Journal of Functional Foods 76 (2021) 104319

Contents lists available at ScienceDirect

Journal of Functional Foods

journal homepage: www.elsevier.com/locate/jff

Total flavonoids extracted from the leaves of Murraya paniculata (L.) Jack
alleviate oxidative stress, inflammation and apoptosis in a rat model of
diabetic cardiomyopathy
Jingtao Zou, Dayun Sui, Wenwen Fu, Yuangeng Li, Ping Yu, Xiaofeng Yu, Huali Xu *
Department of Pharmacology, School of Pharmaceutical Sciences, Jilin University, Changchun 130021, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: The leaves of Murraya paniculata (L.) Jack were used as spices in China for many years. Flavonoids are the main
Murraya paniculata (L.) Jack components of it. However, no study has determined whether the total flavonoids of Murraya paniculata (L.) Jack
Diabetic cardiomyopathy (TFMP) has preventive effects on diabetic cardiomyopathy (DCM).The present study investigated the effect of
Oxidative stress
TFMP on DCM. STZ was administered along with a high-fat diet to induce diabetes in rats. Parallel experiments
Inflammation
were performed using H9c2 cells exposed to high glucose. Diabetic rats showed serious histological changes and
increased levels of cardiac function markers. The markers of ROS, inflammation and apoptosis were also
increased significantly, but the antioxidant defenses were decreased. Treatment with TFMP alleviated histo­
logical alteration in the myocardium. TFMP suppressed oxidative stress, inflammation and apoptosis. Our results
demonstrate that the protective of TFMP on DCM is associated with increasing Nrf2 and HO-1 gene expression
and inhibiting oxidative stress, inflammation and apoptosis.

1. Introduction development is unclear. Moreover, several studies have shown that

Diabetes mellitus (DM) is a group of chronic metabolic disorders
characterized by a high blood glucose level over a prolonged period of
time. With the number of people developing DM increasing exponen­
tially, DM has become one of the most common public health concerns
globally. An estimated 382 million people worldwide have diabetes, and
this number is expected to reach 592 million by 2035 (Guariguata et al.,
2014). High blood glucose levels can lead to the development of serious
life-threatening complications such as stroke, retinopathy, neuropathy,
nephropathy, and cardiomyopathy (Low Wang, Hess, Hiatt, & Goldfine,
2016). Cardiovascular complications such as atherosclerosis, myocar­
dial infarction, and cardiomyopathy are the major cause of death in
nearly 50% of DM patients. The incidence rate of cardiomyopathy in DM
patients is 2 to 5 times higher than that in non-diabetic patients (Kannel,
Hjortland, & Castelli, 1974). Diabetic cardiomyopathy (DCM) is char­
acterized by myocardial systolic and/or diastolic dysfunction, oxidative
stress, inflammation, cardiomyocyte apoptosis, interstitial fibrosis, and
was first defined by Rubler in 1972(Rubler et al., 1972). The cardiac
function of DCM patients declines over time. The process is irreversible
and ultimately leads to heart failure. However, the mechanism of DCM
unbalanced energy metabolism, oxidative stress, inflammation, and
apoptosis contribute to DCM development (Althunibat et al., 2019; H. Li
et al., 2019; K. Li et al., 2019). Table 1.
The leaves of Murraya paniculata (L.) Jack were used as spices in
China for many years. Murraya paniculata (L.) Jack, named Qianlixiang,
belongs to the family of Rutaceae. It is widely distributed in South China
(Fujian, Guangdong, Guangxi and Yunan provinces), India, and
Thailand. Qianlixiang exhibits several anti-anxiety, anti-depression
(Sharma, Batra, Kumar, & Sharma, 2017), anti-inflammation(X. Wang
et al., 2019; Wu, Liu, & Shi, 2016), and anti-microbial activities(I. R.
Menezes et al., 2015). Menezes showed that the hydroalcoholic extract
of M. paniculata had a glucose-lowering effect on alloxan-induced dia­
betic rats, and it reduced tissue lesions developed in diabetes(C. D. A.
Menezes et al., 2017). Many active components, such as flavonoids(J. Y.
Zhang et al., 2011), coumarins(Saied, Nizami, & Anis, 2008), and al­
kaloids(Wang et al., 2018), have been isolated from Murraya paniculata.
Our previous study showed that total flavonoids extracted from the
leaves of M. paniculata (TFMP) can effectively prevent kidney damage in
diabetic rats by regulating oxidative stress and levels of inflammation
cytokines(Zou et al., 2014).

* Corresponding author at: Departments of Pharmacology, School of Pharmaceutical Sciences, Jilin University. 1266 Fujin road, Changchun 130021, Jilin Province,
PR China.
E-mail address: xhl@jlu.edu.cn (H. Xu).

https://doi.org/10.1016/j.jff.2020.104319
Received 28 August 2020; Received in revised form 23 November 2020; Accepted 29 November 2020
Available online 11 December 2020
1756-4646/© 2020 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
J. Zou et al. Journal of Functional Foods 76 (2021) 104319

Table 1 (Shanghai, China). All chemicals used in this study were of analytical
Primers for qPCR. grade. Rat H9c2 cardiomyocyte cells were obtained from Shanghai
Gene Forward primer (5′ -3′ ) Reverse primer (5′ -3′ ) Institute of Cell Biology, Chinese Academic of Sciences (Shanghai,
China). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine
Nrf2 TTGTAGATGACCATGAGTGC TGTCCTGCTGTATGCTGCTT
HO-1 CACGCATATACCCGCTACCT AAGGCGGTCTTAGCCTCTTC serum were purchased from Life Technologies (Grand Island, NY, USA).
TNF-α AGCATGATCCGAGTGTGGAA TAGACAGAAGAGCGTGGTGGC
IL-6 GTTGCCTTCTTGGGACTGATG ATACTGGTCTGTTGTGGGTGGT 2.2. Extraction of TFMP
β-actin CAGGGTGTGATGGTGGGTATG ATGCCTCTCTTGCTCTGGG

The leaves of Murraya paniculata (L.) Jack were procured from

Flavonoids are a vast group of polyphenols found ubiquitously in
plant and have received considerable attention because of their car­
dioprotective function(Liu et al., 2017; Lv, Cheng, Tang, & Jiang, 2017).
However, no study has so far determined whether TFMP has potential
preventive effects on DCM induced by a high-fat diet combined with
streptozotocin (STZ) and the potential mechanisms of action. Therefore,
the present study was designed to confirm the cardioprotective effect of
TFMP on high glucose (HG)-induced H9c2 cardiac myoblasts and dia­
betic rats.
2. Materials and methods
2.1. Reagents and antibodies
Kunming (Yunnan Province, China), and identified by Professor Minglu
Deng of Changchun University of Traditional Chinese medicine. The
dried leaves were crushed, and 85% ethanol was added and the mixture
was refluxed extraction for three times to afford the ethanol concentrate.
Ethanol concentrate was adsorbed by D4020 macroporous resin column
and desorbed with 85% ethanol to obtain ethanol desorption solution.
After decolorization by D941 macroporous resin column, ethanol was
recovered under reduced pressure and dried at 80 ℃ for 2 h to afford the
crude extract of total flavonoids .The crude of total flavonoids (crude
flavonoids: silica gel mass = 1:10), eluted with eluent, recovered under
reduced pressure, dried at 105 ℃ for 2 h to afford the total flavonoids of
Murraya paniculata (L.) Jack (TFMP). The total amount of flavonoids
should not be<50% by HPLC (Fig. 1).

TFMP was provided by Dr. Yongri Jin (College of Chemistry, Jilin
University). Streptozotocin (STZ) was purchased from Sigma Chemicals
(St. Louis, MO, USA). Malondialdehyde (MDA), superoxide dismutase
(SOD), glutathione peroxidase (GSH-Px), troponin I (cTnI), creatine
kinase-MB (CK-MB), and lactate dehydrogenase (LDH) were purchased
from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). An­
tibodies against Bax and Bcl-2 were obtained from Cell Signaling
Technology (Beverly, MA, USA). Antibody against β-actin was obtained
from ZSGB-BIO (Beijing, China). Goat anti-rabbit and goat anti-mouse
secondary antibodies were purchased from Beijing Dingduo Chang­
sheng Biotechnology (Beijing, China). A quantitative polymerase chain
reaction (qPCR) kit was obtained from Beijing TransGen Biotech (Bei­
jing, China). A TUNEL kit was obtained Institute of Biotechnology
(Jiangsu, China). An annexin V–fluorescein isothiocyanate (FITC)
apoptosis detection kit was obtained from Tianjin Sungene Biotech Co.,
Ltd. (Tianjin, China). The CCK-8 was purchased from Yeasen Biotech
2.3. Culturing of H9c2 cardiomyocyte cells
H9c2 cells were cultured in DMEM medium containing 5.5 mM
glucose, supplemented with 10% fetal calf serum. Cells in the HG-
treated group were incubated in DMEM medium containing 35 mM
glucose. The culture was maintained at 37 ◦ C with a gas mixture of 5%
CO2/95% air. All media were supplemented with 100 U/mL penicillin
and 100 µg/mL streptomycin.
2.4. Cell viability assay
The viability of H9c2 rat cardiomyocytes was measured by per­
forming the CCK-8 assay. H9c2 cells at a concentration of 5 × 104 cells/
mL were collected and resuspended in DMEM medium, and 100 µL ali­
quots were added to each well of 96-well flat-bottomed microtiter
plates. TFMP was dissolved in DMSO. H9c2 cells were treated with
TFMP (25, 50, 75, 100, 200 µg/mL) for 24 h. Three replicate wells were

Fig. 1. HPLC of TFMP.

2
J. Zou et al.
used for each data point in the experiments. Then 10 µL of CCK-8 was
added to each well. Absorption was measured at 450 nm with a micro­
plate reader (SpectraMax Plus384, Molecular Devices, USA).
2.5. Lactate dehydrogenase release assay
Cytotoxicity was measured by using the lactate dehydrogenase
(LDH) assay kit. The supernatant (20 µL/well) was incubated with
250 µL LDH reaction agent at room temperature for 5 min. Absorbance
value at 450 nm was measured using the microplate reader.
2.6. DAPI staining
H9c2 cells were seeded on 6-well plates and treated with TFMP for
24 h. The cells were collected and washed twice with PBS, permeabilized
with 0.1% Triton X-100, and stained with 2 µg/mL DAPI for 10 min at
room temperature. The cells were subsequently observed using a fluo­
rescence microscope (magnification, x100; Nikon TE-2000U; Nikon
Corporation, Tokyo, Japan).
2.7. Apoptosis assay
Apoptosis was determined by staining cells with annexin V-FITC and
propidium iodide (PI) labeling. H9c2 cells were treated with TFMP for
24 h. After treatment, the cells were collected and washed twice in ice-
cold PBS and resuspended in 300 µL of binding buffer at 2 × 105 cells/
mL. The samples were incubated with 5 µL of annexin V-FITC and 5 µL
propidium iodide in the dark for 15 min at room temperature. Finally,
the samples were analyzed by flow cytometry and evaluated on the basis
of the percentage of cells that were annexin V positive.
2.8. Quantitative real time-polymerase chain reaction
Total RNA from H9c2 cells was extracted using Trizol reagent
(Invitrogen Inc, Carlsbad, CA, USA) according to the manufacturer’s
instructions. RNA was quantitated by optical density measurements at
260 and 280 nm. TransScript Green Two-Step aPT-PCR SuperMix was
used for cDNA synthesis and amplification. qPCR reaction was per­
formed using the Mx 3000P Real-Time PCR system (Agilent, Santa Clara,
USA). The samples were heated to 95 ◦ C for 10 min. The cycles were
performed at 95 ◦ C for 15 s, 60 ◦ C for 60 s, and 72 ◦ C for 40 s. Relative
expression of genes was performed by Mx 3000P software to calculate
the Ct values for each sample by comparing the Ct values of the target
gene with those of the β-actin constitutive gene product. The primers
(Nrf2, HO-1, TNF-α, IL-6) were synthesized by the Sangon company
(Shanghai, China).
2.9. Rat model of DCM
Male Wistar rats weighing 160–180 g were purchased from the
Experimental Animal Center of Jilin University. They were housed in a
room with an ambient temperature of 22 to 25 ◦ C and a 12-h light/dark
cycle, and fed a standard pelleted diet (SPD) with water ad libitum. The
animal studies are done according to ethical procedures and experi­
mental protocols were approved in accordance with nationally approved
guidelines for “The Institutional Animal Care and Use Committee” (No.
20180041). After one week of acclimatization, the rats were randomly
divided into two groups and were fed with either SPD (control) or a
high-fat diet (HFD) consisting of 40% fat, 41% carbohydrates, and 18%
protein for eight weeks. After overnight fasting, the HFD-fed rats were
intravenously (i.v.) injected with STZ (30 mg/kg). Two weeks later, the
fasting blood glucose (FBG) level was measured in these rats, and those
with an FBG level of ≥ 11.1 mmol/L were considered diabetic. Then, the
diabetic rats were randomly divided into three groups according to the
FBG levels, with 12 rats in each group. The experimental groups were as
follows: Diabetic group: the diabetic rats were orally administered with
3
Journal of Functional Foods 76 (2021) 104319
0.5% CMC-Na; TFMP 35 mg/kg group: the diabetic rats were orally
treated with TFMP at a dose of 35 mg/kg; and TFMP 70 mg/kg group:
diabetic rats were orally administered with TFMP at a dose of 70 mg/kg.
TFMP was dissolved in 0.5% CMC-Na. Meanwhile, the control rats were
orally administered with 0.5% CMC-Na. The rats were treated with
TFMP or 0.5% CMC-Na once a day for 12 weeks.
2.10. Physical and biochemical analyses
At 13 weeks, rats were anesthetized with ketamine (80 mg/kg, i.p),
heart weight (HW), body weight (BW), and levels of blood glucose, cTn
I, CK-MB, and LDH were measured. MDA level, and SOD and GSH-Px
activities in the heart tissue and H9c2 cells were assayed using
commercially available kits and in accordance with the manufacturer’s
instructions.
2.11. Histopathological examination
Heart tissues were fixed in 10% phosphate-buffered formalin,
dehydrated, and embedded in paraffin. Sections about 4-µm thickness
were sliced and stained with hematoxylin and eosin (HE). The slides
were examined under a light microscope with a magnification of
200 × by a pathologist who was blinded to the experiments.
The heart tissues were fixed in 4% glutaraldehyde in sodium phos­
phate buffer (0.2 M, PH 7.4) for 3 h at 4 ◦ C and dehydrated using graded
ethanol. The samples were embedded in resin and polymerized at 72 ◦ C
for 48 h. Ultra-thin sections (50–70 nm) were stained with uranyl ace­
tate and lead acetate. The images were captured using a JEM 1200 EX
electron microscope (JEM 1200 EX; Jeol, Tokyo, Japan).
2.12. TUNEL staining
The apoptotic analysis was performed by TUNEL staining, as
described previously. Heart tissues were pretreated in accordance with
the pretreatment procedure followed for HE staining. Fixed tissue sec­
tions (4 µm) were minced. Based on the instructions given with the
TUNEL staining kit, the apoptotic level was determined.
2.13. Western blotting
Rat heart tissue and H9c2 cells were lysed in RIPA buffer (150 mM
NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM
Tris-HCl pH 7.4) for 30 min on ice. After centrifugation (13, 000 × g
4 ◦ C, 15 min), the supernatants were collected. Samples were loaded
onto 12% polyacrylamide SDS gels. After electrophoresis, the gels were
blotted onto a PVDF membrane, blocked with 5% (w/v) milk for 1 h on a
shaker at room temperature, washed twice with TBST, and probed
overnight at 4 ◦ C. The blots were incubated with primary antibodies
against Bax and Bcl-2 overnight. Next, the blots were incubated with a
secondary antibody for 1 h at room temperature, and bands were
detected by enhanced chemiluminescence (ECL).
2.14. Statistical analyses
Results are expressed as mean ± SD. The statistical significances of
all data were determined using one-way analysis of variance followed by
Turkey’s post-hoc test for multiple comparisons. A P value < 0.05 was
considered statistically significant.
3. Results
3.1. TFMP enhanced the viability of HG-induced H9c2 cells
Cell viability and cytotoxicity were measured by CCK-8 and LDH
assays. TFMP treatment (200 µg/mL) significantly decreased the
viability of H9c2 cells (Fig. 2A). However, TFMP treatment of < 200 µg/
J. Zou et al. Journal of Functional Foods 76 (2021) 104319

Fig. 2. Effect of TFMP on HG-induced cell injury in H9c2 cells. (A) Cells incubated with different concentrations (25, 50, 75, 100 and 200 µg/mL) of TFMP for 24 h,
Cell viability was detected by CCK-8 assay. (B) Effect of TFMP on LDH leakage in the H9c2 cells was measured by LDH assay. #P < 0.05 versus the control group;
*P < 0.05 versus the HG group.

mL did not affect cell viability. As shown in Fig. 2B, HG significantly
increased LDH release, which was alleviated by 50 and 100 µg/mL TFMP
treatment. The use of 25 µg/mL TFMP was less effective. Based on these
results, TFMP was used at concentrations of 50 and 100 µg/mL in the
subsequent experiments.
3.2. TFMP suppressed apoptosis and oxidative stress in H9c2 cells
Apoptosis plays a critical role in the development of diabetic car­
diomyopathy, and hence, the effects of TFMP on HG-induced apoptosis
was investigated. As shown in Fig. 3A, morphological changes typical of
apoptosis such as cell shrinkage, nuclear condensation, and apoptotic
body formation were observed, and the apoptotic rate was also
increased (mean = 38.10%, P < 0.05) in HG cells. The apoptotic rate was
alleviated after treatment with 50 and 100 µg/mL TFMP
(mean = 21.28% and 16.36%, P < 0.05) (Fig. 3B). The expression of Bax
was upregulated and that of Bcl-2 was downregulated in HG cells
(P < 0.01), while TFMP reduced the expression of Bax and increased the
expression of Bcl-2. The ratio of Bax/Bcl-2 expression was markedly
decreased after treatment with 50 and 100 µg/mL TFMP (Fig. 3C-F).
To further investigate the effect of TFMP on oxidative stress in H9c2
cells induced by HG, the MDA content and SOD and GSH-Px activities
were determined. As shown in Fig. 4, the activities of SOD (Fig. 4A) and
GSH-Px (Fig. 4B) were decreased significantly in the HG group. TFMP
effectively increased the activities of SOD and GSH-Px, while the MDA
content was notably increased in the HG group, which was restored after
50 and 100 µg/mL TFMP treatment. To identify the mechanism of action
of TFMP in relation to oxidative stress, Nrf2 and HO-1 mRNA levels were
determined by real-time PCR, and these levels were increased after 50 or
100 µg/mL TFMP treatment (Fig. 4D, E).
3.3. TFMP inhibited TNF-α and IL-6 mRNA expression in H9c2 cells
To determine the effect of TFMP on inflammation in H9c2 cells

Fig. 3. Effect of TFMP on apoptosis in HG-induced H9c2 cells. (A) Annexin V-FITC/PI staining. (B) Apoptosis rate in the control, HG, and TFMP groups. (C) DAPI
staining showing the apoptotic cells. Scale bar = 100 µm. (D–G) Western blot showing Bax, Bcl-2, and the ratio of Bax to Bcl-2. #P < 0.05 vs. the control group;
*P < 0.05 vs. the HG group.

4
J. Zou et al. Journal of Functional Foods 76 (2021) 104319

Fig. 4. Effect of TFMP on oxidative stress in HG-induced H9c2 cells. (A) content of MDA, (B) activity of SOD, (C) activity of GSH-Px, (D) Nrf2 mRNA level and (E)
HO-1 mRNA level, (F) TNF-α mRNA level, (G) IL-6 mRNA level.#P < 0.05 versus control group; * P < 0.05 versus the HG group.

Fig. 5. Effect of TFMP on blood glucose levels, body weight, and HW/BW ratio in DCM rats. (A) Blood glucose levels, (B) Body weight, (C) HW/BW ratio, (D) CK-MB
activity, (E) LDH level, and (F) cTnI activity. #P < 0.05 versus the control group; * P < 0.05 versus the DCM group.

5
J. Zou et al.
induced by HG, the mRNA levels of TNF-α and IL-6 were determined by
real-time PCR. As shown in Fig. 4F, G, the mRNA levels of TNF-α and IL-
6 were significantly increased in H9c2 cells after HG treatment. How­
ever, TFMP efficiently inhibited HG-induced expression of TNF-α and IL-
6 in H9c2 cells.
3.4. TFMP attenuated blood glucose levels and HW/BW ratio
At 13 weeks, BW in the DCM group showed a significant reduction
compared with that in the control group. TFMP prevented BW loss
(Fig. 5A). In addition, blood glucose levels and HW/BW ratio were
higher in the DCM group. TFMP treatment thus significantly inhibited
the increase in glucose levels and HW/BW (Fig. 5B, 5C).
3.5. TFMP alleviated myocardial damage in DCM rats
To evaluate the effect of TFMP on myocardial damage in DCM rats,
CK-MB, LDH, and cTnI levels were measured. As shown in Fig. 5D-F, CK-
MB, LDH, and cTnI levels in the DCM group remarkably increased
compared with those in the control group. TFMP treatment significantly
reduced the levels of CK-MB, LDH, and cTnI.
The cardioprotective effect of TFMP was further confirmed by
morphological examination. As showed in Fig. 6A, the rats in normal
group exhibited a normal heart histology. On the contrary, the animals
in DCM group showed a disorder of the arrangement of cardiomyocytes,
the uneven color, the degeneration of muscle fiber, the swelling of
interstitial muscle and neutrophil infiltration. In the ultrastructural
morphologies examination, the rats of normal group exhibited well-
arranged myofibrils (Fig. 6 B). In the rats of DCM group, myofibrils
arrangement was disordered, broken and disappeared. Sarcomere
arrangement was disorderly, Z line was unclear. Mitochondrion was
broken, swollen and vacuolated. However, TFMP treatment markedly
alleviated the pathological changes mentioned above.
3.6. TFMP suppressed oxidative stress and inflammation in DCM rats
As shown in Fig. 7, the activities of SOD (Fig. 7A) and GSH-Px
(Fig. 7B) were decreased significantly in the DCM group. TFMP treat­
ment effectively increased the activities of SOD and GSH-Px, while the
MDA content was notably increased in the DCM group, which was
restored after TFMP treatment (Fig. 7C). Nrf2 and HO-1 mRNA levels
were increased in the cardiac tissue after TFMP treatment compared
with that in the control group (Fig. 7D,E).
A previous study showed that DCM may also be associated with
inflammation, and hence, we determined the anti-inflammatory effect of
Fig. 6. Effect of TFMP on pathogenic changes in DCM rats. (A) Representative HE staining (magnification = 200 × ). Scale bar = 100 µm. (B) Representative
Transmission Electron Microscopy images of the left ventricular tissues from the different groups (magnification = 15000 × ). Scale bar = 500 nm.
6
Journal of Functional Foods 76 (2021) 104319
TFMP. Treatment with TFMP inhibited the production and mRNA level
of TNF-α and IL-6 (Fig. 7F-I).
3.7. TFMP decreases apoptotic rate in DCM rats
To evaluate the cardioprotective effect of TFMP on apoptosis in DCM
rats, the TUNEL assay was performed. As shown in Fig. 8A-B, the
number of TUNEL-positive cells was significantly increased in the DCM
group, which was decreased after TFMP treatment. The expression of
Bax was higher, while that of Bcl-2 was lower in the DCM group, and this
expression was reversed after TFMP treatment (Fig. 8C-E).
4. Discussion
In the present study, we induced cardiomyopathy in vitro by using a
high glucose concentration and in vivo using a rat model of type 2 dia­
betes. Consistent with previous studies, high glucose levels resulted in
oxidative stress, inflammation, apoptosis, and myocardial pathological
changes in DCM(Badran et al., 2018; Tang et al., 2019). For the first
time, our study showed that the treatment with TFMP significantly
attenuated HG-induced oxidative stress, fibrosis, inflammation, and
apoptosis in H9c2 cells in vitro and prevented structural alterations in
the cardiac tissues of DM rats. This result suggests that TFMP protects
against DCM.
DM is a complex metabolic disease characterized by hyperglycemia
or other metabolic alternations such as hyperlipidemia, hypercholes­
terolemia, and ketoacidemia. Several studies have indicated that
oxidative stress plays a crucial role in the occurrence and development
of cardiomyopathy in DM (Faria & Persaud, 2017; Liao et al., 2017).
Hyperglycemia and/or hyperlipidemia could stimulate reactive oxygen
species (ROS) generation in DM (Zheng et al., 2020). Under the condi­
tions of DCM, a constantly elevated status of oxidative stress depletes
endogenous antioxidants such as SOD and glutathione peroxidase (GSH-
Px) in the heart (Jimenez et al., 2018). The decrease in antioxidant ca­
pacity in the myocardium can, therefore, lead to myocardial cell dam­
age. To combat the damage caused by oxidative stress, a series of
endogenous antioxidative mechanisms in these cells is activated, one of
which involves nuclear factor erythroid 2-related factor 2 (Nrf2). Nrf2 is
a member of the CNC transcription factor family that controls the
expression of several antioxidant genes including heme oxygenase (HO-
1), nicotinamide adenine dinucleotide phosphate-H (NADPH),
quinineoxidoreductase-1 (NQO-1), and glutamate-cysteine ligase cata­
lytic (GCLC) to protect against oxidative damage and ROS-induced
oxidative damage (HAS, Alotaibi, Bin-Jumah, Elgebaly, & Mahmoud,
2019; Jimenez et al., 2018; Tonelli, Chio, & Tuveson, 2018). In our
J. Zou et al.
Fig. 7. Effect of TFMP on oxidative stress and inflammation in DCM rats. (A) SOD activity, (B) GSH-Px activity, (C) MDA level, (D) Nrf2 mRNA level, (E) HO-1 mRNA
level, (F) IL-6 content, (G) TNF-α content, (H) IL-6 mRNA level, (I) TNF-α mRNA level. #P < 0.05 versus control group; *P < 0.05 versus the DCM group.
results, the damage to cardiac function was related to the increase in the
levels of blood glucose, myocardial enzymes, and ROS. TFMP reduced
the release of myocardial enzymes and restored cardiac function. As
expected, TFMP increased the activities of SOD and GSH-Px, and
decreased the MDA content. Moreover, TFMP activated Nrf2 and HO-1
gene expression. These findings demonstrated that TFMP had a protec­
tive effect on myocardial damage induced by oxidative stress in DM rats.
Hyperglycemia could stimulate the ROS generation, which in turn
promotes the secretion of pro-inflammatory cytokines in the diabetic
myocardium(Luo et al., 2019). Additionally, ROS inhibitors dramati­
cally reduce the secretion of IL-1β and IL-18(H. Zhang et al., 2018).
Moreover, a few studies showed that anti-inflammatory agents prevent
the development of cardiac injury in DM rats. TNF-α, a pro-
inflammatory cytokine, resulted in cardiac inflammation and dysfunc­
tion. It also aggravates the inflammatory response by promoting the
production of other inflammatory cytokines. In our results, the levels of
IL-6 and TNF-α were increased in the cardiac tissue of DM rats. Treat­
ment of diabetic rats with TFMP markedly decreased the level of those
inflammatory cytokines in the cardiac tissues.
Cardiac fibrosis is a characteristic of pathological changes in the
diabetic heart (Kai, Kuwahara, Tokuda, & Imaizumi, 2005; Qi, Zheng,
Jiang, Yuan, & Dong, 2020). Several studies have shown that the
inflammation and ROS contributes to the pathogenesis of cardiac
fibrosis (Y. Wang et al., 2019; Zheng et al., 2020). TGF β1, an inflam­
matory cytokine, is a key player in the extracellular matrix (ECM)
accumulation. Overexperssion of TGF β1 results in the production of
granulation consisting connective tissue cells and excessive of ECM
(Voelker et al., 2017; Qi et al., 2020). However, the present study did not
7
Journal of Functional Foods 76 (2021) 104319
show the effect of TFMP on the cardiac fibrosis in diabetic rats. We
openly accept this as a limitation of our study.
Apoptosis plays a vital role in the pathogenesis of DCM (Ouyang,
You, & Xie, 2014). In DM rats, hyperglycemia, hyperlipidemia, excessive
ROS production, and inflammation could induce apoptosis in the heart
(Althunibat et al., 2019). To further elucidate the protective effect of
TFMP, the present study examined its effect on apoptosis. Our results
showed that apoptosis in the heart decreased significantly compared
with diabetic rats, indicating that TFMP can alleviate the process of
apoptosis in the heart of DM.
In summary, our results show that oxidative stress, inflammation,
and apoptosis play critical roles in the pathophysiology of DCM. This
study shows for the first time that long-term treatment with TFMP for a
period of 12 weeks clearly exhibits therapeutic potential for the treat­
ment of DCM by decreasing oxidative stress and inhibiting inflammatory
response and apoptosis. Also, inhibition of oxidative stress was related to
the increased Nrf2 and HO-1 gene expressions. We have already sepa­
rated two monomer compounds (Ja and Jb) in TFMP. Further studies are
needed to determine the exact molecular mechanism of TFMP.
5. Conclusion
The present study demonstrated that TFMP alleviated the develop­
ment of DCM in type 2 diabetes rats. The protective effect is related to
increasing Nrf2 and HO-1 gene expression and inhibiting oxidative
stress, inflammation and apoptosis. These findings suggest that TFMP
might have significant therapeutic potential for treating DCM.
J. Zou et al.
Fig. 8. Effect of TFMP on apoptosis in DCM rats. (A) TUNEL staining showing the apoptotic cells. Scale bar = 100 µm. (B-E) Western blot showing Bax, Bcl-2, and the
ratio of Bax to Bcl-2. *P < 0.05 vs the control group; #P < 0.05 vs the DCM group.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
References
Althunibat, O. Y., Al Hroob, A. M., Abukhalil, M. H., Germoush, M. O., Bin-Jumah, M., &
Mahmoud, A. M. (2019). Fisetin ameliorates oxidative stress, inflammation and
apoptosis in diabetic cardiomyopathy. Life Sci, 221, 83–92. https://doi.org/
10.1016/j.lfs.2019.02.017.
Badran, M. M., Alomrani, A. H., Harisa, G. I., Ashour, A. E., Kumar, A., & Yassin, A. E.
(2018). Novel docetaxel chitosan-coated PLGA/PCL nanoparticles with magnified
cytotoxicity and bioavailability. Biomed Pharmacother, 106, 1461–1468. https://doi.
org/10.1016/j.biopha.2018.07.102.
Faria, A., & Persaud, S. J. (2017). Cardiac oxidative stress in diabetes: Mechanisms and
therapeutic potential. Pharmacol Ther, 172, 50–62. https://doi.org/10.1016/j.
pharmthera.2016.11.013.
Guariguata, L., Whiting, D. R., Hambleton, I., Beagley, J., Linnenkamp, U., & Shaw, J. E.
(2014). Global estimates of diabetes prevalence for 2013 and projections for 2035.
Diabetes Res Clin Pract, 103(2), 137–149. https://doi.org/10.1016/j.
diabres.2013.11.002.
Has, A. L., Alotaibi, M. F., Bin-Jumah, M., Elgebaly, H., & Mahmoud, A. M. (2019). Olea
europaea leaf extract up-regulates Nrf2/ARE/HO-1 signaling and attenuates
cyclophosphamide-induced oxidative stress, inflammation and apoptosis in rat
kidney. Biomed Pharmacother, 111, 676-685. doi: 10.1016/j.biopha.2018.12.112.
Jimenez, R., Toral, M., Gomez-Guzman, M., Romero, M., Sanchez, M., Mahmoud, A. M.,
& Duarte, J. (2018). The Role of Nrf2 Signaling in PPARbeta/delta-Mediated
Vascular Protection against Hyperglycemia-Induced Oxidative Stress. Oxid Med Cell
Longev, 2018, 5852706. https://doi.org/10.1155/2018/5852706.
Kai, H., Kuwahara, F., Tokuda, K., & Imaizumi, T. (2005). Diastolic dysfunction in
hypertensive hearts: Roles of perivascular inflammation and reactive myocardial
fibrosis. Hypertens Res, 28(6), 483–490. https://doi.org/10.1291/hypres.28.483.
8
Journal of Functional Foods 76 (2021) 104319
Kannel, W. B., Hjortland, M., & Castelli, W. P. (1974). Role of diabetes in congestive
heart failure: The Framingham study. Am J Cardiol, 34(1), 29–34. https://doi.org/
10.1016/0002-9149(74)90089-7.
Li, H., Shi, Y., Wang, X., Li, P., Zhang, S., Wu, T., … Wu, R. (2019). Piceatannol alleviates
inflammation and oxidative stress via modulation of the Nrf2/HO-1 and NF-kappaB
pathways in diabetic cardiomyopathy. Chem Biol Interact, 310, Article 108754.
https://doi.org/10.1016/j.cbi.2019.108754.
Li, K., Zhai, M., Jiang, L., Song, F., Zhang, B., Li, J., … Wang, S. (2019).
Tetrahydrocurcumin Ameliorates Diabetic Cardiomyopathy by Attenuating High
Glucose-Induced Oxidative Stress and Fibrosis via Activating the SIRT1 Pathway.
Oxid Med Cell Longev, 2019, 6746907. https://doi.org/10.1155/2019/6746907.
Liao, H. H., Zhu, J. X., Feng, H., Ni, J., Zhang, N., Chen, S., … Tang, Q. Z. (2017).
Myricetin Possesses Potential Protective Effects on Diabetic Cardiomyopathy
through Inhibiting IkappaBalpha/NFkappaB and Enhancing Nrf2/HO-1. Oxid Med
Cell Longev, 2017, 8370593. https://doi.org/10.1155/2017/8370593.
Liu, X. Y., Xu, L., Wang, Y., Li, J. X., Zhang, Y., Zhang, C., … Zhang, X. M. (2017).
Protective effects of total flavonoids of Astragalus against adjuvant-induced arthritis
in rats by regulating OPG/RANKL/NF-kappaB pathway. Int Immunopharmacol, 44,
105–114. https://doi.org/10.1016/j.intimp.2017.01.010.
Low Wang, C. C., Hess, C. N., Hiatt, W. R., & Goldfine, A. B. (2016). Clinical Update:
Cardiovascular Disease in Diabetes Mellitus: Atherosclerotic Cardiovascular Disease
and Heart Failure in Type 2 Diabetes Mellitus - Mechanisms, Management, and
Clinical Considerations. Circulation, 133(24), 2459–2502. https://doi.org/10.1161/
CIRCULATIONAHA.116.022194.
Luo, W., Jin, Y., Wu, G., Zhu, W., Qian, Y., Zhang, Y., … Liang, G. (2019). Blockage of
ROS and MAPKs-mediated inflammation via restoring SIRT1 by a new compound
LF10 prevents type 1 diabetic cardiomyopathy. Toxicol Appl Pharmacol, 370, 24–35.
https://doi.org/10.1016/j.taap.2019.03.005.
Lv, D., Cheng, X., Tang, L., & Jiang, M. (2017). The cardioprotective effect of total
flavonoids on myocardial ischemia/reperfusion in rats. Biomed Pharmacother, 88,
277–284. https://doi.org/10.1016/j.biopha.2017.01.060.
Menezes, C. D. A., de Oliveira Garcia, F. A., de Barros Viana, G. S., Pinheiro, P. G.,
Felipe, C. F. B., de Albuquerque, T. R., … de Menezes, I. R. A. (2017). Murraya
paniculata (L.) (Orange Jasmine): Potential Nutraceuticals with Ameliorative Effect
in Alloxan-Induced Diabetic Rats. Phytother Res, 31(11), 1747–1756. https://doi.
org/10.1002/ptr.5903.
Menezes, I. R., Santana, T. I., Varela, V. J., Saraiva, R. A., Matias, E. F., Boligon, A. A., …
Rocha, J. B. (2015). Chemical composition and evaluation of acute toxicological,
J. Zou et al.
antimicrobial and modulatory resistance of the extract of Murraya paniculata. Pharm
Biol, 53(2), 185–191. https://doi.org/10.3109/13880209.2014.913068.
Ouyang, C., You, J., & Xie, Z. (2014). The interplay between autophagy and apoptosis in
the diabetic heart. J Mol Cell Cardiol, 71, 71–80. https://doi.org/10.1016/j.
yjmcc.2013.10.014.
Qi, S. S., Zheng, H. X., Jiang, H., Yuan, L. P., & Dong, L. C. (2020). Protective Effects of
Chromium Picolinate Against Diabetic-Induced Renal Dysfunction and Renal
Fibrosis in Streptozotocin-Induced Diabetic Rats. Biomolecules, 10(3). https://doi.
org/10.3390/biom10030398.
Qi, S. S., He, J., Dong, L. C., Yuan, L. P., Wu, J. L., Zu, Y. X., & Zheng, H. X. (2020).
Cyanidin-3-glucoside from black rice prevents renal dysfunction and renal fibrosis in
streptozotocin-diabetic rats. J Funct Foods, 72. https://doi.org/10.1016/j.
jff.2020.104062.
Rubler, S., Dlugash, J., Yuceoglu, Y. Z., Kumral, T., Branwood, A. W., & Grishman, A.
(1972). New type of cardiomyopathy associated with diabetic glomerulosclerosis.
Am J Cardiol, 30(6), 595–602. https://doi.org/10.1016/0002-9149(72)90595-4.
Saied, S., Nizami, S. S., & Anis, I. (2008). Two new coumarins from Murraya paniculata.
J Asian Nat Prod Res, 10(5–6), 515–519. https://doi.org/10.1080/
10286020801967292.
Sharma, P., Batra, S., Kumar, A., & Sharma, A. (2017). In vivo antianxiety and
antidepressant activity of Murraya paniculata leaf extracts. J Integr Med, 15(4),
320–325. https://doi.org/10.1016/S2095-4964(17)60352-2.
Tang, S. G., Liu, X. Y., Wang, S. P., Wang, H. H., Jovanovic, A., & Tan, W. (2019).
Trimetazidine prevents diabetic cardiomyopathy by inhibiting Nox2/TRPC3-
induced oxidative stress. J Pharmacol Sci, 139(4), 311–318. https://doi.org/
10.1016/j.jphs.2019.01.016.
Tonelli, C., Chio, I. I. C., & Tuveson, D. A. (2018). Transcriptional Regulation by Nrf2.
Antioxid Redox Signal, 29(17), 1727–1745. https://doi.org/10.1089/ars.2017.7342.
Voelker, J., Berg, P. H., Sheetz, M., Duffin, K., Shen, T., Moser, B., … Lewis, J. B. (2017).
Anti-TGF-beta1 Antibody Therapy in Patients with Diabetic Nephropathy. J Am Soc
Nephrol, 28(3), 953–962. https://doi.org/10.1681/ASN.2015111230.
Journal of Functional Foods 76 (2021) 104319
Wang, X., Liang, H., Zeng, K., Zhao, M., Tu, P., Li, J., & Jiang, Y. (2019). Panitins A-G:
Coumarin derivatives from Murraya paniculata from Guangxi Province, China show
variable NO inhibitory activity. Phytochemistry, 162, 224–231. https://doi.org/
10.1016/j.phytochem.2019.03.012.
Wang, X. T., Zeng, K. W., Zhao, M. B., Tu, P. F., Li, J., & Jiang, Y. (2018). Three new
indole alkaloid derivatives from the roots of Murraya paniculata. J Asian Nat Prod
Res, 20(3), 201–208. https://doi.org/10.1080/10286020.2017.1327950.
Wang, Y., Li, H., Li, Y., Zhao, Y., Xiong, F., Liu, Y., … Wang, L. (2019). Coriolus
versicolor alleviates diabetic cardiomyopathy by inhibiting cardiac fibrosis and
NLRP3 inflammasome activation. Phytother Res, 33(10), 2737–2748. https://doi.
org/10.1002/ptr.6448.
Wu, J., Liu, K., & Shi, X. (2016). The anti-inflammatory activity of several flavonoids
isolated from Murraya paniculata on murine macrophage cell line and gastric
epithelial cell (GES-1). Pharm Biol, 54(5), 868–881. https://doi.org/10.3109/
13880209.2015.1089294.
Zhang, H., Chen, X., Zong, B., Yuan, H., Wang, Z., Wei, Y., … Ma, Y. (2018). Gypenosides
improve diabetic cardiomyopathy by inhibiting ROS-mediated NLRP3
inflammasome activation. J Cell Mol Med, 22(9), 4437–4448. https://doi.org/
10.1111/jcmm.13743.
Zhang, J. Y., Li, N., Che, Y. Y., Zhang, Y., Liang, S. X., Zhao, M. B., … Tu, P. F. (2011).
Characterization of seventy polymethoxylated flavonoids (PMFs) in the leaves of
Murraya paniculata by on-line high-performance liquid chromatography coupled to
photodiode array detection and electrospray tandem mass spectrometry. J Pharm
Biomed Anal, 56(5), 950–961. https://doi.org/10.1016/j.jpba.2011.08.019.
Zheng, H. X., Qi, S. S., He, J., Hu, C. Y., Han, H., Jiang, H., & Li, X. S. (2020). Cyanidin-3-
glucoside from Black Rice Ameliorates Diabetic Nephropathy via Reducing Blood
Glucose, Suppressing Oxidative Stress and Inflammation, and Regulating
Transforming Growth Factor beta1/Smad Expression. J Agric Food Chem, 68(15),
4399–4410. https://doi.org/10.1021/acs.jafc.0c00680.
Zou, J., Yu, X., Qu, S., Li, X., Jin, Y., & Sui, D. (2014). Protective effect of total flavonoids
extracted from the leaves of Murraya paniculata (L.) Jack on diabetic nephropathy in
rats. Food Chem Toxicol, 64, 231–237. https://doi.org/10.1016/j.fct.2013.11.043.