGAGAC
cmrHr2.9 (GT)27 F-TAGCAGCCATAGGGTGGGTC 14 56.5 0.43 0.87 13 159 – 233
R-CTGAATGGGGCTAGCACAAT
cmrHr2.14 (GAGT)8 ... F-GTCCTCCAGTGAGACCCAAA 17 55.5 0.76 0.79 8 199 – 237
(GAGT)5 R-AGCATGGGTATTGTTGACTG
cmrHr2.26 (ATTC)5T4C F-TTCGGACTACAATCTGGAGGA 15 55.5 0.60 0.83 8 190 – 212
(ATTC)2 R-CAACCTCAAACCGCATCTTT
cmrHr2.30 (GT)6.. (GT)13 F-TTGGCAGTGATGGAAACTTG 16 55.5 0.60 0.90 16 284 – 328
(TG)12(AG)5 R-TTCCAAACTGACACAGACGC
.(TG)3. (TG)16
cmrHr2.36 (AC)21 F-CACCCTTTGGCATGAAAGAT 15 56.5 0.46 0.74 8 83 –121
R-ACCAACAGGGGCAGATACAG

structure of the blacklip abalone fishery, inbreeding levels Highly polymorphic microsatellite loci in
in hatcheries and parentage analysis in hatchery reared
abalone, a precursor to selective breeding programmes.
the Heron Reef population of the tropical
abalone Haliotis asinina
M A R I A J O H N P. S E LVA M A N I ,
Acknowledgements
S A N D I E M . D E G N A N , D AV I D PA E T K A U
This research was funded by the Aquaculture CRC Ltd, CSIRO and B E R N A R D M . D E G N A N
Marine Research and a small Australian Research Council grant.
We thank Bob Ward, Dan McGoldrick, Sharon Appleyard and Department of Zoology and Entomology, University of Queensland, Brisbane,
Peter Rothlisberg for comments on the manuscript. Queensland 4072, Australia

Keywords: abalone, Haliotis asinina, microsatellites

References Received 31 December 1999; revision accepted 31 January 2000

Boehringer Mannheim (1995) The DIG system User’s Guide for Correspondence: Bernard M Degnan. Fax: + 61 7-33658515; E-mail:
Filter Hybridisation. Boehringer Mannheim GmbH Biochemica, bdegnan@zoology.uq.edu.au
Mannheim, Germany. Abalone (family Haliotidae) are marine gastropods that are
Grewe PM, Krueger CC, Aquadro CF, Bermingham E, Kincaid HL,
commercially important in both fisheries and aquaculture. The
May B (1993) Mitochondrial DNA variation among lake
aquaculture industry is dominated by temperate species, but
trout (Salvelinus namaycush) strains stocked into Lake
both temperate and tropical species are harvested. One species
Ontario. Canadian Journal of Fisheries and Aquatic Sciences, 50,
distributed throughout coral reefs of the Indo-Pacific, Haliotis
2397–2403.
asinina, appears to be particularly well-suited for aquaculture
Reilly A, Elliott NG, Grewe PM, Clabby C, Powell R, Ward RD
(1999) Genetic differentiation between Tasmanian cultured (Counihan et al. 1998). As a first step towards understanding
Atlantic salmon (Salmo salar L.) and their ancestral Canadian the population structure and the molecular basis of quantitative
population: comparison of microsatellite DNA and allozyme traits such as growth of this tropical abalone, we have character-
and mitochondrial DNA variation. Aquaculture, 173, 457 – ized 11 microsatellite loci. Microsatellites provide a means for
467. identifying quantitative trait loci (QTL) and pedigrees (e.g.
Rychlick W (1996) OLIGO® Primer Analysis Software, Version 5.0 for Moore et al. 1999), allowing progeny to be identified from within
Macintosh. National Biosciences Inc., Plymouth, MN. the mixed family rearing environments (Herbinger et al. 1995)
Sambrook J, Fritsch EF, Maniatis T (eds) (1989) Molecular Cloning: that are typically employed in the culturing of abalone and
a Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory other shellfish. Identification of individual broodstock and
Press, New York. progeny greatly facilitates selective breeding in aquaculture.
982000 notes
981
PRIMER
Graphicraft
1186
1184
primer NOTES
Limited, Hong Kong

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

 MEC954.fm Page 1185 Thursday, July 6, 2000 7:03 PM
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

Table 1 Primer sequences and characteristics of 11 Haliotis asinina microsatellite loci

Locus (Accession no.) Repeat motif Primers (5′ to 3′) Tm (°C) No. of samples No. of alleles Size range HE P

Haµ2 (CA)10T(CA)3 2A:GGGCGAAAGGAGATAGAGGAAG 60 40 2 166–168 0.29 0.07

(G62416) 2B:CTCGGTGATGCTTCACAACGG
Haµ9 (CA)8CG(CA)4AA(CA)3 9A:CCACCCCCATCCCACCCCT 57 40 6 124–134 0.65 0.51
(G62417) 9B:TATTGCATCACCTACGAAAACAAA
Haµ10 (CA)10AA(CA)2(GA)6CA(GA)6 10A:CTAATTGCAGTTATGGGCGTTC 60 41 14 140–170 0.87 0.7
(G62418) 10B:AAGGCTTTCGGAGGACGTGTC
Haµ13 (CA)5AG(CA)11 13A:CTAATTGCAGTTATGGGGTTTTGG 57 41 25 128–182 0.96 0.6
(G62419) 13B:GCGGAGGAAGTACTATAACCAG
Haµ1M (CA)23 1MA:ATAATATACTCGTGAAGTTGATAG 50 37 17 94–136 0.92 0.97
(G62220) 1MB:TCATATACTTCATACATTACTCAT
Haµ2J (CA)21(CT)20 2JA:TGAGGTGTGTAGTTTGGAAGGA 55 35 14 235–265 0.91 0.003
(G62216) 2JB:CTCCCCTGGAAAATGCACATA
Haµ2K (CA)30 2KA:ATATGTTCGCCCTCGTAGGA 55 38 22 102–158 0.92 0.48
(G62221) 2kB:CCATGAGGTTTGTAAAATGGTG
Haµ2L (CA)12(AG)20 2LA:ACAATGCGACACAATGAACA 50 38 16 198–232 0.93 < 10–6
(G62217) 2LB:CCAACCTATGGAATCCTAGAAG
Haµ3C (CA)33 3CA:AAGTATGTGTGTAAAGGGTC 55 22 9 122–140 0.82 0.013
(G62219) 3CB:CAAGAAACTCAAGAGAAAAC
Haµ3D (CA)4(CG)3(CA)14 3DA:CCAACGTCACAGCCAGAAG 55 21 16 192–238 0.93 0.44
(G62222) 3DB:CCGACCATAATGTAAATATAAC
Haµ3E (CA)6TA(CA)5TA(CA)2TACATA 3EA:TCACTGAAATAACCATGCATTC 55 40 12 186–230 0.77 0.97
(G62218) (CA)4TA(CA)4TA(CA)4TACACATA 3EB:GTAACTGATTTGGCATATTCGT
(CA)4TACATA(CA)5TA(CA)6TA(CA)7(TA)2

P R I M E R N O T E S 1185
Tm, optimum annealing temperature; HE, expected heterozygosity; P, probability test for heterozygote deficiency using genepop 3.1c (Rousset & Raymond 1995).
MEC954.fm Page 1186 Thursday, July 6, 2000 7:03 PM
1186 P R I M E R N O T E S
Abalone samples (foot tissue) were collected at Heron Reef
(23°27′ S; 151°55′ Ε) and stored at – 20 °C in 20% solution of
dimethyl sulfoxide saturated with NaCl. DNA was isolated
by homogenizing approximately 5 mg of tissue in 400 µL of
1× SSC, 1.1% SDS and 0.5 mg/mL Proteinase K and incubated
at 55 °C overnight. Four hundred µL of 5 m NaCl and then
4 µL of methylene chloride:isoamyl alcohol (24:1; MC:IA)
were mixed into the homogenate. This solution was placed
at 4 °C for 1 h, and centrifuged at 2000 g for 5 min and then
6000 g for 10 min. The supernatant was mixed with an equal
volume of MC:IA and centrifuged at 6000 g for 10 min. DNA
was precipitated from the supernatant with two volumes of
100% cold ethanol and redissolved in 50 µL of 10 mm Tris-
HCl, pH 7.6 and 1 mm EDTA.
A 300 – 600 bp partial genomic library, constructed in M13mp18
with DNA isolated from the sperm of a single male as described
in Degnan & Lavin (1995), was screened for dinucleotide micro-
satellites (CA)n, using an enrichment technique described
by Paetkau (1999). Forty-seven microsatellite-containing clones
were isolated and sequenced with a M13 forward primer
(5′CGCCACCCTTTTCCCAGTCACGAC-3′), using an Applied
Biosystems (ABI) Prism Ready Reaction Dye Cycle Sequenc-
ing kit on an ABI 373 Automated Sequencer. Twenty-one
clones contained promising microsatellite motifs. These were
sequenced in the opposite direction using a M13 reverse
primer (5′AGCGGATAACAATTTCACACAGGA-3′). Forward
and reverse sequences were aligned and the consensus sequence
was determined. The oligonucleotide primers were designed
using the program oligo™ version 4.0 (National Biosciences
Inc.). Of the 15 microsatellite loci for which primers were
designed, 11 loci were consistently amplified by polymerase
chain reaction (PCR). These were evaluated for their variabil-
ity in Heron Reef population. For fluorescent detection of the
PCR products, the A primer in each pair was labelled with
either HEX, TET or FAM dyes (Table 1; PE-ABI). The micro-
satellite loci were amplified from approximately 50 ng of
DNA in a 15-µL reaction containing 10 mm Tris-HCl pH 8.8,
0.1% Triton-X-100, 50 mm KCl, 2 mm MgCl2, 0.16 mg/mL
BSA, 0.2 mm dNTPs, 0.1 µm fluorescently labelled primer,
0.25 µm unlabelled primer and 0.75 units Taq DNA poly-
merase (Perkin-Elmer). The amplification was carried out in a
Geneamp PCR system 9700 thermal cycler (Perkin-Elmer)
using a touchdown protocol (Don et al. 1991). After an initial
denaturing at 94 °C for 3 min, there were six cycles of 20 s at
94 °C, 25 s at 5 °C above the annealing temperature (Table 1),
with 1 °C reduction with each cycle, and 10 s of extension at
72 °C. This was followed by 25 cycles of 20 s at 94 °C, 25 s at
the annealing temperature and 5 s at 72 °C extension. The
PCR products were electrophoresed in 6% polyacrylamide
gel on the ABI 373 sequencer, and analysed using genescan
and genotyper software programs (Applied Biosystems).
All 11 microsatellite loci were polymorphic in the Heron
Reef population (Table 1). Between 21– 41 H. asinina samples
were analysed and all primers amplified products of the
predicted size. The level of allelic variability for all except
two loci was high, with the number of alleles ranging from
2 to 25 per locus and the expected heterozygosity between
0.29 and 0.96 (Table 1). At two loci (Haµ2J and Haµ2L) there
were significant heterozygote deficiencies (Table 1) after a
Bonferroni correction (Rice 1989), suggesting that null alleles
may be present at these loci. The polymorphism exhibited at
the H. asinina microsatellite loci indicated that they would be
useful in pedigree, QTL and population analyses.
Acknowledgements
We thank the staff at Heron Island Research Station, Liz O’Brien,
Regina Counihan, Kathy Townsend and Dan Jackson for their
assistance in collecting abalone samples, and Sandy Keys for
technical assistance. This work was supported by Australian
Research Council grants to SMD and BMD.
References
Counihan RT, Preston N, Degnan BM (1998) The tropical abalone
Haliotis asinina as a model species to investigate the molecular
and cellular mechanisms controlling growth in abalone. In: Recent
Advances in Marine Biotechnology (eds Le Gal Y, Halvorson H),
pp. 135–140. Plenum Press, New York.
Degnan BM, Lavin MF (1995) Highly repetitive DNA sequences
provide evidence for a lack of gene flow between two morpho-
logical forms of Herdmania momus (Ascidiacea; Stolidobrachia).
Marine Biology, 124, 293–299.
Don RH, Cox PT, Wainright BT, Baker K, Mattick JS (1991)
‘Touchdown’ PCR to circumvent spurious priming during gene
amplification. Nucleic Acids Research, 19, 4008.
Herbinger CM, Doyle RW, Pitman ER et al. (1995) DNA fingerprint
based analysis of paternal and maternal effects on offspring
growth and survival in communally reared rainbow trout.
Aquaculture, 137, 245–256.
Moore SS, Whan V, Davis GP et al. (1999) The development and
application of genetic markers for the kuruma prawn Penaeus
japonicus. Aquaculture, 173, 19–32.
Paetkau D (1999) Microsatellites obtained using strand extension:
an enrichment protocol. Biotechniques, 26, 690 – 697.
Rice WR (1989) Analysing tables of statistical tests. Evolution, 43,
223–225.
Rousset F, Raymond M (1995) Testing heterozygote excess and
deficiency. Genetics, 140, 1413–1419.
982000 notes
979
PRIMER
Graphicraft
1187
1186
primer NOTES
Limited, Hong Kong
Isolation and characterization of
microsatellite loci from the Japanese red
pine, Pinus densiflora
C . L I A N , M . M I WA and T. H O G E T S U
Asian Natural Environmental Science Center, the University of Tokyo,
Midori-cho 1–1-8, Tanashi, Tokyo 188–0002, Japan
Keywords: microsatellite, Pinus densiflora, reproduction
Received 30 January 2000; revision received 2 March 2000; accepted 17 March
2000
Correspondence: C. Lian. Fax: + 81–424–65 – 5601; E-mail:
lian@uf.a.u-tokyo.ac.jp
Japanese red pine (Pinus densiflora Sieb. et Zucc.) is one of main
tree species in Japan. In recent years, the species has been
severely damaged by pine wood nematodes, and the distribu-
tion area has been gradually decreasing. In order to protect and
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
MEC954.fm Page 1187 Thursday, July 6, 2000 7:03 PM

P R I M E R N O T E S 1187

Table 1 Characteristics of six microsatellites isolated from Pinus densiflora (n = 36 individuals)

Size range No. of GenBank

Locus Repeat Primer sequence (5′– 3′) Ta (°C) (bp) alleles HO HE accession no.

Pde3† (AC)12AAA(AC)15AAAA(CG)3 GTTGATACAATCATTGTTGTAACAC 52 175–258 13 0.52* 0.773 AB038257

(AC)6AAA(AC)12AAA(AC)10 CAAATATTTATATTCCCCTACGTG
Pde5 (CA)5C(CA)51 AACGCACCTTTCTCAATGCAC 56 116–235 18 1.00 0.928 AB038258
ATAAAGAGGCTACATGGTCCC
Pde6 (CA)8 AATGTAATCCCTTAGCACCTT 52 139–143 3 0.50 0.398 AB038259
TTCTTTGTGCATTGAGAAAGG
Pde7‡ (CA)25TA(CA)10 TTGAGTGAGAGGACTCTAGGC 57 133–200 9 0.36* 0.751 AB038260
AGGTAGACCCTATGGCGGATG
Pdel3§ (CA)30 AATATTCCTAACGACCCTATC 53 183–211 8 0.25* 0.837 AB038261
TGTTTCTATATGCATGTATGAGTC
Pde14 (TC)18(AC)14 TCATAGGTACAAAGTCATTACACC 55 182–236 16 0.81 0.886 AB038262
CTTCCCCACTTGACTTGAAGT

Ta, annealing temperature; HE, expected heterozygosity; HO, observed heterozygosity; *indicates significant deviation from Hardy–
Weinberg equilibrium (P < 0.005); †,‡,§ no amplification occurred in 3, 3, 24 individuals, respectively. HE and HO for Pde3, Pde7 and
Pde13 were calculated only among individuals amplifying at least one allele.

preserve forests of this species, it may be indispensable to
know how P. densiflora is reproduced in nature. In this paper
and as a first step to investigate the reproduction behaviour
of P. densiflora, polymorphic microsatellite markers were
developed.
Microsatellite isolation was performed after an enrichment
method (Edwards et al. 1996) modified by Miwa et al. (2000).
Total DNA was extracted from fresh leaves of P. densiflora with
a modified cetyltrimethylammonium bromide (CTAB)
method (Zhou et al. 1999), and digested with either BamHI,
EcoRI, EcoRV, XbaI or XhoI restriction enzyme. Fragments
produced by the above restriction digestion, except for EcoRV
which directly made blunted ends, were blunted by a DNA
Blunting Kit (Takara Shuzo Co.) and subsequently ligated
with an EcoRI/NotI/BamHI adaptor by a DNA Ligation
Kit (Takara Shuzo Co.). The adaptor-ligated fragments
were then amplified by polymerase chain reaction (PCR).
Microsatellite-containing fragments were selected by hybrid-
ization to nylon filter membrane (Hybond N+, Amersham)
to which a combination of different oligonucleotides were
attached. Two combinations of oligonucleotides were used,
namely (GT)15, (AT)15, (GA)15 and (GC)15, and (GCC)10, (CAA)10,
(AGA)10 and (CTG)10, respectively. Selected fragments were
ligated into pT7 Blue vectors and the plasmids were trans-
formed into Escherichia coli, XL1-Blue MRF’ strain. Plasmid
DNA extracted from positive clones were sequenced by a
Thermo Sequenase Pre-mixed Cycle Sequencing Kit (Hitachi
Instruments Service Co., Tokyo) using the T7 primer labelled
with Texas Red (Hitachi Instruments Service Co., Tokyo),
and the products were detected with a SQ-5500L sequencer
(Hitachi Co., Tokyo). Primer pairs were designed from flank-
ing sequences of microsatellites.
To investigate characteristics of amplified microsatellite
loci, template DNA was extracted from fresh leaves of 36
P. densiflora individuals growing in the experimental station
at Tanashi, the University of Tokyo. The PCRs were carried out
by a PCR Thermal cycler (TP3000 Takara Shuzo Co., Tokyo)
in a reaction mixture (10 µL) containing 20 ng of template
DNA, 0.4 mm of each dNTP, 0.5 µm of each designed primer
pair of which the reverse primer was labelled with Texas Red,
2 × GC buffer I containing 2.5 mm of Mg2+ (Takara Shuzo Co.,
Ingredients are unopened), and 0.5 U of LA Taq DNA polymer-
ase (Takara Shuzo Co.). The PCR condition was as follows: 29
cycles of 1 min at 94 °C, 1 min at annealing temperature of each
primer pair and 1 min at 72 °C, followed by 1 cycle of 1 min at
94 °C, 1 min at annealing temperature of each primer pair and
5 min at 72 °C. The reaction products were electrophoresed on
a 6% Long Ranger sequencing gel (FMC BioProducts Co., ME,
USA) using a SQ-5500 sequencer (Hitachi Co., Tokyo). Elec-
trophoretic patterns were analysed with a software fraglys
version 2 (Hitachi Electronics Engineering Co., Tokyo).
Of the 14 designed primer pairs, nine yielded PCR pro-
ducts, of which six were single-locused and codominant.
Alleles produced by six single-locused markers ranged from
3 to 18 per locus and the expected heterozygosities were
calculated as values from 0.398 to 0.928 (Table 1). The average
number of alleles per locus for the six markers was 11.2,
which is much greater than the value of 3.8 obtained by an
isozyme analysis in P. densiflora (Na’iem et al. 1989). Significant
heterozygote deficiencies were detected at locus Pde3, Pde7,
and Pde13 using the χ2 goodness-of-fit tests to Hardy–
Weinberg equilibrium. No band was observed in several
individuals for Pde3, Pde7 and Pde13, suggesting the presence
of null alleles. Thus, this heterozygote deficiency might result
from the presence of null alleles (Pemberton et al. 1995).
The six polymorphic loci were also tested for amplification
in 12 other pine species (Table 2). In P. densiflora form. Umbra.
and P. massoniana, all of six microsatellite loci were amplified.
In P. bungeana, P. rigida, P. koraiensis, and P. strobus, no amplified
products were detected for any locus. The result suggests
that the microsatellite markers developed from P. densiflora
would probably work as well in some other pine species.
Some reproductive characteristics in P. densiflora such as
the self-fertilization rate and the pollen dispersal distance are

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1188 Thursday, July 6, 2000 7:03 PM

1188 P R I M E R N O T E S

Table 2 PCR-amplification by six poly-

Locus morphic microsatellite markers from Pinus
densiflora in different pine species
Species* Pde3 Pde5 Pde6 Pde7 Pde13 Pde14

P. densiflora form. Umbra. + + + + + +

P. banksiana + + + + + –
P. tabulaeformis + + + + – +
P. thunbergii + + + + – +
P. massoniana + + + + + +
P. caribaea + – + – – –
P. echinata – – + – – –
P. palustris – + + + – –
P. bungeana – – – – – –
P. rigida – – – – – –
R koraiensis – – – – – –
P. strobus – – – – – –

‘+’, amplification; ‘–’, no amplification; *one sample of each species was tested.

under investigation using the developed codominant micro- *Laboratory of Forest Ecology and Physiology, Graduate School of Bioagricultural
satellite markers. Sciences, Nagoya University, Nagoya 464–8601, Japan, †Bio-resources
Technology Division, Forestry and Forest Products Research Institute, Kukizaki,
Ibaraki 305–8687, Japan, ‡Silviculture Division, Hokkaido Research Center,
Acknowledgements Forestry and Forest Products Research Institute, Sapporo 062 – 8516, Japan

This work was supported in part by a grant from PROBRAIN
and a Grant-in-Aid (Nos. 11556027) from the Ministry of Educa-
tion, Science, Sports and Culture of Japan. We would like to
thank the staff of Experimental Station at Tanashi, the University
of Tokyo, for their help in sampling.
Keywords: Castanopsis cuspidata, forest dynamics, microsatellite, population
genetics
Received 10 February 2000; revision accepted 18 March 2000
Correspondence: Saneyoshi Ueno. Fax: + 81 – 52 – 789 – 5014; E-mail:
i981203d@mbox.media.nagoya-u.ac.jp

Microsatellite markers have been characterized in many plant

References
Edwards KJ, Barker JHA, Daly A, Jones C, Karp A (1996) Micros-
atellite libraries enriched for several microsatellite sequences
in plants. Biotechniques, 20, 758 –760.
Miwa M, Tanaka R, Shinone M, Kojima K, Hogetsu T (2000)
Development of polymorphic microsatellite markers in a tropical
tree species, Melaleuca cajuputi (Myrtaceae). Molecular Ecology,
9, 639 – 640.
Na‘iem M, Tsumura Y, Uchida K et al. (1989) Inheritance of iso-
zyme variants of megagametophyte in Japanese red pine. Jour-
nal of the Japanese Forestry Society, 71, 425–434.
Pemberton JM, Slate J, Bancroft DR, Barrett JA (1995) Nonamplify-
ing alleles at microsatellite loci: a coution for parentage and
population studies. Molecular Ecology, 4, 249–252.
Zhou Z, Miwa M, Hogetsu T (1999) Analysis of genetic structure
of a Suillus grevillei population in a Larix kaempferi stand by
polymorphism of inter-simple sequence repeat (ISSR). New
Phytologist, 144, 55 – 63.
982000 notes
978
PRIMER
Graphicraft
1189
1187
primer NOTES
Limited, Hong Kong
Isolation of microsatellite markers in
Castanopsis cuspidata var. sieboldii Nakai
from an enriched library
S. UENO,* H. YOSHIMARU,†
T. K AWA H A R A ‡ and S . YA M A M O T O *
species recently, and increasingly used for studies of genetic
diversity, gene flow and conservation of natural plant popu-
lations (Dow & Ashley 1996; Streiff et al. 1998; Ueno et al. 2000).
Their sensitivity to polymorphism and ease of use make
microsatellites attractive, especially for surveying large
numbers of individuals.
Castanopsis cuspidata is a major canopy tree species in
evergreen forests and its ecological characteristics, such as
regeneration regimes and demography, have been intensively
studied in an old-growth evergreen forest in Tsushima, Japan,
in relation to forest dynamics (Yamamoto 1992; Yamamoto
1996). Our interests are now focused upon its genetic diversity,
structure and assessment of its pollen and seed dispersal
through parentage analysis with microsatellites. In this paper
we have developed seven polymorphic microsatellite markers
in C. cuspicata.
A modification of the enrichment protocol of Kijas et al.
(1994), was used for this purpose, exploiting the nonradio-
active nucleic acid labelling and detection (DIG) system
(Boehringer). Genomic DNA of C. cuspidata was extracted
by a modified cetyltrimethylammonium bromide (CTAB)
method (Murray & Thompson 1980), digested with NdeII
and 300–1000 bp fragments were isolated by electrophoresis.
The fragments (≈ 500 ng) were ligated to Sau3AI cassettes
(TaKaRa, 5 pmol). After healing the nick between the
genomic DNA and the cassette sequence, the DNA was
amplified by polymerase chain reaction (PCR) with Primer C1

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1189 Thursday, July 6, 2000 7:03 PM

P R I M E R N O T E S 1189

Table 1 Seven polymorphic microsatellite loci in Castanopsis cuspidata. Motifs and PCR product sizes refer to sequenced alleles. Thirty-
two individuals were genotyped. DDBJ accession numbers are listed under the respective loci

Locus PCR product No. of

designation Primer Sequence Motif Ta (°C) size (bp) alleles HO HE

Ccu16H15 F:CTGCCTATCCCCCTCTACTTT (TC)16 60 136 6 0.81 0.72

(AB037690) R:AAGCCCGTACAATTATATGAATGA
Ccu17F15 F:AATTTCAATTAATAAAGACCA (TC)34 52 138 23 0.84 0.93
(AB037691) R:GGAGCATTATAGGGTAGATT
Ccu22F30 F:AGCAGCTTTGTCTAACCACCTAT (TC)31 65 276 13 0.75 0.87
(AB037692) R:CGTCGCATTCATTTTCATTC
Ccu28H18 F:ACGGATTGAAACCAGACAGAAGA (CT)26 65 140 10 0.5 0.86
(AB037693) R:CAGGTGGTGGCGATGAGATT
Ccu33H25 F:GGGTTTGGGTGGAGAAGTC (TG)11(TC)15 67 197 10 0.84 0.85
(AB037694) R:GATCGGTACAACCCCTCACT
Ccu5F45 F:ACGGCTCTGATACCACTTG (CT)40 45 353 21 0.97 0.93
(AB037695) R:TCCCATATTCTACATTTCTCTTTG
Ccu9T20 F:GATCAGATAACATTCCTCTTTA (TC)27 45 183 14 0.97 0.89
(AB037696) R:TCGCACAGGTATTTCTCT

Ta, annealing temperature; HO, observed heterozygosity; HE, expected heterozygosity.

F, forward primer; R, reverse primer.

(TaKaRa), which anneals to part of the cassettes, under the
following conditions: 3 min at 95 °C; 30 cycles of 1 min
at 95 °C, 1 min at 55 °C, 2 min at 72 °C; 5 min at 72 °C. The
PCR products were heat-denatured for 5 min and hybrid-
ized to 100 pmol of 5′ digoxigenin-labelled oligonucloetide
probes (5′DIG(CT)203′) in 200 µL of binding buffer (10 mm
Tris-HCl, 1 mm EDTA, 100 mm NaCl, pH 7.5). Prewashed
anti-digoxigenin magnetic particles (Boehringer) were
added (1 mg) to capture DIG-labelled probes with target
DNA by incubation at room temperature for 30 min with
gentle pipetting. Microsatellite-containing sequences were
recovered by resuspending the particles in elution buffer
(6 m Guanidine-HCl) and purified using a MicroSpin S-
400 column (Pharmacia). Double-stranded conformation was
reformed by PCR and the products were digested with
Sau3AI to remove the cassettes, ligated into pUC18/BamHI
(Pharmacia) and cloned into competent cells. Recombinants
were transferred to Hybond N + membranes and screened by
colony hybridization with the same probes as above. Positive
clones were PCR-amplified and sequenced with the BigDye
Terminator and 377 DNA sequencers (Perkin-Elmer). Primer
pairs were designed using the oligo computer program
(National Biosciences). After PCR optimization, successful
forward primers were fluorescently labelled, and products
were amplified in 7.5 µL reaction mixtures containing 10 mm
Tris-HCl pH 8.3, 50 mm KCl, 100 mm dNTP, 0.02% Triton
X-100 and 0.01% gelatin, 1.5 mm MgCl2, 0.225 U Taq DNA
Polymerase (GIBCO BRL), 0.1–0.2 µm of each primer and
7.5 ng of template DNA, using a 9600 thermal cycler (Perkin-
Elmer) with the following conditions: 3 min at 94 °C; 30
cycles of 30 s at 94 °C, 15 – 40 s at the primer-specific anneal-
ing temperature, 0 – 40 s at 72 °C. The PCR products were
separated on a Perkin-Elmer 310 Genetic Analyser in GeneS-
can mode.
Transformation yielded approximately 10 000 recombinants.
Among these, 500 clones were screened, yielding 204 positives,
of which 135 were sequenced, resulting in 69 microsatellite
sequences suitable for primer design. Twenty-seven primer
pairs were designed, seven of which showed single-locus
polymorphism. For these loci, 32 C. cuspidata individuals
from our study site were genotyped. Each locus was highly
polymorphic, with 6 – 23 alleles per locus, and observed
heterozygosities of 0.5 – 0.97 (Table 1). Significant departures
from Hardy–Weinberg equilibrium were tested following Li
& Horvitz (1953). Heterozygote deficiency was found at
locus Ccu28H18, indicating that null alleles might exist.
We hope that these markers will be useful in molecular
ecological studies.
Acknowledgements
Financial support was provided by a Grant-in-Aid for Scientific
Research (10354013, 11460069) from the Ministry of Education,
Science, Sports and Culture of Japan. We thank H. Iwata,
C. Yamanaka, K. Yoshimura and T. Sugaya for help in the labor-
atory and M. Miura and T. Fujita for collecting samples.
References
Dow BD, Ashley MV (1996) Microsatellite analysis of seed dispersal
and parentage of saplings in bur oak, Quercus macrocarpa.
Molecular Ecology, 5, 615–627.
Kijas JM, Fowler JC, Garbett CA, Thomas MR (1994) Enrichment
of microsatellites from the citrus genome using biotinylated
oligonucleotide sequences bound to streptavidin-coated
magnetic particles. Biotechniques, 16 (656 – 60), 662.
Li CC, Horvitz DG (1953) Some methods of estimating the inbreed-
ing coefficient. American Journal of Human Genetics, 5, 107–117.

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1190 Thursday, July 6, 2000 7:03 PM

1190 P R I M E R N O T E S

Murray MG, Thompson WF (1980) Rapid isolation of high molecu-
lar weight plant DNA. Nucleic Acids Research, 8, 4321–4325.
Streiff R, Labbe T, Bacilieri R et al. (1998) Within-population
genetic structure in Quercus robur L. & Quercus petraea (Matt.)
Liebl. assessed with isozymes and microsatelllites. Molecular
Ecology, 7, 317 – 328.
Ueno S, Tomaru N, Yoshimaru H, Manabe T, Yamamoto S (2000)
Genetic structure of Camellia Japonica L. in an old-growth ever-
green forest, Tsushima, Japan. Molecular Ecology, 9, 647–656.
Yamamoto S (1992) Gap characteristics and gap regeneration in
primary evergreen broad-leaved forests of western Japan.
Botanical Magazine, Tokyo, 105, 29 – 45.
Yamamoto S (1996) Gap regeneration of major tree species in
different forest types of Japan. Vegetatio, 127, 203–213.
982000 notes
987
PRIMER
Graphicraft
1191
1190
primer NOTES
Limited, Hong Kong
Microsatellite markers for the
ectomycorrhizal basidiomycete
Rhizopogon vinicolor
ANNETTE M. KRETZER,* RANDY MOLINA†
and J O S E P H W. S PATA F O R A *
*Oregon State University, Department of Botany and Plant Pathology, 2082
Cordley Hall, Corvallis OR 97331–2902, USA, †USDA Forest Service Pacific
North-west Research Station, 2300 SW Jefferson Way, Corvallis OR 97331,
USA
Keywords: ectomycorrhizae, microsatellite loci, Rhizopogon
Received 24 January 2000; revision accepted 2 February 2000
Correspondence: A. Kretzer. Fax: + 1541 7373573; E-mail:
kretzera@bcc.orst.edu
Rhizopogon vinicolor is a false-truffle in the Boletales (Basidio-
mycota) and is a common ectomycorrhizal (EM) symbiont
of Douglas-fir (Pseudotsuga menziesii) in the Pacific north-
west of America (Molina et al. 1999). The ectomycorrhizae are
tuberculate which means that they grow in dense clusters
that are surrounded by a weft of darkly pigmented hyphae
(Zak 1971). While much research has been conducted on
population structure of fungal pathogens (McDonald 1997),
knowledge on population structure of EM fungi is sparse,
and most work has focused primarily on the size and distribu-
tion of genets (e.g. Dahlberg & Stenlid 1995). In this paper
we describe the development of microsatellite markers for
the EM basidiomycete R. vinicolor. Although R. vinicolor
forms fruit-bodies below ground that are difficult to sample,
R. vinicolor provides a number of advantages for population
studies: (i) the tuberculate mycorrhizae are morphologically
very distinct and provide ample material for DNA extraction
and amplification; (ii) Rhizopogon species grow readily in
culture; and (iii) they form mycorrhizae from either mycelia
or spores under greenhouse conditions (Molina et al. 1999).
R. vinicolor (collection no. T20787) was grown on modified
Melin-NorKran’s (MMN) medium, and genomic DNA was
extracted from freeze dried mycelium using the method described
below. Genomic DNA was subsequently digested with Sau3AI,
and fragments in the 500 – 1000 bp size range were ligated into
the BamHI restriction site of pUC19 and cloned in Escherichia
coli DH5. Transformants were detected on LBAmp+X-Gal plates.
White colonies were transferred to LBAmp master plates and
from there to Ny+ membranes (Millipore). Screening for mic-
rosatellite sequences was performed using the AlkPhosDIRECT
labelling and detection kit (Amersham Life Science) and two
oligonucleotide probes, (CAC)13 and (CGA)13, simultaneously
at a hybridization temperature of 57.5 °C. Inserts of positive
clones were amplified and sequenced with vector specific M13
forward and reverse primers. Nucleotide sequences were

Table 1 Microsatellite loci characterized from Rhizopogon vinicolor

GenBank No. of alleles Called sizes‡

Locus Repeat* accession no Primer sequence† (5′–3′) observed (bp) HO HE§

Rv02 (CAC)7 AF154076 ‘F’GTGAAACTGTTCAACGCACG 6 296.6– 311.0 0.47 0.76

GTAACTCGTGCTCTTCATCG
Rv15 (CAC)11 AF154077 ‘F’TCCACCTATCCACCTATTCG 4 274.5– 287.8 0.37 0.43
AACGTAGACCCAACATAAGAC
Rv25 (CGA)6 AF221518 AGCACCCGGAATGTTGAGG 2 245.4– 248.5 0.05 0.05
‘H’GGCTATTACAGTGGTCAATGTC
Rv35 (CAC)6 AF221519 CGTGCAGCCCGAATCTC 4 285.8– 303.8 0.61 0.56
‘H’GATCCATTCTGAGATGCTCC
Rv46 (CCG)5(CCA)6 AF154078 CATCTGGTCTAGTGCTGACTGC 4 241.4– 250.3 0.74 0.66
‘H’CTCGGCAGCAGAAACCTCAGG
Rv53 (CGA)6N24(CGA)4 AF154079 ‘F’GTTGCGTGGGAAGTCATTC 5 251.9– 263.5¶ 0.58 0.76
GGTACAGGGAATGCTTCG

*sequence motif found in R. vinicolor T20787; †‘H’ = HEX dye, ‘F’ = fluorescein; ‡fragment sizes as determined by the ABI genescan
software are highly reproducible due to the internal size standard run in every lane, but they are relative rather than absolute and
commonly include fractions of a basepair; §HE = 1 − ΣP i , with Pi = frequency of allele i.
2

¶An additional band of approx. 550 bp was often seen on agarose gels. This band was apparently the result of self-annealing of one
of the amplified strands since the band could be re-amplified using the (GTTGCGTGGGAAGTCATTC)-primer without the
(GGTACAGGGAATGCTTCG)-primer. Production of the 550 bp band from R. vinicolor extracts could be prevented by reducing
the concentration of the former PCR-primer 5–10 fold.

© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

MEC954.fm Page 1191 Thursday, July 6, 2000 7:03 PM
determined using the BigDye Terminator sequencing kit and
an ABI 373 automated sequencer (PE Applied Biosystems).
Sequences flanking individual microsatellite repeats were
used to design locus-specific polymerase chain reaction (PCR)
primers, and one primer per locus was synthesized with a
fluorescent dye at the 5′-prime end (Operon Technologies).
Primers were tested on DNA extracted from various collec-
tions of R. vinicolor as follows: dried tissue was ground in
cetyltrimethylammonium bromide (CTAB) buffer (100 mm Tris
pH 8 – 9, 1.4 m NaCl, 20 mm EDTA, 2% CTAB) followed by
three cycles of freezing and thawing. The material was sub-
sequently incubated at 65 °C for 1–2 h followed by chloro-
form extraction. The clear supernatant was transferred to a new
tube, and DNA was further purified using the GeneClean III
kit (BIO 101). PCR contained 1 × MasterAmp premix E
(Epicentre Technologies), 0.5 µm each of two locus-specific
primers, empirical amounts of genomic DNA, and 50 U/mL
Taq polymerase (various suppliers) in a 10-µL volume.
Thermal cycling was performed on a PTC-100 Program-
mable Thermal Controller (MJ Research Inc.) under the
following conditions: 2 min at 93 °C, 40 – 45 cycles of (45 s at
93 °C, 30 s at 60 °C, and 30 s at 72 °C), 1 h at 72 °C. Presence
of PCR products was verified on agarose gels stained with
ethidium bromide, and appropriate dilutions were analysed
on an ABI 377 automated sequencer using the ‘GS500 Tamra’
internal size standard. Band sizes were called using the
genescan software (PE Applied Biosystems).
Under the conditions described above, none of the primer
pairs given in Table 1 were found to amplify DNA from
Pseudotsuga menziesii which is the only known EM host of R.
vinicolor (Massicotte et al. 1994). Consequently, both fruit-bodies
as well as EM samples were used in the subsequent screening
process. The species identity of all fungal samples was con-
firmed by restriction fragment length polymorphisms of the
internal transcribed spacer region of the nuclear ribosomal
repeat (ITS-RFLPs) as has been described by Gardes & Bruns
(1996). In short, the ITS-region was amplified using fungus-
specific PCR primers and subsequently digested with the
restriction enzymes AluI and HinfI.
Allelic diversity was assessed across 19 collections which
represented 19 distinct genets as evidenced by the microsatel-
lite markers described here (n = 19). All collections originated
from various locations in Oregon with the exception of
R. vinicolor T20787 which had been collected in Idaho. Six
microsatellite loci given in Table 1 were found to be both
polymorphic and fairly unambiguous to score. The observed
numbers of alleles ranged from 2 to 6, and expected and
observed heterozygosities ranged from 0.05 to 0.76. In sum-
mary, polymorphic microsatellite markers presented here
should prove useful for studying the distribution of genets
as well as population structure at different spatial scales in
R. vinicolor. Furthermore, since the primers do not amplify
any DNA from the plant host P. menziesii, they will allow
us to investigate fungal population structure from EM roots.
Acknowledgements
The authors thank Nancy Adair and Caprice Rosato for running
countless sequencing and GeneScan gels, and Susie Dunham
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
P R I M E R N O T E S 1191
and Adam Jones for critical proof-reading of the manuscript.
This work was supported by joint venture agreement no. PNW-
98–5113–1JVA from the USDA Forest Service Pacific North-west
Research Station.
References
Dahlberg A, Stenlid J (1995) Spatiotemporal patterns in ectomy-
corrhizal populations. Canadian Journal of Botany, 73, S1222 –
S1230.
Gardes M, Bruns TD (1996) ITS-RFLP matching for identification
of fungi. Methods in Molecular Biology, 50, 177 – 186.
Massicotte HB, Molina R, Luoma DL, Smith JE (1994) Biology of the
ectomycorrhizal genus, Rhizopogon: II. Patterns of host-fungus
specificity following spore inoculation of diverse hosts grown in
monoculture and dual culture. New Phytologist, 126, 677 – 690.
McDonald BA (1997) The population genetics of fungi: tools and
techniques. Phytopathology, 87, 448–453.
Molina R, Trappe JM, Grubisha LC, Spatafora JW (1999) Rhizopogon.
In: Ectomycorrhizal Fungi: Key Genera in Profile (eds Cairney JWG,
Chambers SM), pp. 129–161. Springer Verlag, Heidelberg.
Zak B (1971) Characterization and classification of mycorrhizas
of Douglas-fir. II Pseudotsuga menziesii + Rhizopogon vinicolor.
Canadian Journal of Botany, 49, 1079–1048.
982000 notes
992
PRIMER
Graphicraft
1193
1191
primer NOTES
Limited, Hong Kong
Highly polymorphic microsatellite
markers in the landsnail Helix aspersa
(Mollusca Gastropoda)
A . G U I L L E R , * J . - F. A R N A U D * , †
D . VA U T R I N ‡ and M . S O L I G N A C ‡
*Laboratoire de Parasitologie Pharmaceutique, CNRS UMR 6553, Faculté des
Sciences Pharmaceutiques et Biologiques, 35043 Rennes, France, †Laboratoire de
Zoologie et d’Ecophysiologie, CNRS UMR 6553, Campus de Beaulieu, 35042
Rennes, France, ‡Population, Génétique et Evolution, CNRS, 91198 Gif-sur-
Yvette, France
Keywords: Helix aspersa, microsatellite, Mollusca, population structure
Received 31 December 1999; revision accepted 29 March 2000
Correspondence: Annie Guiller. Fax: +02 99 33 68 96; E-mail:
annie.guiller@univ-rennes1.fr
In an attempt to trace back the history of the landsnail, Helix
aspersa, spread in the western Mediterranean, anatomical,
biochemical and molecular markers have been used to
explore genetic variation in native populations of the species
(Guiller et al. 1994, 1998; Madec & Guiller 1994; Thomaz et al.
1996). In this context, two observations have drawn our
attention to the population structure of the species: (i) the
very high level of mitochondrial diversity found even at this
lowest taxonomic rank; (ii) the frequent occurrence of depar-
tures from Hardy–Weinberg expectations in almost all samples
scored for allozyme variation. Regarding preliminary results
on the fine scale genetic structure of allele frequencies at
enzyme loci (Arnaud et al. 1999), such possible effects of pop-
ulation mixing may indeed be due to the particular popula-
tion structure of H. aspersa and land molluscs in general,
where populations are subdivided in numerous demes with
limited migration between them. Because allozyme loci might
 MEC954.fm Page 1192 Thursday, July 6, 2000 7:03 PM
1192 P R I M E R N O T E S
Table 1 Primer sequences and some characteristics of polymorphic microsatellites in Helix aspersa. The number of scored individuals was 47 for Ha12, 48 for Ha9, 50 for Ha7, and 117
for the rest of the markers (#origin of individuals tested)

Heterozygosity
GenBank Annealing No. of
Locus Accession no. Primer Sequences (5′– 3′) Repeat motif temp. (°C) Alleles Size-range (bp) HO HE

Mont-St-Michel’s Bay#
Ha2 AF204939 CGAAGCCTTTGGCACAATGT (CA)7TG(CA)11TA(CA)6 54 5 302 – 310 0.68 0.61
TCCCTGACACTGGAAGATGGA
Ha5 AF204931 GTGTGACACACTGCCCTGGA (TG)19 54 6 183 – 195 0.60 0.65
CAATGGCAAACTACTGAAAGCAA
Ha6 AF204932 TTATCCGCTTGATATATCCT (GA)23(GGA)4 51.4 21 162 – 232 0.79 0.76
ACTCGTACATGGTTGAAAAC
Ha8 AF204937 AGTTTGCTGGTTTGTACACTCG (CA)14CGTG(CA)3AGATG(CA)2 51.4 18 152 – 220 0.91 0.85
CGTTTTTAGCTCTTGAATACGG
Ha10 AF204940 GCGTTCAATGTAGTTTATGTGCG (CA)6(CGCA)3(CA)4TACACG(CA)14 54 8 225 – 241 0.82 0.81
GAGAACATGCATACAAACAAACATG
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193

Ha11 AF204938 CGTGTACTACTGGGCAACGT (TC)2ACTGTTCC(TC)33 54 21 207 – 309 0.91 0.87

ACGGAAAGAGACAGAAAGTGAG
Ha13 AF204930 AAAATAGTTCCTGCATGTTACGTAG (TC)4(AC)9(GC)2(ACGC)7GC(ACGC)7 54 25 162 – 344 0.79 0.79
CTGGTGTTAACAGCGAAGTTCT
Southern France#
Ha7 AF204933 GCCATATGGGATAAAATACCGGTG (TC)2G(TC)37 54 18 216 – 296 0.66 0.77
CGCCCCTTGTTTACACGAGAAA
Ha9 AF204936 AGCTAACCCACACTCAGATTT (TG)5 … (CA)20 … (AT)6 49.5 11 138 – 173 0.52 0.72
AGCCAGCTAATATGTTTGGA
Ha12 AF204941 CCATGAAATACGACATATTC (CA)50CC(CA)3CC(CA)4 48.5 13 107–147 0.68 0.81
TTGAAGTCCATTGAAATCTA
MEC954.fm Page 1193 Thursday, July 6, 2000 7:03 PM
not be sufficiently variable to reveal this underlying model
of population level structuring, we have developed micro-
satellite markers which may help redefine the panmictic unit
of the species previously estimated using the marked-
recapture method. Here, we describe the first microsatellite
loci isolated from the genome of H. aspersa. Most snails used
to assess the polymorphism of these loci originated from
populations living in fragmented habitats (Polders of the Bay
of Mt-St-Michel).
Genomic DNA was extracted from foot muscle of one fresh
snail using the CTAB extraction protocol (Terret 1992). Appro-
ximately 5 µg of DNA extract was digested to completion
with Sau3AI (Pharmacia). The restriction fragments were
separated on a 1.4% agarose gel and a range from 500 to
700 bp were selected with NA45 DEAE membrane. After
recovery by phenol–chloroform extraction, DNA fragments
were ligated to BamHI-digested pUC18 (Pharmacia) vector
and cloned in Escherichia coli XL-1 Blue Cells (Stratagene).
Over 2000 recombinant clones were transferred onto nylon
membranes (Hybond-N+, Amersham) and hybridized with
an equal mix of (TC)10, (TG)10, (CCT)5, (CAC)5, (ATCT)6, and
(TGTA)6 oligonucleotides labelled with digoxygenin, using
the DIG oligonucleotide tailing kit (Boehringer Mannheim).
Of the 78 positive clones detected (3.7% of the recombinant
plaques), inserts from 19 of those harbouring a strong hybrid-
ization signal were polymerase chain reaction (PCR) amplified
using the M13/pUC18 universal primers, and sequenced using
an ABI 377 DNA automated sequencer. Primer sets were des-
igned for 13 microsatellite sequences (the remainder were unsuit-
able because of incomplete sequences obtained) using oligo
software version 4.04. One primer of each set was fluorescently
labelled with 6-HEX, NED, or 6-FAM dyes (Perkin-Elmer).
DNA for genotyping was extracted by using a 10%
Chelex-100 (Sigma) suspension. The PCR reactions were
carried out either in 25 µL, when using the amplification ‘ready
to go’ PCR beads (Pharmacia), or in 10 µL which contained
≈ 50 ng of genomic DNA, 1 U of Taq polymerase (Appligène),
1.2 – 1.4 µL of PCR buffer (10 mm TrisHCl, pH 9.0; 50 mm KCl,
0.1% Triton X-100; 0.2 mg/mL BSA or gelatin; 1.5 mm MgCl2),
0.2 µL of 100 mm dNTPmix, 0.20 µm of each primer. Cycling
was performed in a Biometra® thermocycler with one cycle
of 3.5 min at 95 °C followed by 30 cycles of 30 s at 94 °C, 30 s
at the annealing temperature (Table 1), and 30 s at 72 °C, and
© 2000 Blackwell Science Ltd, Molecular Ecology, 9, 1171–1193
P R I M E R N O T E S 1193
a final 5 min extension at 72 °C. The PCR products were
visualized on a 2% agarose gel and electrophoresed using an
ABI Prism 310 Genetic Analyser (Perkin-Elmer).
Initial screening for polymorphic loci was performed with
117 individuals collected in different sample sites from the
Mt-St-Michel’s Bay. Of the 13 primer pairs designed, 10 reliably
amplified a single strong band. Seven loci revealed extensive
allelic polymorphism for this fine level of population struc-
turing with the number of alleles per locus ranging between
6 and 25 and the observed heterozygosity between 0.60 and
0.91 (Table 1). Because of two monomorphic loci (Ha9 and
Ha12) and a null allele suspected for loci Ha7, new individuals
from populations sampled in Southern France were tested.
Even with only 50 individuals screened, 11 and 13 alleles
were detected for loci Ha9 and Ha12, respectively. For the 10
loci analysed, the observed heterozygosity values were very
close to the expected heterozygosity values, meaning that the
Wahlund effect due to population substructuring may con-
tribute to the deficit of heterozygotes previously observed
with allozyme data. This paper shows that microsatellites
provide an ideal tool for studying population structure and
estimating gene flow among demes which may function as
metapopulations.
References
Arnaud JF, Madec L, Bellido A, Guiller A (1999) Microspatial
genetic structure in the land snail Helix aspersa (Gastropoda:
Helicidae). Heredity, 83, 110–119.
Guiller A, Bellido A, Madec L (1998) Genetic distances and
ordination: the land snail Helix aspersa in North Africa as a
test case. Systematic Biology, 47, 208–227.
Guiller A, Madec L, Daguzan J (1994) Geographical patterns of
genetic differentiation in the landsnail Helix aspersa Müller
(Gastropoda: Pulmonata). Journal of Molluscan Studies, 60, 205–221.
Madec L, Guiller A (1994) Geographic variation of distal genitalia
in the landsnail Helix aspersa (Mollusca: Gastropoda). Journal of
Zoology, 233, 215–231.
Terret JA (1992) The mitochondrial genome of Cepaea nemoralis.
PhD Thesis, University of Nottingham, Nottingham.
Thomaz D, Guiller A, Clarke B (1996) Extreme divergence of
mitochondrial DNA within species of pulmonate land
snails. Proceedings of the Royal Society of London Series B, 263,
363–368.