Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No.

04  1673

Molecular and Biochemical Characterizations of

Staphylococcusaureus ß-Lactamase Recovered from
Iraqi Patients with UTI

Ruqaya M. Hassan1, Maha H. Abdullah1, Ghazi M.Aziz2, Ali J. Al-Sa’edy2

1
College of Biotechnology/Al-Nahrain University, 2College of Science/University of Baghdad

Abstract
A total of 126 samples (wound, urine) were collected and only sixty one isolates were detected phenotypicallyas
Staphylococcusaureus. All Staphylococcusaureus isolates were screened for their ability to produce
β-lactamase. The best isolates for produce β-lactamase was RU57 isolated from urine with activity 134.5
U/ml. Molecular identification for bla Z was donefor the highest 12activities of the β-lactamaseand only
10 isolates were found to be chromosomal origin bla Z andothersplasmid origin.β-lactamase was partially
purified by ion exchange chromatography in CM cellulose column, the Overall purification fold was 1.65
with 52% yield for wash step and 4.8 with 26% yield for elution step. The maximum enzyme activity was
recorded at pH 7.0 and 37° C, while the maximum enzyme stability was recorded at pH range from 6-7.5
and temperature degree ranged from 25-40°C. A phylogenetic tree was used To elucidate the diversity and
evolutionary of chromosomally-located blaZ, of S.s aureus isolates RU57 from Iraqi patients with others
from different country and the results showed that blaZ was have similarity 100% with China, France, South
Korea,United Kingdom, and Brazil. The sequence of blaZwas differsfrom blaZ of Australia, Japan and USA.
Today therapeutic control of ß-lactamase-producing bacteria has been a major clinical problem.

Keywords:  ß-lactamase, bla Z, Staphylococcus .aureus, polymerase chain reaction, resistance genes.

Introduction penicillin-binding proteins are enzymes located in the

cytoplasmic membrane and responsible for penicillins
Staphylococcus belongs to the low GC content
and cephalosporins resistance (5). Other enzyme such as
division of Gram positive bacteria. Three species,
protease, lipase, and hyaluronidase, that destroy tissue
S. aureus, S. epidermidis, and S.saprophyticus, are
and may aid the spread of infection to other tissues.
recognized as both a commensal bacterium and a
Coagulase, an enzyme Its contributed to the virulence of
opportunistic human pathogen on host skin (1). Multiple
bacteria (6).The blaZ has also been identified as the cause
studies have now documented the prevalence, prognosis,
of penicillin resistance among Staphylococci(7,8). Today,
and outcome of Staphylococcus aureus bacteremia
S. aureus has develop resistant to many commonly used
in industrialized guregions of the world(2,3). Many
antibiotics. The best-known mechanism of bacterial
strains of Staphylococci are secrete a group of enzymes
resistanceis resistance to β-lactam group, such resistance
and cytotoxins such as nucleases, proteases, lipases,
may be chromosomally or plasmid-mediated or may be
hyaluronidase, and collagenase (4). The main function of
constitutive or inductive. The aim of this research to
these enzymes may be to convert local host tissues into
identify and characterization of β-lactamase isolated
nutrients required for bacterial growth. ß-lactamase and
from Iraqi clinical samples at molecular and biochemical
levels.
Corresponding Author:
Maha H. Abdullah Materials and Method
College of Medicine-AL-Nahrain University, Iraq Samples Collection: A total of 126 samples (wound
e-mail: dr.mahahameed@gmail.com and urine) were collected, from the Ear-Nose-Throat
1674  Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04
(ENT) consultant Unit at Al-Kindy teaching Hospital
and Al-Yarmouk Teaching Hospital in Baghdad city
from February to March, 2017. The samples obtained
from subjects of various ages, gender and infection sites,
were transferred to the laboratory for analysis.
Diagnosis of Staphylococcus aureus:
Microscopic examination(9)
: All isolates were
subjected to Gram staining technique and only Gram
(+ve) coccus cells grouped mainly in clusters were
considered as belonging to Staphylococcus sp.
Morphological Examination(10): Each of the
suspected bacterial isolates was streaked on mannitol salt
agar and incubated at 37°C for 24 h. After incubation.
The colour and texture of the colonies are observed.
Biochemical tests(11):
Standard microbiological
procedures were used for the identification of S. aureus.
Microbiologic Procedure: In vitro antimicrobial
susceptibility testing was done by disc diffusion method
using the penicillin Gand interpreted according to the
Clinical and Laboratory Standards Institute (CLSI
2008)(12)
PCR amplification for Staphylococcus aureus:
DNA was extracted as previously described (13).
Polymerase chain reaction for detection of genes
bla Z was carried out using the following primers:
5’CAAAGATGATATAGTTGCTTATTCTCC-
3’,5’TGCTTGACCACTTTTATCAGC - 3’respectively.
Amplification cycles for bla Z was done according to
Coelho et al. (14) considering 35 cycles of 94ºC for 30s,
56ºC for 30 sec, 72ºC for 1 min. with a final extension
at 72ºC for 7 mins. The amplicons were evaluated by
agarose gel electrophoresis followed by staining in
ethidium bromide (0.5mg/mL), visualized on UV
transilluminator and documented by the program Quanti
One (BioRad) using molecular weight markers of
1000 bp.
Sequence Homology and Phylogenetic Analysis:
The Sequencing of PCR product was performed by
national instrumentation center for environmental
management using BLAST system.Phylogenetic tree
was constructed using the program Neighbor-Joining in
the same software.
Protein determination(15): Protein concentration
was determined by Bradford using BSAas standard.
Determination of β-Lactamase activity:
Quantitative determining of ß-Lactamase
activity: β-Lactamase was detected by measuring the
enzyme activity according to a micro-iodometric assay
at 620 nm(16).
International Unit (IU): the amount of enzyme
needed to hydrolyzed 1µmole of penicillin G per minute
at 25ºC and PH 7.0.
Enzyme activity = U/ml =
Enzyme purification: The purification was carried
out at 4°C on the cell lysate according to Hedberget al.
(1995).
Dialysis of crude enzyme: The crude enzyme put
in dialysis tube with 10000MW cutoff against, after
dialysis, the enzyme after concentrated by sucrose use
for purification by ion exchange chromatography.
Purification by ion exchange chromatography:
The dialyzed β-Lactamase was further purified by ion
exchange chromatography technique using CMC-
Cellulose column (1.57Х15 cm) which prepared
according to(17).
Characterization of purified β-lactamase.
Determination of the optimal temperature for
β-lactamase activity and stability: ß-lactamase activity
was determined after incubation of substrate at different
temperatures (25,30,37,40,45, 50ºC) for 30min. for
determine enzyme stability the enzyme was transferred
into ice bath.
Determination of the optimum pH for β-lactamase
activity and stability: This can be achieved by using
acetate buffer, phosphate buffer and tris buffer. pH was
adjusted in each one, penicillin Gwas added to buffer
solution at different pH values(4-9) the activity of
β-lactamase was assayed.
Results and Discussion
Total of 61 isolates were identified as S. aureus
depended on the morphological features and biochemical
test. Only 49 isolates from Urine and wound isolates
were positive for production of β-lactamase by inhibition
zone for Penicillin Gand edges around the penicillin G
disk ((inhibitor standard) and according to disk diffusion
method (Oxoid, Basingstoke, England) and as shown in
 Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04  1675
table (1). The test was defined as negative when thefuzzy The β-lactamase positive S. aureus isolates
edge like a beach and as positive when the edge was recovered from the urine and wound samples were
sharp like a cliff(18). screened for bla Zgene. The result was shown the bla
Z was approximately 421 bp in length. The optimum
Table 1: Highest ten S. aureus isolates of positive temperature for amplifying this gene was 56°C.
β-lactamase However, a large inhibition halo did not rule out the
presence of the blaZ gene, as also noted by Feghaly(19).
Inhibition Zone Enzyme
No. No. Isolates This result was agreed with Ferreira(20) how mentioned
(mm) Activity
that the bla Z 421bp in S.aureus. ATCC 29213.
1 RW14 23 19.3U/ml
Other study had shown the PCR product of the blaZ
2 RW21 21 80.3U/ml
geneisolated from isolates from Australia was 326 bp(21).
3 RW 34 20 97.5U/ml Recently, many studies carried out in different countries
4 RW35 23 70.4U/ml describing the characteristics of ß-lactamase gene from
5 RW36 20 57.5U/ml different bacteria types,since there results were seem to
6 RU44 19 55.8U/ml
be geographical variations in the occurrence of different
β-lactamase gene, including E. coli and,P. mirabilis, and
7 RW47 22 61.5U/ml
E. Aero genes(22).As shown in fig. 1, some of the isolates
8 RU51 21 90.2U/ml were shown negatives amplicons, indicating that, the
9 RU52 22 62.4U/ml bla Z genes were not contained in the genomic of these
10 RU57 20 134U/ml isolates or these isolates may contain other resistance
11 RU59 21 89.3U/ml gene but not expressed as reported byJoseph(8).
12 RU60 22 4.59U/ml

Figure 1: Agarose gel electrophoresis of the amplified bla Z gene of RU57 on (1%) agarose under
UV (1.15 h. and 110 Volts)

Sequence Homology: We performed genome
analysis on the bla Z gene of different S. aureus isolates
(3 isolated from wounds and 3 isolated from urine) in
comparison with that of S. aureus strain by using inverse
PCR-based sequencing analysis. The results shown
that two genomic structures of S. aureus isolated from
wounds, was 100% similar to the genomic structure that
was found in the chromosomal region encoded to bla
Z geneand the remaining isolated shown the difference
in the bla Z gene in one nucleotide (Table 2). The bla
1676  Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04
Z gene of S. aureus of 3 urine samples have shown ofamino acid substitution in β-lactamase is considered
single nucleotide changes in three analyzed isolates such Trans version because both amino acids are from the
change known as Missense and lead to change the amino same group
acid which β-lactamase consist from it. Such Type

Table 2: Sequencing analysis of bla Z gene

Identities Predicted Effect Amino Acid Change Nucleotide Change Nucleotide Sample
99% Missense Serine > Arginine AGT > AGG T>G
99% Missense Glycine > Valine GGT > GTT G>T 57
100% Missense Serine > Arginine AGT > AGG T>G

Phylogenetic Analysis: The blaZ genes encode
enzymes of the β-lactamase of Staphylococci. The blaZ
genes of the S. aureus species group formed a separate
cluster from the other S. According to the phylogenetic
analysis the evolutionary relationship among the
group of S. aureus. thebla Z genesof RU57in the tree
was occurred on the same line with others bla Z genes
isolated from S.aureus from China, South Korea, United
Kingdom and Brazil.
Partial purification of β-lactamase: Partial
purification which was produced by the locally
isolated S.aureus. R57 isolated was partial purified
through purification steps. These include the dialysis
of crud and concentration by sucrose and ion exchange
chromatography Carboxyl methyl cellulose (CMC
Cellulose) as follow: Results indicated in figure (2)
showed that there are two peaks appeared in washing
step, while two protein peaks appeared by the gradient
concentration of sodium chloride. All these four protein
peaks were detected by measuring the absorbance at
280 nm. Result showed peak in washed protein after
concentration by sucrose 57.2 U/ml, while peaks eluted
proteins after concentration by sucrose 36.33 U/ml. The
results were shown that there are two forms of enzyme
(isozymes) which were appeared through the separation
techniques. The purification fold of this experiment was
10.83 and the yield was 64.69%.

Figure 2: Purification of βlactamase from RU57 by CMC Cellulose

 Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04  1677
Effect of temperatureand pH on the activity and
stability of β-lactamase: The effect of temperature
on β-lactamase activity was studied by performing the
enzymatic reaction at different temperatures in the range
25 – 50°C. The purified β-lactamase was shown good
stability and retained about 100% of its initial activity
after incubation for 30 min from range 25-40 °C, and then
the activity was decreased with increasing the degree of
temperature and lost more than 70% of its activity 40°C,
(Fig.3). These results were disagreed with (25) that it was
Figure 3: Thermal stability of β-lactamase purified from RU57.
β-lactamase was found to beactivein the pH range
4.0–9.0 at 37°C. The maximum activity was shown 4.3
± 0.16 and recorded at pH 7.0 (Fig.4A). Any further
increase resulted in the loss of β-lactamase activity due to
the alteration in the ionization of groups responsible for
substrate binding. pHcan have an effect on the ionization
state of the acidic or basic amino acid group. Basic amino
acids have amine functional groups in their side chains,
acidic amino acids have carboxyl functional groups in
their side chains. If the state of ionization of amino acids
in a protein is altered, then the ionic linkages that help
to determine the 3-D shape of the protein can also be
altered and lead to a change of protein recognition.At
alkalin pH (8, 9) and the low acidity(4,5)of the reaction
shown the optimum temperature for enzyme activity
was found to be 30°C. Other study shown an optimal
temperature of β-lactamase isolated from local isolate
from asopharyngeal region of healthy individuals from
Basra city, at25, 30,and35°C(26). Results showed that the
highest ß-lactamase activity was 4.9 ± 0.17 and at 37
°C. The statistical analysis also illustrated that there was
significant difference between the activity and stability
at different degrees of temperature (p<0.01).
media would result in the denaturation of the enzyme or
decrease in it reaction rates (25,26). This was consistent
with the behavior of other β-lactamase from S. aureus
isolated from Lebanese Community(26). However, the
enzyme was stable at pH range from 5-7, only 50%and
20% of optimum activity β-lactamase was retainedat pH
8,pH 9 respectively (Fig.4B). The influence of pH on
enzyme stability was significantly differentat (p<0.01)
and these different were related to the effect of pH on
the enzyme structure. This leads to the denaturation of
enzyme molecular or to change in the ionic state of the
active site, as well as it effect on secondary and tertiary
enzyme structure which lose the activity.
1678  Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04

Figure 4: A: Optimum pH for β-lactamase activity purified RU57.

B: Stability of purified β-lactamase from RU57

Conclusions and 7respectively. The optimum temperature and pH

S. aureus isolates are different in their ability to
produced β-lactamase. The local isolate RU57 which
isolate from urine had the highest β-lactamase activity.
The bla Z of β-lactamase which isolated from local
S. aureus isolates was similar to that found in china,
France, South Korea, United Kingdom, Brazil according
to sequencing and phylogenetic tree analysisβ-lactamase
was partially purified by concentrated using sucrose
and ion exchange chromatography. The optimum
temperature and pH for β-lactamase activity were 37°C
for β-lactamase stability were range from 25-40°C and
6-7.5 respectively
Acknowledgements: Many thanks to the patients
and staff ofAl-Nahrain University and Baghdad
University who participate in this study I am grateful to
Professor Ghazi M. and Associate Professor Maha H. for
them mentorship.
Ethical Clearance: The Research Ethical
Committee at scientific research by ethical approval of
 Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04  1679
both environmental and health and higher education and
scientific research ministries in Iraq.
Conflict of Interest: The authors declare that they
have no conflict of interest.
Funding: Self-funding
References
1. Kahlmeter, G. An international survey of the
antimicrobial susceptibility of pathogens from
uncomplicated urinary tract infections: the
ECO•SENS Project. Antimic. Chemoth., 2003,
51(1), 69–76.
2. Garrity, G. M., et al., Taxonomic outline of
the prokaryotes. Bergeys manual of systematic
bacteriology. Springer, New York, Berlin,
Heidelberg, 2004.
3. Ghebremedhin, B., et al Genetic classification and
distinguishing of S. species based on different
partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf
gene sequences. ClinMicrob, 2008,46(3), 1019–
1025.
4. Rasigade, J., et al. New epidemiology of S. aureus
infections, In: Clinical Microbiology and Infection,
European Society of Clinical Microbiology
and Infectious Diseases, 2014,10.1111/1469-
0691.1271.
5. Martin M., Paual M. and Patrick M., Exotoxins of
S.aureus, Clinic Biol, 2000,13(1),p. 16–34.
6. Eiichi A.; et al.,Biofilm formation among
methicillin-resistant S. aureus isolates from patients
with urinary tract infection, Acta Med. 2004,58,
No. 4, pp. 207-214.
7. Baba-Moussa, L., et al., Virulence factors produced
by strains of Staphylococcus aureus isolated from
urinary tract infections. Hosp Infec., 2008,68(1),
32–38.
8. Devapriya, F., et al., β-lactamase production of
S.aureus: a comparison study of different iodometric
method. Gulf Medical 2013,2(1), 16–21.
9. Joseph, W. et al., Molecular Detection of ß-Lactam
Resistance Genes in S. aureus Isolated From
Women in Nasarawa State, Nigeria. Healthc.
MedSci,2018,4(5), 60–65.
10. Haitham, E.; et al.,S. aureus subsp. anaerobius
strain ST1464 genome sequence, Stand Genomic
Sci., 2013,16; 9(1): 1–13
11. MacFaddin. Biochemical tests for identification of
medical bacteria,. Lippincott Williams & Wilkins,
Philadelphia, Part II. Low price edition, 2000, 193-
194.‫‏‬
12. CLSI Document M31-A3. Performance Standards
for Antimicrobial Disk and Dilution Susceptibility
Tests for Bacteria Isolated from Animals, Approved
Standard, Third Edition. CLSI, Pennsylvania,
USA.2008 .
13. Adwan, K., et al., Molecular analysis and
susceptibility patterns of methicillin-resistant S.
aureus strains causing community-and health care-
associated infections in the northern region of
Palestine. Ame J. infec con., 2013,41(3), 195-198.
14. ‫‏‬Coelho S.et al.,Pesq. Vet. Bras. 2009,29:369-374.
15. Bradford, M. M. A rapid and sensitive method for
the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding.
Biochem., 1976,72(1–2), 248–254.
16. Novick, R. P. Micro-iodometric assay for
penicillinase. Biochemical J. 1962,83(2), 236.‫‏‬
17. Whitaker, J. R. and Bernard, R. A., Experiments
for: An Introduction for Enzymology, the Whiber
Press, 1972.
18. Wayne, P.CLSI 25st Informational Supplement,
clin. Lab stand. inst,2015,Vol 35(3):224-231.
19. Ferreira, A.et al.,Correlation of phenotypic tests
with the presence of the blaZ gene for detection
of beta-lactamase, Braz J Microbiol.; 2017,48(1):
159–166.
20. Firth, N., et al.,Replication of Staphylococcal
multiresistance plasmids. J.Bacteriol., 2000,182(8),
2170–2178.
21. Lito, E., et al., Performance of Phenotypic Tests
for Detection of Penicillinase in S. aureus Isolates
from Australia, J Clin Microbiol., 2014,52(4):
1136–1138.
22. Samuel, B. Medical Microbiology,edition,
University of Texas Medical Branch at Galveston,
1996, ISBN-10: 0-9631172-1-1.
23. Hamed, M. et al., Characterization of β-Lactamase
from Two Pathogenic Bacteria. Curr. Microbiol.
App. Sci. 2017,6(6): 927-941.
24. De Castillo, et al., Purification and characterizzation
of βlactamase from Neisseria gonorrhoeae from
clinical samples. Revista Latinoamericana de
Microbiologia, 2001,43(2): 70-75.
1680  Indian Journal of Public Health Research & Development, April 2020, Vol. 11, No. 04
25. Ranade, Y., et al.,. Screening, Production, 26. Omeiri, M.; Holail, H. and Olama, Z. Purification
Purification and Characterization of ß-Lactamase and characterization of S. aureus beta -lactamase
from Uropathogenic E.coli. European Experimenl from Lebanese community. Curr. Microbiol. App.
Bio, 2013,31: 434-442. Sci., 2014,3 (2): 527-535.