Microb Ecol
DOI 10.1007/s00248-017-1016-9
ENVIRONMENTAL MICROBIOLOGY
Plasmid-Mediated Quinolone Resistance (PMQR) Genes
and Class 1 Integrons in Quinolone-Resistant Marine Bacteria
and Clinical Isolates of Escherichia coli from
an Aquacultural Area
Alexandra Tomova 1,2 & Larisa Ivanova 1 & Alejandro H. Buschmann 3 &
Henry P. Godfrey 4 & Felipe C. Cabello 1
Received: 25 January 2017 / Accepted: 12 June 2017
# Springer Science+Business Media, LLC 2017
Abstract Antimicrobial usage in aquaculture selects for
antimicrobial-resistant microorganisms in the marine environ-
ment. The relevance of this selection to terrestrial animal and
human health is unclear. Quinolone-resistance genes qnrA,
qnrB, and qnrS were chromosomally located in four randomly
chosen quinolone-resistant marine bacteria isolated from an
aquacultural area with heavy quinolone usage. In quinolone-
resistant uropathogenic clinical isolates of Escherichia coli
from a coastal area bordering the same aquacultural region,
qnrA was chromosomally located in two E. coli isolates, while
qnrB and qnrS were located in small molecular weight plas-
mids in two other E. coli isolates. Three quinolone-resistant
marine bacteria and three quinolone-resistant E. coli contained
class 1 integrons but without physical association with PMQR
genes. In both marine bacteria and uropathogenic E. coli, class
1 integrons had similar co-linear structures, identical gene
cassettes, and similarities in their flanking regions. In a
Marinobacter sp. marine isolate and in one E. coli clinical
isolate, sequences immediately upstream of the qnrS gene
were homologous to comparable sequences of numerous
plasmid-located qnrS genes while downstream sequences
* Felipe C. Cabello
cabello@nymc.edu
1
Department of Microbiology and Immunology, New York Medical
College, Valhalla, NY, USA
2
Institute of Physiology, Faculty of Medicine, Comenius University in
Bratislava, Bratislava, Slovakia
3
Centro i~mar and CeBiB, Universidad de Los Lagos, Puerto
Montt, Chile
4
Department of Pathology, New York Medical College, Valhalla, NY,
USA
were different. The observed commonality of quinolone resis-
tance genes and integrons suggests that aquacultural use of
antimicrobials might facilitate horizontal gene transfer be-
tween bacteria in diverse ecological locations.
Keywords Quinolone resistance . Aquaculture . Class 1
integrons . PMQR genes . Marine bacteria . Uropathogenic
clinical isolates
Introduction
There is increasing evidence for bidirectional flow of antimi-
crobial resistance genes (ARGs) between free-living environ-
mental bacteria and human/animal pathogens through hori-
zontal gene transfer (HGT) [1–4]. This flow is facilitated by
the commonality of mobile genetic elements (plasmids,
integrons, transposons, integrative conjugative elements) that
carry and disseminate ARG between bacteria occupying di-
verse ecological niches [3–6]. HGT can be stimulated by an-
timicrobials in the environment resulting from their use in
terrestrial animal husbandry and in aquaculture [7, 8]. These
antimicrobials can select for multi-resistant environmental
bacteria that become donors of ARG and mobile genetic ele-
ments [2, 3, 8–11]. They can also stimulate mutagenesis,
integron recombination, and HGT through mobilization of
genetic elements carrying ARG in terrestrial and aquatic en-
vironments contaminated with animal and human commen-
sals and pathogens [2, 3, 9, 10]. Moreover, they can promote
passage of ARG by HGT to commensals and pathogens in the
human intestine by selecting resistant bacteria contaminating
food staples [1, 12–16].
Plasmid-mediated quinolone resistance (PMQR) genes
represent an important challenge to the effectiveness of

quinolones in the treatment of human and animal infections
[17]. PMQR genes include six qnr genes (qnrA, qnrB, qnrC,
qnrD, qnrS, and qnrVC) encoding gyrase-protection repetitive
peptides [18, 19]; oqxAB, qepA, and qaqBIII encoding efflux
pumps [20–23]; and aac(6′)-Ib-cr encoding an aminoglyco-
side and quinolone inactivating acetyl-transferase [24, 25].
These genes can synergize with chromosomal gyrA and
parA mutations [26, 27], increase the mutant prevention con-
centration to quinolones [26], interfere with quinolone action
in apparently susceptible bacteria harboring them [28, 29], and
confer evolutionary fitness apparently unrelated to quinolone
resistance [30].
Plasmids harboring PMQR genes can be large and usually
conjugative (qnrA, qnrB) or small, mobilizable, and non-
conjugative (qnrS) [31, 32]. Both types readily disseminate
in bacterial populations. In plasmids and perhaps in the chro-
mosome, PMQR genes have been located close to or in
integrons [17, 33]. This location can putatively increase their
mobility by transposition and allow them to become associat-
ed with ARG cassettes in integrons to form genetic modular
assemblies with multiple ARG and genes for heavy metal and
disinfectant resistance [32, 34, 35]. Several PMQR genes of
human pathogens including qnrA, qnrS, and qnrVC appear to
have originated in aquatic bacteria [17, 36–40]. The routes and
mechanisms by which chromosomally located PMQR genes
in various bacterial species can become plasmid-encoded and
part of integrons have not been characterized [38, 41–43].
We have previously found quinolone residues in marine
sediments in a region of salmon aquaculture in Chile where
approximately 950 MT of quinolones were used between
2000 and 2008 [44]. This was associated with an increased
number of quinolone-resistant bacteria containing some
PMQR genes in the aquaculture site and with increased
PMQR genes in uropathogenic Escherichia coli isolated from
human urinary tract infections in a coastal area bordering this
aquacultural region [44, 45]. In a preliminary effort to discern
potential genetic networks between these bacteria from differ-
ent environments, we have now examined the genetic location
of PMQR genes and their relationships to class 1 integrons in
a small sample of randomly chosen isolates of quinolone-
resistant marine bacteria and urinary tract E. coli from this
region in Chile.
Methods
Bacterial Strains Containing PMQR Genes
Isolation of 46 marine bacteria resistant to 10 μg/ml of
oxolinic acid from water and sediments of an aquaculture site
(23 isolates) and a non-aquaculture (Bcontrol^) site 8 km dis-
tant (23 isolates) in the Calbuco archipelago of the Lake
Region (Región de Los Lagos), Chile, during 2008 and
Tomova A. et al.
2009 has been previously described [44, 45]. Both sites are
located in open access areas. Quinolone-resistant
uropathogenic E. coli isolated from individual patient urine
samples were obtained during the same period from the
Clinical Microbiology Laboratories of the Puerto Montt
Regional Hospital, Región de Los Lago, Chile (25 isolates),
and Bellevue Hospital, New York, NY, USA (23 isolates)
[45]. Marine bacteria were propagated in marine broth and
agar, and E. coli were propagated in L broth and agar [44].
Localization of PMQR Genes
PMQR genes were detected by PCR [44]. The physical loca-
tion of bacterial quinolone resistance genes was determined in
four randomly chosen quinolone-resistant marine bacterial
isolates (previously identified by 16S RNA sequencing) from
an aquacultural site [44, 45]. Quinolone resistance in isolates
from this site fluctuated between 4 and 92% of cultivable
bacteria over the course of a year [44]. In brief, qnrA, qnrB,
qnrS, and aac(6′)-Ib-cr were detected 12 times in 11 randomly
chosen quinolone-resistant isolates from water, and the same
PMQR genes were detected 19 times in 12 randomly chosen
isolates from sediments at this site [45]. Studied isolates con-
taining different PMQR were randomly chosen from this col-
lection. Isolates from seawater included Arcobacter sp.
UMB84 containing qnrA and Dietzia sp. UMB75 containing
qnrS. Isolates from marine sediments included Rhodococcus
sp. UMB27 and Marinobacter sp. UMB36 both containing
qnrB. The abundance of these strains in their habitat is un-
known. Location of quinolone resistance genes was also de-
termined in four randomly chosen Chilean uropathogenic
E. coli clinical isolates. Isolate 2 contained qnrB, qnrS, and
aac(6′)-Ib-cr; isolate 6 contained qnrA; isolate 7 contained
qnrB; and isolate 13 contained qnrS. DNA from all these
strains was treated with S1-endonuclease to determine the size
of plasmids carrying qnr genes. PMQR genes in small plas-
mids were localized using 1% agarose gels and Southern hy-
bridization of plasmid DNA [46]. DNA of strains that did not
demonstrate hybridization with this procedure underwent
treatment with S1 and CeuI and pulsed-field gel electrophore-
sis (PFGE) followed by Southern hybridization [46, 47]. For
PFGE, marine bacteria cultured in 50 ml Difco Marine Broth
(Becton Dickinson, Sparks, MD) or E. coli cultured in 10 ml
LB Broth were lysed, and gel plugs formed using a PFGE
insert mold (Bio-Rad Laboratories, Hercules, CA). These
were sequentially incubated with lysozyme and proteinase K
(Sigma-Aldrich, St. Louis, MO), extensively washed in TE,
and stored at 4 °C until electrophoresed. Separated DNA was
transferred to nylon membranes, simultaneously hybridized
with DIG-labeled (DIG High Prime DNA Labeling and
Detection Kit, Roche, Mannheim, Germany), PCR-amplified
PMQR genes (qnrA, qnrB, qnrS), and intl1 and 16S ribosomal
RNA (rRNA) gene probes (to identify chromosomal DNA).
PMQR Genes in Marine Bacteria and Clinical Isolates from an Aquacultural Area

Labeled probes were generated and hybridized bands were
visualized with NBT/BCIP (Roche) using previously de-
scribed primers (Table 1) and methods [45].
Detection and Mapping of Class 1 Integrons
The intl1 gene coding for the integrase was detected by PCR
[44]. The conserved intl1 sequence was first amplified with
primers 5′-CS and 3′-CS (see Table 1 for these and all other
primers), followed by expansion upstream with primers 3′-CS
and intl1R for all E. coli isolates, and then with primers intl1F
and tn402liker for E. coli isolates 6 and 9. For downstream
amplification, primers 5′-CS and qacE-39r and/or 5′-CS and
sul1-R were used with all E. coli isolates. Primers sul1-F/
tn402likef and sul1-F/orf98F were used to obtain amplicons
for Arcobacter sp. UMB84 and Rhodococcus sp. UMB 26 and
E. coli isolates 6 and 9. Primers sul1-f and orf5 were used to
obtain an amplicon for Dietzia sp. UMB75, while primers
sul1-F and IS26tsF were used to obtain an amplicon for
E. coli isolate 7. Integron mapping was done by long PCR
(Expand Long Range dNTPack, Roche Applied Science,
Germany) following the manufacturer’s instructions using
5× Expand Long Range Buffer with 12.5 MgCl2, 1.25 μl;
primers, 1 μl; DMSO, 3 μl; Expand Long Range Enzyme
mix, 0.35 μl; DNA template, 1 μl; distilled water to a final
volume of 25 μl. Initial denaturation at 93 °C for 2 min was
followed by 12 cycles of 92 °C, 20 s—56 °C, 30 s—68 °C,
6 min; 12 cycles of 92 °C, 20 s—54 °C, 30 s—68 °C, 6 min
15 s; 12 cycles of 92 °C, 20 s—52 °C, 30 s—68 °C, 6 min
30 s; and final extension of 68 °C, 7 min. PCR amplicons were
sequenced, sequences aligned with Lasergene 6 (DNASTAR,
Madison, WI), and identified by BLAST analysis against the
GenBank database.
Determination of qnrS Genetic Environment
Total DNA (1 μg) of quinolone-resistant Marinobacter sp.
UMB34 or E. coli isolate 9 was digested with Hhal or Xbal,
respectively, in a final volume of 20 μl. Enzymes were
inactivated by incubation at 65 °C for 30 min. Ligation was
performed by adding 2 μl of ATP, 1.5 μl of T4 DNA ligase
(New England BioLabs), 50 μl of 10× ligation buffer, and
distilled water to 500 μl and incubating overnight at 15 °C.
Ligase was inactivated by incubation at 65 °C for 20 min,
DNA precipitated with sodium acetate and glycogen, and
the pellet dissolved in 15 μl nuclease-free water. Two micro-
liter of this DNA was used in inverse PCR with primers
qnrSlongF/qnrSlongR (Table 1). Initial denaturation at 93 °C
for 2 min was followed by 14 cycles of 92 °C, 15 s—59 °C,
20 s—68 °C, 7 min; 14 cycles of 92 °C, 15 s—58 °C, 20 s—
68 °C, 7 min 15 s; and final extension of 68 °C, 7 min. Nested
PCR was performed with 0.3-μl long PCR product with
primers qnrS546_f/qnrS115r with Choice TaqBlue DNA po-
lymerase (Denville Scientific Inc., Metuchen, NJ). PCR
amplicons were sequenced; sequences were aligned with
Lasergene 6 and identified by BLAST analysis against the
GenBank database.
Nucleotide Accession Numbers
The following GenBank accession numbers have been
assigned to sequences containing the integrons reported in

Table 1 Primers used in this study

Gene Primer Sequence (5′ → 3′) Amplicon (bp) References

intl1 int1lF GTTCGGTCAAGGTTCTGG 890 [48]

int1lR CGTAGAGACGTCGGAATG
sul1 sul1-F GATTTTTCTTGAGCCCCGC 155 [49]
sul1-R TGGACCCAGATCCTTTACAGG
Integron 5′-CS GGCATCCAAGCAGCAAG Variable [50]
3′-CS AAGCAGACTTGACCTGA
qacE_39r CGGATGTTGCGATTACTTCG This study
tn402likef (IRt) GTGCAGTCGTCTTCTGAAAATGACA Variable [34]
tn402liker (IRi) TGTCATTTTCAGAAGACGACTGCAC
IS26tsF ATGGCAAACTGAAACGGAT This study
orf5 CGCACAACCTCGTCGATATCACC [51]
orf98F GGCTATCTGACCTCACGCCACGAACG This study
QnrSlongF ATGCCACGCCGAACTCGACGGTTTAGATCC Variable This study
QnrSlongR CTTAAGTCTGACTCTTTCAGTGATGCACCGCTAG
qnrS546f CGAACTCGACGGTTTAGATC Variable This study
qnrS115r GCAAGTTAGCACGTCGAAAGTC

the present study: KY788349 (E. coli isolate 6), KY788350
(E. coli isolate 7), KY788351 (E. coli isolate 9), KY788352
(E. coli isolate 2), KY788355 (Arcobacter sp. UMB84),
KY788354 (Dietzia sp. UMB75), and KY788353
(Rhodococcus sp. UMB26).
Results
PMQR Resistance Genes and Class 1 Integrons
in Quinolone-Resistant Marine Bacteria
and Uropathogenic E. coli
Because PMQR resistance genes have been associated with
class 1 integrons, and because integrons are present in aquatic
environments and may be a sign of human interventions such
as aquaculture [52, 53], an effort was made to determine if the
intl1 integrase gene was present in these quinolone-resistant
bacteria. Intl1was present in 11 of 23 marine bacterial isolates
from water and sediment from the aquaculture site, and in 11
of 23 marine bacterial isolates from water and sediment from
the non-aquaculture (Bcontrol^) site. Of the 23 isolates from
the aquaculture site, 9 contained only PMQR genes, 2
contained only intl1, and 9 contained both, while of the 23
isolates from the control site, 8 contained only PMQR genes, 3
only intl1, and 8 contained both. As regards the E. coli clinical
isolates, of the 25 from Chile, 9 contained only PMQR genes,
none contained only intl1, and 13 contained both, while of the
23 from the USA, 8 contained only PMQR genes, 3 only intl1,
and 7 contained both. The limited numbers of strains analyzed
precluded drawing any statistical conclusions regarding dif-
ferences in the proportion of isolates harboring PMQR genes
alone or in conjunction with intl1 in this bacterial collection.
Location of PMQR Genes in Quinolone-Resistant Marine
Bacteria and Uropathogenic E. coli
PMQR genes in some bacteria are located in the chromosome
despite their designation as Bplasmid-mediated^ [17, 54, 55].
In marine bacteria Arcobacter sp. UMB84, Rhodococcus sp.
UMB27, Marinobacter sp. UMB36, and Dietzia sp. UMB75,
single high molecular weight bands (>800 kb) for qnrA, qnrB,
and qnrS were similar in size to the band for 16S rRNA,
consistent with a chromosomal location for these genes
(Fig. 1 and data not shown). In E. coli isolate 6, qnrA was
present in a single high molecular weight band (>500 kb),
again consistent with a chromosomal location (Fig. 1). In the
other studied uropathogenic E. coli isolates, qnrB and qnrS
were located in ~7-kb plasmids in isolate 2 (Fig. 2a), qnrB was
located in ~5-kb plasmids in isolate 7 (Fig. 2b), and qnrS was
located in an ~3-kb plasmid in isolate 13 (Fig. 2b). E. coli
isolate 2 also carried aac(6′)-Ib-cr and intl1 on its ~7-kb small
plasmid as well as on a large 45-kb plasmid (Fig. 2a). E. coli
Tomova A. et al.
isolate 6 contained two copies of the integrase gene intl1, one
in the chromosome and the other in an ~150–160-kb plasmid
(data not shown).
Molecular Analysis of Class 1 Integrons in Marine
Bacteria and Uropathogenic E. coli Containing PMQR
Genes
To investigate the association of qnrA, qnrB, and qnrS
with integrons, integrons were mapped in quinolone-
resistant marine bacteria and E. coli isolates. There was
no physical association between any qnr genes and
integron gene cassettes or in close proximity to their ends
in any of the three marine bacteria or the three
uropathogenic E. coli containing qnrA, qnrB, or qnrS that
were examined (Fig. 3). From all studied strains only in
E. coli isolate 2 (containing qnrB, qnrS, and aac(6′)-Ib-
cr), aac(6′)-Ib-cr was located between the intl1 and
qacEΔ1 genes of integron class 1 (data not shown).
There were clear similarities between the integrons of
marine bacteria and those of E. coli that were independent
of the particular qnr gene contained in the bacterial isolate
(Fig. 3). For example, Arcobacter sp. UMB84 and E. coli
isolate 6 (both containing qnrA) had identical linear ar-
rangements of gene cassettes for resistance to trimetho-
prim (dfrA12), streptomycin-spectinomycin (aad2), anti-
septics (qacEΔ1), and sulfonamide (sul1) (Fig. 3). While
the 3′ end of the integron in both Arcobacter sp. UMB84
and E. coli isolate 6 contained the integron-associated
orf98, the chromate resistance gene (chrA) in E. coli iso-
late 6 was located between sul1 and orf98 (Fig. 3).
Integron maps of Rhodococcus sp. UMB26 and E. coli
isolate 7 (both containing qnrB) displayed a similar linear
order for the gene cassettes drfA, aadA, qacEΔ1, and
sul1, but alleles for drfA and aadA genes differed between
the isolates. Although the integrons had a common 5′ end,
their 3′ ends were different and had different associated
DNA transposon sequences. Similarities in linear arrange-
ment of genes were also observed between integrons of
Dietzia sp. UMB75 and E. coli isolate 9 (both containing
qnrS), but the alleles in the cassettes were different
(Fig. 3). orf5 and orf98 associated with the 3′ end of class
I integrons and transposon-associated tnpM (transposon
Tn21 modulator proteins) were found in the 5′ end of
E. coli isolates 6 and 9. In Arcobacter sp. UMB84,
Rhodococcus sp. UMB26, and E. coli isolates 6 and 9,
an inverted repeat corresponding to a potential transposon
(IRt) was also detected downstream of the 5′ CS (intl1)
sequence, confirming the presence of residual transposon
sequences in the regions flanking these integrons.
There were also similarities between the integrons of the
marine bacteria and E. coli among themselves. For example,
cassettes and their linear order were identical in the integrons
PMQR Genes in Marine Bacteria and Clinical Isolates from an Aquacultural Area
Fig. 1 Chromosomal localization of qnrA, qnrB, and qnrS in marine
bacteria and clinical E. coli isolates from the aquaculture site. Whole-
cell DNA of aquaculture site marine bacteria Arcobacter sp. UMB84,
Rhodococcus sp. UMB27, and Dietzia sp. UMB75 and clinical isolate
E. coli EC6 were digested in agarose blocks with I-CeuI, separated by
PFGE, transferred to nylon membranes and hybridized with various
of Arcobacter sp. UMB84, Rhodococcus sp. UMB26, and
Dietzia sp. UMB75, while DNA sequences flanking the 5′
and 3′ ends of the integrons in E. coli isolates 6 and 9 were
identical. All six integrons analyzed contained the 5′ CS
(intl1) and 3′ CS (qacEΔ1/sul1) regions present in some clin-
ical class 1 integrons [56].
Fig. 2 Plasmid localization of aac(6′)-Ib-cr, qnrB, qnrS, and int1 in three
clinical E. coli isolates from the aquaculture site. Total DNA from E. coli
were digested by S1 endonuclease, separated by conventional agarose gel
electrophoresis, transferred on nylon membrane and hybridized with
different gene probes [46]. a Clinical isolate E. coli EC2, hybridized
labeled DNA probes [47]. Lane 1, bacterial DNA hybridized with 16S
rRNA gene probe; lane 2, marine bacteria UMB84 DNA hybridized with
qnrA gene probe; lane 3, marine bacteria UMB27 DNA hybridized with
qnrB gene probe; lane 4, marine bacteria UMB75 hybridized with qnrS
gene probe; lane 5, clinical isolate E. coli EC6 DNA hybridized with
qnrA gene probe
Genetic Environment of qnrS Genes
in Quinolone-Resistant Marine Bacteria
and Uropathogenic E. coli
Because no association was found between qnr genes and
integrons that could explain HGT of qnr genes between
with lane 1, qnrB gene probe; lane2, qnrS; lane 3, aac(6′)-Ib gene
probe; and lane 4, intl1 probe. b Lane 1, clinical isolate E. coli EC7,
hybridized with qnrB gene probe; lane 2, clinical isolate E. coli EC13
hybridized with qnrS gene probe

Fig. 3 Comparison of class 1
integrons in marine bacteria and
clinical E. coli isolates from the
aquaculture site containing qnrA,
qnrB, and qnrS genes. Schematic
genetic map of class 1 integrons
in three marine bacteria,
Arcobacter sp. UMB84,
Rhodococcus sp. UMB26, and
Dietzia sp. UMB75, and three
uropathogenic E. coli isolates
EC6, EC7, and EC9 harboring
qnrA, qnrB, and qnrS,
respectively. The maps were
generated by genome walking as
described in the BMethods^
section
marine bacteria and E. coli [18, 33], DNA sequences sur-
rounding the qnrS gene were further investigated. Attempts
to do this in Dietzia sp. UMB75 were unsuccessful, and an-
other quinolone-resistant isolate harboring a qnrS gene,
Marinobacter sp. UMB34, was used for this analysis.
Inverse PCR generated a 1994-bp sequence from
Marinobacter sp. UMB34 and a 1207-bp sequence from
E. coli isolate 9. In the region immediately 5′ to the qnrS gene,
184-bp DNA sequences in Marinobacter sp. UMB34 and
E. coli isolate 9 displayed 87% identity to each other and
88% identity to regions immediately 5′ to the qnrS gene in
numerous enterobacterial plasmids (e.g., pVQS1) [57, 58].
The GC contents of these 5′ sequences were similar (40.8%
for the sequence from Marinobacter sp. UMB34, 42.9% for
the sequence from E. coli isolate 9), but their GC contents
were clearly different from the GC content of the chromo-
somes of Marinobacter sp. UMB34 (approximately 57%)
and E. coli (50.8%). As for the qnrS genes themselves, the
657-bp DNA sequences of Marinobacter sp. UMB34 and
E. coli isolate 9 were 99% identical to each other and 99–
100% identical to qnrS genes in numerous enterobacterial
plasmids (e.g., pVQS1). In contrast, sequences 3′ to the qnrS
gene were completely different in Marinobacter sp. UMB34
and E. coli isolate 9. The marine bacterial sequence contained
an amidase family protein gene 95% identical to
pyrazinamidase nicotinamidase in Vibrio parahaemolyticus
BB22OP [59], while the E. coli sequence contained an IS2-
like-sequence, with both sequences being part of a putative
transposon (data not shown).
Tomova A. et al.
Discussion
We have previously shown that quinolone-resistant
uropathogenic E. coli isolates from patients in a coastal region
to intensive aquaculture in Chile harbored significantly more
qnrB and aac(6′)-Ib and fewer qnrA genes than their New
York counterparts [45]. We have also previously shown that
quinolone-resistant marine bacteria isolated from aquaculture
and control sites shared sequence identical PMQR genes with
quinolone-resistant uropathogenic E. coli isolates from pa-
tients in the same coastal region [45, 60].
The present study is an initial attempt to analyze potential
networks between bacteria in aquacultural regions in Chile
and coastal areas adjacent to them by examining the genetic
location of PMQR and class 1 integrons in quinolone-resistant
bacteria from these two environments. In both the marine
bacteria and the uropathogenic E. coli studied here, qnrA,
qnrB, and qnrS genes were not associated with class 1
integrons, either as cassettes within the integrons or down-
stream in close proximity to their 3′ ends, while aac(6′)-Ib-
cr was part of a class I integron in E. coli clinical isolate 2
(data not shown) as has been previously described in other
Enterobacteriaceae [17, 61].
The independence of occurrence of PMQR genes and class
1 integrons in many isolates in the present collection and the
lack of association of PMQR genes and class 1 integrons in
the six isolates analyzed here differ from previous reports [31,
62]. There were however genetic similarities between
integrons in quinolone-resistant marine bacteria and in
PMQR Genes in Marine Bacteria and Clinical Isolates from an Aquacultural Area
uropathogenic E. coli isolates. The sequences surrounding the
5′ (intl1) and 3′ ends (qacEΔ/sul1) of these integrons and the
linear order of gene cassettes in them were conserved, and
sul1 was identical (Fig. 3). The presence of class I integrons
capable of undergoing cassette recombination stimulated by
residual antimicrobials in sediments from which the studied
marine bacteria originated suggested that these bacteria could
undergo genetic variation in this environment [44, 52]. The
findings of similar class 1 integrons among these strains ex-
pand earlier communications, suggesting linkage between the
marine environmental and human pathogen resistomes [19,
25, 36, 54, 60, 63, 64].
Of the PMQR genes studied, only aac(6′)-Ib-cr showed
any association with class 1 integrons. In the case of E. coli
clinical isolate 6, the lack of linkage would be expected be-
cause qnrA is in the chromosome and the integron is probably
in a plasmid. Because the marine bacterial species studied here
have only recently been discovered to harbor these qnr genes
[45], the possibility exists that they have not yet become as-
sociated with class 1 integrons and ISCR1 sequences in re-
sponse to relatively recent high concentrations of quinolones
in the marine environment [42, 44]. The results indicating the
presence of these PMQR genes in strains of this small collec-
tion lacking intl1 suggest as much, as does recently published
work indicating that PMQR are not always linked to integrons
[65, 66]. A somewhat similar scenario might also account for
the lack of linkage of qnr genes to class 1 integrons in these
E. coli clinical isolates if qnr genes were at the beginning of an
evolutionary process because of their recent transfer from
commensals and marine bacteria. A clear limitation of this
work is that few strains were tested, nor was the possibility
that these qnr genes were associated with class 2 and 3
integrons or other mobile genetic elements [3, 31, 67] or po-
tential assocations between qnr genes and intI1 using DNA
hybridization explored.
qnrA, qnrB, and qnrS in the four marine bacteria examined
and qnrA in E. coli clinical isolate 6 were chromosomally
located (Fig. 1 and data not shown). The location of qnrA in
E. coli clinical isolate 6 was unexpected, as most studies in
enteric bacteria have found qnrA and qnrB located in large
conjugative plasmids [18, 31, 62]. For similar reasons, the
location of qnrB in small plasmids in E. coli clinical isolates
2 and 7 was also unexpected. We do not know whether this
was due to methodological limitations or to plasmid instability
after serial culture [10]. In contrast, qnrS in E. coli clinical
isolates 2 and 13 was, as expected, located in small molecular
weight plasmids [18, 31, 62]. Some of these unexpected find-
ings could also be a result of the paucity of molecular studies
of antimicrobial-resistant bacterial populations of marine en-
vironments and in the Southern Hemisphere.
The mechanisms by which genes located in the chromo-
some in one bacterial species are in plasmids of another and
vice versa are unclear. However, the sharing of identical qnr
genes by marine bacterial isolates and uropathogenic E. coli
[45, 60]; the presence of similar class 1 integrons in marine
bacteria and E. coli clinical isolates (Fig. 3) ; the location of
qnrB, qnrS, and aac(6′)-Ib-cr genes in potentially mobilizable
E. coli plasmids (Fig. 2); the presence of residual transposon
DNA sequences in close proximity to integrons (Fig. 3); the
nearly identical sequences with a similar GC content at the 5′
end of a qnrS gene; and the qnrS gene itself in quinolone-
resistant Marinobacter sp. UMB34 and uropathogenic
E. coli 9 provide support for the hypothesis that these two
bacterial populations may constitute, directly or indirectly, a
HGT community despite their diverse ecological locations.
The places where HGT between these populations may take
place may be in the marine environment, which in this region
is heavily contaminated with antimicrobial-resistant human
pathogens [68, 69]. A limitation of these studies is that only
a few strains in our collection were studied in detail. A more
comprehensive study might generate a more balanced picture
of the molecular genetics of qnr genes and integrons in these
strains. Identification of the genetic and molecular mecha-
nisms involved in ARG sharing between environmental bac-
teria and animal and human pathogens will constitute an im-
portant area of future research in this field given the potential
negative impacts such processes can have on animal and hu-
man health.
Acknowledgements This work was supported by grants from the
Lenfest Ocean Program/Pew Charitable Trusts (FCC and AHB), Basal
Program (FB001), Chile (AHB), and by a fellowship from the John
Simon Guggenheim Foundation (FCC).
References
1. Marshall BM, Levy SB (2011) Food animals and antimicrobials:
impacts on human health Clin Microbiol Rev 24:718–733. doi:10.
1128/CMR.00002-11
2. Domingues S, Harms K, Fricke WF, Johnsen PJ, Da Silva GJ,
Nielsen KM (2012) Natural transformation facilitates transfer of
transposons, integrons and gene cassettes between bacterial species
PLoS Pathog 8:e1002837. doi:10.1371/journal.ppat.1002837
3. Cabello FC, Godfrey HP, Tomova A, Ivanova L, Dölz H, Millanao
A, Buschmann AH (2013) Antimicrobial use in aquaculture re-ex-
amined: its relevance to antimicrobial resistance and to animal and
human health Environ Microbiol 15:1917–1942. doi:10.1111/
1462-2920.1213
4. Cabello FC, Godfrey HP, Buschmann AH, Dölz HJ (2016)
Aquaculture as yet another environmental gateway to the develop-
ment and globalisation of antimicrobial resistance Lancet Infect Dis
16:e127–e133. doi:10.1016/S1473-3099(16)00100-6
5. Prescott JF (2006) History of antimicrobial usage in agriculture. In:
Aarestrup FM (ed) Antimicrobial resistance in bacteria of animal
origin. ASM Press, Washington, D.C., pp. 19–27
6. Cantas L, Shah SQ, Cavaco LM, Manaia CM, Walsh F, Popowska
M, Garelick H, Bürgmann H, Sørum H (2013) A brief multi-
disciplinary review on antimicrobial resistance in medicine and its
linkage to the global environmental microbiota Front Microbiol 4:
96. doi:10.3389/fmicb.2013.00096

7. Hastings PJ, Rosenberg SM, Slack A (2004) Antibiotic-induced lateral
transfer of antibiotic resistance Trends Microbiol 12:401–404
8. Sun M, Chang Z, Van den Brink PJ, Li J, Zhao F, Rico A (2016)
Environmental and human health risks of antimicrobials used in
Fenneropenaeus chinensis aquaculture production in China
Environ Sci Pollut Res Int 23:15689–15702. doi:10.1007/s11356-
016-6733-y
9. Baharoglu Z, Mazel D (2011) Vibrio cholerae triggers SOS and
mutagenesis in response to a wide range of antibiotics: a route
towards multiresistance Antimicrob Agents Chemother 55:2438–
2441. doi:10.1128/AAC.01549-10
10. Shah SQ, Cabello FC, L'Abée-Lund TM, Tomova A, Godfrey HP,
Buschmann AH, Sørum H (2014) Antimicrobial resistance and
antimicrobial resistance genes in marine bacteria from salmon aqua-
culture and non-aquaculture sites Environ Microbiol 16:1310–
1320. doi:10.1111/1462-2920.12421
11. Muziasari WI, Parnanen K, Johnson TA, Lyra C, Karkman A,
Stedtfeld RD, Tamminen M, Tiedje JM, Virta M (2016)
Aquaculture changes the profile of antibiotic resistance and mobile
genetic element associated genes in Baltic Sea sediments FEMS
Microbiol Ecol 92:fiw052. doi:10.1093/femsec/fiw052
12. Angulo FJ, Nargund VN, Chiller TC (2004) Evidence of an asso-
ciation between use of anti-microbial agents in food animals and
anti-microbial resistance among bacteria isolated from humans and
the human health consequences of such resistance J Vet Med B
Infect Dis Vet Public Health 51:374–379
13. Love DC, Rodman S, Neff RA, Nachman KE (2011) Veterinary
drug residues in seafood inspected by the European Union, United
States, Canada, and Japan from 2000 to 2009 Environ Sci Technol
45:7232–7240. doi:10.1021/es201608q
14. Chen DQ, Yang L, Luo YT, Mao MJ, Lin YP, Wu AW (2013)
Prevalence and characterization of quinolone resistance in
Laribacter hongkongensis from grass carp and Chinese tiger frog
J Med Microbiol 62:1559–1564. doi:10.1099/jmm.0.059451-0
15. Roy Chowdhury P, McKinnon J, Wyrsch E, Hammond JM, Charles
IG, Djordjevic SP (2014) Genomic interplay in bacterial communi-
ties: implications for growth promoting practices in animal hus-
bandry Front Microbiol 5:394. doi:10.3389/fmicb.2014.00394
16. Deng YT, Wu YL, Tan AP, Huang YP, Jiang L, Xue HJ, Wang WL,
Luo L, Zhao F (2014) Analysis of antimicrobial resistance genes in
Aeromonas spp. isolated from cultured freshwater animals in China
Microb Drug Resist 20:350–356. doi:10.1089/mdr.2013.0068
17. Hooper DC, Jacoby GA (2016) Topoisomerase inhibitors: fluoro-
quinolone mechanisms of action and resistance. Cold Spring Harb
Perspect Med 6. doi:10.1101/cshperspect.a025320
18. Robicsek A, Jacoby GA, Hooper DC (2006) The worldwide
emergence of plasmid-mediated quinolone resistance Lancet
Infect Dis 6:629–640
19. Fonseca EL, Vicente AC (2013) Epidemiology of qnrVC alleles
and emergence out of the Vibrionaceae family J Med Microbiol
62:1628–1630. doi:10.1099/jmm.0.062661-0
20. Kim HB, Wang M, Park CH, Kim EC, Jacoby GA, Hooper DC
(2009) oqxAB encoding a multidrug efflux pump in human clinical
isolates of Enterobacteriaceae Antimicrob Agents Chemother 53:
3582–3584. doi:10.1128/AAC.01574-08
21. Ma J, Zeng Z, Chen Z, Xu X, Wang X, Deng Y, Lü D, Huang L,
Zhang Y, Liu J, Wang M (2009) High prevalence of plasmid-
mediated quinolone resistance determinants qnr, aac(6′)-Ib-cr,
and qepA among ceftiofur-resistant Enterobacteriaceae isolates
from companion and food-producing animals Antimicrob Agents
Chemother 53:519–524. doi:10.1128/AAC.00886-08
22. Nakaminami H, Noguchi N, Sasatsu M (2010) Fluoroquinolone
efflux by the plasmid-mediated multidrug efflux pump QacB vari-
ant QacBIII in Staphylococcus aureus Antimicrob Agents
Chemother 54:4107–4111. doi:10.1128/AAC.01065-09
Tomova A. et al.
23. Rodríguez-Martínez JM, Diaz de Alba P, Briales A, Machuca J,
Lossa M, Fernández-Cuenca F, Rodríguez Baño J, Martínez-
Martínez L, Pascual Á (2013) Contribution of OqxAB efflux
pumps to quinolone resistance in extended-spectrum-beta-
lactamase-producing Klebsiella pneumoniae J Antimicrob
Chemother 68:68–73. doi:10.1093/jac/dks377
24. Robicsek A, Strahilevitz J, Jacoby GA, Macielag M, Abbanat D,
Park CH, Bush K, Hooper DC (2006) Fluoroquinolone-modifying
enzyme: a new adaptation of a common aminoglycoside acetyl-
transferase Nat Med 12:83–88
25. Zhao JY, Dang H (2012) Coastal seawater bacteria harbor a large
reservoir of plasmid-mediated quinolone resistance determinants in
Jiaozhou Bay, China Microb Ecol 64:187–199. doi:10.1007/
s00248-012-0008-z
26. Cesaro A, Bettoni RR, Lascols C, Merens A, Soussy CJ, Cambau E
(2008) Low selection of topoisomerase mutants from strains of
Escherichia coli harbouring plasmid-borne qnr genes J
Antimicrob Chemother 61:1007–1015. doi:10.1093/jac/dkn077
27. Martínez-Martínez L, Cano ME, Rodríguez-Martìnez JM, Calvo J,
Pascual A (2008) Plasmid-mediated quinolone resistance Expert
Rev Anti-Infect Ther 6:685–711
28. Jakobsen L, Cattoir V, Jensen KS, Hammerum AM, Nordmann
P, Frimodt-Møller N (2012) Impact of low-level fluoroquino-
lone resistance genes qnrA1, qnrB19 and qnrS1 on ciprofloxa-
cin treatment of isogenic Escherichia coli strains in a murine
urinary tract infection model J Antimicrob Chemother 67:
2438–2444. doi:10.1093/jac/dks224
29. Domínguez-Herrera J, Velasco C, Docobo-Pérez F, Rodríguez-
Martínez JM, López-Rojas R, Briales A, Pichardo C, Díaz-de-
Alba P, Rodríguez-Baño J, Pascual A, Pachón J (2013) Impact of
qnrA1, qnrB1 and qnrS1 on the efficacy of ciprofloxacin and
levofloxacin in an experimental pneumonia model caused by
Escherichia coli with or without the GyrA mutation Ser83Leu J
Antimicrob Chemother 68:1609–1615. doi:10.1093/jac/dkt063
30. Michon A, Allou N, Chau F, Podglajen I, Fantin B, Cambau E
(2011) Plasmidic qnrA3 enhances Escherichia coli fitness in ab-
sence of antibiotic exposure PLoS One 6:e24552. doi:10.1371/
journal.pone.0024552
31. Cattoir V, Nordmann P (2009) Plasmid-mediated quinolone resis-
tance in gram-negative bacterial species: an update Curr Med Chem
16:1028–1046
32. Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A (2009) Plasmid-
mediated quinolone resistance: a multifaceted threat Clin Microbiol
Rev 22:664–689. doi:10.1128/microbiolspec.PLAS-0006-2013
33. Nordmann P, Poirel L (2005) Emergence of plasmid-mediated re-
sistance to quinolones in Enterobacteriaceae J Antimicrob
Chemother 56:463–469
34. Rosewarne CP, Pettigrove V, Stokes HW, Parsons YM (2010) Class
1 integrons in benthic bacterial communities: abundance, associa-
tion with Tn402-like transposition modules and evidence for
coselection with heavy-metal resistance FEMS Microbiol Ecol 72:
35–46. doi:10.1111/j.1574-6941.2009.00823.x
35. Stokes HW, Gillings MR (2011) Gene flow, mobile genetic ele-
ments and the recruitment of antibiotic resistance genes into
gram-negative pathogens FEMS Microbiol Rev 35:790–819. doi:
10.1111/j.1574-6976.2011.00273.x
36. Cattoir V, Poirel L, Mazel D, Soussy CJ, Nordmann P (2007) Vibrio
splendidus as the source of plasmid-mediated QnrS-like quinolone re-
sistance determinants Antimicrob Agents Chemother 51:2650–2651
37. Cattoir V, Poirel L, Aubert C, Soussy CJ, Nordmann P (2008)
Unexpected occurrence of plasmid-mediated quinolone resistance
determinants in environmental Aeromonas spp Emerg Infect Dis
14:231–237. doi:10.3201/eid1402.070677
38. Xia R, Guo X, Zhang Y, Xu H (2010) qnrVC-like gene located in a
novel complex class 1 integron harboring the ISCR1 element in an
Aeromonas punctata strain from an aquatic environment in
PMQR Genes in Marine Bacteria and Clinical Isolates from an Aquacultural Area
Shandong Province, China Antimicrob Agents Chemother 54:
3471–3474. doi:10.1128/AAC.01668-09
39. Han JE, Kim JH, Choresca Jr CH, Shin SP, Jun JW, Chai JY, Park
SC (2012) First description of ColE-type plasmid in Aeromonas
spp. carrying quinolone resistance (qnrS2) gene Lett Appl
Microbiol 55:290–294. doi:10.1111/j.1472-765X.2012.03293.x
40. Del Castillo CS, Hikima J, Jang HB, Nho SW, Jung TS,
Wongtavatchai J, Kondo H, Hirono I, Takeyama H, Aoki T
(2013) Comparative sequence analysis of a multidrug-resistant
plasmid from Aeromonas hydrophila Antimicrob Agents
Chemother 57:120–129. doi:10.1128/AAC.01239-12
41. Quiroga MP, Andres P, Petroni A, Soler Bistué AJ, Guerriero L,
Vargas LJ, Zorreguieta A, Tokumoto M, Quiroga C, Tolmasky ME,
Galas M, Centrón D (2007) Complex class 1 integrons with diverse
variable regions, including aac(6′)-Ib-cr, and a novel allele,
qnrB10, associated with ISCR1 in clinical enterobacterial isolates
from Argentina Antimicrob Agents Chemother 51:4466–4470
42. Chen YT, Liao TL, Liu YM, Lauderdale TL, Yan JJ, Tsai SF (2009)
Mobilization of qnrB2 and ISCR1 in plasmids Antimicrob Agents
Chemother 53:1235–1237. doi:10.1128/AAC.00970-08
43. Rodríguez-Martínez JM, Cano ME, Velasco C, Martínez-Martínez L,
Pascual A (2011) Plasmid-mediated quinolone resistance: an update J
Infect Chemother 17:149–182. doi:10.1007/s10156-010-0120-2
44. Buschmann AH, Tomova A, López A, Maldonado MA, Henríquez
LA, Ivanova L, Moy F, Godfrey HP, Cabello FC (2012) Salmon
aquaculture and antimicrobial resistance in the marine environment
PLoS One 7:e42724. doi:10.1371/journal.pone
45. Tomova A, Ivanova L, Buschmann AH, Rioseco ML, Kalsi RK,
Godfrey HP, Cabello FC (2015) Antimicrobial resistance genes in
marine bacteria and human uropathogenic Escherichia coli from a
region of intensive aquaculture Environ Microbiol Rep 7:803–809.
doi:10.1111/1758-2229.12327
46. Barton BM, Harding GP, Zuccarelli AJ (1995) A general method
for detecting and sizing large plasmids Anal Biochem 226:235–240
47. Liu SL, Hessel A, Sanderson KE (1993) Genomic mapping with I-
Ceu I, an intron-encoded endonuclease specific for genes for ribo-
somal RNA, in Salmonella spp., Escherichia coli, and other bacte-
ria Proc Natl Acad Sci U S A 90:6874–6878
48. Xu H, Davies J, Miao V (2007) Molecular characterization of class
3 integrons from Delftia spp J Bacteriol 189:6276–6283
49. Song JS, Jang SJ, Lee JJ, Lee JH, Bae IK, Jeong BC, Cha SS, Lee
JH, Hong SK, Lee SH (2010) Association of the blaCMY-10 gene
with a novel complex class 1 integron carrying an ISCR1 element in
clinical isolates from Korea Clin Microbiol Infect 16:1013–1017.
doi:10.1111/j.1469-0691.2009.03002.x
50. Lévesque C, Piché L, Larose C, Roy PH (1995) PCR mapping of
integrons reveals several bnovel combinations of resistance genes
Antimicrob Agents Chemother 39:185–191
51. Sunde M, Sørum H (1999) Characterization of integrons in
Escherichia coli of the normal intestinal flora of swine Microb
Drug Resist 5:279–287
52. Gaze WH, Abdouslam N, Hawkey PM, Wellington EM (2005)
Incidence of class 1 integrons in a quaternary ammonium
compound-polluted environment Antimicrob Agents Chemother
49:1802–1807
53. Stalder T, Barraud O, Casellas M, Dagot C, Ploy MC (2012)
Integron involvement in environmental spread of antibiotic resis-
tance Front Microbiol 3:119. doi:10.3389/fmicb.2012.00119
54. Poirel L, Liard A, Rodriguez-Martinez JM, Nordmann P (2005)
Vibrionaceae as a possible source of Qnr-like quinolone resistance
determinants J Antimicrob Chemother 56:1118–1121
55. Saga T, Kaku M, Onodera Y, Yamachika S, Sato K, Takase H
(2005) Vibrio parahaemolyticus chromosomal qnr homologue
VPA0095: demonstration by transformation with a mutated gene
of its potential to reduce quinolone susceptibility in Escherichia
coli Antimicrob Agents Chemother 49:2144–2145
56. Gillings MR (2014) Integrons: past, present, and future Microbiol
Mol Biol Rev 78:257–277. doi:10.1128/MMBR.00056-13
57. Kehrenberg C, Friederichs S, de Jong A, Michael GB, Schwarz S
(2006) Identification of the plasmid-borne quinolone resistance
gene qnrS in Salmonella enterica serovar Infantis J Antimicrob
Chemother 58:18–22
58. Karczmarczyk M, Stephan R, Hachler H, Fanning S (2012)
Complete nucleotide sequence of pVQS1 containing a quinolone
resistance determinant from Salmonella enterica serovar Virchow
associated with foreign travel J Antimicrob Chemother 67:1861–
1864. doi:10.1093/jac/dks158
59. Jensen RV, Depasquale SM, Harbolick EA, Hong T, Kernell AL,
Kruchko DH, Modise T, Smith CE, McCarter LL, Stevens AM
(2013) Complete genome sequence of prepandemic Vibrio
parahaemolyticus BB22OP Genome Announc 1:e00002–e00012.
doi:10.1128/genomeA.00002-12
60. Aedo S, Ivanova L, Tomova A, Cabello FC (2014) Plasmid-related
quinolone resistance determinants in epidemic Vibrio
parahaemolyticus, uropathogenic Escherichia coli, and marine bac-
teria from an aquaculture area in Chile Microb Ecol 68:324–328.
doi:10.1007/s00248-014-0409-2
61. Ramirez MS, Nikolaidis N, Tolmasky ME (2013) Rise and dissem-
ination of aminoglycoside resistance: the aac(6′)-Ib paradigm Front
Microbiol 4:121. doi:10.3389/fmicb.2013.00121
62. Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC (2006)
qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates
from the United States Antimicrob Agents Chemother 50:2872–2874
63. Jacoby GA, Griffin CM, Hooper DC (2011) Citrobacter spp. as a
source of qnrB alleles Antimicrob Agents Chemother 55:4979–
4984. doi:10.1128/AAC.05187-11
64. Hatosy SM, Martiny AC (2015) The ocean as a global reservoir of
antibiotic resistance genes Appl Environ Microbiol 81:7593–7599.
doi:10.1128/AEM.00736-15
65. Ribeiro TG, Novais Â, Branquinho R, Machado E, Peixe L (2015)
Phylogeny and comparative genomics unveil independent diversi-
fication trajectories of qnrB and genetic platforms within particular
Citrobacter species Antimicrob Agents Chemother 59:5951–5958.
doi:10.1128/AAC.00027-15
66. Lin M, Wu X, Yan Q, Ma Y, Huang L, Qin Y, Xu X (2016)
Incidence of antimicrobial-resistance genes and integrons in
antibiotic-resistant bacteria isolated from eels and aquaculture
ponds Dis Aquat Org 120:115–123. doi:10.3354/dao03013
67. Guglielmini J, Quintais L, Garcillán-Barcia MP, de la Cruz F, Rocha
EPC (2011) The repertoire of ICE in prokaryotes underscores the
unity, diversity, and ubiquity of conjugation PLoS Genet 7:
e1002222. doi:10.1371/journal.pgen.1002222
68. Silva J, Zemelman R, Mandoca MA, Henríquez M, Merino C,
González C (1987) Antibiotic-resistant gram negative bacilli isolat-
ed from sea water and shellfish. Possible epidemiological implica-
tions Rev Latinoam Microbiol 29:165–169
69. Miranda CD, Zemelman R (2001) Antibiotic resistant bacteria in
fish from the Concepcion Bay, Chile Mar Pollut Bull 42:1096–1102