OLIGONUCLEOTIDES 17:251–257 (2007)

© Mary Ann Liebert, Inc.

DOI: 10.1089/oli.2006.0063

Hairpin RNA-Mediated Strategies for Silencing of

Tomato Leaf Curl Virus AC1 and AC4 Genes for
Effective Resistance in Plants

S.V. RAMESH,1* A.K. MISHRA,2 and S. PRAVEEN2*

Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.

ABSTRACT

RNA interference (RNAi) using short interfering RNAs (siRNAs) has been widely explored for the
suppression of intracellular viral target mRNAs. On the basis of our previous work with stable si-
lencing of Tomato leaf curl virus, in vivo by the antisense replicase gene (AC1) of the virus and char-
acterizing AC4, as a small RNA regulator, besides its role in pathogenicity, we used four different
plasmid vector-based siRNA generation strategies to silence viral genes (AC1 and AC4) of tomato
leaf curl viruses. The RNAi target sequence were chosen from DNA A of the Tomato leaf curl virus
(ToLCV) on the basis of conserved regions in AC1 with an overlapping sequences of the AC4 gene.
Different hairpin RNA-mediated strategies like antisense, self-complementary inverted repeats, in-
tron-spliced hairpin RNAs, and small hairpin RNAs were deployed for efficient and predictable re-
sistance to the viruses. Here we present that appropriately designed siRNAs not only prevents RNAi
suppression but also help in developing trait-stable transgenics. These strategies imply that ToLCV
rep-driven RNAi, targeting AC4 and conserved viral sequences, provides a promising approach to
suppress a wide spectrum ToLCV infection in the tomato.

INTRODUCTION al., 2001). These findings raised our interest in RNAi as

R NA INTERFERENCE is an ancient natural mechanism
that directs gene silencing in a sequence-specific
manner (Ratcliff et al., 1997, 1999; Voinnet, 2001). It has
already been established as an invaluable research tool in
adaptive defense mechanisms against viruses infecting
animal and plant cells (Ding et al., 2004). But can RNA
interference be used as an effective antiviral strategy in
development of trait-stable transgenics? Recently, in tis-
sue culture models, impressive results have been
achieved against various plant viruses using RNA inter-
ference to target viral genes (Nicola-Negri et al., 2005;
Pooggin et al., 2003; Waterhouse et al., 2001; Wesley et
an effective strategy against Tomato leaf curl disease
(ToLCD), caused by different variants of Tomato leaf
curl virus globally. Our previous study demonstrated that
antisense technology could specifically suppress the ex-
pression of the Tomato leaf curl New Delhi virus
(Praveen et al., 2005). Present strategies have generated
much more hope for the use of RNAi as a novel antiviral
therapy targeting different variants of the virus by chal-
lenging conserved viral sequences along with the viral
suppressor affecting RNAi machinery (Vanitharani et al.,
2004;Anandlakshmi et al. 1998; Bisaro, 2006).
ToLCD occurs in all the major tomato-growing areas
of the world. In India, the occurrence of the ToLCD is

1
Division of Biochemistry, and 2Advanced Center for Plant Virology, Division of Plant Pathology, Indian Agricultural Research
Institute, New Delhi-110012, India.
*These authors contributed equally to this work.

251
 252
widespread, causing yield reduction and economic
losses, and is continuously emerging in new areas. The
emergence of ToLCD in geographically widely separated
areas suggests the independent origin of the disease in
different regions resulting in greater diversity of the asso-
ciated viruses. The single-stranded DNA genome of the
virus is replicated in the host nuclei via double-stranded
DNA intermediates using a rolling circle mechanism
(Saunders et al., 1991; Stenger et al., 1991). The virus
multiplication relies mostly on the host DNA replication
apparatus with only one virus-encoded protein, replicase,
or replication initiator protein (Rep). The product of the
AC1 ORF, Rep, plays its key role by initiating the rolling
circle replication by virtue of its nicking and ligation
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.
property. An overlapping ORF AC4 with in the AC1
gene is characterized as a pathogenicity determinant as
well as a suppressor of RNAi (Chellappan et al., 2005).
Tomato leaf curl disease is known to be caused by a
large number of geminiviruses, which share only 70–90%
homology in their genomes. In India alone, five distinct
geminiviruses have been reported to cause the disease
(Varma and Malathi, 2003). For establishing RNAi as a
viable approach in managing these viruses multiple siR-
NAs would be required, focusing on the conserved region
of the viral genome (Praveen et al., 2004), as well as tar-
geting the viral suppressor (Nicola-Negri et al., 2005).
Analysis of the replication initiator protein (AC1) gene
from different variants of viruses suggests a conserved
core of 318 nucleotides at the 3’ end of the gene encoding
for Motif III, playing a vital role in viral replication. In
this study, we describe strategies for crossinhibition of
ToLCV replication by siRNAs targeted to various con-
served regions of the AC1 gene. The multiple siRNAs
have been used to target the AC1 gene, including a small
overlapping AC4 gene essential for pathogenicity and
having silencing suppression activity.
MATERIALS AND METHODS
Selection of target sequences
The reference sequences of the conserved regions of the
ToLCV AC1 gene were obtained from the National Center
for Biotechnology Information (NCBI) Web site (www.
ncbi.nlm.nih.gov) and compared with those of ToLCNDV
by nucleotide (nt) BLAST (Dasgupta et al., 2004). The re-
gions of interest encoding for replicase and AC4 proteins
have a relatively conserved nucleotide sequences, as dia-
grammed (Fig. 1). Truncated rep sequences of 479 (T-rep)
were selected based on: (1) sequences from conserved
core of AC1,318 nt (272–590 of the AC1 gene), and (2) se-
quences covering AC4 ORF (suppressor of RNAi), 176 nt
(157–333 of the AC1 gene), capable of producing potent
siRNA, which is analyzed through an siRNA design algo-
rithm DEQOR (Henschel et al., 2004).
RAMESH ET AL.
Besides T-rep sequences, 60 nucleotides (254–313 nu-
cleotides of the AC1 gene) and 80 nucleotides (254–339
nucleotides of the AC1 gene) from this T-rep region were
chosen based on a potent siRNA-producing capability for
self-complementary inverted repeats (IR) and intron
spliced hairpin RNA (Ihp RNA) construct formation, re-
spectively. A region comprised of 21 nucleotides of po-
tent siRNA was selected for a short hairpin RNA
(shRNA) construct.
Plasmid construction for siRNA generation
A truncated rep sequence of 479 nucleotides (129–607
of rep gene) was amplified using specific primers
(5CATCAAGATCTGTGGAGAGAGC3 and 5CGT-
CGATTGGGTCT CGTCTA 3) from the pGEM–T–
EASY rep plasmid as a template. A PCR fragment was
cloned in the pGEM–T–EASY vector and confirmed by
sequencing. T-rep was further subcloned in the pUC 118
vector under the transcription control of the Cauliflower
mosaic virus 35 S promoter and 35S terminator at the
NotI site. The cassette comprised of the 35S promoter, T-
rep, and terminator (1078 bp) was released from the pUC
118 clone using BamHI and HindIII, then subcloned in
pCAMBIA 2301, a binary vector at the respective sites. It
was later transformed to the Agrobacterium tumefaciens
strain LBA 4404.
Self-complementary IR construct
DNA sequences homologous to 60 bases of viral ge-
nome of ToLCNDV consisting of 18 nucleotides from the
AC4 region and 42 nucleotides from the conserved AC1
region were selected. Inverted repeats of 120 bp were syn-
thesized in vitro using Taq polymerase and appropriately
designed oligonucleotides. The sequence spans the viral
genome from 254–313 (Acc. No. AF 524893), and conse-
quently, it includes a potent siRNA-inducing sequence:
CACATTTCCATCCGAACATTC(-sense) and TCGT-
GTAAAGGTAGGCTTGTA(-antisense).
It was cloned in the pUC 118 vector between and under
the transcription control of the Cauliflower mosaic virus
35 S promoter and 35S terminator. The cassette com-
prised of the promoter, the inverted repeat, and the termi-
nator (720 bp) was released from the pUC 118 clone us-
ing EcoRI and Hind III then subcloned in pCAMBIA
2301, a binary vector at the respective sites. It was later
transformed to the A. tumefaciens strain LBA 4404.
Intron spliced hairpin RNA (Ihp RNA) construct
DNA sequences homologous to 80 bases of viral ge-
nome consisting of 18 nucleotides from the AC4 region,
and 62 nucleotides from the conserved core of the AC1
gene were selected. Inverted repeats of 250 bp was syn-
 SILENCING OF TOMATO LEAF CURL VIRUS 253

FIG. 1. Functional domains of replication initiator protein (Rep) of the Tomato leaf curl virus; truncated Rep (T-rep) targets
DNA binding, cleavage, and oligomerization domains. It also includes motif III and Tyr103 (Y).
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.

thesized in vitro as described earlier with an intron (Poog-
gin et al., 2003) of 85 bp placed between the repeats. The
sequence spans the viral genome from 254–339 (Acc. No.
AF 524893) and consequently, it includes a potent
siRNA-inducing sequence as mentioned previously. It
was cloned in the pUC 118 vector between and under the
transcription control of the Cauliflower mosaic virus 35 S
promoter and 35S terminator. The cassette comprising of
the promoter, the inverted repeat, and the terminator (850
bp) was released from the pUC 118 clone using EcoRI
and HindIII, then subcloned in pCAMBIA 2301, a binary
vector at the respective sites. It was later transformed to
the A. tumefaciens strain LBA 4404.
Short hairpin RNA (sh RNA) construct
A DNA sequence of 21 bases homologous to potent
siRNA in the viral genome (254–274) was selected for
synthesis of short inverted repeats with an eight nucleo-
tide sequence for loop formation. It was cloned in the
pUC118 vector between and under the transcription con-
trol of the Cauliflower mosaic virus 35 S promoter and
35S terminator. The cassette comprising of the promoter,
the inverted repeat, and the terminator (50 bp) was re-
leased from the pUC 118 clone using EcoRI and HindIII,
then subcloned in pCAMBIA 2301, a binary vector at the
respective sites. It was later transformed to the A. tumefa-
ciens strain LBA 4404.
Gene silencing studies
Tomato plants infected with the Tomato leaf curl virus
were maintained in a glasshouse condition through
whitefly transmission. For gene silencing assays, calli
derived from young symptomatic leaves were regener-
ated and cocultivated separately with Agrobacterium car-

FIG. 2. Different hairpin-mediated RNAi strategies targeting different viral sequences capable of producing potent siRNA and
their predicted RNA structures.
 A
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.

FIG. 3. Gene silencing studies. (A) Structure of Ihp and IR pre-siRNA constructs represented as hairpin RNAs. siRNA targeting
viral AC1 RNA is expressed in the tomato. (B) Transgenic tomato plants expressing different RNAi constructs showed recovery
from ToLCV infection. Morphological abnormalities were also associated with plants expressing shRNA gene constructs. Healthy
and infected tomato plants were used as controls. (C) The efficacy of the viral gene silencing was ascertained by the presence or
the absence of ToLCV coat protein gene through PCR.
 SILENCING OF TOMATO LEAF CURL VIRUS
rying the constructs (McCormick, 1991). Explants were
incubated in Petri plates on callusing medium containing
MSsalts, vitamins, 3% sucrose, 0.2 mg/L NAA, 1 mg/L
BAP, 50 mg/L kanamycin (in the case of cocultivated ex-
plants), and 200 mg/L cefotaxime (pH 5.8). The culture
conditions were 25°C for a 16-hour photoperiod. They
were later transferred to shooting and rooting medium,
respectively (MS salts, 2.5 mg/L BAP, 0.5 mg/L IBA;
half MS, 0.2 mg/L NAA, respectively). Kanamycin
(50–100 mg/ L) was used for selection of transgenic
tomato plants. The rooted explants were transplanted into
small pots containing a sterilized (soil:peat:vermiculite,
1:1:1) mixture for establishment. The transformed as
well as the nontransformed plants were shifted to large
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.
earthen pots in the greenhouse before being assayed for
the presence of virus.
Transformed and nontransformed plants were ob-
served for the development of leaf curl symptoms from
the shooting stage onward and the presence/absence of
virus was substantiated by PCR analysis using specific
primers (forward primer: 5-TTGGATCCATGGCGA-
AGCGACCA-3 and reverse primer 5-AAGAGCTCT-
TAATTTGTGACCGA-3) for the coat protein gene
(AV1;AY390957) of ToLCV.
RESULTS AND DISCUSSION
DEQOR, a Web-based siRNA design algorithm, was
employed to find potent siRNA oligonucleotide se-
quences with the entire AC1 gene (AF 524893) as an in-
put query. The algorithm evaluated the query in silico for
its ability to induce sequence-specific AC1 gene silencing
and for its ability to cross-silence genes different from the
target by performing BLAST searches against the genome
of Arabidopsis and Oryza. The siRNA scoring system of
the algorithm displayed 10 effective siRNAs, among
these one potent siRNA with favorable GC content of
42.9%, antisense preference, no polynucleotide feature,
no cross-silencing ability on the plant genome, possessing
a target sequence against both AC4 and the conserved
AC1 gene was selected for RNAi based construct devel-
% of recovered plants
opment. The conserved target region corresponds to the
Motif III of the replicase protein, and contributes to DNA
binding, cleavage, and oligomerization domains. It also
targets conserved residue, Tyr103(Y), involved at the ac-
tive site of the protein (Fig. 1).
The siRNAs targeted to the conserved regions of
ToLCV rep gene were designed by the antisense, IR,
Ihp, and sh RNA approach, as shown in Figure 2. To
study the efficacy of constructs in silencing viral ge-
nome, these constructs were mobilized in a healthy and
ToLCV-infected tomato through Agrobacterium-medi-
ated transformation as discussed by Praveen et al.
(2005). About 38 out of 40 ToLCV-infected explants,
255
when transformed with each of antisense T-rep, IR, and
Ihp gene constructs were found to be fully recovered
from the virus infection, while the non-transformed
(regenerated from the ToLCV-infected leaf) plants
showed the typical leaf curl symptom, poor growth,
and poor root formation. Recovery of infected plants
from virus infection was supported at the molecular
level by the PCR-based analysis of the presence or ab-
sence of the viral coat protein gene. The suppression of
the viral genome was confirmed by the nonamplifica-
tion of the coat protein gene in plants transformed with
Agrobacterium containing the RNAi constructs against
the control (Fig. 3C). The percentage of recovery of
transformed plants using different RNAi constructs
varied from 80% to 95% (Fig. 4). The differential si-
lencing in terms of percentage recovery might be at-
tributed to the construct efficacy or positional effect of
the transgene integration. Recovered plants showed
faster growth in each plant transformation stage. Mor-
phologically abnormal transformants (showing shoot
initiation without the auxiliary buds) were also ob-
tained when transformed with a shRNA construct, indi-
cating cross-silencing of plant transcripts. The results
suggested that the siRNA generated by antisense T-rep,
IR, and Ihp were found to be more effective in silenc-
ing viral infection. However, shRNA construct produc-
ing 21 nucleotides siRNA homologous to potent
siRNA in the viral genome (254–274) may be involved
in cross-silencing of the host genome (Fig. 3B).
Previously, we have investigated the efficacy of the an-
tisense full-length rep gene construct in silencing the ho-
mologous viral genome (Praveen et al., 2005) as the
plants regenerated from ToLCV-infected tomato ex-
plants fully recovered when transformed with the anti-
sense rep gene construct. In the present study, we have
further demonstrated that siRNAs directed to the con-
served regions of the ToLCV rep gene and targeting the
100
90
80
70
60 Normal
50 Abnormal
40
30
20
10
0
T-Rep IR Ihp RNA shRNA
RNAi Constructs
FIG. 4. Percentage of tomato plants recovered from viral in-
fection upon transformation with various RNAi constructs.
 256
AC4 region through antisense T-rep, IR, and Ihp, could
inhibit the expression of existing leaf curl virus. How-
ever, unexpected behavior of shRNA construct may be
attributed to cross-silencing of the tomato genome. Our
data suggest that it is feasible to produce multiple siR-
NAs, focusing on the conserved regions of the viral ge-
nome, against the high genetic variability of tomato leaf
curl viruses or the viral escape.
The Rep gene was chosen as targets in this study for
two reasons. First, it is well known that rep-mediated re-
sistance is successful against geminiviruses (Aragao et
al., 1998; Asad et al., 2003; Yang et al., 2004), it has an
overlapping ORF AC4 corresponding to suppressor of
RNAi. Therefore, in order to realize efficient RNAi in-
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.
duction, it is important to screen appropriate target re-
gions along the ToLCV rep gene conferring a strong
RNAi activity. Secondly, because of the high genetic
variability of ToLCVs, the relatively conserved regions
with important functions were focused on. At present,
there is a lack of clear understanding on the mechanisms
that determine the gene-silencing efficiency of a given
siRNA. Recent studies show that the gene-silencing effi-
ciency of siRNA is strongly dependent on the local struc-
ture of mRNA at the targeted region. To further test the
relationship between silencing efficiency and targeted
mRNA, work needs to be done on these aspects. Addi-
tionally, in our study, the unusual characteristics (with no
apical buds) of transformed tomato with shRNA seems
apparently cross-silencing some vital gene of the tomato,
for which further work is required to evaluate if tomato
transcripts are being cross-silenced with the siRNA of
shRNA gene construct.
Our results take RNAi-based antiviral strategy a step
forward to the control of ToLCD. Other than viral es-
cape, several critical issues need to be addressed to im-
prove RNAi effectiveness as an antiviral strategy. It is
anticipated that the researchers would convert more and
more new laboratory approaches based on RNAi to effec-
tive procedures to treat viral diseases.
REFERENCES
ANANDLAKSHMI, R., PRUSS, G.J., GE, X., MARATHE,
R., MALLORY, A.C., SMITH, T.H. and VANCE, V.B.
(1998). A viral suppressor of gene silencing in plant. Proc.
Natl. Acad. Sci. USA 95, 13079–13084.
ARAGAO, F.J.L., RIBEIRO, S.G., BARROS, L.M.J.,
BRASILEIRO, A.C.M., MAXWELL, D.P., RECH, E.L.,
and FARIA, J.C. (1998). Transgenic beans (Phaseolus vul-
garis L.) engineered to express viral antisense RNAs show
delayed and attenuated symptoms to bean golden mosaic
geminivirus. Mol. Breed 4, 491–499.
ASAD, S., HARIS, W.A., BASHIR, A., ZAFAR, Y., MALIK,
K.A., MALIK, N.N. and LICHTENSTEI, C.P. (2003).Trans-
genic tobacco expressing geminiviral RNAs are resistant to
RAMESH ET AL.
the serious viral pathogen causing cotton leaf curl disease.
Arch. Virol. 148, 2341–2352.
BISARO, D.M. (2006). Silencing suppression by geminivirus
proteins. Virology 344, 158–168.
CHELLAPPAN, P., VANITHARANI, R., FAUQUET, C.M.
(2005) MicroRNA-binding viral protein interferes with Ara-
bidopsis development. Proc. Natl. Acad. Sci. USA 102,
10381–10386.
DASGUPTA, A., SINHA, S.K., and PRAVEEN, S. (2004).
Structure of replication initiator protein unites diverse
viruses causing tomato leaf curl disease (ToLCD). Plant Sci.
166, 1063–1067.
DING, S.W., LI, H., LU, R., and LI, W.X. (2004). RNA silenc-
ing: a conserved antiviral immunity of plants and animals.
Virus Res. 102, 109–115.
HENSCHEL, A., BUCHILZ, F., and HABERMANN, B.
(2004). DEQOR: a web-based tool for the design and quality
control of siRNAs. Nucleic Acids Res. 32, 113–120.
MCCORMICK, S. (1991). Transformation of tomato with
Agrobacterium tumefaciens. Plant Tissue Cult. Manual B6,
1–9.
NICOLA-NEGRI, D.E., BRUNETTI, A., TAVAZZA, M.
and ILARDI, V. (2005). Hairpin RNA mediated silencing
of Plum pox virus P1 and HC-Pro genes for efficient and
predictable resistance to the virus. Transgenic Res. 14,
989–994.
POOGGIN, M., SHIVAPRASAD, P.V., VELUTHAMBI, K.
and HOHN, T. (2003). RNAi targeting of DNA virus in
plants. Nat. Biotechnol. 21, 131–132.
PRAVEEN, S., DASGUPTA, A., and VARMA, A. (2004).
Phylogenetic analysis and homologies of the replicase
of tomato leaf curl geminiviruses: implications for obtain-
ing pathogen derived resistance. Virus Gene 28, 197–
201.
PRAVEEN, S., MISHRA, A.K., and DSGUPTA, A. (2005)
Antisense suppression of replicase gene expression recovers
tomato plants from leaf curl virus infection. Plant Sci. 168,
1011–1014.
RATCLIFF, F., HARRISON, B., and BAULCOMBE, D.C.
(1997). A similarity between viral defense and gene silencing
in plants. Science 276, 1558–1560.
RATCLIFF, F., MACFARLANE, S., and BAULCOMBE,
D.C. (1999). Gene silencing with out DNA: RNA mediated
cross protection between viruses. Plant Cell 11,
1207–1215.
SAUNDERS, K., LUCY, A., and STANLEY, J. (1991). DNA
forms of the geminivirus of African cassava mosaic virus
consistent with a rolling circle mechanism of replication. Nu-
cleic Acids Res. 19, 2325–2330.
STENGER, D.C., REVINGTON, G.N., STEVENSON, M.C.
and BISARO, D.M. (1991). Replicational release of gemi-
nivirus genomes from tandemly repeated copies: evidence
for rolling-circle replication of a plant viral DNA. Proc. Natl.
Acad. Sci. USA 88, 8029–8033.
VANITHARANI, R., CHELLAPPAN, P., PITA, J.S., and
FAUQUET, C. (2004). Differential roles of AC2 and AC4 of
cassava geminiviruses in mediating synergism and suppres-
sion of posttranscriptional gene silencing. J. Virol. 78,
9478–9498.
VARMA, A., and MALATHI, V.G. (2003). Emerging gemi-
 SILENCING OF TOMATO LEAF CURL VIRUS
nivirus problems: a serious threat crop production. Ann.
Appl. Biol. 142, 145–164.
VOINNET, O. (2001). RNA silencing as a plant immune sys-
tem against viruses. Trends Genet. 17, 449–459.
WATERHOUSE, P.M., WANG, M.B., and LOUGH T. (2001).
Gene silencing as an adaptive defence against viruses. Nature
411, 834–842.
WESLEY, V., HELLIWELL, C.A., SMITH, N.A., WANG,
M.B., ROUSE, D.T., LIU, Q., GOODING, P.S., SINGH,
S.P., ABBOTT, D., STOUTJESDIJK, P.A., ROBINSON,
S.P., GLEAVE, A.P., GREEN, A.G., and WATERHOUSE,
P.M. (2001). Construct design for efficient, effective and
high-throughput gene silencing in plants. Plant J. 27,
581–591.
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.
257
YANG, Y., SHERWOOD, T.A., PATTE, C.P., HIEBERT, E.
and POLSTON, J.E., (2004). Use of Tomato yellow leaf curl
virus (TYLCV) rep gene sequences to engineer TYLCV resis-
tance in tomato. Phytopathology 94(5), 491–496.
Address reprint requests to:
S. Praveen
Advanced Center for Plant Virology
Division of Plant Pathology
Indian Agriculture Research Institute
New Delhi 110012, India
E-mail: shellypraveen@hotmail.com
 This article has been cited by:

1. Yi-Shu Chiu, Yuh Tzean, Yi-Hui Chen, Chi-Wei Tsai, Hsin-Hung Yeh. 2021. Fungal F8-Culture Filtrate Induces Tomato
Resistance against Tomato Yellow Leaf Curl Thailand Virus. Viruses 13:8, 1434. [Crossref]
2. Hymavathi Salava, Sravankumar Thula, Vijee Mohan, Rahul Kumar, Fatemeh Maghuly. 2021. Application of Genome Editing in
Tomato Breeding: Mechanisms, Advances, and Prospects. International Journal of Molecular Sciences 22:2, 682. [Crossref]
3. Anurag Kumar Sahu, Neeti-Sanan Mishra, Rajarshi Kumar Gaur. Suppressor to Survival: RNAi as a Molecular Weapon in Arms
Race Between Virus and Host 131-154. [Crossref]
4. Konstantin B. Blyuss, Fahad Al Basir, Victoria A. Tsygankova, Liudmyla O. Biliavska, Galyna O. Iutynska, Serhii N. Kyrychko,
Serhii V. Dziuba, Olexandr I. Tsyliuryk, Olexandr O. Izhboldin. 2020. Control of mosaic disease using microbial biostimulants:
insights from mathematical modelling. Ricerche di Matematica 69:2, 437-455. [Crossref]
5. Ramanna Koulagi, Sagar Banerjee, Bharat H. Gawade, Ashish Kumar Singh, P. K. Jain, Shelly Praveen, K. Subramaniam, Anil
Sirohi. 2020. Host-delivered RNA interference in tomato for mediating resistance against Meloidogyne incognita and Tomato
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.

leaf curl virus. Plant Cell, Tissue and Organ Culture (PCTOC) 143:2, 345-361. [Crossref]
6. T. Vinutha, S. Vanchinathan, Navita Bansal, Gaurav Kumar, Vipin Permar, Archana Watts, S. V. Ramesh, Shelly Praveen. 2020.
Tomato auxin biosynthesis/signaling is reprogrammed by the geminivirus to enhance its pathogenicity. Planta 252:4. . [Crossref]
7. Özge Çelik, Sinan Meriç, Alp Ayan, Çimen Atak. Biotic stress-tolerant plants through small RNA technology 435-468. [Crossref]
8. Vidya Sagar, Pradip Karmakar, Jyoti Devi, Nakul Gupta, Bharat Raj Meena. Begomovirus Menace and Its Management in
Vegetable Crops 493-521. [Crossref]
9. H.A. Walsh, H. Vanderschuren, S. Taylor, M.E.C. Rey. 2019. RNA silencing of South African cassava mosaic virus in transgenic
cassava expressing AC1/AC4 hp- RNA induces tolerance. Biotechnology Reports 24, e00383. [Crossref]
10. Shunmugiah V. Ramesh, Maranna Shivakumar, Shelly Praveen, Bhagat S. Chouhan, Suresh Chand. 2019. Expression of short
hairpin RNA (shRNA) targeting AC2 gene of Mungbean yellow mosaic India virus (MYMIV) reduces the viral titre in soybean.
3 Biotech 9:9. . [Crossref]
11. Neelam Chaudhary, Arun Kumar, Baudh Bharti. Functional Genomics of Microbial Pathogens for Crop Improvement 145-162.
[Crossref]
12. T. Vinutha, Gaurav Kumar, Varsha Garg, Tomas Canto, Peter Palukaitis, S.V. Ramesh, Shelly Praveen. 2018. Tomato geminivirus
encoded RNAi suppressor protein, AC4 interacts with host AGO4 and precludes viral DNA methylation. Gene 678, 184-195.
[Crossref]
13. Ru Yu, Caixia Chen, Weilin Cao, Hongmei Liu, Shumei Zhou, Yunzhi Song, Changxiang Zhu. 2018. High-degree and broad-
spectrum resistance mediated by a combination of NIb siRNA and miRNA suppresses replication of necrotic and common strains
of potato virus Y. Archives of Virology 163:11, 3073-3081. [Crossref]
14. Krishan Kumar, Chetana Aggarwal, Sapna, Ishwar Singh, Pranjal Yadava. Microbial Genes in Crop Improvement 39-56. [Crossref]
15. Sanjeev Kumar, Bhaben Tanti, Basavaprabhu L. Patil, Sunil Kumar Mukherjee, Lingaraj Sahoo. 2017. RNAi-derived transgenic
resistance to Mungbean yellow mosaic India virus in cowpea. PLOS ONE 12:10, e0186786. [Crossref]
16. Enrique Moriones, Shelly Praveen, Supriya Chakraborty. 2017. Tomato Leaf Curl New Delhi Virus: An Emerging Virus Complex
Threatening Vegetable and Fiber Crops. Viruses 9:10, 264. [Crossref]
17. Shunmugiah Ramesh, Pranav Sahu, Manoj Prasad, Shelly Praveen, Hanu Pappu. 2017. Geminiviruses and Plant Hosts: A Closer
Examination of the Molecular Arms Race. Viruses 9:9, 256. [Crossref]
18. Shelly Praveen, S. V. Ramesh, Satendra Kumar Mangrauthia. Transgenic Approaches to Combat Plant Viruses Occurring in India
783-805. [Crossref]
19. Savarni Tripathi, Raj Verma. Begomoviruses in India 171-186. [Crossref]
20. Huei-mei Chen, Chen-yu Lin, Wen-shi Tsai, Lawrence Kenyon, Ming-tsair Chan, Jo-yi Yen, Shao-yu Chang, Robert de la Peña,
Roland Schafleitner. 2016. Resistance to viral yellow leaf curl in tomato through RNAi targeting two Begomovirus species strains.
Journal of Plant Biochemistry and Biotechnology 25:2, 199-207. [Crossref]
21. Pranav Pankaj Sahu, Manoj Prasad. 2015. Application of molecular antiviral compounds: novel approach for durable resistance
against geminiviruses. Molecular Biology Reports 42:7, 1157-1162. [Crossref]
22. Gnanasekaran Shanmugapriya, Sudhanshu Sekhar Das, Karuppannan Veluthambi. 2015. Transgenic tobacco plants expressing
siRNA targeted against the Mungbean yellow mosaic virus transcriptional activator protein gene efficiently block the viral DNA
accumulation. VirusDisease 26:1-2, 55-61. [Crossref]
 23. Veerendra Kumar Sharma, Nirbhay Kushwaha, Saumik Basu, Ashish Kumar Singh, Supriya Chakraborty. 2015. Identification of
siRNA generating hot spots in multiple viral suppressors to generate broad-spectrum antiviral resistance in plants. Physiology and
Molecular Biology of Plants 21:1, 9-18. [Crossref]
24. Jian Ye, Jing Qu, Hui-Zhu Mao, Zhi-Gang Ma, Nur E Rahman, Chao Bai, Wen Chen, Shu-Ye Jiang, Srinivasan Ramachandran,
Nam-Hai Chua. 2014. Engineering geminivirus resistance in Jatropha curcus. Biotechnology for Biofuels 7:1. . [Crossref]
25. Sheng Sun, Xiu-Ping Kang, Xiao-Juan Xing, Zhi-Feng Chen, Shao-Wen Zheng, Guo-Ming Xing. 2014. Transient expression of
siRNA targeted against the TYLCV AV1, AC1 and AC3 genes for high resistance in tomato. Scientia Horticulturae 179, 321-327.
[Crossref]
26. Yun-Zhi Song, Quan-Jun Han, Fang Jiang, Run-Ze Sun, Zhi-Hang Fan, Chang-Xiang Zhu, Fu-Jiang Wen. 2014. Effects of the
sequence characteristics of miRNAs on multi-viral resistance mediated by single amiRNAs in transgenic tobacco. Plant Physiology
and Biochemistry 77, 90-98. [Crossref]
27. Md. Abul Kalam Azad, Latifah Amin, Nik Marzuki Sidik. 2014. Gene Technology for Papaya Ringspot Virus Disease
Management. The Scientific World Journal 2014, 1-11. [Crossref]
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.

28. Diana Medina-Hernández, Rafael Rivera-Bustamante, Francisco Tenllado, Ramón Holguín-Peña. 2013. Effects and Effectiveness
of Two RNAi Constructs for Resistance to Pepper golden mosaic virus in Nicotiana benthamiana Plants. Viruses 5:12, 2931-2945.
[Crossref]
29. Veer B. Singh, Q.M.R. Haq, V.G. Malathi. 2013. Antisense RNA approach targeting Rep gene of Mungbean yellow mosaic India
virus to develop resistance in soybean. Archives Of Phytopathology And Plant Protection 46:18, 2191-2207. [Crossref]
30. L. Zhang, X. Xie, Y. Song, F. Jiang, C. Zhu, F. Wen. 2013. Viral resistance mediated by shRNA depends on the sequence similarity
and mismatched sites between the target sequence and siRNA. Biologia plantarum 57:3, 547-554. [Crossref]
31. Sukumaran Sunitha, Gnanasekaran Shanmugapriya, Veluthambi Balamani, Karuppannan Veluthambi. 2013. Mungbean yellow
mosaic virus (MYMV) AC4 suppresses post-transcriptional gene silencing and an AC4 hairpin RNA gene reduces MYMV DNA
accumulation in transgenic tobacco. Virus Genes 46:3, 496-504. [Crossref]
32. Sivakumar Prasanth Kumar, Saumya K. Patel, Ravi G. Kapopara, Yogesh T. Jasrai, Himanshu A. Pandya. 2012. Evolutionary and
Molecular Aspects of Indian Tomato Leaf Curl Virus Coat Protein. International Journal of Plant Genomics 2012, 1-12. [Crossref]
33. Vidhu Verma, Shweta Sharma, S. Vimla Devi, S. Rajasubramaniam, Indranil Dasgupta. 2012. Delay in virus accumulation and low
virus transmission from transgenic rice plants expressing Rice tungro spherical virus RNA. Virus Genes 45:2, 350-359. [Crossref]
34. S. ROY, A. BANERJEE, J. TARAFDAR, B. K. SENAPATI, I. DASGUPTA. 2012. Transfer of transgenes for resistance to rice
tungro disease into high-yielding rice cultivars through gene-based marker-assisted selection. The Journal of Agricultural Science
150:5, 610-618. [Crossref]
35. Basanta K Borah, Indranil Dasgupta. 2012. Begomovirus research in India: A critical appraisal and the way ahead. Journal of
Biosciences 37:4, 791-806. [Crossref]
36. Avinash Marwal, Rajneesh Prajapat, Anurag Kumar Sahu, R.K. Gaur. 2012. Current Status of Geminivirus in India: RNAi
Technology, A Challenging Cure. Asian Journal of Biological Sciences 5:6, 273-293. [Crossref]
37. Ching-Yi Lin, Wen-Shi Tsai, Hsin-Mei Ku, Fuh-Jyh Jan. 2012. Evaluation of DNA fragments covering the entire genome of
a monopartite begomovirus for induction of viral resistance in transgenic plants via gene silencing. Transgenic Research 21:2,
231-241. [Crossref]
38. Surekha Agarwal, Muthugounder Mohan, Satendra K. Mangrauthia. RNAi: Machinery and Role in Pest and Disease Management
447-469. [Crossref]
39. Jin Ma, Yunzhi Song, Bin Wu, Mingsong Jiang, Kaidong Li, Changxiang Zhu, Fujiang Wen. 2011. Production of transgenic
rice new germplasm with strong resistance against two isolations of Rice stripe virus by RNA interference. Transgenic Research
20:6, 1367-1377. [Crossref]
40. Thomas Hohn, Franck Vazquez. 2011. RNA silencing pathways of plants: Silencing and its suppression by plant DNA viruses.
Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1809:11-12, 588-600. [Crossref]
41. Betty E. Owor, Darren P. Martin, Edward P. Rybicki, Jennifer A. Thomson, Marion E. Bezuidenhout, Francisco M. Lakay,
Dionne N. Shepherd. 2011. A rep-based hairpin inhibits replication of diverse maize streak virus isolates in a transient assay.
Journal of General Virology 92:10, 2458-2465. [Crossref]
42. Owen Wally, J Jayaraj, Zamir Punja. Transgenic Vegetables 31-54. [Crossref]
43. Xuemei Chen, Jing Liu, Li Xu, Fang Jiang, Xueying Xie, Changxiang Zhu, Fujiang Wen. 2010. Inhibiting Virus Infection by RNA
Interference of the Eight Functional Genes of the Potato Virus Y Genome. Journal of Phytopathology 158:11-12, 776-784. [Crossref]
 44. Jaya Soneji, Madhugiri Rao, Padmini Sudarshana, Jogeswar Panigrahi, Chittaranjan Kole. Current Status of On-going Genome
Initiatives 305-353. [Crossref]
45. Zhi-Yong Zhang, Feng-Ling Fu, Lin Gou, Han-Guang Wang, Wan-Chen Li. 2010. RNA Interference-Based Transgenic Maize
Resistant to Maize Dwarf Mosaic Virus. Journal of Plant Biology 53:4, 297-305. [Crossref]
46. Alessandra Frizzi, Shihshieh Huang. 2010. Tapping RNA silencing pathways for plant biotechnology. Plant Biotechnology Journal
8:6, 655-677. [Crossref]
47. R. C. de la Pen˜a, P. Kadirvel, S. Venkatesan, L. Kenyon, J. Hughes. Integrated Approaches to Manage Tomato Yellow Leaf Curl
Viruses 105-132. [Crossref]
48. Shelly Praveen, S. V. Ramesh, Anil K. Mishra, Vikas Koundal, Peter Palukaitis. 2010. Silencing potential of viral derived RNAi
constructs in Tomato leaf curl virus-AC4 gene suppression in tomato. Transgenic Research 19:1, 45-55. [Crossref]
49. Masayuki Isshiki, Hiroaki Kodama. Plant RNAi and Crop Improvement 653-673. [Crossref]
50. Satendra K. Mangrauthia, Priyanka Singh, Shelly Praveen. 2010. Genomics of Helper Component Proteinase Reveals Effective
Strategy for Papaya Ringspot Virus Resistance. Molecular Biotechnology 44:1, 22-29. [Crossref]
Downloaded by University Of Illinois At Urbana-champaign from www.liebertpub.com at 10/31/21. For personal use only.

51. Rahma Jardak-Jamoussi, Patrick Winterhagen, Badra Bouamama, Cornelia Dubois, Ahmed Mliki, Thierry Wetzel, Abdelwahed
Ghorbel, Goetz M. Reustle. 2009. Development and evaluation of a GFLV inverted repeat construct for genetic transformation
of grapevine. Plant Cell, Tissue and Organ Culture (PCTOC) 97:2, 187-196. [Crossref]
52. Dionne N. Shepherd, Darren P. Martin, Jennifer A. Thomson. 2009. Transgenic strategies for developing crops resistant to
geminiviruses. Plant Science 176:1, 1-11. [Crossref]
53. Satendra K. Mangrauthia, B. Parameswari, R. K. Jain, Shelly Praveen. 2008. Role of Genetic Recombination in the Molecular
Architecture of Papaya ringspot virus. Biochemical Genetics 46:11-12, 835-846. [Crossref]
54. Himani Tyagi, Shanmugam Rajasubramaniam, Manchikatla Venkat Rajam, Indranil Dasgupta. 2008. RNA-interference in rice
against Rice tungro bacilliform virus results in its decreased accumulation in inoculated rice plants. Transgenic Research 17:5,
897-904. [Crossref]