Materials and methods

Isolates used in the study

Cultures of antagonists and pathogens used were obtained from the Institute of Agricultural

sciences (IAS) Quaid-e- Azam Campus PU, Lahore

Preparing the medium

Following media were prepared during study:

For preparation of 1000 ml of PDA media, 40 grams of commercial PDA powder was

dissolved in 1000 ml of distilled water.

Medium was sterilized at 15 psi for 20 minutes

Preparing potato extract

1. Place potatoes in a saucepan with approximately 1.2 liters of tap water and boil on a

stove for one hour.

2. Remove the saucepan from the stove and let the liquid cool until it can be comfortably

handled.

3. Pour liquid potato extract through a stainer or cheesecloth and collect it in another

container.

Sterilization

1. Thoroughly mix the medium and divide it into smaller batches of 250 ml poured into

the four 500 ml flasks.

 2. Cover each flask with a piece of loosely crimped aluminum foil, so the foil will not

fall off. But does not make a tight seal.

3. Place the flasks in an autoclave.

4. Operate the autoclave in accordance with the manufacturer’s instructions to sterilize

the PDA at 121 degrees C at the pressure of 103, 421 Pascal’s (15PSI) for 15 minutes.

5. Close the autoclave and let it return to atmospheric pressure, then remove the flasks

and let them cool until they can be handled. Penicillin and streptomycin were added

sterilized stock medium just before pouring to inhibit the bacterial growth.

Pouring the medium

1. Line up the sterile petri dishes on a flat surface of Laminar flow.

2. Once the flasks have cooled to handling temperature, but before the medium begins to

solidify, grasp a flask with one hand and remove and set aside its foil lid with the

other hand

3. For each petri dish, lift the lid with one hand, quickly fill halfway with liquid PDA

and replace the lid.

4. Repeat it until petri dishes are filled.

5. If there is any PDA left over, loosely recover the flask with its original foil lid, let it

cool and solidify, tighten the foil lid and store in a refrigerator.

In vitro interaction of M. phaseolina with trichoderma species

Cultures of Trichoderma harzianum, Trichoderma viride and Macrophomina phaseolina

were prepared on PDA. A 5 mm inoculum disc of Trichoderma harzianum was placed at one
side of a petri plate containing PDA amended with penicillin. A 5 mm disc of M. phaseolina

was cut and placed at other side of petri plate. There were three replicates of each treatment.

Similarly a 5mm inoculum disc of Trichoderma viride was placed at one side of another petri

plate containing PDA amended with penicillin and 5mm disc of M. phaseolina was cut and

placed at other side of this petri plate. Plates were incubated at room temperature and growth

rate of fungi were recorded daily.

.Types of interaction

1. Antagonist completely overgrew on the pathogen and covered the entire medium

surface

2. The pathogen completely overgrew the antagonist and occupies the entire surface

3. Zone is formed

4. The pathogen grows more than the antagonist and zone formation also occurred

5. Antagonist and pathogen each colonized on one-half of the medium surface and

neither organism appears to dominate the other

6. The pathogen colonized at least two thirds of the medium surface.

Macroscopic characterization of fungal colony

Rate of growth, morphology of colony, culturability and specific characters were recorded for

evaluating macro morphology.

Morphology of colony

For morphological characters of colony following features were observed;

 Color of colony

Colony color was observed and noted for each sample.

 Diameter of colony

With the help of a scale in mm the colony diameter was measured.

 Habit of colony

Following aerial, submerged and surficial characters were noted for determining the colony

habit.

Rate of growth

Colony width was measured after fixed intervals of time for determining growth rate of

colony.

Culturability

It was noted on the basis of mycelial growth and enlargement of colony size, further these

were divided into fast growing, intermediate and slow.

Specific features

Carefully some specific features were also noted e.g., odor, exudation etc.

Effect of Seed pelleting with trichoderma species on plant growth and root colonization

Seed pelleting
Trichoderma harzianum and Trichoderma viride were grown on PDA plates were used for

pelleting of sunflower seeds. One ml of conidial suspensions of a trichoderma harzianum was

prepared in 40% of water solution and added to 10g of seeds in polythene bag. Similarly ne

ml of conidial suspensions of a trichoderma viride was prepared and added to 10g of seeds in

polythene bag. In this case, the bags were shaken well to provide a uniform coating. The

evenly coated seeds were sown in pots containing 200g soil. Half of the pots had artificial

infestation of M. phaseolina @50 scl. /g soil while half of the pots had non- infested soil. Soil

moisture was adjusted to 50 % WHC and amount of moisture lost was adjusted after each 24

hours. There were three replicates of each treatment. Plants were uprooted after 30 days

intervals to assess plant growth and colonization of roots by M. phaseolina and Trichoderma

species.

Molecular Characterization

DNA was extracted from a small portion of fungal colony cultures for molecular

characterization. Amplification of ITS region was done, then sequenced for the phylogenetic

investigation by using known software’s.

DNA Extraction

From a minor portion of fungus culture the genomic DNA was extracted by using the

modified CTAB protocol which following Bruns that is given below:

Small piece of fungal culture was transferred into the autoclaved eppendorf which containing

300ul CTAB. Eppendorf was freeze and thawed three times. After this process, the material

medium in the eppendorf was crushed with the help of micro-pestle, in front of the laminar

air flow. At 65oC for about 40 – 50 minutes the material containing eppendorf was incubated

in water bath. After the gaps of 20 minutes, the eppendorf tube was inverted up and down
twice during the incubation procedure. After 50 minutes, 300ul of chloroform.

Isoamylalcohol mixture solution was added into the eppendorf and vortexed nicely for 30 –

45 seconds. At 40C for about 20 minutes, the sample was centrifuged at 13200 rmp. After this

centrifugation period, about 200ul of supernatant occupied into a new autoclaved tube and

133.3ul ice chilled isopropanol was added. This eppendorf tube was kept into the refrigerator

at -4oC overnight.

On very next day, at 4oC for about 20 minutes the eppendorf tube was again centrifuged at

13200 rmp. Discarded the supernatant and the pellet of DNA was washed with the addition of

22ul 70% Ethanol. At 4oC, this tube of eppendorf again centrifuged, for about 20 to 22

minutes at 13000rmp. DNA pellet washing with 70% Ethanol was repeated twice. Finally the

Ethanol was discarded and DNA pellet was dried by placing eppendorf tube in overturned

situation in the laminar air flow for about 1 hour. Pellet of DNA then kept in 50 – 55ul of de-

ionized water and at 40C it was stored.

Polymerase Chain Reaction (PCR)

Extracted DNA material was amplified by using following sets of primers i. e., ITS4, reverse

primer (5’ TCCTCCGCTTATTGATATGC 3’) and forward primer, ITS1F

(CTTGGTCATTAGAGGAAGTAA 3’). For all samples, ITS region’s multiplication was

made by using the PCR mixture provided with the DNA Extraction kit of plants. Polymerase

Chain Reaction conceded under these pedaling limitations.

 Initial denaturation of double stranded DNA at 940C for about 1 minute.

 Annealing at 53oC for 1 minute.

 For 8 minutes the final extension was completed at 72oC

These cycling parameters worked for complete 35 cycles. On 1% of Agarose gel, the PCR

products will be separated by gel electrophoresis, which run at 70 Volts for 35 – 45 minutes.

And EtBr used as stain. Samples were sent to BGI- HongKong (China), TsingKE (China) for

sequencing.

Sequencing and data analysis

Both products (extracted and PCR) comprising of single band was used only for sequencing.

These products were sequenced by using the same set of primers in both directions. After the

analyzation of nucleotide peaks, the sequenced data was inspected physically. By using the

Bio- Edit software, consensus sequences were made after cleaning the nucleotides peaks.

Consensus sequence was matched with the Basic Local Alignment Search Tool (BLAST) by

the national center for biotechnology information (NCBI), USA database. Closely related

sequences were retrieved from GenBank and from different articles. Their alignment was

done by the Clustal- W, for Multiple Sequence Alignment in Bio-Edit. Molecular isolation

and identification was achieved up to the taxa level. Those samples with 97-100% similarity

with existing species in Gene Bank will be considered a match and will be named to the

species level. Those sequences with less than 96% similarity were designed new names and

contemplate undescribed from Pakistan.

Phylogenetic analysis

For analyzation of phylogeny, similar sequences then rectified from the GenBank and aligned

by following default settings in MAFT and MUSCLE software’s. We followed Dentinger et

al., 2011 for entire ITS arranged sequences, and edited by conserved motifs 5’ (----GAT)

CATTA- & - GACCT (CAAAT----) 3’. In analysis the alignment portion which was in

between the both motifs were used. Phylogenetic tree was assembled using MEGA software

with maximum likelihood algorithm & Jukes Cantor model of nrITS sequences and nearest
Neighbor Interchange (NNI) as ML heuristic search method. All missing data and breaks

were excluded. The topography was calculated by 500 or 1,000 bootstrap values which were

50% mentioned in final phylogenetic tree. Bootstrap consensus, is then used to illustrate

topography of species in phylogenetic tree analysis. Divergences of DNA and percent

identities (PID) were intended by DNA star.