P O L S K I E T O WA R Z Y S T W O M I K R O B I O L O G Ó W

POLISH SOCIETY OF MICROBIOLOGISTS

Polish Journal of Microbiology

We are proud to inform our Readers that in 2012 the Polish Journal of Microbiology
(published up to 2004 under the title Acta Microbiologica Polonica) is celebrating
its first 60 years of continuous publication.

2012
Polish Journal of Microbiology
formely Acta Microbiologica Polonica
2012, Vol. 61, No 2

CONTENTS

MINIREWIEV

Q Fever at the turn of the century

CHMIELEWSKI T., TYLEWSKA-WIERZBANOWSKA S. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Synergy between novel antimicrobials and conventional antibiotics or bacteriocins
Wolska K.I., Grześ K., Kurek A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

ORIGINAL PAPERS

Virulence genes profiles and phylogenetic origin of Escherichia coli from acute and chronic intestinal diseases revealed by
comparative genomic hybridization microarray
Sobieszczańska B., Kasprzykowska U., Turniak M., Maciejewski H., Franiczek R., Duda-Madej A. . . . . . . . . . . 105
Isolation, characterization and phylogenetic analysis of halophilic archaea from a Salt Mine in Central Anatolia (Turkey)
YILDIZ E., OZCAN B., CALISKAN M. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Antagonistic effects of Bacillus cereus strain B-02 on morphology, ultrastructure and cytophysiology of Botrytis cinerea
FENG-XIA LI, HUI-QUAN MA, JING LIU, CHAO ZHANG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
Ultrastructure of Candida albicans pleomorphic forms: phase-contrast microscopy, scanning and transmission
electron microscopy
Staniszewska M., Bondaryk M., Siennicka K., Kurzątkowski W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
Modifications influencing Widal test reactivity in a novel microplate assay
Almogren A., Shakoor Z., Adam M.H., Gadelrab M.O., Musa H.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137

SHORT COMMUNICATIONS

Susceptibility of Polish Bartonella henselae strains

Podsiadły E., Żabicka D., Demkow U., Hryniewicz W., Tylewska-Wierzbanowska S. . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
The relationship between H. pylori virulence genotypes and gastric diseases
Yun en Liu, Yue hua Gong, Li ping Sun, Qian Xu, Yuan Yuan . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147

Instruction for Authors

Submission of manuscripts: http://pjm.indexcopernicus.com/
Instructions for authors: http://www.pjm.microbiology.pl/
Polish Journal of Microbiology
2012, Vol. 61, No 2, 81–93

MINIREVIEW

Q Fever at the Turn of the Century

TOMASZ CHMIELEWSKI* and STANISŁAWA TYLEWSKA-WIERZBANOWSKA

Laboratory of Rickettsiae, Chlamydiae and Enzotic Spirochetes,

National Institute of Public Health – National Institute of Hygiene, Warsaw

Received 10 October 2011, accepted 5 May 2012

Abstract

Q fever is an infectious zoonotic disease characterized by sudden fever, headache, and atypical pneumonia, caused by Coxiella burnetii
– an obligatory intracellular parasite. Based on phylogenetic analysis of the genes sequences, the classification was changed and C. bur­
netii species was included to the gamma subgroup of the proteobacteria, Legionellales order and Coxiellaceae family. This analysis showed
more than 99% sequence similarity of 16SrRNA gene among the strains isolated in different regions of the world. Q fever is a widespread
in the world zoonosis. Its main reservoir in the rural environment are farm animals: cows, sheep, goats, and urban pets such as dogs,
cats, rabbits. In acute infection these bacteria are detected in various internal organs such as lungs, liver, spleen, and in excretion in
urine, faeces and milk. During childbirth, they occur in large number in the amniotic fluid and placenta. Recently, it has been found
that free-living amoeba Acanthamoeba castellani may also be a reservoir of the pathogen. The intra-amoebal location of C. burnetii cells
was observed.

K e y w o r d s: Coxiella burnetii, Q fever, zoonosis

Introduction Classification of Coxiella burnetii

Q fever is an infectious zoonotic disease charac-
terized by sudden fever, headache, and atypical pneu-
monia, caused by Coxiella burnetii – an obligatory
intracellular parasite. For the first time the disease was
recognized in 1935 and described in 1937 by Derrick,
when he studied an unknown disease outbreak among
abattoir workers in Brisbane,Australia (Derrick, 1937).
The predominant symptom was a fever of unknown
origin (called “query”). Isolation of etiologic agent
attempts failed, but transfer of infection to guinea pig
was successful. For this reason, it was thought that the
disease was caused by unknown viruses (Burnet and
Freeman, 1937). Two years after the outbreak, bacte-
rial etiology was discovered by Burnet and Freeman
(Burnet and Freeman, 1938). They injected guinea
pigs with blood and urine of Derrick’s patients and
observed the presence of intracellular Gram-negative
organisms morphologically similar to Rickettsia sp. in
stained spleen cells preparations. In 1938, Cox devel-
oped a method of culture in chicken embryos, which
allowed to isolate the bacterial strains and to investigate
them (Cox, 1941).
Initially the microorganism was named Rickett­
sia burnetii, because of the characteristic features of
all Rickettsia species. They are small Gram-negative
coccoid rods. They are absolute intracellular parasites
and can be cultivated in laboratory animals, chicken
embryos or cell lines. In vertebrates infection involves
reticulo-endothelial, vascular endothelial cells or eryth-
rocytes. C. burnetii bacteria were found in the gut and
haemolymph of ticks, suggesting that they are a natural
vector as for other rickettsiae (Rehacek and Tarasevich,
1988). Currently, ticks are considered to be a reservoir
in the environment.
In 1948 Philip proposed to create a new genus of
Coxiella and classify the bacteria as a new species Coxi­
ella burnetii (the name in honour of the discoverers
– Cox and Burnet).
Until the 90s, this organism had been classified as
alpha subgroup of proteobacteria, order Rickettsiales,
and together with the genera Rickettsia and Rochal­
imea as Rickettsiaceae family. At the end of the nine-
ties, a  small subunit of rRNA was sequenced and
determined for representative strains of six species of

*  Corresponding author: T. Chmielewski, Laboratory of Rickettsiae, Chlamydiae and Enzotic Spirochetes, National Institute of Public
Health – National Institute of Hygiene; Chocimska 24, 00-791 Warsaw, Poland; e-mail: tchmielewski@pzh.gov.pl
82 Chmielewski T. and Tylewska-Wierzbanowska S.
the family Rickettsiaceae: Rickettsia rickettsii (ATCC
VR 891), Rickettsia prowazekii (strain Breinl), Rick­
ettsia typhi (strain Wilmington), Coxiella burnetii
(strain Q177), Ehrlichia risticii (ATCC VR 986), and
Wolbachia persica (ATCC VR 331). The relationships
among these sequences and those of other eubacteria
(about 100 sequences of purple bacteria group) show
that three representatives of the genus Rickettsia form
a tight monophyletic cluster within the alpha subdivi-
sion of the purple bacteria. E. risticii also belongs to
the alpha subdivision and shows a distant relationship
to the genus Rickettsia. Sequencing DNA fragment of
rRNA gene revealed that C. burnetii and W. persica are
members of the gamma subdivision and they show
a  specific, although distant relationship to the genus
Legionella (Weisburg et al., 1989). This phylogenetic
study was based on one C. burnetii strain only. In the
next study, fragments of 16SrRNA gene (about 95%)
from six strains were sequenced. Five of these strains
were isolated from humans (strains: Q212, MEI1, ME5,
MAC12, ME6) and one from tick (Nine Mile). They
represented different pathogenic characteristic and
geographic origin (USA, Canada, France). Based on
phylogenetic analysis of these genes sequences, the
classification was changed and C. burnetii species was
included to the gamma subgroup of the proteobacte-
ria, Legionellales order and Coxiellaceae family. This
analysis showed more than 99% sequence similarity of
16SrRNA gene among the strains isolated in different
regions of the world. The result of the study has shown
the presence of one species only within the genus Coxi­
ella (Stein et al. 1993).
Biology of Coxiella burnetii
Morphology
C. burnetii is a pleomorphic, Gram-negative small
rod with a diameter of 0.2–0.4 µm wide and 0.4–1.0 µm
length. In life cycle, the bacteria occur in two forms:
the “large cell variant” (LCV) which are a vegetative
intracellular form and “small cell variant” (SCV), which
are spore-like forms. They are distinguished by mor-
phology of the cell and peptidoglycan content in the
cell wall. LCV reach 1 µm and are characterized by
irregular shape, loose nucleoid structure and granular
or filamentous cytoplasm. The size of the SCV varies
between 0.2 and 0.4 µm, and is characterized as a rod
shape with thick wall and highly condensed chromatin.
It has been observed by Coleman that transition
from LCV to SCV occurs in host cells phagosomes
in acidic environment conditions of pH = 4.8. This
process has been monitored in cells in vitro. During
the first two days of intracellular growth, transforma-
tion of SCV to LCV takes place. The number of LCV
2
cells dominates during the four days of rapid growth
phase (time between cell division of about 10 hours).
Stationary phase begins approximately at 6 day after
infection. In this phase the process of the reappearance
of SCV also begins. Their number increase at 8 day
after infection.
It was estimated that among 675 of C. burnetii pro-
teins, a few dozen of them are involved in the process
of sporulation. Measuring the intensiveness of proteins
synthesis in SCV and LCV, it was established that the
synthesis of 48 proteins increased twice or more dur-
ing the formation of LCV. Fifteen of them have been
identified by mass spectrometry. They are respon-
sible mostly for bacterial physiological activity. These
activities include: transcription (N utilization protein
–  NusA), translation (ribosomal proteins RpsA and
RplI and elongation factor EF-Tu), cell division (cell
division protein FtsZ), chromosome partitioning (seg-
regation and condensation protein ScpB and chromo-
some partitioning protein ParB), riboflavin biosynthesis
(synthase RibH), and protein folding (60-kDa chaper-
one GroEL and chaperone protein HtpG). Synthesis of
6 other proteins increased in the SCV phase including
proteins involved in outer membrane stability TolB,
GTP binding protein (Era), cystathionine beta-lyase
(MetC). They are mainly involved in processes of cell
resistance to environmental conditions (Coleman et al.,
2004; Coleman et al., 2007).
The process of sporulation and the formation of
SCV, was observed in vivo with electron microscopy
(Avakyan et al., 1983; McCaul et al., 1981; McCaul
et al., 1994). C. burnetii presented pleomorphism with
occuring of both cell types. A spore-like formation was
observed in large vegetative cells. The process began at
the polar regions of the LCV and appearing SCV were
identified by high density of core, membrane-like struc-
tures, peptidoglycan and trilaminar outer membrane
(McCaul et al., 1994).
Decreased metabolic activity, condensed chromatin
and thick wall of SCV determine resistance to physi-
cal and chemical factors. These features makes them
capable to live in the external environment. In this
form the bacteria are able to survive for 30 days at the
4°C, and at 60°C for one hour. Their survival in milk at
63°C for 30 minutes or 74°C for 15 seconds has been
also observed. They are resistant to biocides such as
lysol 5%, formalin 5%, sodium hypochloride 0.5%,
sodium hydroxide 5% or ammonium chloride 10%
(Babudieri, 1959; Scott and Williams, 1990). Capac-
ity of spore formation, determined the resistance to
adverse environmental conditions. In nature, C. bur­
netii bacteria can survive two years in animal feces,
six months in dried blood and a month in dried urine
(Kishimoto et al., 1979).
2 Q fever at the turn of the century
Cell wall of C. burnetii
As Gram-negative bacteria, C. burnetii show a typi-
cal cell wall structure, characteristic for that group of
microorganisms consisting of the cell wall with outer
membrane. The wall contains the peptidoglycan layer
which is composed of N-acetylmuramic acid, N-acetyl-
glucosamine, D-alanine, D-glutamic acid, and meso-
diaminopimelic acid. The outer membrane includes
a  complex of lipopolysaccharide (LPS) (Amano and
Williams, 1984).
Regardless of the morphological LCV and SCV
forms, C. burnetii demonstrate antigenic variation of
LPS chemical composition, similar to that observed
in the Enterobacteriaceae family. These variations deter-
mine the form of the bacterial cells in phase I or phase
II. Phase I is the natural form, occurring in infected
animals and humans and is characterized by high
infectivity. Phase II is not very infectious and occurs
in laboratory conditions after passages in cell lines or
chicken embryos.
The O-antigenic polysaccharide of phase I LPS is
composed of galactosaminuronyl-alpha-(1,6)-gluco­
samine disaccharide and two other unique sugars:
6-deoxy-3-C-methyl-gulose (virenose) and dihydroxys-
treptose 3-C-(hydroxymethyl)-lyxose (Amano et al.,
1984; Schramek et al., 1985; Slabá et al., 2003). They
are located at the O-polysaccharide terminus and are
responsible for antigenic specificity. Attachment sites
of phase I-specific sugars to the LPS II-core are: the
3-position of a branched heptose and, presumably,
the 4-position of a terminal D-mannose (Mayer et al.,
1988). Additionally, it contains D-mannose, D-glucose
D-glyceromannoheptose, glucosamine, ethanolamine
acid, 3-deoxy-D-mannooctulose and 9 other unidenti-
fied compounds also (Amano et al., 1984).
Phase II LPS is a reduced form and does not con-
tain branched sugar chains. Reducing processes of the
LPS chain are regulated at the genome level. Dele-
tions in the chromosomal DNA occur in the region
containing genes essential for process of LPS biosyn-
thesis, including genes of epimerase, dehydratase,
glycosyl transferases, or primary production virenose
C-methyltransferase gene. The composition of this
region also includes genes responsible for synthesis
pyruvate dehydrogenases and adenosyl sulfotransfer-
ases. These molecular changes appear during passages
in cell lines or in chicken embryos (Hoover et al., 2002;
Denison et al., 2007).
Phase I LPS of C. burnetii cells is responsible for
their virulence. It affects the phagocytosis process of
monocytes and macrophages. It stimulates αvβ3 integ-
rin to transform it into an active form, allowing adhe-
sion of the pathogen to the surface of monocyte as the
first step of phagocytosis. It also causes conversion of
83
F-actin into the fibrillar form in macrophages, which
leads to the formation of cytoplasmic pseudopodia
surrounding bacterial cells (Honstettre et al., 2004).
Both processes are stimulated by creation a complex
with Toll-like receptor 4 (TLR4). Such complexes also
stimulate the production of IFN-γ and TNF cytokines
which are essential in the early immune response to
the infection.
After successfully evading host defense mecha-
nisms, C. burnetii bacteria are able to inhibit apoptosis
to survive and to multiply inside the cells. C. burnetii
infection affects the expression of multiple apoptosis-
related genes and resulting in increased synthesis of the
antiapoptotic proteins such as A1/Bfl-1 (member of
Bcl-2 family antiapoptotic proteins), c-IAP2 (inhibitors
of apoptosis protein family member – IAP), prosur-
vival kinases Akt and Erk1/2 (extracellular signal-reg-
ulated kinases 1 and 2). C. burnetii infection of THP-1
human macrophage-like cells caused increased levels of
phosphorylated c-Jun, Hsp27, Jun N-terminal protein
kinase, and p38 protein. This pathogen can interfere
with the intrinsic cell death pathway during infection
by producing proteins that either directly or indirectly
prevent release of cytochrome c from mitochondria.
(Voth et al., 2007; Voth and Heinzen, 2009; Lührmann
and Roy, 2007). C. burnetii bacteria may inhibit the pro-
cess of apoptosis in the host cells for at least 4 weeks
(Chmielewski and Tylewska-Wierzbanowska, 2011).
This phenomen can permit bacteria to survive intra-
cellularly in the host and to develop chronic disease.
Genome of C. burnetii
C. burnetii possesses a small chromosome of 5 Mbp
in size, and one to five plasmids of 30–51 kbp, which
contained about 2% of the genetic information. So far,
2134 gene sequences have been identified. These genes
are involved in adhesion, invasion, intracellular traf-
ficking, host modulation and other virulence-related
functions. Among all detected gene sequences, 719
(33.7%) have no homologues of gene sequences known
in other bacteria and enclosed in genetic databases.
These hypothetical genes may be responsible for func-
tions important in the unique developmental cycle of
C. burnetii. Genome analysis has also revealed the pres-
ence of numerous mobile elements and pseudogenes
which are the dysfunctional relatives of genes that have
lost their protein-coding ability. It indicates the ongo-
ing process of genome reduction (Seshadri et al., 2003).
However, there is only one species within Coxiella
genus, the diversity of clinical symptoms indicates
differences in the pathogenicity of isolated strains.
Recently their heterogeneity and association of partic-
ular strains with acute disease were investigated with
molecular genotyping techniques.
84 Chmielewski T. and Tylewska-Wierzbanowska S. 2

In nineties of the XX century determination of plas-
mid profiles allowed to distinguish five types of C. bur­
netii (types named as plasmids): QpH1, QpRS, QpDV,
QpDG and plasmidless type. Initially, it made possible
to identify pathogenicity, since particular types were
observed among strains isolated from patients with
acute or chronic Q fever.
Subsequently restriction fragment length polymor-
phism (RFLP) analysis of chromosomal and plasmid
DNA distinguished six genomic groups (I to VI). These
groups correlate well with plasmid profiles and they
are points of reference for new molecular methods for
characterizing C. burnetii strains (Hendrix et al., 1991,
Nguyen and Hirai, 1999) (Table I).
Plasmids QpH1, in size of 36 kbp occur in strains
of genomic groups I to III in one to three copies in
the cell and are mainly associated with acute infec-
tion. Group  I includes strains: Nine Mile RSA 493,
Australia QD RSA435, California 33 RSA329, Ohio
314 RSA270, Dyer RSA345, group II includes Henzer-
ling RSA331 and M44 RSA459, and group III includes
Idaho Goat Q195, Koka. Plasmid QpRS was detected
in strains of group IV isolated from miscarrying goats
and from humans with endocarditis (MSU Goat Q177,
Priscilla Q177, Canada Goat Q218, K Q154, P Q173,
F Q228). Plasmid QpDV in size of 30 kbp, is also iso-
lated from patients with acute and chronic Q  fever
(Valkova and Kazár, 1995). Plasmidless strains (Scurry
Q217, Q229, G212, L Q216) belong to the V group and
contain homo­logous to the QpRS sequences, located
in chromosomal DNA. Plasmid QpDG (42 kbp) is
characteristic for the genomic group VI isolates, from
rodents and cattle (Dugway 7E22-57, Z257, Z3027)
and from patients with both acute and chronic Q fever
(Hendrix et al., 1991; Mallavia, 1991; Willems et al.,
1993). It was shown that this plasmid is almost identi-
cal with the plasmid QpH1 (Jäger et al., 2002). Analysis
of genomic DNA with pulsed field gel electrophoresis
(PFGE) showed greater variation and allowed the dis-
tinction of 20 groups of C. burnetii strains (Jäger et al.,
1998). The first four groups correspond to previously
described genomic groups: I, IV, V and VI. This method
showed phylogenetic relatedness of bacteria occurring
in the same parts of the world, but there was no cor-
relation between the different groups separated in the
PFGE analysis and virulence. Pathogens isolated from
patients with acute or chronic Q fever have the same
restriction profile.
Sequencing of the whole genome of C. burnetii (strain
Nine Mile) in 2003, allowed the introduction of geno-
typing this organism by MST (multispacer sequence
typing). Selected region of 16/23S ribosomal DNA, is
used in the genotyping of many other bacteria. Based
on the sequencing of 10 different parts of the region,
among the 173 previously characterized strains, 34 gen­
o­types sequence types (ST) from ST1 to ST34 were
distinguished and divided into three phylogenetically
homogeneous groups. This classification corresponds
to the groups established by plasmid DNA analysis.
The first group (containing the strains with the plas-
mids QpRS and/or QpDV) includes types of ST1-ST10
and ST26, ST28, ST30, ST31. The second group (with
plasmid QpH1) are the types: ST11-ST20, ST22, ST25,
ST27, ST29, ST32, ST33. The third group include ST21
only (QpH1 or plasmidless strains). In all groups, there
are strains isolated in Europe, North America, Asia
and Africa. MST show that the same sequence types
can occur in distant parts of the world. For example,
ST16 strains were isolated on four continents. It may be
the proof of its spread with infected humans, animals
and their products or ticks. This method has shown the
correlation between ST1, ST4, ST16, ST18 and acute
Q fever, and correlation between ST8 and chronic form
of disease (Glazunowa et al. 2005).
C. burnetii reservoir and mode of transmission
Q fever is a widespread in the world zoonosis. Its
main reservoir in the rural environment are farm

Table I
C. burnetii genomic groups

Plasmid Profiling1 RFLP analysis2 PFGE3 MST4 MLVA5

5 plasmid profiles 6 genomic groups 20 restriction patterns 34 sequence types (ST) 22 panels
QpH1 I I ST11-ST20, ST22, ST25, ST27, ST29, ST32, ST33 1–2, 4–14
II ND6
III ND
Plasmidless V V ST21 3
QpDV VII ND ST1-ST10 and ST26, ST28, ST30, ST31 17
QpRS IV IV 15–16, 18–22
QpDG VI VI – –
Not established – 1–16 – –
1
according to Willems, et al. 1993;   2 according to Hendrix, et al. 1991 and Beare et al. 2006;   3 according to Jäger, et al. 1998
4
according to Glazunova, et al. 2005;   5 according to Arriccau-Bouvery, et al. 2006 (genotyping in 1–22 panels);  6 not determined
2 Q fever at the turn of the century
animals: cows, sheep, goats, and urban pets such as
dogs, cats, rabbits. In acute infection these bacteria
are detected in various internal organs such as lungs,
liver, spleen, and in excretion in urine, faeces and
milk. During childbirth, they occur in large number
in the amniotic fluid and placenta. It was estimated
that one gram of placenta of infected animals may
contain 109  C. burnetii bacteria, and one millilitre of
milk 103 bacterial cells (Babudieri, 1959). It has been
shown that 1–10 bacterial cells (Ormsbee et al., 1978)
can cause Q fever in human.
The environmental reservoir of C. burnetii are
wild animals: mammals, birds, reptiles and also ticks.
Antibodies and/or DNA of the pathogen was found
in deer, mouflon, coyotes, foxes, raccoons, mice and
rabbits (Barandika et al., 2007, McQuiston and Childs,
2002, Ruiz-Fons et al. 2008, Dorko et al., 2009, Stein
and Raoult, 1999). Migratory birds may carry micro-
organisms over long distances, even in areas previously
known as free of Q fever (Ionnou et al., 2009). C. bur­
netii was also isolated from the liver and spleen of tur-
tles, snakes and lizards. Potential source of infection for
the snakes are infected small rodents (Yadav and Sethi,
1979). Ticks are vital reservoir in natural environment.
C. burnetii bacteria were detected in more than 40 tick’s
species, mainly in those belonging to the genus Ixodes,
Rhipicephalus, Amblyomma, and Dermacentor. More-
over, ticks may play a role of a vector of Q fever. C. bur­
netii bacteria have the ability to penetrate their digestive
tract and multiply in epithelial cells of the intestine and
in the midgut. Bacteria can be transmitted from feed-
ing tick with excreted feces which contaminate fur of
animals. Next C. burnetii is transmitted to healthy indi-
viduals with a dust or aerosol. Tick’s participation in
the epidemiological process in many cases is limited
to the passive spread of the pathogen in the environ-
ment and is not a necessary link in the epidemical chain
(Maurin and Raoult, 1999; Rehacek and Tarasevich,
1988). All these data indicate that C. burnetii has no
specific reservoir in the environment, and that they can
provide all vertebrates.
Recently, it has been found that free-living pro-
tozoa amoeba Acanthamoeba castellani may also be
a  reservoir of the pathogen. This is a cosmopolitan
protozoan occurring in fresh water, damp soil and
air. The intra-amoebal location of C. burnetii cells was
observed by microscopy. After 3  days of cultivation,
bacteria were found in vacuoles within the amoebae
in a large cell variant form. Bacteria were not found
free in cytoplasm. Viable bacteria were seen for 18 days
and after that time some of them appeared as spore-
like forms demonstrating the ability of C. burnetii to
undergo differentiation process within amoebae. These
results indicate that free-living amoebae could be an
intracellular niche for the spore formation and sur-
85
vival of C. burnetii in the environment (La Scola and
Raoult, 2001) The bacteria spread in the environment
after delivery by infected animals and they could be
ingested by soil amoebae. Then they can differentiate
into a spore-like forms inside, and the infected amoebae
can be transmitted with the wind. Q fever was observed
in areas distant for several kilometres from the farms
with infected animals. These cases were the result of the
C. burnetii carried with the dust by the mistral blowing
from infected areas (Tissot-Dupont et al., 1999; Tissot-
Dupont et al., 2004).
Human infection could occur through the inhala-
tion of infected amoebae as it has been described in
the epidemiology of Legionella pneumophila – closely
related phylogenetically to C. burnetii (Greub and
Raoult, 2004). In addition these two pathogens have
some other common features. Legionella can be cul-
tured in living protozoa (Rowbotham, 1983) and
C. burnetii is cultured in different eukaryotic cell lines
(Gouriet et al., 2005). During infection of humans both
of these pathogens multiply in alveolar macrophages
inside a phagosome. L. pneumophila and C. burnetii are
the only two bacteria known today to utilize a type-
IVB secretion system for pathogenesis. This system play
an important role in creating the specialized vacuole
that supports C. burnetii replication within the host
cell (Segal et al., 2005). All known intracellular species
(including both pathogens) have common evolution-
ary origin confirmed by detection of over 200 ortholog
genes. Moreover, C. burnetii and L. pneumophila obvi-
ously may exchange genes in the amoebas with other
bacteria (Gimenez et al., 2011).
Implication of ability to intracellular existence in
free living amoebas, may be transmission of the Q fever
agent by air conditioning as it has been observed in
Legionella infections. This etiology should be analyzed
if atypical pneumonia appears among patients exposed
to such system. For the first time the role of air con-
ditioning as a potential source of a Q fever was estab-
lished in 2005 in Israel. Infection was detected among
322 students and employees eating in dining room of
local urban school (Amitai et al., 2010).
The route of infection can determine clinical symp-
toms of Q fever (Marrie et al., 1996). The main route
of C. burnetii transmission from animals to humans is
the inhalation of contaminated aerosols. Less impor-
tant is oral route of infection. Consumption of raw milk
and its products but also tobacco smoking, have been
reported as a risk factor of disease (Fishbein and Raoult,
1992; Hatchette et al., 2001).
Transmission among humans through sexual con­-
tacts has been described (Kruszewska et al., 1996;
Tylewska-Wierzbanowska et al., 1996). This route of
infection was also confirmed experimentally in mice.
From intraperitoneal infected male mice, spermatozoa
86 Chmielewski T. and Tylewska-Wierzbanowska S.
were isolated and examined with electron microscopy.
C. burnetii formed agglomerations of spermatozoa with
bacteria attached to their heads and leukocytes. Infec-
tion was transmitted by sexual contact from infected
male mice to uninfected female mice. This was con-
firmed by humoral response to the antigens of both
phases (Kruszewska and Tylewska-Wierzbanowska,
1991; 1993). These findings suggested hypothesis of the
sexual transmission of Q fever in artificially inseminated
cattle. Such hypothesis was confirmed by examination
of serum and semen samples from bulls suspected to
be infected with C. burnetii. Among seropositive bulls,
viable bacteria have been detected in semen with indi-
rect immunofluorescence assay and strains of C. bur­
netii have been isolated (Kruszewska and Tylewska-
Wierzbanowska, 1997).
Other than sexual transmission from man to man
may occur sporadically. Such infections have been
described during autopsy from necropsy material, by
blood transfusion and after contact with infected par-
turient woman (Maurin and Raoult, 1999; Rehacek and
Tarasevich, 1988)
Clinical course of disease
Q fever shows a wide range of acute and chronic
manifestations. The incubation time is 1–3  weeks.
About 60% of infected persons are asymptomatic. The
others have a non-specific influenza-like illness with
fever, headache, sweats, non productive cough, myal-
gias and arthralgias in acute phase of infection. Most
of them develop atypical pneumonia confirmed with
the chest radiograph and/or hepatitis. In patients with
hepatitis, the liver biopsy reveals diffuse granuloma-
tous changes, and blood testing shows high levels of
alkaline phosphatase and transaminases. About 5% of
infected patients required hospitalization due to respi-
ratory distress or hepatitis (Tissot Dupont et al., 1992;
Maurin and Raoult 1999). Infection of the central and
peripheral nervous system is reported as a rare feature
and manifests as a meningitis, meningoencephalitis,
Guillain-Barre syndrome. The majority of patients
present with severe headache, confusion, psychiatric
disturbances, peripheral neuropathies and neurologi-
cal deficits. Cranial nerve palsy and blurred vision is
observed less frequently. Small pleocytosis and elevated
protein levels are detected in cerebrospinal fluid in
approximately 30% of these patients (Bernit et al., 2002;
Kofteridis et al., 2004, Ong et al. 2010). Rare manifes-
tations of acute Q  fever affect cardiovascular system
(myocarditis and pericarditis) and skin. Myocarditis
is usually asymptomatic and is detected only in the
electrocardiogram (T wave inversion, ST elevation). It
can be accompanied by arrhythmia, tachycardia and
hypoxemia leading to severe cardio-vascular disorders
in some cases (Chevalier et al., 1997; Vogiatzis et al.,
2
2008; Fournier et al., 2001). Pericarditis is manifested
as a pain in the chest. It is often not recognized due
to similar symptoms accompanying atypical pneumo-
nia (Levy et al., 1999, Bautista-Hernandez et al., 2004).
In 5–21% of patients can also be observed macular or
papular rash on the skin (Maurin and Raoult, 1999).
Chronic Q fever occurs in less than 1% of cases. It is
developed months or years after infection, and affects
mainly patients with the mitral or aortic valve defects,
with vascular diseases or immune defect. Myocarditis
(60–70%) and vascular infections (about 9%) are the
most common manifestation in the chronic form of dis-
ease (Botelho-Nevers et al., 2007, Maurin and Raoult,
1999; Varma et al., 1980). Clinical forms range from
asymptomatic to congestive heart failure with mortal-
ity of about 30–40% (Fennolar et al., 2006; Karakousis
et al., 2006). Death rate has decreased to 5% over the
past 10 years due to better diagnosis and the introduc-
tion of treatment with several antibiotics simultane-
ously (Raoult et al., 1999).
The second most common form of chronic Q fever
are vascular infections of large blood vessels. Serious
sequels occur in patients with aortic aneurysm or vas-
cular grafts. Infection with C. burnetii may lead to
massive hemorrhage from the wall of the aneurysm or
from the anastomosis. Mortality among these patients
reaches 25% (Botelho-Nevers et al., 2007; Ellis et al.,
1983; Sessa et al., 2005).
Rare manifestations involve liver, osteoarticular and
respiratory systems. Chronic hepatitis has been reported
mainly as a concomitant symptom with chronic myo-
carditis (Westlake et al., 1987). In some individuals it
may be the only manifestation of chronic Q fever and
can be confirmed by detection of high levels of anti­
bodies to phase I antigen (Yebra et al., 1988).
Osteoarthritis is diagnosed mainly in children.
Inflammation of the hip joint, lumbar sopondylitis,
discitis and osteomyelitis have been reported (Cot-
talorda et al., 1995; Ortolá et al., 1992; Raoult et al.,
1989). Bronchial tumors may occur in respiratory sys-
tem as a result of long-lasting pneumonia. Cumulation
of monocytes in the alveolar closes bronchioles lumen.
This mechanism has been observed in the histopatho-
logical examination of pulmonary tissue (Janigan and
Marrie, 1983).
There are a few data on the consequences of Q fever
during pregnancy. In untreated women is associated
with high fetal mortality. Normal outcome and a healthy
child at delivery had only 18.9% of monitored untreated
women. So far congenital teratogenic defects in chil-
dren of untreated mothers have not been observed.
Infection with C. burnetii can cause premature delivery
(44.7% of cases), abortion (26% of cases), intrauterine
fetal death intrauterine growth retardation. C. burnetii
penetration of the placenta and fetus infection in utero
2 Q fever at the turn of the century
are well documented. The bacteria colonize and mul-
tiply in the uterus, placenta and mammary glands. It
leads to placenta insufficiency following vasculitis and
thrombosis (Stein and Raoult, 1998).
Infection during pregnancy is associated with
higher risk of developing chronic form of the disease
and spontaneous abortions in the future. Q fever can
also be activated during the next pregnancy, and there-
fore patients require regular monitoring and long-term
cotrimoxazole therapy (Carpocino et al., 2009; Raoult
et al., 2002). It has been proved that a late sequel of
acute Q fever may be chronic fatigue syndrome also
(Ayres et al., 1996).
Q fever is uncommon in children. The main clinical
symptoms are pneumonia with pleural effusion, men-
ingitis, rarely hepatitis (with elevated transaminases)
and hemolytic-uremic syndrome. Fever is ascertained
in all infected ones and it lasts for 10 days. About half
of affected children complain of headache, abdominal
pain, nausea, and fatigue (Maltezou et al., 2004).
Treatment of Q fever
Treatment of acute Q fever should be started
within the first 3 days of diseases. The drugs of choice
are tetracycline (4 × 500 mg), primarily doxycycline
(2 × 100 mg), administered for 14 days. An alternative
for tetracyclines are fluoroquinolones (3 × 200 mg)
for 14–21 days, or pefloxacin (400 mg) administered
14–2 days (Raoult, 1993; Maurin and Raoult, 1999).
Fluoroquinolones alkalinizes the phagolysosomes of
infected host cells and could be used in patients with
Q  fever meningoencephalitis considering their good
penetration to cerebrospinal fluid. Effective treatment
were also observed after macrolides applications. Clini-
cal studies have shown that erythromycin administered
in doses of 500 mg every 6 hours for 10 days, is effective.
Comparing duration of treatment with erythromycin,
clarithromycin, roxithromycine or β-lactam antibiot-
ics with doxycycline, normalization of body tempera-
ture was longer on the average of one day in groups
of patients treated with clarithromycin (2 × 500 mg),
erythromycin (3 × 500 mg) and roxithromycin, and by
nearly 3 days longer in patients receiving β-lactams
(Gikas et al., 2001)
Chronic Q fever (myocarditis) requires a long treat-
ment with tetracycline (months and years) and is one
of the longest duration of antibiotic therapy in bacterial
diseases. Often the treatment leads to failure or relapse
(Ellis et al., 1983). Combined treatment, including tet-
racycline with lincomycin, co-trimoxazole with tetra­
cycline or rifampicin with tetracycline (Tobin et al.,
1982, Varma et al., 1980) does not give the expected
results. Despite the use of them for several years C. bur­
netii was isolated from valves. Good therapeutic results
were obtained using a combination of doxycycline with
87
ofloxacin. Mortality decreased to about 5%, however,
proportion of relapses was still high (64%). This pro-
portion dropped to 14% after the 18 months treat-
ment with doxycycline (2 × 100 mg) and chloroquine
(3 × 200 mg). This scheme is currently recommended
in the treatment of chronic Q fever. In clinical cases, in
which of chloroquine is contraindicated, doxycycline
(2 × 100 mg) with ofloxacin (3 × 200 mg) for at least
3 years is administered (Fennolar et al., 2006; Maurin
and Raoult, 1999)
Sensitivity of C. burnetii to antibiotics
Antibiotic sensitivity has been studied in animal
models, chicken embryos and cell lines (Baca and
Yeaman, 1991; Raoult, 1991; Spicer et al., 1981). Animal
models were used for testing sensitivity to antibiotics in
acute infection only.
In these studies resistance to streptomycin treatment
to infected guinea pigs has been proved. In in vitro stud-
ies, the antibiotics influence on the growth of C. bur­
netii in chicken embryos was examined. Extension of
survival time was revealed in infected embryos after
administration of antibiotics. It was found that rifam-
picin, doxycycline, oxytetracycline and trimethoprim
are effective but their use has shown a bacteriostatic
effect against C. burnetii infection only. Tested strains
demonstrated also the resistance to penicillin, amino-
glycoside, erythromycin, clindamycin and cephalotin
(Spicer et al., 1981).
With the development of cell lines culture tech-
niques it was possible to use them to determine sen-
sitivity of the bacteria to antibiotics. The study was
conducted in line L-929 (mouse fibroblasts) freshly
(few days) and chronically (over 100 days) infected
with different strains of C. burnetii. Antibiotics labeled
with isotopes were added to infected cultures and their
accumulation in bacterial cells was measured (Baca and
Yeaman, 1991). It was shown, that in vitro C. burnetii
strains isolated from chronic Q fever patients, exhibit
significant differences in reaction to tetracycline, rifam-
picin and fluoroquinolones. Priscilla strain, has been
shown a significant resistance to these antibiotics, com-
paring to the “S” isolate which was much more sensitive
in chronically infected cells (300 days). The “S” strain
was significantly more resistant to doxycycline and cip-
rofloxacin compared to the acute Q fever-implicated
Nine Mile strain. Their sensitivity to antibiotics was
found to be moderate in fresh infected (22 days) cell
culture. It suggests that C. burnetii isolates, which may
be responsible for the clearly different Q fever symp-
toms exhibit a spectrum of antibiotic sensitivity ranging
from very sensitive acute-implicate Nine Mile strain, to
moderately susceptible chronic-implicated “S” isolate,
and to moderately resistant chronic-implicated Priscilla
isolate (Yeaman and Baca, 1990).
88 Chmielewski T. and Tylewska-Wierzbanowska S.
It has been demonstrated that bacteriostatic activity
of doxycycline, could be changed into bactericidal, by
the adding of amantadine or chloroquine to the fresh
infected cell line. They raised the pH of infected cells
and improve the efficiency of doxycycline (Maurin and
Raoult, 1999; Raoult et al., 1999).
The machanisms of antibiotic resistance are poorly
characterized. Genome-based studies have shown that
the main mechanism of C. burnetii resistance to fluo-
roquinolones is based on mutations in genomic qui-
nolone-resistance-determining region (QRDR). About
15 bacterial proteins are involved in these cellular pro-
cesses (Vranakis et al., 2011). The best known mecha-
nism is that caused by nucleotide mutation in DNA
gyrase encoding genes (gyrA and gyrB) and topoisom-
erase IV genes (in subunits: parC and parE), leading to
an amino acid substitution (Vranakis et al., 2010).
Q fever in Europe
In Europe for the first time Q fever was detected
in Greece during the World War II. C. burnetii strain
was isolated in guinea pig injected with the blood
of a patient infected during an outbreak in Athens in
1943. The disease resembling influenza, has been named
by Germans a “Balkan Grippe”. In the years 1944 and
1945 epidemics of Q fever occurred among U.S. troops
stationed in Italy and at Corsica. After World War II,
an endemic +area of Q fever in Europe represented
Portugal, Spain, southern France, Italy, Switzerland,
southern Germany, Slovakia, Great Britain, the Balkans
and the southern part of the USSR. In central Europe
the source of infection for humans mainly were cattle
and sheep, and in southern Europe goats (Rehacek et al.,
1988). Until the eighties of the 20th century Q  fever
was reported as a local outbreaks or sporadic cases
(Marrie et al., 1988; Marrie et al., 1986; Meiklejohn
et al., 1981; Salmon et al., 1982; Spelman, 1982; Tissot
Dupont et al., 1992).
At the turn of the centuries, besides local foci, major
outbreaks with large number of infection cases have
occurred (Lyytikäinen et al., 1998; Panaiotov et al., 2009;
Dupuis et al., 1987; King et al., 2011; Carrieri et al.,
2002). This phenomen is related to change sin animal
farm organization and their structure. Because of the
great demand for goat milk products, the number of
herds of these animals has increased. Intensive breeding
and transport of goats between farms favor the spread
of infection among these animals. The cause of the
pathogen spread among humans is the use of goat feces
as a natural fertilizer close to the towns and transport
the animals through the densely populated urban areas
(Enserink et al., 2010).
For the first time, that process was observed in
Bulgaria in nineties of the twentieth century. Greater
demand for goat milk products, caused that the num-
2
ber of goats tripled and replaced cattle and sheep as
the main source of human C. burnetii infections. Hun-
dreds of serologically confirmed human cases of acute
Q  fever have occurred and chronic disease as endo-
carditis were also observed (Serbezov et al. 1999).
Since 2007 in the Netherlands the largest Q-fever epi-
demic ever reported has been lasting up today. During
2007–10 over 4,000 human cases have been recorded,
with 14 deaths. The main reason of the epidemic is the
increase in the intensity of goat breeding. The number
of those animals has quadrupled since 1995 to more
than 350 thousand. Geographically, farms are located
often close together. Transport of goats between them
through densely populated areas facilitating spread of
C. burnetii in environment. Genetic typing with VNTR
(variable-number tandem repeat analysis) has shown
that animals and humans are infected by a single sub-
type suggesting its better propagation than others.
Additionally, animal vaccination is not effective. These
are the probable reasons of the spread of the epidemic
(Speelman, 2010; Tillburg et al., 2012).
The proximity of large numbers of people not
related to livestock production in contact with infected
animals is another cause of large outbreaks. Such two
foci occurred in Germany in 2003 and 2005. In the
first one, 299 patients were registered. The source were
infected sheep sold in the local market visited by large
number of customers. In the second one (331 patients),
infected sheep were grazed a few dozen meters away
from housing developments (Gilsdorf et al., 2008;
Porten et al., 2006).
Q fever in Poland
Two sources of the outbreaks have been observed
in Poland: the import of infected animals or their
products and natural domestic foci (Anusz, 1995,
Anusz et al., 1996, Chrzanowski et al. 1960). In 1956
the first outbreak of Q fever was recorded in Owczary
near Gorlice (south-eastern Poland). In April and May
63  persons were affected and among tested 35 cases
were confirmed with serology. Epidemiological investi-
gations revealed that the source of infection was a sheep
flock imported from Romania (Lutyński, 1956). Tested
wool samples from these animals were the source of
the secondary outbreaks in laboratory of Zootechnical
Institute in Kraków (20 cases) and National Institute
of Hygiene in Warsaw (17 cases). In 1962 Q fever in
the furrier factory was reported. Twenty six persons
were infected, and the source of infection were skins
from American sheep (Gawron and Wagner, 1962). In
1985 Q fever outbreak occurred in Olsztyn region in the
factory of leather industry. Five persons were hospital-
ized in this outbreak. (Stempień et al., 1985). In 1992
Q fever was recognized among 18 workers of a tannery
in Malopolska voivodship (southern Poland). Antibod-
2 Q fever at the turn of the century
ies to C. burnetii were detected in all 18 individuals who
had been in contact with fells imported from Mongolia
(Tylewska-Wierzbanowska et al., 1996). These fells were
contaminated with infected ticks
From 1956 until 2005 several domestic outbreaks of
Q fever were described (Anusz et al., 1986; Mikołajczyk
et al., 1986; Tylewska-Wierzbanowska et al., 1993; 1996).
In 1983 an epidemic of Q fever among humans
and animals was recognized near Zamość (Lubelskie
voivodship in eastern Poland). More than one thousand
people showed high levels of antibodies and C. burnetii
strains were isolated from human as well as cow pla-
centas. Epidemiological investigations did not detect
the source of infection and there was no any import of
animals or their products to this region (Mikołajczyk
et al., 1986). In 1985 the focus of Q fever was found in
the Bialowieza primeval forest (eastern Poland) among
bisons, cattle and sheep. (Anusz et al., 1991b). A sero-
logical survey in small mammals revealed the presence
of specific antibodies in mice, rats, shrews, field-voles
in the Olsztyn region in north-eastern Poland (Anusz
et al., 1991a). C. burnetii caused outbreaks in 1985 and
1986 in two farms in olsztyńskie voivodship. In one of
them, among 686 person examined for the presence
of C. burnetii antibodies, 11% were seropositive. Spe-
cific antibodies were also found in 19% of tested cattle.
Rodents were not infected. These results suggested
the existence of a natural C. burnetii reservoir (Anusz
et al. 1986). Circulation of the pathogen in the envi-
ronment was first confirmed in 1989 by isolation of
C. burnetii from the tick Ixodes ricinus found in this
focus (Anusz et al., 1996).
From 1973 to 1991 a serological survey of Q fever
among cattle and sheep has been performed in Wielko­
polska voivodship (western Poland). From 1973 to 1985
over 28 thousands blood samples derived from cattle
and sheep have been tested. All were seronegative. In
1986 the first seropositive cattle were found (5.5%) and
in the next year the percentage increased to 16.3%. In
1988 serum antibodies to C. burnetii were detected
in 25.9% cattle. At the same time sheep living in the
neighborhood were free of infection. In the consecutive
years, the percentage of seropositive animals decreased
and in 1991 was only 3.2%. In this time, a serologi-
cal survey was performed among individuals who had
professional contact with the animals. In southern
Wielkopolska, among 4214 persons tested, 34.4% were
seropositive. From 1988 to 1991, in the central part of
this region, antibodies to C. burnetii have been detected
in 22.7% of 6396 people tested. In the next years, the
percentage fluctuated from 16.6 to 34.7% (Tylewska-
Wierzbanowska et al. 1991; 1993)
In 1992 an outbreak of Q fever was detected at
a farm in Dolnoslaskie voivodship (southern Poland).
The disease was recognized serologically in 25 per-
89
sons (27 tested). It was found that C. burnetii infection
spread among cattle and these animals were the source
of infection for humans (Tylewska-Wierzbanowska
et al., 1996).
The source in those epidemics was unclear. There
was no any import of animals at that time. The only
probable source of infection could be imported bull
semen contaminated with C. burnetii bacteria. Outbreak
invastigation confirmed transmission of Q fever by arti-
ficially insemination of cattle (Kruszewska et al., 1997).
In 1993 several cases of Q fever were observed
among people living in various regions of the coun-
try. Epidemiological investigations revealed that the
infected patients were seasonal workers employed dur-
ing the shearing time in Spain. Specific serum antibod-
ies reached the titer 512 and C. burnetii strains were
isolated from the urine and semen of 2 patients. At the
same time symptoms of the disease and increased lev-
els of specific serum antibodies were detected in their
wives who remained in Poland and had no any con-
tact with the animals. Transmission among humans
through sexual contact was confirmed. Since the other
family members have not shown infectious symptoms,
sexual transmission was postulated (Kruszewska et al.,
1996; Tylewska-Wierzbanowska et al., 1996).
MST analysis of C. burnetii strains isolated in Poland
between the sixties and the eighties of the 20th century,
showed that all of them represent ST18 (sequence type),
although MLVA typing showed their genotypic het-
erogeneity. Strain isolated in 1956 from sheep belongs
to unique MST pattern ST16 which have never been
recognized later in Poland (Chmielewski et. al., 2009).
It suggests that this imported strain was effectively
eliminated due to sanitary procedures applied. This
particular strain did not spread later on Polish terri-
tory, even though it is known that C. burnetii strains
with ST16 profile occur in Europe (Romania, Ger-
many and France) as well as on other continents. It has
been established, that ST18 and ST16 types appear in
strains isolated from patients with acute form of the
disease and they have never been present in strains
isolated from chronic Q fever cases. There is a wide
variety of isolated strains in countries neighboring
with Poland. In Germany there are at least six sequence
types, and in Slovak Republic at least three (Arricau-
Bouvery et al., 2006).
From 2005 to 2010, five Q fever outbreaks have been
recognized in southern Poland. Over sixty human cases
have been reported. These outbreaks demonstrate that
the source of infection for humans are infected cattle (in
press). In 2007 epidemiological study was carried out
in Poland to determine prevalence of C. burnetii anti-
bodies in the 48 herds of goats located in different parts
of the country. The survey did not revealed antibodies
to C. burnetii in tested animals (Czopowicz et al., 2010).
90 Chmielewski T. and Tylewska-Wierzbanowska S.
So far, there have been no reported goat-to-human
transmissions of C. burnetii in Poland.
All human cases diagnosed to this time, represented
acute form of infection. Chronic Q fever cases (endo-
carditis) in previous and recent Q fever outbreaks have
not been reported (Hryniewiecki et al., 2001). It is not
clear whether this was the result of the low pathoge-
nicity of circulating strains or low detection of human
cases and notification of the disease. In the newest
study, the presence of C. burnetii DNA has been shown
in heart valves and in the myocardium of malfunction-
ing human hearts. The obtained results indicate that
among patients with cardiac diseases, infections caused
by C. burnetii could occur and should be obligatorily
tested (Mączka et al., 2011).
Literatura
Amano K. and J.C. Williams. 1984. Chemical and immunological
characterization of lipopolysaccharides from phase I and phase II
Coxiella burnetii. J. Bacteriol. 160: 994–1002.
Amano K, J.C. Williams, T.F. McCaul and M.G. Peacock. 1984.
Biochemical and immunological properties of Coxiella burnetii cell
wall and peptidoglycan-protein complex fractions. J. Bacteriol. 160:
982–988.
Amitai Z., M. Bromberg, M. Bernstein, D. Raveh, A. Keysary,
D. David, S. Pitlik, D. Swerdlow, R. Massung, S. Rzotkiewicz,
O. Halutz and T. Shohat. 2010. A large Q fever outbreak in an urban
school in central Israel. Clin. Infect. Dis. 50: 1433–1438.
Anusz Z., H. Ciecierski, J. Knap, Z. Piesiak, A. Platt-Samoraj,
J. Siemionek, W. Szweda, M. Szymański, J. Łęcki and E. Kowalska.
Q fever in Poland in the years 1952–1995. Rickettsiae and rickettsial
diseases Proceedings of the Vth International Symposium, 1–6.09.
1996, Bratislava.
Anusz Z., J. Knap, J. Ziemka, Z. Piesiak, K. Borko, H. Ciecierski,
D. Kruszewska, Z. Lewińska, E. Mikołajczyk and W. Rumin. 1986.
Two foci of Q fever in humans, sheep and cattle in the Olsztyn
province. Przegl. Epidemiol. 40: 349–361.
Anusz Z., J. Rehacek, J. Knap, H. Krauss, H. Ciecierski, A. Platt-
Samoraj, W. Wodecki and P. Lewicki. 1991. Sytuacja epizootiolo­
giczno-epidemiologiczna gorączki Q u bydła i ludzi w regionie
Żuław. Acta. Acad. Agricult. Tech. Olst. Vet. 20: 35–45.
Anusz Z., E. Walkowiak, J. Krupa, D. Kruszewska, W. Rumin and
H. Ciecierski. Occurence of Coxiella burnetii antibodies in bisons
(Bison bonasus) from Bialowieski Primeval Forest and in cattle and
sheep from villages around it. Proceedings of the 37 Annual Meeting
of the European Association for Animal Production; 1991 Sep 1–6;
Budapest, Hungary: Summaries. p. 538.
Anusz Z. Q fever in humans and animals. Olsztyn: WART; 1995.
Arricau-Bouvery N., Y. Hauck, A. Bejaoui, D. Frangoulidis,
C.C. Bodier, A. Souriau, H. Meyer, H. Neubauer, A. Rodolakis
and G. Vergnaud. 2006. Molecular characterization of Coxiella bur­
netii isolates by infrequent restriction site-PCR and MLVA typing.
BMC Microbiol. 6: 38.
Avakyan A.A., V.L. Popov, S.M. Chebanov, A.A. Shatkin,
V.E. Sidorov and R.I. Kudelina. 1983. Comparison of the ultra-
structure of small dense forms of chlamydiae and Coxiella burnetii.
Acta Virol. 2: 168–172.
Ayres J.G., E.G. Smith and N. Flint. 1996. Protracted fatigue and
debility after acute Q fever. Lancet 347: 978.
2
Babudieri B. 1959. Q fever: A zoonosis. Adv. Vet. Sci. 5: 81–154.
Baca O.G. and M.R. Yeaman. 1991. Antibiotic susceptibilities and
possible resistance mechanisms of several Coxiella burnetii isolates.
(W:) J. Kazar and D. Raoult: Rickettsiae and Rickettsial Diseases.
Bratislava, pp.: 700–713.
Barandika J.F., A. Hurtado, C. García-Esteban, H. Gil, R. Escu-
dero, M. Barral, I. Jado, R.A. Juste, P. Anda and A.L. García-
Pérez. 2007. Tick-borne zoonotic bacteria in wild and domestic
small mammals in northern Spain. Appl. Environ. Microbiol. 73:
6166–6171.
Bautista-Hernández V., F. Gutierrez, V.G. Ray, J.M. Arribas,
J. García-Puente, N. Casinello and R. Arcas. 2004. Constrictive
pericarditis due to Coxiella burnetii. Ann. Thorac. Surg. 1: 326–328.
Beare P.A., J.E. Samuel, D. Howe, K. Virtaneva, S.F. Porcella and
R.A. Heinzen. 2006. Genetic diversity of the Q fever agent, Coxiella
burnetii, assessed by microarray-based whole-genome comparisons.
J. Bacteriol. 188: 2309–2324.
Bernit E., J. Pouget, F. Janbon, H. Dutronc, P. Martinez,
P. Brouqui and D. Raoult. 2002. Neurological involvement in acute
Q fever: a report of 29 cases and review of the literature. Arch. Intern.
Med. 162: 693–700
Botelho-Nevers E., P.E. Fournier, H. Richet, F. Fenollar, H. Lepidi,
C. Foucault, A. Branchereau, P. Piquet, M. Maurin and D. Raoult.
2007. Coxiella burnetii infection of aortic aneurysms or vascular
grafts: report of 30 new cases and evaluation of outcome. Eur. J. Clin.
Microbiol. Infect. Dis. 26: 635–640.
Burnet F.M. and M. Freeman. 1937. Experimental studies on the
virus of “Q” fever. Med. J. Aust. 2: 299.
Burnet F.M. and M. Freeman. 1938. The rickettsia of Q fever: fur-
ther experimental studies. Med. J. Aust. 1: 296.
Carcopino X., D. Raoult, F. Bretelle, L. Boubli and A. Stein. 2009.
Q Fever during pregnancy: a cause of poor fetal and maternal out-
come. Ann. N. Y. Acad. Sci. 1166: 79–89.
Carrieri, M.P., H. Tissot-Dupont, D. Rey, P. Brousse, H. Renard,
Y. Obadia and D. Raoult. 2002. Investigation of a slaughterhouse-
related outbreak of Q fever in the French Alps. Eur. J. Clin. Microbiol.
Infect. Dis. 21: 17–21.
Chevalier P., F. Vandenesch, P. Brouqui, G. Kirkorian, A. Tabib,
J. Etienne, D. Raoult, R. Loire and P. Touboul. 1997. Fulminant
myocardial failure in a previously healthy young man. Circulation.
95: 1654–1657.
Chmielewski T., K. Sidi-Boumedine, V. Duquesne, E. Podsiadly,
R. Thiéry and S. Tylewska-Wierzbanowska. 2009. Molecular epi-
demiology of Q fever in Poland. Pol. J. Microbiol. 58: 9–13
Chmielewski T. and S. Tylewska-Wierzbanowska. 2011. Inhibi-
tion of fibroblast apoptosis by Borrelia afzelii, Coxiella burnetii and
Bartonella henselae. Pol. J. Microbiol. 60: 269–272.
Chrzanowski J., I. Kularska, R. Stempień and L. Wojciechowski.
1960. Badania serologiczne w kierunku gorączki Q wśród pra-
cowników przemysłu wełnianego. Przeg. Epid. 4: 411–416.
Coleman S.A., E.R. Fischer, D.C. Cockrell, D.E. Voth, D. Howe,
D.J. Mead, J.E. Samuel and R.A. Heinzen. 2007. Proteome and
antigen profiling of Coxiella burnetii developmental forms. Infect.
Immun. 75: 290–298.
Coleman S.A., E.R. Fischer, D. Howe, D.J. Mead and R.A. Heinzen.
2004. Temporal analysis of Coxiella burnetii morphological differ-
entiation. J. Bacteriol. 186: 7344–7352.
Cottalorda J., J.L. Jouve, G. Bollini, P. Touzet, A. Poujol,
F. Kelberine and Raoult D. 1995. Osteoarticular infection due to
Coxiella burnetii in children. J. Pediatr. Orthop. B. 4: 219–221.
Cox H.R. 1941. Cultivation of rickettsiae of the rocky mountain
spotted fever, typhus and Q fever groups in the embryonic tissues
of developing chicks. Science. 94(2444): 399–403.
Czopowicz M., J. Kaba, O. Szaluś-Jordanow, M. Nowicki,
L. Witkowski, D. Nowicka and T. Frymus. 2010. Prevalence of
2 Q fever at the turn of the century
antibodies against Chlamydophila abortus and Coxiella burnetii in
goat herds in Poland. Pol. J. Vet. Sci. 13: 175–179.
Denison A.M., R.F. Massung and H.A. Thompson. 2007. Analysis
of the O-antigen biosynthesis regions of phase II isolates of Coxiella
burnetii. FEMS Microbiol. Lett. 267: 102–107.
Derrick E.H. 1937. Q fever, a new fever entity: clinical features,
diagnosis and laboratory investigation. Med. J. Aust. 2: 281.
Dorko E., K. Rimarova, E. Pilipcinec and M. Travnicek. 2009.
Prevalence of Coxiella burnetii antibodies in wild ruminants in
Kavecany zoo, Kosice, eastern Slovakia. Ann. Agric. Environ. Med.
16: 321–324
Dupuis G., J. Petite, O. Péter and M. Vouilloz. 1987. An important
outbreak of human Q fever in a Swiss Alpine valley. Int. J. Epidemiol.
16: 282–287.
Ellis M.E., C.C. Smith and Moffat M.A. 1983. Chronic and fatal
Q-fever infection: a review of 16 patients seen in North-East Scot-
land (1967–1980). Q.J. Med. 52: 54–66.
Enserink M. 2010. Infectious diseases. Questions abound in Q-fever
explosion in the Netherlands. Science 327: 266–267
Fenollar F., F. Thuny, F. Xeridat, H. Lepidi and D. Raoult. 2006.
Endocarditis after acute Q fever in patients with previously undiag-
nosed valvulopathies. Clin. Infect. Dis. 42: 818–821.
Fishbein D.B. and D. Raoult. 1992. A cluster of Coxiella burnetii
infections associated with exposure to vaccinated goats and their
unpasteurized dairy products. Am. J. Trop. Med. Hyg. 47: 35–40.
Fournier P.E., J. Etienne, J.R. Harle, G. Habib and D. Raoult. 2001.
Myocarditis, a rare but severe manifestation of Q fever: report of
8 cases and review of the literature. Clin. Infect. Dis. 32: 1440–1447.
Gawron H. and K. Wagner. 1962. A focus of Q-fever in Gdańsk in
1962. Przegl. Epid. 1: 87–89.
Gikas A., D.P. Kofteridis, A. Manios, J. Pediaditis and Y. Tselentis.
2001. Newer macrolides as empiric treatment for acute Q fever
infection. Antimicrob. Agents Chemother. 45: 3644–3646.
Gilsdorf A., C. Kroh, S. Grimm, E. Jensen, C. Wagner-Wiening
and K. Alpers. 2008. Large Q fever outbreak due to sheep farm-
ing near residential areas, Germany, 2005. Epidemiol. Infect. 136:
1084–1087.
Gimenez G., C. Bertelli, C. Moliner, C. Robert, D. Raoult,
P.E. Fournier and G. Greub. 2011. Insight into cross-talk between
intra-amoebal pathogens. BMC Genomics. 2; 12: 542.
Glazunowa O., V. Roux, O. Freylikman, Z. Sekeyova, G. Fournous,
J. Tyczka, N. Tokarevich, E. Kovacava, T.J. Marrie and D. Raoult.
2005. Coxiella burnetii genotyping. Emerg. Inf. Dis. 11: 1211–1217.
Gouriet F., F. Fenollar, J.Y. Patrice, M. Drancourt and D. Raoult.
2005. Use of shell-vial cell culture assay for isolation of bacteria
from clinical specimens: 13 years of experience. J. Clin. Microbiol.
43: 4993–5002.
Greub G. and D. Raoult. 2004. Microorganisms resistant to free-
living amoebae. Clin. Microbiol. Rev. 17: 413–433.
Hatchette T.F., R.C. Hudson, W.F. Schlech, N.A. Campbell,
J.E. Hatchette, S. Ratnam, D. Raoult, C. Donovan and T.J. Marrie.
2001. Goat-associated Q fever: a new disease in Newfoundland.
Emerg. Infect. Dis. 7: 413–419.
Hendrix L.R., J.E. Samuel and L.P. Mallavia. 1991. Differentiation
of Coxiella burnetii isolates by analysis of restriction-endonucle-
ase-digested DNA separated by SDS-PAGE. J. Gen. Microbiol. 137:
269–276
Honstettre A., E. Ghigo, A. Moynault, C. Capo, R. Toman,
S. Akira, O. Takeuchi, H. Lepidi, D. Raoult and J.L. Mege. 2004.
Lipopolysaccharide from Coxiella burnetii is involved in bacterial
phagocytosis, filamentous actin reorganization, and inflammatory
responses through Toll-like receptor 4. J. Immunol. 172: 3695–3703
Hoover T.A., D.W. Culp, M.H. Vodkin, J.C. Williams and
H.A. Thompson. 2002. Chromosomal DNA deletions explain
phenotypic characteristics of two antigenic variants, phase II and
91
RSA 514 (crazy), of the Coxiella burnetii Nine Mile strain. Infect
Immun. 70: 6726–6733
Hryniewiecki T., S. Tylewska-Wierzbanowska and I. Rawczyńska-
Englert. 2001. Attempt of estimation of Q fever endocarditis fre-
quency in Poland. Przegl. Lek. 58: 759–761
Ioannou I., D. Chochlakis, N. Kasinis, P. Anayiotos, A. Lyssan-
drou, B. Papadopoulos, Y. Tselentis and A. Psaroulaki. 2009. Car-
riage of Rickettsia spp., Coxiella burnetii and Anaplasma spp. by
endemic and migratory wild birds and their ectoparasites in Cyprus.
Clin. Microbiol. Infect. 15 Suppl 2: 158–160.
Jäger C., S. Lautenschläger, H. Willems and G. Baljer. 2002. Coxi­
ella burnetii plasmid types QpDG and QpH1 are closely related and
likely identical. Vet. Microbiol. 89: 161–166
Jäger C., H. Willems, D. Thiele and G. Baljer. 1998. Molecular
characterization of Coxiella burnetii isolates. Epidemiol. Infect.
120(2): 157–164
Janigan D.T. and T.J. Marrie. 1983. An inflammatory pseudotumor
of the lung in Q fever pneumonia. N. Engl. J. Med. 308: 86–88.
Karakousis P., M. Trucksis and S. Dumler. 2006. Chronic Q fever
in the United States. J. Clin. Microbiol. 44: 2283–2287.
King L.A., L. Goirand, H. Tissot-Dupont, B. Giunta, C. Giraud,
C. Colardelle, V. Duquesne, E. Rousset, M. Aubert, R. Thiéry,
L. Calatayud, G. Daurat, L. Hocqueloux, V. Cicchelero, F. Golliot,
and H. de Valk. 2011. Outbreak of Q fever, Florac, Southern France,
Spring 2007. Vector Borne Zoonotic Dis. 11: 341–347.
Kishimoto R.A., R.W. Stockman and C.L. Redmond. 1979.
Q  fever: diagnosis, therapy, and immunoprophylaxis. Mil. Med.
144: 183–187.
Kofteridis D.P., E.E. Mazokopakis, Y. Tselentis and A. Gikas. 2004.
Neurological complications of acute Q fever infection. Eur. J. Epi­
demiol. 19: 1051–1054.
Kruszewska D., K. Lembowicz and S. Tylewska-Wierzbanowska.
1996. Possible sexual transmission of Q fever among humans. Clin.
Infect. Dis. 22: 1087–1088.
Kruszewska D. and S. Tylewska-Wierzbanowska. 1991. Influence
of Coxiella burnetii infection of male mice on their offspring. Acta
Virol. 35: 79–82.
Kruszewska D. and S. Tylewska-Wierzbanowska. 1997. Isolation
of Coxiella burnetii from bull semen. Res. Vet. Sci. 62: 299–300.
Kruszewska D. and S.K. Tylewska-Wierzbanowska. 1993. Coxi­
ella burnetii penetration into the reproductive system of male
mice, promoting sexual transmission of infection. Infect. Immun.
61: 4188–4195.
La Scola B. and D. Raoult. 2001. Survival of Coxiella burnetii within
free-living amoeba Acanthamoeba castellanii. Clin. Microbiol. Infect.
75–9.
Levy P.Y., P. Carrieri and D. Raoult. 1999 Coxiella burnetii pericar-
ditis: report of 15 cases and review. Clin. Infect. Dis. 29(2): 393–397.
Lührmann A. and C.R. Roy. 2007. Coxiella burnetii inhibits acti-
vation of host cell apoptosis through a mechanism that involves
preventing cytochrome c release from mitochondria. Infect. Immun.
75: 5282–5289.
Lutynski R. 1956. First focus of Q-fever on the territory of Poland.
Przegl. Lek. 12: 187–188.
Lyytikäinen O., T. Ziese, B. Schwartländer, P. Matzdorff,
C. Kuhnhen, C. Jäger and L. Petersen. 1998. An outbreak of sheep-
associated Q fever in a rural community in Germany. Eur J Epide­
miol. 14: 193–199.
Mayer H., J. Radziejewska-Lebrecht and S. Schramek. 1988.
Chemical and immunochemical studies on lipopolysaccharides of
Coxiella burnetii phase I and phase II. Adv. Exp. Med. Biol. 228:
577–591.
Mączka I., T. Chmielewski, E. Walczak, J. Różański, G. Religa, and
S. Tylewska-Wierzbanowska. 2011. Tick-borne infections as a cause
of heart transplantation. Pol. J. Microbiol. 60: 341–343.
92 Chmielewski T. and Tylewska-Wierzbanowska S.
Mallavia L.P. 1991. Genetics of rickettsiae. Eur. J. Epidemiol. 7:
213–221.
Maltezou H.C., J. Constantopoulou, C. Kallergi, V. Vlahou,
D. Georgakopoulos, D.A. Kafetzis and D. Raoult. 2004. Q fever in
children in Greece. Am. J. Trop. Med. Hyg. 70: 540–544.
Marrie T.J., A. MacDonald, H. Durant, L. Yates and L. McCor-
mick. 1988. An outbreak of Q fever probably due to contact with
a parturient cat. Chest. 93: 98–103.
Marrie T.J., W.F. Schlech, J.C. Williams and L. Yates. 1986. Q fever
pneumonia associated with exposure to wild rabbits. Lancet. 1:
427–429.
Marrie T.J., A. Stein, D. Janigan and D. Raoult. 1996. Route of
infection determines the clinical manifestations of acute Q fever.
J. Infect. Dis. 173: 484–487.
Maurin M. and D. Raoult. 1999. Q fever. Clin. Microbiol. Rev. 4:
518–553.
Maurin M. and D. Raoult. Antimicrobial therapy of rickettsial dis-
eases. (eds.) D. Raoult and P. Brouqui. Rickettsiae and Rickettsial
Diseases at the Turn of the Thrid Millenium 1999, p. 330–342.
McCaul T.F., A.J. Dare, J.P. Gannon and A.J. Galbraith. 1994. In
vivo endogenous spore formation by Coxiella burnetii in Q fever
endocarditis. J. Clin. Pathol. 47: 978–981.
McCaul T.F. and J.C. Williams. 1981. Developmental cycle of
Coxiella burnetii: structure and morphogenesis of vegetative and
sporogenic differentiations. J. Bacteriol. 147: 1063–1076.
McQuiston J.H. and J.E. Childs. 2002. Q fever in humans and ani-
mals in the United States. Vector Borne Zoonotic Dis. 2: 179–191
Meiklejohn G., L.G. Reimer, P.S. Graves and C. Helmick. 1981.
Cryptic epidemic of Q fever in a medical school. J. Infect. Dis. 144:
107–113.
Mikolajczyk E., Z. Lewińska, R. Lojewska, W. Rumin and D. Kru­
szewska. 1986. Serologic reactions in humans during the outbreak
of Q fever. Przeg. Epid. 40: 342–348.
Nguyen S.V. and K. Hirai. 1999. Differentiation of Coxiella burnetii
isolates by sequence determination and PCR-restriction fragment
length polymorphism analysis of isocitrate dehydrogenase gene.
FEMS Microbiol. Lett. 180: 249–254
Ong C., O. Ahmad, S. Senanayake, G. Buirski and C. Lueck. 2010.
Optic neuritis associated with Q fever: case report and literature
review. Int. J. Infect. Dis. 145: 269–273.
Ormsbee R.A., M.G. Peacock, R. Gerloff, G. Tallent and D. Wike.
1978. Limits of rickettsial infectivity. Infect. Immun. 19: 239–245.
Ortolá P.R., F.G. Peñalba, C.J. Ruiz and M.A. Angulo. 1992. Coxi­
ella burnetii osteoarthritis. Rev. Clin. Esp. 191: 25–26
Panaiotov S., M. Ciccozzi, N. Brankova, V. Levterova, M. Mitova-
Tiholova, M. Amicosante, G. Rezza and T. Kantardjiev. 2009. An
outbreak of Q fever in Bulgaria. Ann. Ist. Super. Sanita. 45: 83–86.
Porten K., J. Rissland, A. Tigges, S. Broll, W. Hopp, M. Lune­mann,
U. van Treeck, P. Kimmig, S.O. Brockmann, C. Wagner-Wiening,
W. Hellenbrand and U. Buchholz. 2006. A super-spreading ewe
infects hundreds with Q fever at a farmers’ market in Germany.
BMC Infect. Dis. 6: 147.
Raoult D., G. Bollini and H. Gallais. 1989. Osteoarticular infection
due to Coxiella burnetii. J. Infect. Dis. 159: 1159–1160.
Raoult D., F. Fenollar and A. Stein. 2002. Q fever during preg-
nancy: diagnosis, treatment, and follow-up. Arch. Intern. Med. 162:
701–704.
Raoult D., P. Houpikian, H. Tissot Dupont, J.M. Riss, J. Arditi-
Djiane and P. Brouqui. 1999. Treatment of Q fever endocarditis:
comparison of 2 regimens containing doxycycline and ofloxacin or
hydroxychloroquine. Arch. Intern. Med. 159: 167–173
Raoult D. Antibiotic treatment of rickettsiosis, recent advances and
current concepts. In: Kazar J., Raoult D. Rickettsiae and rickettsial
diseases. Bratislava 1991, 652–662.
2
Raoult D. 1993. Treatment of Q fever. Antimicrob. Agents. Che­
mother. 37: 1733–1736.
Rehacek J. and Tarasevich I.V. Q fever. In: Acari-borne rickettsiae
& rickettsioses in Eurasia. Veda Publishing House of the Slovak
Academy of Sciences. Bratislava 1988.
Rowbotham T.J. 1983. Isolation of Legionella pneumophila from
clinical specimens via amoebae, and the interaction of those and
other isolates with amoebae. J. Clin. Pathol. 36: 978–986.
Ruiz-Fons F., O. Rodríguez, A. Torina, V. Naranjo, C. Gortázar,
and J. de la Fuente. 2008. Prevalence of Coxiella burnetti infection
in wild and farmed ungulates. Vet. Microbiol. 126: 282–286.
Salmon M.M., B. Howells, E.J. Glencross, A.D. Evans and
S.R. Palmer. 1982. Q fever in an urban area. Lancet 1: 1002–1004
Schramek S., J. Radziejewska-Lebrecht and H. Mayer. 1985.
3-C-branched aldoses in lipopolysaccharide of phase I Coxiella bur­
netii and their role as immunodominant factors. Eur. J. Biochem.
148(3): 455–461.
Scott G.H. and J.C. Williams. 1990. Susceptibility of Coxiella bur­
netii to chemical disinfectants. Ann. N.Y. Acad. Sci. 590: 291–296.
Segal G., M. Feldman and T. Zusman. 2005. The Icm/Dot type-IV
secretion systems of Legionella pneumophila and Coxiella burnetii.
FEMS Microbiol. Rev. 29: 65–81.
Serbezov V.S., J. Kazár, V. Novkirishki, N. Gatcheva, E. Kovácová
and V. Voynova. 1999. Q fever in Bulgaria and Slovakia. Emerg.
Infect. Dis. 5: 388–394.
Seshadri R., I.T. Paulsen, J.A. Eisen, T.D. Read, K.E. Nelson,
W.C. Nelson, N.L. Ward, H. Tettelin, T.M. Davidsen, M.J. Beanan,
R.T. Deboy, S.C. Daugherty, L.M. Brinkac, R. Madupu,
R.J. Dodson, H.M. Khouri, K.H. Lee, H.A. Carty, D. Scanlan,
R.A. Heinzen, H.A. Thompson, J.E. Samuel, C.M. Fraser and
J.F. Heidelberg. 2003. Complete genome sequence of the Q-fever
pathogen Coxiella burnetii. Proc. Natl. Acad. Sci. USA 100: 5455–5460.
Sessa C., L. Vokrri, P. Porcu, M. Maurin, J.P. Stahl and J.L. Magne.
2005. Abdominal aortic aneurysm and Coxiella burnetii infection:
report of three cases and review of the literature. J. Vasc. Surg. 42:
153–158.
Slabá K., A. Hussein, P. Palkovic, V. Horváth and R. Toman.
2003. Studies on the immunological role of virenose and dihydro-
hydroxystreptose present in the Coxiella burnetii phase I lipopoly-
saccharide. Ann. N.Y. Acad. Sci. 990: 505–509
Speelman P. 2010. The largest Q fever outbreak ever reported. Neth.
J. Med. 68: 380–381.
Spelman DW. 1982. Q fever: a study of 111 consecutive cases. Med.
J. Aust. 1: 547–553.
Spicer A.J., M.G. Peacock and J.C. Williams. 1981. Effectiveness
of several antibiotics in suppressing chick embryo lethality during
experimental infections by Coxiella burnetii, Rickettsia typhi and
R. rickettsii. (In:) W. Burgdorfer, R. l. Anacker Rickettsiae and rick-
ettsial Diseases. Academic Press, New York, 375–383.
Stein A. and D. Raoult. 1999. Pigeon pneumonia in provence:
a bird-borne Q fever outbreak. Clin. Infect. Dis. 29: 617–620.
Stein A. and D. Raoult. 1998. Q fever during pregnancy: a public
health problem in southern France. Clin Infect Dis. 27: 592–596
Stein A., N.A. Saunders, A.G. Taylor and D. Raoult. 1993. Phylo­
genic homogeneity of Coxiella burnetii strains as determinated
by 16S ribosomal RNA sequencing. FEMS Microbiol. Lett. 113:
339–344.
Stempień R., Z. Deroń, T. Górski, M. Libich, A. Vogel and
M. Dadak. 1985. Imported leather raw materials as a cause of Q fever.
Przegl. Epidemiol. 39: 218–223.
Tilburg J.J., J.W. Rossen, E.J. van Hannen, W.J. Melchers,
M.H. Hermans, J. van de Bovenkamp, H.J. Roest, A. de Bruin,
M.H. Nabuurs-Franssen, A.M. Horrevorts and C.H. Klaassen.
2012. Genotypic diversity of Coxiella burnetii in the 2007–2010
2 Q fever at the turn of the century
Q fever outbreak episodes in The Netherlands. J. Clin. Microbiol.
50: 1076–1078.
Tissot Dupont H., D. Raoult, P. Brouqui, F. Janbon, D. Peyramond,
P.J. Weiller, C. Chicheportiche, M. Nezri and R. Poirier. 1992.
Epidemiologic features and clinical presentation of acute Q fever
in hospitalized patients: 323 French cases. Am. J. Med. 93: 427–434.
Tissot-Dupont H., M.A. Amadei, M. Nezri and D. Raoult. 2004.
Wind in November, Q fever in December. Emerg. Infect. Dis. 10:
1264–1269.
Tissot-Dupont H., S. Torres, M. Nezri and D. Raoult. 1999.
Hyperendemic focus of Q fever related to sheep and wind. Am.
J. Epidemiol. 150: 67–74.
Tobin M.J., Cahill N., Gearty G., Mauer B., Blake S., Daly K. and
R. Hone. 1982. Q-fever endocarditis. Am. J. Med. 72: 369–400.
Tylewska-Wierzbanowska S., D. Kruszewska and T. Chmielewski.
1996. Epidemics of Q-fever in Poland in 1992–1994. Ann. Acad.
Med. Bial. 1: 123–128.
Tylewska-Wierzbanowska S., H. Lewkowicz and M. Wesołowska.
1993. Coxiella burnetii infections (Q fever) in animals and humans
in Poznan and Leszno districts detected by serodiagnosis. Przegl.
Epidemiol. 47: 399–404.
Tylewska-Wierzbanowska S., W. Rumin, H. Lewkowicz and
S. Sikorski. 1991. Epidemic of Q-fever in Leszno district in Poland.
Eur. J. Epidemiol. 3: 307–309.
Valková D. and J. Kazár. 1995. A new plasmid (QpDV) common to
Coxiella burnetii isolates associated with acute and chronic Q fever.
FEMS Microbiol. Lett. 125: 275–280.
Varma M.P., A.A. Adgey and J.H. Connoly. 1980. Chronic Q-fever
endocarditis. Br. Heart J. 43, 695–699.
Vogiatzis I., G. Dimoglou and V. Sachpekidis. 2008. Q fever myo-
carditis. Hippokratia12: 46–49
93
Voth D.E. and R.A. Heinzen. 2009. Sustained activation of Akt and
Erk1/2 is required for Coxiella burnetii antiapoptotic activity. Infect.
Immun. 77: 205–213.
Voth D.E., D. Howe and R.A. Heinzen. 2007. Coxiella burnetii
inhibits apoptosis in human THP-1 cells and monkey primary
alveolar macrophages. Infect. Immun. 75: 4263–4271.
Vranakis I., P.J. De Bock, A. Papadioti, Y. Tselentis, K. Gevaert,
G. Tsiotis and A. Psaroulaki. 2011. Identification of potentially
involved proteins in levofloxacin resistance mechanisms in Coxiella
burnetii. J. Proteome Res. 10: 756–762.
Vranakis I., V. Sandalakis, D. Chochlakis, Y. Tselentis and
A. Psarou­laki. 2010. DNA gyrase and topoisomerase IV mutations
in an in vitro fluoroquinolone-resistant Coxiella burnetii strain.
Microb. Drug Resist. 16: 111–117.
Weisburg W.G., M.E. Dobson, J.E. Samuel, G.A. Dasch,
L.P. Mallavia, O. Baca, L. Mandelco, J.E. Sechrest, E. Weiss and
C.R. Woese. 1989. Phylogenetic diversity of the Rickettsiae. J. Bac­
teriol. 171: 4202–4206.
Westlake P., L.M. Price, M. Russell and J.K. Kelly. 1987. The
pathology of Q fever hepatitis. A case diagnosed by liver biopsy.
J. Clin. Gastroenterol. 9: 357–363.
Willems H., D. Thiele and H. Krauss. 1993. Plasmid differentiation
and detection of Coxiella burnetii in clinical samples. Eur. J. Epide­
miol. 9: 411–418.
Yadav M.P. and M.S. Sethi. 1979. Poikilotherms as reservoirs of
Q-fever (Coxiella burnetii) in Uttar Pradesh. J. Wildl. Dis. 15: 15–17.
Yeaman M.R. and O.G. Baca. 1990. Unexpected antibiotic suscep-
tibility of a chronic isolate of Coxiella burnetii. Ann. N. Y. Acad. Sci.
590: 297–305.
Yebra M., M. Marazuela, F. Albarrán and A. Moreno. 1988.
Chronic Q fever hepatitis. Rev. Infect. Dis. 10: 1229–1230.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 95–104

MINIREVIEW

Synergy Between Novel Antimicrobials

and Conventional Antibiotics or Bacteriocins

Krystyna I. Wolska*, Katarzyna Grześ and Anna Kurek

Department of Bacterial Genetics, Institute of Microbiology, Faculty of Biology,

University of Warsaw, Warsaw, Poland

Received 9 November 2011, revised 7 April 2012, accepted 7 May 2012

Abstract

Due to the alarming spread of resistance to classic antimicrobial agents, innovative therapeutic methods to combat antibiotic-resistant
bacterial pathogens are urgently required. This minireview examines the enhancement of antibiotic efficacy by their combination with
new antimicrobials, such as plant-derived compounds, metal ions and nanoparticles and bacteriophage lytic enzymes. The mechanisms of
the observed synergy are also described. The promising results of basic research indicate that in future, combined therapy may be applied
in human and veterinary medicine, agriculture and the food industry to combat bacterial pathogens.

K e y w o r d s:  antibiotics, bacteriophages, nanoparticles, plant compounds, synergy

Introduction larly Staphylococcus aureus (Parson and Rock, 2011).

The extensive use of antibiotics has led to growing
resistance and the spread of many bacterial pathogens,
which now constitutes a serious medical problem.
For this reason, the number of studies aimed at devel-
oping new analogs of known antibiotics, e.g. oxazoli­
dinones, glycopeptides, quinolones, aminoglycosides,
tetracyclines and ketolides (Theuretzbacher, 2011),
and at identifying novel antibacterial therapeutics and
strategies, is growing exponentially. Positive valida-
tion of new antimicrobial agents is often connected
with the discovery of novel targets. To illustrate this
point, the so-called switch region of bacterial RNA
polymerase, that does not overlap the rifamycin bind-
ing site, has been confirmed as the target of mycopyro-
nin, corallopyronin, ripostatin and lipiarmycin – anti-
biotics which are not cross-resistant with rifamycins
(Srivastava et al., 2011). It was also recently postu-
lated that NF-κB (nuclear transcription factor-κB),
which is crucial for the cellular response to stress
and inflammation caused by e.g. microbial infection,
could represent a target for antimicrobial and antiviral
therapies (Vitiello et al., 2012). In addition, there is cur-
rent controversy over whether fatty acid biosynthesis
pathways may constitute a novel promising target for
antibiotics to control bacterial pathogens, particu-
Potential antibacterial treatments include the use of
anti­microbial peptides, antivirulence strategies and
therapeutic antibodies (Fernebro, 2011), as well as plant-
derived compounds, metal nanoparticles and bacterio-
phage lytic enzymes.
Plant-derived compounds, metal nanoparticles and
bacteriophage lysins, which are the subject of this
review, may be considered new antimicrobials due to
their proven and substantial antibacterial effect, which
is, however, weaker than that of common antibiotics
produced by bacteria and fungi (Hemaiswarya et al.,
2008). In the last decade, the first steps in elucidating
the mechanisms of antibacterial activity and the cel-
lular targets of plant-derived compounds have been
made, with phenolics, and especially flavones, being
the subject of the majority of studies. Flavones cause
disruption of the bacterial cytoplasmic membrane and
inhibit energy metabolism (Tsuchiya and Iinuma, 2000;
Plaper et al., 2003). These compounds can also attenu-
ate the pathogenicity of various bacteria by their ability
to inhibit quorum-sensing signal receptors, sortase and
urease activity, listeriolysin O, coagulase and α-toxin
secretion, and by neutralizing bacterial toxins (for
review see Cushnie and Lamb, 2011). There have also
been a considerable number of reports describing the
antibacterial effect of another group of plant-derived

*  Corresponding author: K.I. Wolska, Department of Bacterial Genetics, Institute of Microbiology, University of Warsaw, Mieczni­
kowa 1, 02-096 Warsaw, Poland; phone: (+48) 22 55 41 402; fax: (+48) 22 55 41 402; e-mail: izabelaw@biol.uw.edu.pl
96 K.I. Wolska et al.
compounds, the terpenes, but only a few discuss the
molecular basis of their antibacterial activity (for review
see Kurek et al., 2011; Wolska et al., 2010). For example,
pentacyclic triterpenoids can inhibit insoluble glycan
synthesis by Streptococcus mutans (Kozai et al., 1999)
and peptidoglycan metabolism in Listeria monocyto­
genes (Kurek et al., 2010), and also influence Escherichia
coli gene expression and biofilm formation (Ren et al.,
2005; Grudniak et al., 2011). It was also shown that
diterpenoids have potent anti-biofilm activity against
staphylococci (Walencka et al., 2007). In addition, the
sesquiterpene farnesol was found to inhibit S. aureus
growth by affecting the mevalonate pathway of isopren-
oid synthesis (Kaneko et al., 2011).
Metal ions and nanoparticles, especially silver com-
pounds, constitute another group of potent antimicro-
bials that have already been applied in medicine and
pharmacology (Chopra, 2007; Li et al., 2006; Monteiro
et al., 2009). They are used as antibacterial surface coat-
ings on medical devices, such as venous and urinary
catheters, implants and megaprostheses (Hamill et al.,
2007; Hardes et al., 2010). Silver nanoparticles (AgNPs)
display remarkable antimicrobial activity against Pseu­
domonas aeruginosa, E. coli and Enterobacter cloacae,
being more active against Gram-negative than against
Gram-positive bacteria (Im et al., 2011). Metal ions
and nanoparticles are safer in vitro and have a greater
antibacterial effect when stabilized by various polymer
surfactants (Lin et al., 2012). Silver nanoparticles can
disrupt bacterial membranes (Singh et al., 2008), cause
membrane lipid peroxidation (Neal, 2008), alter gene
expression (Lok et al., 2006), and when inside the cell,
they may also damage DNA and impair the respiratory
chain and cell division (Rai et al., 2009).
The lytic enzymes of bacteriophages may also be
considered as novel antimicrobials. Bacteriophage the­
rapy to treat bacterial infections has been well studied,
but the extensive literature on this subject will not be
considered here (for review see Chibani-Chennoufi
et al., 2004; Górski et al., 2009). An alternative to whole
phage particles is the application of phage lysins:
enzymes that are active against Gram-positive bacte-
ria. It was shown that the lytic enzyme PhyPH is active
against Bacillus anthracis strains (Yoong et al., 2006),
and the S. aureus bacteriophage ϕMR11 lysin, desig-
nated MV-L, can inhibit a number of S. aureus strains,
including those that are methicillin-resistant (MRSA)
or vancomycin-intermediate (VISA) (Rashel et al.,
2007). Using a mouse model, Grandgigard and cowork-
ers (2008) demonstrated that the recombinant phage
lysine Clp-1 may be useful in therapy for pneumococcal
meningitis, and Nelson et al. (2001) found that the lysin
isolated from a virulent C1 phage, specific for group C
streptococci, can prevent and eliminate upper respira-
tory tract colonization by group A streptococci.
2
The compounds listed above display antibacterial
activity when used alone, but there is also the possi-
bility of using them in combination with conventional
antibiotics in order to improve their efficacy. Com-
bination therapy, i.e. the simultaneous treatment of
infections with more than one drug, may constitute
an efficient strategy to combat antibacterial resistance.
This minireview summarizes current data on the syner-
gistic activity of antibiotics in combination with plant-
derived compounds, metal ions and nanoparticles, and
bacteriophage lytic enzymes. The examples of synergy
between novel antimicrobials and antibiotics / bacterio-
cins are also listed in Table I. The determination of syn-
ergy between two compounds is based on calculation
of the FICI (fractional inhibitory concentration index),
where a value of ≤ 0.5 indicates a synergistic interaction
(EUCAST, 2000). The possible mechanisms underlying
these interactions are described in a separate chapter.
Synergy between plant-derived compounds
and antibiotics or bacteriocins
There have been a substantial number of reports
on synergistic antibacterial activity between various
purified plant-derived compounds and plant oils, and
antibiotics (mainly β-lactams) against Staphylococcus
aureus including (MRSA). The most relevant findings
from these studies will be presented in chronological
order. Brehm-Stecher and Johnson (2003) observed
that treatment with low concentrations of the sesqui-
terpenoids nerolidol, bisabolol and apritone enhanced
bacterial susceptibility to ciprofloxacin, clindamycin,
erythromycin, gentamicin, tetracycline and vancomy-
cin. Synergism was demonstrated between ampicillin
and ethanolic extracts from 10 Indian medicinal plants,
including Camelia sinensis (Chinese tea), that are rich
in alkaloids, glycosides, flavanoids, phenols and sapo-
nins (Aqil et al., 2005), and quinic acid gallates from
Caesalpina spinosa could intensify the susceptibility of
MRSA to oxacillin (Kondo et al., 2006). Grande et al.
(2007) found that the antimicrobial activity of bac-
teriocin produced by Enterococcus faecalis, enterocin
AS-48, against S. aureus was potentiated when applied
in combination with phenolic compounds such as car-
vacrol. Synergy was demonstrated between the diter-
penoids salvipisone and aethiopinone, and antibiotics
from the β-lactam, glycopeptide and oxazolidinone
groups (Walencka et al., 2007). Nascimento et al. (2007)
observed synergistic activity between ampicillin and
the Brazilian plant Eremanthus erythropappus oil and
β-bisakolene. The hop (Humulus lupulus)-derived com-
pounds, lupulone and xanthohumol, showed synergy
with tobramycin and ciprofloxacin (Natarajan et al.,
2008). A synergistic effect of kaempferol glycosides
2 Antibiotics and novel antimicrobials 97

Table I
Examples of synergy between novel antimicrobials and antibiotics/bacteriocins

Novel antimicrobial Antibiotic/bacteriocin Bacterial species Reference

Plant compound
Thymol Nisin L. monocytogenes Ettayebi et al., 2000
EGCg Ampicillin + sulbactam MRSA Hu et al., 2001
EGCg Penicillin S. aureus Zhao et al., 2002
Baicalein β-lactams, tetracycline MRSA Fujita et al., 2005
7-methyljuglone Isoniazid M. tuberculosis Bapela et al., 2006
Carnosol Aminoglycosides VRE Horiuchi et al., 2007
Asiatic acid, corosolic acid Tobramycin P. aeruginosa Garo et al., 2007
Ellagic acid, tannic acid Novobiocin A. baumanii Chusri et al., 2009
Kaempferol glycosides Fluorochinolones MRSA Liu et al., 2009
Galangin Cefazidime PRSA Eumkeb et al., 2010
Oleanolic acid Rifampicin M. tuberculosis Ge et al., 2010
Betulic acid Methicillin, vancomycin S. aureus Chung et al., 2011
Oleanolic acid, ursolic acid Ampicillin, oxacillin S. aureus, S. epidermidis Kurek et al., 2012
Ag+ and AgNPs
Ag+ Vancomycin, amoxicillin, penicillin G S. aureus Shahverdi et al., 2007
AgNPs Polymyxin B Gram– bacteria Ruden et al., 2009
AgNPs Ampicillin Gram+ bacteria Fayaz et al., 2010
Bacteriophages lytic enzymes
Cpl -1 Cefotaxime, moxifloxacin S. pneumoniae Rogríguez-Cerrato et al., 2007
LysK Lysostaphin MRSA Becker et al., 2008
ClyS Oxacillin, vancomycin MRSA Daniel et al., 2010
LysH5 Nizin S. aureus Garcia et al., 2010

purified from Laurus nobilis and fluorochinolones on
MRSA was shown by Liu et al. (2009), while the efficacy
of galangin, a flavanol isolated from Alpinia officina­
rum, administered with ceftazidime, against penicillin-
resistant S. aureus (PRSA) was demonstrated by Eum-
keb and coworkers (2010). In a study of the synergistic
antimicrobial activity of pentacyclic triterpenoids (e.g.
betulinic acid) combined with methicillin or vancomy-
cin, it was found that various combinations of these
compounds could reduce their minimal inhibitory con-
centrations (MICs) by 0.05–50% (Chung et al., 2011).
Two other pentacyclic triterpenoids, oleanolic acid and
ursolic acid, have recently been shown to act synergis-
tically with ampicillin and oxacillin against S. aureus
and Staphylococcus epidermidis grown in solution or as
biofilms (Kurek et al., 2012).
In the last decade, there have been an appreciable
number of reports describing synergy between plant
compounds and antibiotics against bacteria outside
the genus Staphylococcus. The antibacterial effect of
nisin Z against Listeria monocytogenes ATCC 7644
and Bacillus subtilis ATCC 33712 was found to be
greatly enhanced by a subinhibitory concentration
of thymol (Ettayebi et al., 2000), and the diterpenoid
carnosol reduced the MICs of various aminoglyco-
sides against vancomycin-resistant enterococci – VRE
(Horiuchi et al., 2007). Garo et al. (2007) showed that
treatment with asiatic acid and corosolic acid enhanced
the susceptibility of Pseudomonas aeruginosa bioilms
to tobramycin. Alcoholic extracts from 15 traditio­
nal Indian medicinal plants exhibited synergy with
tetracycline and ciprofloxacin to inhibit the growth
of ESbetaL (extended spectrum beta-lactamase)-pro-
ducing E. coli and Shigella (Ahmad and Aqil, 2007).
The combination of kaempferol with clindamycin or
quercetin produced a  large synergistic effect against
antibiotic-resistant Propionibacterium acnes (Lim et al.,
2007). Studies by a Chinese group have confirmed the
synergistic activity between a herbal medicine iso-
lated from Ramulus cinnamoni and tetracycline, gen-
tamicin and streptomycin against nosocomical anti­-
biotic-resistant strains of P. aeruginosa (Liu et al., 2007).
Using transmission electron microscopy, Sivarooban
et al. (2008) observed cell damage in L. monocytogenes
caused by a combination of nisin with either a grape
seed or a  green tea extract rich in phenolic consti­
tuents. Combination with gerianol isolated from Heli­
chrysum italicum, a member of the sunflower family,
significantly increased the efficacy of β-lactams, quino-
lones and chloramphenicol towards multidrug resistant
98 K.I. Wolska et al.
Enterobacter aerogenes, E. coli, P. aeruginosa and Aci­
netobacter baumanii (Lorenzi et al., 2009). The antibac-
terial activity of novobiocin was shown to be enhanced
by the plant phenolics ellagic and tannic acids, which
increased its effectiveness against multi-drug resistant
A. baumanii (Chusri et al., 2009). A crude leaf extract
of Helichrysum pedunculatum enhanced the activity of
eight antibiotics from various groups against bacteria
implicated in wound infections (Aiyegoro et al., 2010).
Mulyaningsih et al. (2010) elucidated the synergistic
properties of two terpenoids from the essential oil
of Eucalyptus globulus, aromadendrene and 1,8-cin-
eole, against VRE. A notable study by Ge et al. (2010)
described synergistic in vitro interactions between olea-
nolic acid and isoniazid, rifampicin or ethambutanol
against Mycobacterium tuberculosis. The potent syner-
gism of ciprofloxacin with extracts of medicinal plants,
e.g. Angelica sinensis and Melissa officinalis, against
Enterobacteriaceae and P. aeruginosa has also recently
been reported (Garvey et al., 2011).
Synergistic activity between metal ions
or nanoparticles and antibiotics or bacteriocins
The majority of reports on the interaction between
antibiotics and various forms of metals describe the
effects of silver ions and silver nanoparticles (AgNPs).
In an early study, Modak and Fox (1985) identified syn-
ergism between silver sulfadazine and piperacillin (an
extended-spectrum penicillin antibiotic), both in vitro
and in vivo. The antimicrobial activities of various anti-
biotics in the presence of Ag+ ions have since been stud-
ied more systematically and the greatest enhancing effect
was observed for vancomycin, amoxicillin and penicillin
G against S. aureus rather than E. coli (Shahverdi et al.,
2007). In contrast, the synergistic activity between sil-
ver nanoparticles (AgNPs) and ampicillin, gentamicin,
kanamycin, streptomycin and vancomycin was subse-
quently shown to be greater against E. coli and P. aeru­
ginosa than against S. aureus (Birla et al., 2009). It was
also confirmed that silver nanoparticles can enhance
the antibacterial activity of chloramphenicol, being an
active carrier of this antibiotic (Patil et al., 2009). It has
yet to be determined whether nanoparticles pre-bound
to an antibiotic produce a greater antimicrobial effect
than simultaneous addition of silver and the antibiotic
(Durán et al., 2010). A number of studies have shown
that silver can act synergistically with compounds
other than antibiotics. The activity of AgNPs against an
E. coli biofilm was increased by the lipopeptide biosur-
factant V9T14 (Rivardo et al., 2010), and synergy with
chitosan against S. aureus has also been reported (Potara
et al., 2011). Ammons et al. (2011) recently showed that
a  silver wound dressing combined with the immune
2
molecule lactoferrin and the rare sugar-alcohol xylitol,
reduced biofilm viability more effectively than standard
silver hydrogel.
So far there have been no reports of the direct syn-
ergistic activity of gold nanoparticles (AuNPs) and
antibiotics. Gu et al. (2003) found that AuNP-vanco-
mycin conjugates can act as a potent inhibitor of VRE
and E. coli. It has also been demonstrated that AuNPs
function as useful carriers for ciprofloxacin and other
fluoroquinolones (Tom et al., 2004). In the case of
E. coli, the AuNP conjugate showed greater antibacte-
rial activity than free ciprofloxacin (Rosemary et al.,
2006). However, Burygin et al. (2009) found no differ-
ence between the antibacterial activity of a gentamicin
conjugate with AuNPs and the free antibiotic. A single
report has described the synergistic interaction between
copper and an antibiotic – erythromycin (Sultana et al.,
2005). Synergism was observed between this antibiotic
and several other trace elements besides copper (e.g.
cobalt, nickel, chromium), against both Gram-negative
and Gram-positive bacteria. Synergistic antimicrobial
effects between metal ions and compounds other than
antibiotics have also been reported, the most well docu-
mented of which is enhancement of the antimicrobial
activity of pomegranate extracts against clinical isolates
of S. aureus and P. aeruginosa by combination with
cupric sulfate (Gould et al., 2009 a, b).
Antibiotics or bacteriocins
and bacteriophage lytic enzymes
There have been several recent reports describ-
ing interactions between bacteriophage-encoded lytic
enzymes and classic antibiotics or bacteriocins. A syn-
ergistic effect with penicillin and gentamicin was
observed for lytic enzyme Cpl-1 encoded by Streptococ­
cus pneumoniae lytic phage Cp-1 and also for another
endolysin, Pal, encoded by S. pneumoniae lytic phage
Dp-1 (López and García, 2004), against several pen-
icillin-resistant and -sensitive S. pneumoniae strains
(Loeffler and Fischetti, 2003; Djurkovic et al., 2005).
In vitro interactions between Cpl-1 and Pal with cefo-
taxime and moxifloxacin against antibiotic-susceptible
and antibiotic-resistant S. pneumoniae have also been
studied. Synergistic activity was confirmed for the
combination of Cpl-1 and cefotaxime or moxifloxacin
and the effect was strain-dependent. It is noteworthy
that greater synergy was observed for the combina-
tion of these antibiotics with LytA, which is the major
pneumococcal autolysin (Rodríguez-Cerrato et al.,
2007). The combined effect of nisin and two S. aureus
lytic phages, φ35 and φ88, was assessed, and a syner-
gistic effect was observed in short-term experiments.
However nisin adaptation and reciprocal resistance to
2 Antibiotics and novel antimicrobials
both phages have prevented the practical application of
this combined therapy (Martínez et al., 2008). Another
two endolysins, LysK, produced by staphylococcal
bacteriophage K (O’Flaherty et al., 2005) and the anti-
staphylococcal bacteriocin, lysostaphin, synthesized by
Staphylococcus simulans (Dajcs et al., 2000), exhibited
synergy in killing MRSA (Becker et al., 2008). Recently,
a  novel chimeric lysin, ClyS, was engineered by fus-
ing the N-terminal catalytic domain of S. aureus Twort
phage lysin with the C-terminal cell-wall targeting
domain of the phage φNM3 lysin. The chimeric pro-
tein displayed synergistic interactions with both van-
comycin and oxacillin in vitro and its combination with
oxacillin could prevent septic death in MRSA-infected
mice (Daniel et al., 2010).
Molecular basis of synergistic activities
Three categories of combination therapy can be
distinguished (Fischbach, 2011). The most common
strategy utilizes the combination of drugs which inhibit
different pathways within bacterial cells. An example of
such a strategy is treatment of Mycobacterium tubercu­
losis infections with four drugs: 1) isoniazid, an inhibi-
tor of fatty acid synthesis, 2) rifampicin, an inhibitor
of RNA polymerase, 3) ethambutanol, an inhibitor of
arabinose transferases involved in cell wall biosynthesis,
and 4) pyrozinamide, with an as yet unknown mecha-
nism of action (Ginsberg and Spigelman, 2007). The
second strategy is based on the inhibition of different
targets in the same pathway. The inhibition of folic
acid synthesis by a combination of sulfamethoxazole,
an inhibitor of dihydropteroate synthetase, and trime-
thoprim, inhibiting dihydrofolate reductase, is based on
this strategy (Wormster et al., 1982). The third strategy
requires inhibition of the same target in different ways,
e.g. the application of streptogramin and virginamycin,
which both inhibit the peptidyl transferase center on
the 50S ribosomal subunit (Tu et al., 2005). It should be
noted that such a combined antimicrobial effect is uti-
lized in nature by antibiotic producers to compete effec-
tively with other species (Ohnishi et al., 2008). Instead
of two antibiotics, combination therapy can utilize
antibiotics with their “sensitizers”: molecules that make
the co-applied antibiotic more effective by inhibiting
enzymes responsible for antibiotic resistance or those
that metabolize the drug. For example, diazabicyclooc-
tanes (DBOs) are novel class A and class C β-lactamase
inhibitors that are more potent than current commer-
cially available inhibitors (Coleman, 2011). Similarly,
the synergistic antibacterial activity between various
plant-derived compounds increases the effectiveness of
herbal extracts in comparison with the isolated single
constituents. In phytotherapy, this synergy is more dif-
99
ficult to dissect because plant extracts contain many
minor agents that may influence the combined effect. In
spite of this, many synergistic activities between phyto-
pharmaceuticals have been demonstrated, and in some
cases the mechanism of this effect has been elucidated
(Wagner and Ulrich-Merzenich, 2009).
The synergistic antimicrobial effect of an antibiotic
combined with another agent requires interaction of the
latter compound with the bacterial resistance mecha-
nism. The first details of the molecular basis of synergis-
tic interaction between some plant-derived compounds
and various classes of antibiotics have recently been
revealed. The ability of novel therapeutics to inhibit
lactam- or ester-cleaving enzymes can result in synergy
with β-lactams. EGCg (epigallocatechin gallate) inhib-
its penicillinase activity, thus restoring the effectiveness
of penicillin against S. aureus (Zhao et al., 2002) and
potentiating the effect of ampicillin and sulbactam
against MRSA (Hu et al., 2001). The synergy between
galangin and methicillin, ampicillin, amoxicillin, cloxa-
cillin, penicillin G and cefazidime against S. aureus was
found to be based on the marked inhibitory activity of
galangin against penicillinase and β-lactamase (Eumkeb
et al., 2010). The two antimicrobials in a combination
may affect the same cellular target. For example, EGCg
administered with a β-lactam antibiotic could inhibit
peptidoglycan synthesis (Yam et al., 1998; Zhao et al.,
2001). Subsequently, Fujita et al. (2005) demonstrated
that the flavone baicalein exhibits remarkable synergy
with β-lactam antibiotics against MRSA, possibly by
inhibiting the activity of PBP 2a or by affecting pepti-
doglycan structure, and Kuroda et al. (2007) demon-
strated that the sesquiterpene farnesol inhibits recycling
of the C55 carrier of the murein monomer precursor,
thus contributing to increased bacterial susceptibility to
β-lactams. Several plant compounds appear to inhibit
defined targets in the bacterial cell. The flavanol myric-
etin was found to suppress DnaB helicase activity and
glycosylated flavones could inhibit topoisomerase IV,
so these compounds have the potential to act synergis-
tically with particular antibiotics (Hemaiswarya et al.,
2008). Another mechanism of synergy is by increasing
the intracellular antibiotic concentration, which may be
achieved by overcoming cellular barriers that prevent
antibiotics from penetrating the cell or by blocking bac-
terial efflux pumps that extrude such agents from the
cell. The majority of reports have described the effect of
plant compounds on bacterial efflux pumps. The indole
alkaloid reserpine, a modulator of multidrug pumps
enhanced tetracycline activity against MRSA contain-
ing the tetK determinant (Gibbons and Udo, 2000), and
baicalein inhibited TetK-dependent efflux of tetracy-
cline (Fujita et al., 2005). Certain plant-derived com-
pounds, e.g. EGCg, have been shown to act as bacterial
efflux pump inhibitors (EPIs) and are able to restore
100 K.I. Wolska et al.
the antibacterial effect of ineffective antibiotics such as
ciprofloxacin, preferentially against Gram-positive, but
also against Gram-negative species (Stavri et al., 2007).
N-caffeoylphenalkylamide derivatives were found to act
as EPIs in S. aureus, especially in strains overexpressing
the multidrug efflux transporter NorA (Michalet et al.,
2007). Chusri et al. (2009) suggested that ellagic and
tannic acids act as efflux pump inhibitors in A. bauma­
nii. It was recently demonstrated that the aforemen-
tioned synergism between medicinal plant extracts
and ciprofloxacin is the result of inhibition of the efflux
pump in Gram-negative bacteria (Garvey et al., 2011).
Another recent study showed that caffeoylquinic acids
from Artemisia absinthium preferentially bind to Major
Facilitator Super Family efflux systems, which are key
multidrug resistance determinants in Gram-positive
bacteria (Fiamegos et al., 2011). Plant-derived com-
pounds may also be involved in the transformation
of a non-active antimicrobial into its active form. The
naphthoquinone 7-methyljuglone was able to potenti-
ate the effect of antituberculous drugs against extra-
cellular and intracellular Mycobacterium tuberculosis,
possibly due to the elevated synthesis of superoxide,
which catalyzes the transformation of isoniazid into its
active form (Bapela et al., 2006). A recent attempt to
elucidate the mechanism of synergy between oleanolic
and ursolic acids and ampicillin failed to produce an
unequivocal answer. However, the inactivation of ampi-
cillin target, the PBPs (penicillin binding proteins), the
inhibition of β-lactamase translocation and increased
β-lactam transport mediated by these compounds, were
all excluded (Kurek et al., 2012).
There have been few studies on the molecular basis
of synergy between antibiotics and metal nanoparticles
or bacteriophage lytic enzymes. It has been claimed that
the synergism between nanoparticles and antibiotics or
bacteriocins is based on the ability of the latter to help
nanoparticles reach their cellular targets. Synergistic
activity between silver nanoparticles and membrane-
permeabilizing antimicrobial peptides, such as the lipo-
peptide polymyxin B has been reported (Ruden et al.,
2009). Polymyxin B is a cyclic polycationic lipopeptide
that disrupts the outer membranes of Gram-negative
bacteria by interacting with lipid  A (Schindler and
Osborn, 1979), and it was postulated that such anti-
microbial peptides allow nanoparticles to gain access
to their internal target site. Fayaz et al. (2010) showed
that AgNPs can act synergistically with several antibiot-
ics, preferentially against Gram-negative bacteria, and
the greatest effect was observed with ampicillin. These
authors proposed a model in which AgNPs associate
with ampicillin, these complexes interact with the bac-
terial cell wall and subsequently inhibit the formation
of peptidoglycan cross-links, leading to cell wall lysis.
In addition, the AgNPs may prevent DNA unwinding
2
when inside the cell. It has also been established that
AuNPs are a very useful tool for drug delivery and serve
as a stable and non-toxic platform for pharmaceuti-
cals, enhancing their stability and improving targeting
(Pissuwan et al., 2010).
The aforementioned synergy between two peptido-
glycan hydrolases, endolysin LysK and lysostaphin, may
be due to the fact that LysK has two lytic domain (endo-
peptidase and amidase) and thus is able to enhance
the lytic potential of lysostaphin, which has single
lytic domain (Becker et al., 2008). García et al. (2010)
reported synergy between phage endolysin LysH5,
which is active against a wide range of staphylococci
(Obeso et al. 2008), and nisin in killing S. aureus in
pasteurized milk. The MICs of nisin and LysH5 were
diminished by 64- and 16-fold, respectively. It was
postulated that LysH5 activity might be increased by
the permeabilization of the cytoplasmic membrane by
nisin, as was previously documented for the endolysin
Lys44 (Nascimento et al., 2008).
Conclusion
The number and variety of novel antimicrobials
which show synergy with classic antibiotics and bac-
terio­cins is substantial. Many of these compounds
have already been used as an alternative to conven-
tional treatments in medicine and agriculture. How-
ever, their widespread application is restricted, mainly
because their mechanisms of action have not been fully
characterized and their effect on eukaryotes has yet
to be established. The problem of antibiotic resistance
among bacteria has received much coverage in the
literature (Fernebro, 2011; Defoirdt et al., 2011). The
proven synergistic activities of novel antimicrobials
with well known antibiotics provides some hope that
the latter may still be of use to treat diseases caused by
antibiotic-resistant bacteria. Due to their narrow action
spectrum and toxicity, bacteriocins were replaced by
antibiotics in clinical use and are now extensively used
in food preservation (Riley and Wertz, 2002; Falagas
and Kasiakou, 2005). Bacteriocin-resistance may be
countered by the use of these compounds in combina-
tion with novel antimicrobials. Such a strategy might
restore the potential of bacteriocin (e.g. nisin) to elim-
inate pathogenic bacteria, like S. aureus, from food.
Currently, novel antimicrobials cannot replace antibiot-
ics, but they may become valuable antibiotic comple-
ments. In order to exploit these new antimicrobials
effectively in synergistic combination therapy, it will
be necessary to determine the optimal ratio and dosing
regimen, and to fully characterize the mechanisms of
their activities by employing genomic, proteomic and
metabolomic technologies.
2 Antibiotics and novel antimicrobials
Acknowledgment
This work was supported by Polish Ministry of Science and
Higher Education grant NN 302 027937.
Literature
Ahmad I. and F. Aqil. 2007. In vitro efficacy of bioactive extracts of
15 medicinal plants against ES beta L-producing multidrug resistant
enteric bacteria. Microbiol. Res. 162: 264–275.
Aiyegoro O.A., A.J. Afolayan and A.I. Okoh. 2010. Interactions of
antibiotics and extracts of Helichrysum pedunculatum against bac-
teria implicated in wound infections. Folia Microbiol. 55: 176–180.
Aqil F., M.S. Khan, M. Owais and I. Ahmad. 2005. Effect of certain
bioactive plant extracts on clinical isolates of beta-lactamase produc-
ing methicillin resistant Staphylococcus aureus. J. Basic Microbiol.
45: 106–114.
Ammons M.C., L.S. Ward and G.A. James. 2011. Anti-biofilm effi-
cacy of a lactoferrin/xylitol wound hydrogel used in combination
with silver wound dressings. Int. Wound J. 8: 268–273.
Bapela N.B., N. Lall, P.B. Fourie, S.G. Franzblau and C.E.J. van
Rensburg. 2006. Activity of 7-methyljuglone in combination with
antituberculous drugs against Mycobacterium tuberculosis. Phyto­
medicine 13: 630–635.
Becker S.C., J. Foster-Frey and D.M. Donovan. 2008. The phage K
lytic enzyme LysK and lysostaphin act synergistically to kill MRSA.
FEMS Microbiol. Lett. 287: 185–191.
Birla S.S., V.V. Tiwari, A.K. Gade, A.P. Ingle, A.P. Yadav and
M.K. Rai. 2009. Fabrication of silver nanoparticles by Phoma glom­
erata and its combined effect agaist Escherichia coli, Pseudomonas
aeruginosa and Staphylococcus aureus. Lett. Appl. Microbiol. 48:
173–179.
Brehm-Stecher B.F. and E.A. Johnson. 2003. Sensitization of Sta­
phy­lococcus aureus and Escherichia coli to antibiotics by the sesqui-
terpenoids nerolidol, farnesol, bisabolol and apritone. Antimicrob.
Agents Chemother. 47: 3357–3360.
Burygin G.L., B.N. Khlebtsov, A.N. Shantrokha, L.A. Dykman,
V.A. Bogatyrev and N.G. Khlebtsov. 2009. On the enhanced
antibacterial activity of antibiotics mixed with gold nanoparticles.
Nanoscale Res. Lett. 4: 794–801.
Chibani-Chennoufi S., J. Sidoti, A. Bruttin, E. Kutter, S. Sarker
and H. Brusow. 2004. In vitro and in vivo bacteriolytic activities of
Escherichia coli phages: implications for phage therapy. Antimicrob.
Agents Chemother. 48: 2558–2569.
Chopra I. 2007. The increasing use of silver-based products as
antimicrobial agents: a useful development or a case for concern?
J. Antimicrobial. Chem. 59: 587–590.
Chung P.Y., P. Navaratnam and L.Y. Chung. 2011. Synergistic
antimicrobial activity between pentacyclic triterpenoids and anti-
biotics against Staphylococcus aureus strains. Ann. Clin. Microbiol.
Animicrob. 10: 25–30.
Chusri S., I. Villanueva, S.P. Voravuthikunchai and J. Davies.
2009. Enhancing antibiotic activity: a strategy to control Acineto­
bacter infections. J. Antimicrob. Chemother. 64: 1203–1211.
Coleman K. 2011. Diazabicyclooctanes (DBOs): a potent new class
of a non-β-lactam -lactamase inhibitors. Curr. Opin. Microbiol. 14:
550–555.
Cushnie T.P. and A.J. Lamb. 2011. Recent advances in understand-
ing the antibacterial properties of flavonoids. Int. J. Antimicrob.
Agents 38: 99–107.
Dajcs J.J., E.B. Hume, J.M. Moreau, A.R. Caballero, B.M. Cannon
and R.J. O’Callaghan. 2000. Lysostaphin treatment of methi-
cillin-resistant Staphylococcus aureus keratitis in the rabbit (1). Am.
J. Ophtalmol. 130: 544.
101
Daniel A., C. Euler, M. Collin, P. Chahales, K.J. Gorelick and
V.A. Fischetti. 2010. Synergism between a novel chimeric lysin and
oxacillin protects against infection by methicillin-resistant Staphylo­
coccus aureus. Antimicrob. Agents Chemother. 54: 1603–1612.
Defoirdt T., P. Sorgeloos and P. Bossier. 2011. Alternatives to anti-
biotics for the control of bacterial disease in aquaculture. Curr. Opin.
Microbiol. 14: 251–258.
Djurkovic S., J.M. Loeffler and V.A. Fischetti. 2005. Synergistic
killing of Streptococcus pneumoniae with the bacteriophage lytic
enzyme Cpl-1 and penicillin or gentamicin depends on the level of
penicillin resistance. Antimicrob Agents Chemother. 49: 1225–1228.
Durán N., P.D. Marcato, R. De Conti, O.L. Alves, F.T.M. Costa
and M. Brocchi. 2010. Potential use of silver nanoparticles on
pathogenic bacteria, their toxicity and possible mechanisms of
action. J. Braz. Chem. Soc. 21: 949–959.
EUCAST, 2000. Terminology relating to methods for the determina-
tion of susceptibility of bacteria to antimicrobial agents. http://www.
escmid.org/Files/E_def_1_2_03_2000.pdf
Ettayebi K., J. El Yamani and B. Rossi-Hassani. 2000. Synergis-
tic effect of nisin and thymol on antimicrobial activities in Liste­
ria monocytogenes and Bacillus subtilis. FEMS Microbiol. Lett. 183:
191–195.
Eumkeb G., S. Sakdarat and S. Siriwong. 2010. Reversing β-lactam
antibiotic resistance against Staphylococcus aureus with galangin
from Alpinia officinarum Hance and synergism with ceftazidime.
Phytomedicine 18: 40–45.
Falagas M.E. and S.K. Kasiakou. 2005. Colistin: the revival of poly-
myxins for the management of multidrug-resistant gram-negative
bacterial infections. Clin. Infect. Dis. 40: 1333–1341.
Fayaz A.M., K. Balaji, M. Girilal, R. Yadav, P.T. Kalaichelvan and
R. Venketesan. 2010. Biogenic synthesis of silver nanoparticles and
their synergistic effect with antibiotics: a study against gram-positive
and gram-negative bacteria. Nanomedicine 6: 103–109.
Fernebro J. 2011. Fighting bacterial infections – Future treatment
options. Drug Resist. Updat. 14: 125–139.
Fiamegos Y.C., P.L. Kastritis, V. Exarchou, H. Han, A.M. Bon-
vin, J. Vervoort, K. Lewis, M.R. Hamblin and G.P. Tegos. 2011.
Antimicrobial and efflux pump inhibitory activity of caffeoylquinic
acids from Artemisia absinthium against Gram-positive pathogenic
bacteria. PLoS ONE 6: e18127.
Fischbach M. 2011. Combination therapies for combating antibac-
terial resistance. Curr. Opin. Microbiol. 14: 519–523.
Fujita M., S. Shiota, T. Kuroda, T. Hatano, T. Yoshida, T. Mizu­
shima and T. Tsuchiya. 2005. Remarkable synergies between baica-
lein and tetracycline and baicalein and β-lactam against methicillin-
esistant Staphylococcus aureus. Microbiol. Immunol. 49: 391–396.
García P., B. Martínez, L. Rodríguez and A. Rodríguez. 2010.
Synergy between the phage endolysin LysH5 and nisin to kill
Staphylococcus aureus in pasteurized milk. Int. J. Food Microbiol.
141: 151–155.
Garo E., G.R. Eldridge, M.G. Goering, E. DeLancey Pulcini,
M.A. Hamilton, J.W. Costerton and G.A. James. 2007. Asiatic
acid and corosolic acid enhance the susceptibility of Pseudomonas
aeruginosa biofilms to tobramycin. Antimicrob. Agents Chemother.
51: 1813–1817.
Garvey M.I., M.M. Rahman, S. Gibbons and L.J. Piddock. 2011.
Medical plant extracts with efflux inhibitory activity against Gram-
negative bacteria. Int. J. Antimicrob. Agents 37: 145–151.
Ge F., F. Zeng, S. Liu, N. Guo, H. Ye, Y. Song, J. Fan, X. Wu,
X. Wang, X. Deng, Q. Jin and L. Yu. 2010. In vitro synergistic inter-
actions of oleanolic acid in combination with isoniazid, rifampicin
or ethambutanol against Mycobacterium tuberculosis. J. Med. Micro­
biol. 59: 567–572.
Gibbons S. and E.E. Udo. 2000. The effect of reserpine, a modulator
of multidrug pumps, on the in vitro activity of tetracycline against
102 K.I. Wolska et al.
clinical isolates of methicillin resistant Staphylococcus aureus (MRSA)
possessing the tet(k) determinant. Phytother. Res. 14: 139–140.
Ginsberg A.M. and M. Spigelman. 2007. Challenges in tuberculosis
drug research and development. Nat. Med. 13: 290–294.
Gould S.W., M.D. Fielder, A.F. Kelly and D.P. Naughton. 2009a.
Anti-microbial activities of pomegranate rind extracts: enhance-
ment by cupric sulphate against clinical isolates of S. aureus, MRSA
and PVL positive CA-MSSA. BMC Complement. Altern. Med. 9: 23
Gould S.W., M.D. Fielder, A.F. Kelly, W. El Sankary and
D.P. Naughton. 2009 b. Antimicrobial pomegranate rind extracts:
enhancement by Cu(II) and vitamin C combinations against clinical
isolates of Pseudomonas aeruginosa. Br. J. Biomed. Sci. 66: 129–132.
Górski A., A. Międzobrodzki, J. Weber-Dabrowska, M. Łobocka,
W. Fortuna, S. Letkiewicz, M. Zimecki and G. Filby. 2009. Bacte-
riophage therapy for the treatment of infections. Curr. Opin. Investig.
Drugs 10: 766–774.
Grande M.J., R.L. López, H. Abriouel, E. Valdivia, N. Ben Omar,
M. Maqueda, M. Martinez-Caňamero and A. Gálvez. 2007. Treat-
ment of vegetable sauce with enterocin AS-48 alone or in combina-
tion with phenolic compounds to inhibit proliferation of Staphylo­
coccus aureus. J. Food Prot. 70: 405–411.
Grandgirard D., J.M. Loeffler, V.A. Fischetti and S.I. Lieb. 2008.
Phage lytic enzyme CpL-1 for antibacterial therapy in experimental
pneumococcal meningitis. J. Infect. Dis. 197: 1519–1522.
Grudniak A.M., A. Kurek, J. Szarlak and K.I. Wolska. 2011.
Oleanolic and ursolic acids influence the expression of the cysteine
regulon and the stress response in Escherichia coli. Curr. Microbiol.
62: 1331–1336.
Gu H., P.L. Ho, E. Tong, L. Wang and B. Xu. 2003. Presenting
vancomycin on nanoparticles to enhance antimicrobial activities.
Nano Lett. 3: 1261–1263.
Hamill T.M., B.F. Gilmore, D.S. Jones and S.P. Gorman. 2007.
Strategies for the development of the urinary catheters. Expert Rev.
Med. Devices 4: 215–225.
Hardes J., C. von Eiff, A. Streitbuerger, M. Balke, T. Budny,
M.P. Henrichs, G. Hauschild and H. Ahrens. 2010. Reduction
of periprosthetic infection with silver-coated megaprostheses in
patients with bone sarcoma. J. Surg. Oncol. 101: 389–395.
Hemaiswarya S., A.K. Kruthiventi and M. Doble. 2008. Synergism
between natural products and antibiotics against infectious diseases.
Phytomedicine 15: 639–652.
Horiuchi K., S. Shiota, T. Kuroda, T. Hatano, T. Yoshida and
T. Tsuchiya. 2007. Potentiation of antimicrobial activity of amino-
glycosides by carnosol from Salvia officinalis. Biol. Pharm. Bull. 30:
287–290.
Hu Z.-Q., W.-H. Zhao, Y. Hara and T. Shimamura. 2001. Epigallo­
catechin gallate synergy with ampicillin/sulbactam against 28 clinical
isolates of methicillin-resistant Staphylococcus aureus J. Antimicrob.
Chemother. 48: 361–364.
Im A.R., L. Han, E.R. Kim, Y.S. Kim and Y. Park. 2011. Enhanced
antibacterial activities of Leonuri Herba extracts containing silver
nanoparticles. Phytother. Res. Doi: 10.1002/ptr.3683.
Kaneko M., N. Togashi, H. Hamashima, M. Hirohara and Y. Inoue.
2011. Effect of farnesol on mevalonate pathway of Staphylococcus
aureus. J. Antibiot. 64: 547–549.
Kondo K., Y. Takaishi, H. Shibata and T. Higuti. 2006. ILSMRs
(intensifier of beta-lactam-susceptibility in methicillin-resistant
Staphylococcus aureus) from Tara [Caesalpinia spinosa (Molina)
Kuntze]. Phytomedicine 13: 209–212.
Kozai K., J. Suzuki, M. Okada and N. Nagasaka. 1999. Effect of
oleanolic acid-cyclodextrin inclusion compounds on dental carries
by in vitro experiment in rat-carries model. Microbios 97: 179–188.
Kurek A., A.M., Grudniak, M. Szwed, A. Klicka, Ł. Samluk and
K.I. Wolska. 2010. Oleanolic acid and ursolic acid affect peptido-
2
glycan metabolism in Listeria monocytogenes. Anton. Leuven. Int.
J. Mol. Biol. 97: 61–68.
Kurek A., A.M. Grudniak, A. Kraczkiewicz-Dowjat and K.I. Wol-
­ska. 2011. New antibacterial therapeutics and strategies. Pol. J. Micro­
biol. 60: 3–12.
Kurek A., P. Nadkowska, S. Pliszka and K.I. Wolska. 2012. Mod-
ulation of antibiotic resistance in bacterial pathogens by oleano-
lic acid and ursolic acid. Phytomedicine, doi: 10.1016/j. phymed.
2011.12.009.
Kuroda M., S. Nagasaki and T. Ohta. 2007. Sesquiterpene farnesol
inhibits recycling of the C55 lipid carrier of the murein monomer
precursor contributing to increased susceptibility to β-lactams in
methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother.
59: 425–432.
Li Y., P. Leung, Q.W. Song and E. Newton. 2006. Antimicrobial
effect of surgical masks coated with nanoparticles. J. Hosp. Infect.
62: 58–63.
Lim Y.H., I.H. Kim and J.J. Seo. 2007. In vitro activity of kaempferol
isolated from Impatiens balsamina alone and in combination with
erythromycin and clindamycin against Propionnibacterium acnes.
J. Microbiol. 45: 473–477.
Lin J.J., W.C. Lin, R.X. Dong and S.H. Hsu. 2012. The cellular
responses and antibacterial activities of silver nanoparticles stabi-
lized by different polymers. Nanotechnology 23: 065102.
Liu C.S., T.M. Cham, C.H. Yang, H.W. Chang, C.H. Chen and
L.Y. Chuang. 2007. Antibacterial properties of Chinese herbal medi-
cines against nosocomical antibiotic resistant strains of Psuedomo­
nas aeruginosa in Taiwan. Am. J. Chin. Med. 35: 1047–1060.
Liu M.H., N. Otsuka, K. Noyori, S. Shiota, W. Ogawa, T. Kuroda,
T. Hatano and T. Tsuchiya. 2009. Synergistic effect of kaempferol
glycosides purified from Laurus nobilis and fluoroquinolones on
methicillin-resistant Staphylococcus aureus. Biol. Pharm. Bull. 32:
489–492.
Loeffler J.M. and V.A. Fischetti. 2003. Synergistic lethal effect of
a combination of phage lytic enzymes with different activities on
penicillin-sensitive and -resistant Streptococcus pneumoniae strains.
Antimicrob. Agents Chemother. 47: 375–377.
Lok C.M., C.M. Ho, R. Chen, Q.Y. He, W-Y. Yu, H. Sun,
P.K. Tam, J.F. Chiu and C.M. Che. 2006. Proteomic analysis of the
mode of antibacterial action of silver nanoparticles. J. Prot. Res. 5:
916–924.
López R. and E. García. 2004. Recent trends on the molecular bio­
logy of pneumococcal capsules, lytic enzymes and bacteriophage.
FEMS Microbiol. Rev. 28: 553–580.
Lorenzi V., A. Muselli, A.F. Bernardini, L. Berti, J.M. Pages,
L. Amaral and J.M. Bolla. 2009. Geraniol restores antibiotic activi-
ties against multidrug-resistant isolates from gram-negative species.
Antimicrob. Agents Chemother. 53: 2209–2211.
Martínez B., J.M. Obeso, A. Rodríguez and P. García. 2008. Nisin-
bacteriophage crossresistance in Staphylococcus aureus. Int. J. Food
Microbiol. 122: 253–258.
Michalet S., G. Cartier, B. David, A.M. Mariotte, M.G. Dijoux-
Franca, G.W. Kaatz, M. Stavri and S. Gibbons. 2007. N-caffeoyl-
phenalkylamide derivatives as bacterial efflux pump inhibitors.
Bioorg. Med. Chem. Lett. 17: 1755–1758.
Modak S. and C.L. Fox Jr. 1985. Synergistic action of silver sulfa-
diazine and sodium piperacillin on resistant Pseudomonas aerugi­
nosa in vitro and in experimental burn wound infections. J. Trauma.
25: 27–31.
Monteiro D.R., L.F. Gorup, A.S. Takamiya, A.C. Ruvollo-Filho,
E.R. de Camargo and D.B. Barbosa. 2009. The growing impor-
tance of materials that prevent microbial adhesion; antimicrobial
effect of metal devices containing silver. Int. J. Antimicrob. Agents
34: 103–110.
2 Antibiotics and novel antimicrobials
Mulyaningsih S., F. Sporer, S. Zimmermann, J. Reichling and
M. Wink. 2010. Synergistic properties of the terpenoids aromaden-
drene and 1,8-cineole from the essential oil of Eucalyptus globulus
against antibiotic-susceptible and antibiotic-resistant pathogens.
Phytomedicine 17: 1061–1066.
Nascimento A.M., M.G. Brandăo, G.B. Oliveira, I.C. Fortes
and E. Chartone-Souza. 2007. Synergistic bactericidal activity
of Eremanthus erythropappus oil or β-bisabolene with ampicillin
against Staphylococcus aureus. Anton. Loeven. Int J. Mol. Biol. 92:
95–100.
Nascimento J.G., M.D. Guerreiro-Pereira, S.F. Costa, C. Săo-
José and M.A. Santos. 2008. Nisin-triggered activity of Lys44, the
secreted endolysin from Oenococcus oeni phage fOg44. J. Bacteriol.
190: 457–461.
Natarajan P., S. Katta, I. Andrei, V. Babu Rao Ambati, M. Leonida,
G.J. Haas. 2008. Positive antibacterial co-action between hop
(Humulus lupulus) constituents and selected antibiotics. Phytomedi­
cine 15: 194–201.
Neal A.I. 2008. What can be inferred from bacterium – nanopar-
ticle interactions about the potential consequences of environmental
exposure to nanoparticles? Exotoxicobiology 7: 362–371.
Nelson D., L. Loomis and V.A. Fischetti. 2001. Prevention and
elimination of upper respiratory colonization of mice by group A
streptococci by using a bacteriophage lytic enzyme. Proc. Natl. Acad.
Sci. U.S.A. 98: 4107–4112.
Obeso J.M., B. Martínez, A. Rodríguez and P. García. 2008. Lytic
activity of the recombinant staphylococcal bacteriophage phiH5
endolysin active against Staphylococcus aureus in milk. Int. J. Food
Microbiol. 128: 212–218.
O’Flaherty S., A. Coffey, W. Meaney, G.F. Fitzgerald and R.P. Ross.
2005. The recombinant phage lysin LysK has a broad spectrum
of lytic activity against clinically relevant staphylococci, includ-
ing methicillin-resistant Staphylococcus aureus. J. Bacteriol. 187:
7161–7164.
Ohnishi Y., J. Ishikawa, H. Hara, H. Suzuki, M. Ikenoya, H. Ikeda,
A. Yamashita, M. Hattori and S. Horinouchi. 2008. Genome
sequence of the streptomycin-producing microorganism Strepto­
myces griseus IFO 13350. J. Bacteriol. 190: 4050–4060.
Parson J.B. and C.O. Rock. 2011. Is bacterial fatty acid synthesis
a valid target for antibacterial drug discovery? Curr. Opin. Microbiol.
14: 544–549.
Patil S.S., R.S. Dhumal, M.V. Varghese, A.R. Paradkar and
P.K. Khanna. 2009. Synthesis and antibacterial studies of chloram-
phenicol loaded nano-silver against Salmonella typhi. Synth. React.
Inorg. Met-Org. Nano-Met. Chem. 39: 65–72.
Pissuwan D., C.H. Cortie, S.M. Valenzuela and M.B. Cortie. 2010.
Functionalised gold nanoparticles for controlling patogenic bacteria.
Trends Biotechnol. 28: 207–213.
Plaper A., M. Golob, I. Hafner, M. Oblak, T. Solmajer and R. Jerala.
2003. Characterization of quercetin binding site on DNA gyrase.
Biochem. Biophys. Res. Commun. 306: 530–536.
Potara M., E. Jakab, A. Damert, O. Popescu, V. Canpean and
S.  Astilean. 2011. Synergistic antibacterial activity of chitosan-
silver nanocomposites on Staphylococcus aureus. Nanotechnology
22: 135101.
Rai M., A. Yadav and A. Gade. 2009. Silver nanoparticles as a new
generation of antimicrobials. Biotech. Adv. 27: 76–83.
Rashel M., J. Uchiyama, T. Ujihara, Y. Uehara, S. Kuramoto,
S. Sugihara, K. Yagyu, A. Muraoka, M. Sugai, K. Hiramatsu,
K. Honke and S. Matsuzaki. 2007. Efficient elimination of multi-
drug-resistant Staphylococcus aureus by cloned lysine derived from
bacteriophage phi MR11. J. Infect. Dis. 196: 1237–1247.
Ren D., R. Zuo, A.F. Gonzalez Barrios, L.A. Bedzyk, G.R. Eldridge,
M.E. Pasmore and T.K. Wood. 2005. Differential gene expression
103
for investigation of Escherichia coli biofilm inhibition by plant
extract ursolic acid. Appl. Environ. Microbiol. 71: 4022–4034.
Riley M.A. and J.E. Wertz. 2002. Bacteriocins: evolutions, ecology,
and application. Annu Rev. Microbiol. 56: 117–137.
Rivardo F., M.G. Martinotti, R.J. Turner and H. Ceri. 2010. The
activity of silver against Escherichia coli biofilm is increased by
a lipopeptide biosurfactant. Can. J. Microbiol. 56: 272–278.
Rodríguez-Cerrato V., P. García, G. del Prado, E. García,
M. Garcia, L. Huelves, C. Ponte, R. López and F. Soriano. 2007. In
vitro interactions of LytA, the major pneumococcal autolysin, with
two bacteriophage lytic enzymes (Clp-1 and Pal), cefotaxime and
moxifloxacin against antibiotic-susceptible and -resistant Streptococ­
cus pneumoniae strains. J. Antimicrob. Chemother. 60: 1159–1162.
Rosemary M.J., I. McLaren, T. Pradeep. 2006. Investigations of
the antibacterial properties of ciprofloxacin SiO2. Langmuir. 22:
10125–10129.
Ruden S., K. Hilpert, M. Berditsch, P. Wadhwani and A.S. Ulrich.
2009. Synergistic interaction between silver nanoparticles and mem-
brane-permeabilizing antimicrobial peptides. Antimicrob. Agents
Chemother. 53: 3538–3540.
Schindler M. and M.J. Osborn. 1979. Interaction of divalent cat-
ions and polymyxin B with lipopolysaccharide. Biochemistry 18:
4425–4430.
Shahverdi A.R., A. Fakhimi, H.R. Shahverdi and S. Minaian.
2007. Synthesis and effect of silver nanoparticles on the antibacte-
rial activity of different antibiotics against Staphylococcus aureus and
Escherichia coli. Nanomedicine 3: 168–171.
Singh M., S. Singh, S. Prasada and I.S. Gambhir. 2008. Nanotech-
nology in medicine and antibacterial effect of silver nanoparticles.
Digest J. Nanomat. Biostruct. 3: 115–122.
Sivarooban T., N.S. Hettiarachchy and M.G. Johnson. 2008. Trans-
mission electron microscopy study of Listeria monocytogenes treated
with nisin in combination with either grape seed or green tea seed.
J. Food Prot. 71: 2105–2109.
Srivastava A., M. Talaue, S. Liu, D. Degen, R.Y. Ebright, E. Sineva,
A. Chakraborty, S.Y. Druzhinin, S. Chatterjee, J. Mukhopadhyay,
J.W. Ebright, A. Zozula, J. Shen, S. Sengupta, R.R. Niedfeldt,
C. Xin, T. Kaneko, H. Irschik, R. Jansen, S. Donadio, N. Connell
and R.H. Ebright 2011. New target for inhibition of bacterial RNA
polymerase: ”swith region”. Curr. Opin. Microbiol. 14: 532–543.
Stavri M., L.J. Piddock and S. Gibbons. 2007. Bacterial efflux
pump inhibitors from natural sources. J. Antimicrob. Chemother.
59: 1247–1260.
Sultana N., M.S. Arayne and R. Sabri. 2005. Erytromycin syner-
gism with essential and trace elements. Pak. J. Pharm. Sci. 18: 35–39.
Theuretzbacher U. 2011. Resistance drives antibacterial drug devel-
opment. Curr. Opin. Pharmacol. 11: 433–438.
Tom R.T., V. Suryanarayanan, P.G. Reddy, S. Baskaran and
T. Pradeep. 2004. Ciprofloxacin-protected gold nanoparticles. Lang­
muir. 20: 1909–1914.
Tsuchiya H. and M. Iinuma. 2000. Reduction of membrane fluidity
by antibacterial sophoraflavanone G isolated from Sophora exigua.
Phytomedicine 7: 161–165.
Tu D., G. Blaha, P.B. Moore and T.A. Steitz. 2005. Structures of
MLSBK antibiotics bound to mutated large ribosomal subunits pro-
vide a structural explanation of resistance. Cell 121: 257–270.
Vitiello M., M. Galdiero, E. Finamore, S. Galdiero and M. Gal­
diero. 2012. NF-κB as a potential therapeutic target in microbial
diseases. Mol. Biosyst. 8: 1108–1120.
Wagner H. and G. Ulrich-Merzenich. 2009. Synergy research:
approaching a new generation of phytopharmaceuticals. Phyto­
medicine 2–3: 97–110.
Walencka E., S. Różalska, H. Wysokińska, M. Różalski, L. Kuźma
and B. Różalska. 2007. Salvipisone and aethopinone from Salvia
104 K.I. Wolska et al.
sclarea hairy roots modulate staphylococcal antibiotic resistance and
express anti-biofilm activity. Planta Med. 73: 545–551.
Wolska K.I., A.M. Grudniak, B. Fiecek, A. Kraczkiewicz-Dowjat,
A. Kurek. 2010. Antibacterial activity of oleanolic and ursolic acids
and their derivatives. Centr. Eur. J. Biol. 5: 543–553.
Wormser G.P., G.T. Keusch and R.C. Heel. 1982. Co-trimoxazole
(trimethoprim-sulfamethoxazole): an updated review of its antibac-
terial activity and clinical efficacy. Drugs 24: 459–518.
Yam Y.S., J.M.T. Hamilton-Miller and S. Shah. 1998. The effect
of a component of tea (Camellia sinensis) on methicillin resistance,
PBP2’ synthesis, and β-lactamase production in Staphylococcus
aureus. J. Antimicrob. Chemother. 42: 211–216.
2
Yoong P., R. Schuch, D. Nelson and V.A. Fischetti. 2006. PlyPH,
a bacteriolytic enzyme with a broad pH range of activity and lytic
action against Bacillus anthracis. J. Bacteriol. 188: 2711–2714.
Zhao W.-H., Z.Q. Hu, S. Okuba, Y. Hara and T. Shimamaura.
2001. Mechanism of synergy between epigallocatechin gallate and
β-lactams against methicillin-resistant Staphylococcus aureus. Anti­
microb. Agents Chemother. 45: 1737–1742.
Zhao W.-H., Z.-. Hu, Y. Hara, T. Shimamura. 2002. Inhibition
of penicillinase by epigallocatechin gallate resulting in restora-
tion of antibacterial activity of penicillin against penicillinase pro-
ducing Staphylococcus aureus. Antimicrob. Agents Chemother. 36:
2266–2268.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 105–110

ORGINAL PAPER

Virulence Genes Profiles and Phylogenetic Origin

of Escherichia coli from Acute and Chronic Intestinal Diseases Revealed
by Comparative Genomic Hybridization Microarray

Beata Sobieszczańska1*, Urszula Kasprzykowska1, Michał Turniak1,

Henryk Maciejewski2, Roman Franiczek1 and Anna Duda-Madej1

University of Medicine, Department of Microbiology, Wrocław, Poland

1 

Wrocław University of Technology, Institute of Computer Engineering, Control and Robotics, Wrocław, Poland
2 

Received 25 November 2011, revised 5 April 2012, accepted 7 May 2012

Abstract

The association between Escherichia coli virulence factors and chronic intestinal disorders is mostly unknown. The presented study com-
pared the distribution of virulence genes and phylogroups among E. coli isolated from chronic intestinal disorders such as Crohn’s disease
and irritable bowel syndrome (IBS) with strains isolated from patients with acute diarrhea as a control group. The presence of 159 virulence
genes corresponding to known E. coli pathotypes was determined among 78 E. coli archive strains isolated from IBS, acute diarrhea and
Crohn’s disease using CGH microarray. E. coli isolated from IBS demonstrated a mosaic of virulence genes specific to enteropathogenic,
enterotoxigenic, enterohemorrhagic E. coli strains and Shigella species. In contrast, virulence factors and phylogroups distribution among
E. coli isolated from children with acute diarrhea was similar to extraintestinal E. coli strains that probably acquired some virulence genes.
The acquisition of virulence genes might have an impact on diarrheagenic potential of these strains. On the other hand, E. coli isolated
from children with Crohn’s disease seem to be similar to adherent-invasive E. coli strains (AIEC), as it lack most known virulence genes.
The presented study showed that these analyzed groups of E. coli strains differed from each other with the respect to the distribution of
virulence genes. The differences in gene content support the idea that the participation of E. coli in chronic intestinal diseases is mostly
related to virulence potential of these strains.

K e y w o r d s: E. coli, DNA microarray, virulence genes

Introduction Crohn’s disease, next to ulcerative colitis, is one

There are many E. coli pathotypes responsible for
gastrointestinal diseases in humans. Most of these
pathotypes possess specific virulence factors determin-
ing the pathomechanism of the infection, but not neces-
sarily influencing the course of the disease. Enteropatho-
genic E. coli (EPEC) produce intimin responsible for
specific histopathological lesions of intestinal microvilli
that results in watery diarrhea, whereas enterotoxigenic
E. coli (ETEC) secrete heat-stable and/or heat-labile
enterotoxins causing intestinal net fluid secretion and
thus promoting the development of non-inflammatory
watery diarrhea similar to that caused by EPEC (Kaper
et al., 2004). The younger the organism infected with
pathogenic E. coli strain the bigger the probability of
clinically symptomatic disease what is associated with
the lack of immunity in young individuals. Thus, most
acute intestinal infections caused by pathogenic E. coli
occur among children (Hunter, 2003).
of the feature of inflammatory bowel disease (IBD) of
unknown etiopathogenesis (Moyer, 2005; Abdel-Hady
and Bunn, 2004). Recently, the association of adherent-
invasive E. coli strains (AIEC) with Crohn’s disease has
been demonstrated. AIEC have been isolated from
more than 36% of adult patients with Crohn’s disease
and from only 6% of healthy individuals (Rolhion
and Darfeuille-Michaud, 2007; Darfeuille-Michaud
et al., 2004). Therefore it is not known whether AIEC
can cause intestinal disease only among genetically or
immunologically predisposed individuals, or is related
to virulence potential of these strains.
IBS is another, probably the most common, chronic
intestinal disorder that in contrast with IBD affects only
adults (Olden, 2003; Garcia-Rodriguez and Ruigomez,
1999). In our previous study enteroaggregative E. coli
strains (EAEC) were isolated from more than 80%
of patients with diarrheal form of IBS in comparison
with only 30% of healthy individuals (Sobieszczańska

*  Corresponding author: B. Sobieszczańska, Department of Microbiology, Chałubińskiego 4 Str., 50-368 Wrocław, Poland;
phone: 48 071 784 13 08; fax: 48 071 784 17 01; e-mail: bmsobie@gmail.com
106 Sobieszczańska B. et al.
et al., 2007). EAEC are associated with acute or persis-
tent watery diarrhea and have been isolated from chil-
dren and adults worldwide (Okeke and Nataro, 2001;
Weintraub, 2007; Huang et al., 2006). The pathotype is
defined by its characteristic stacked-brick-like pattern
of adherence to epithelial cells (Wientraub, 2007). The
pathotype is heterogeneous regarding virulence factors
and its ability to cause diarrhea since these strains are
isolated from diarrheal and healthy individuals (Kaur
et al., 2010; Paciorek, 2002).
Most virulence factors of E. coli pathotypes involved
in acute diarrheas are well characterized. On the other
hand, the virulence markers of E. coli strains isolated
from chronic intestinal diseases are still unknown. The
aim of the study was to compare virulence genes pro-
files and phylogenetic origin of E. coli strains isolated
from chronic and acute intestinal disorders using CGH
microarray.
Experimental
Materials and Methods
E. coli strains. A collection of 78 E. coli archive
strains was examined. The strains were isolated from
three different groups of patients. Two of these groups
comprised E. coli strains isolated from patients with
chronic intestinal diseases, e.g. CD and IBS that were
compared with E. coli strains included in the third
group of E. coli strains isolated from cases of acute
diarrhea. The IBS group included 26 E. coli isolates
collected in our laboratory from stool specimens of
26 adult patients (age mean age 37 years) with diarrheal
form of IBS recognized on the basis of Rome II crite-
ria in the Clinic of Gastroenterology and Hepatology
of Medical University, Wrocław, Poland. The Crohn’s
disease (CD) group comprised 28 E. coli isolated from
terminal ileum biopsy specimens of 28 children (mean
age 1.7  year) with Crohn’s disease diagnosed on the
basis of clinical presentation, endoscopy examination
and histopathology in the Department and Clinic of
Pediatrics and Gastroenterology of Medical University,
Wrocław, Poland. The third group of 24 E. coli strains
was collected in our laboratory from 24 stool speci-
mens of children (mean age 2.5 year) with acute diar-
rhea (AD) hospitalized in the Department and Clinic of
Pediatrics and Gastroenterology of Medical University,
Wrocław, Poland. None of these E. coli strains examined
belonged to enteropathogenic E. coli (EPEC) as assessed
by standard agglutination assay with specific antisera
(Biomed, Poland).
Phylogenetic group determination. Affiliation to
four main phylogenetic groups A, B1, B2 and D was
determined based on an anonymous DNA fragment
2
designated TSPE4.C2, chuA gene required for heme
transport in EHEC O157:H7 E. coli, and yjaA gene of
unknown function present in nonpathogenic E. coli
K12 strain by DNA microarray and confirmed by PCR
according to Clermont et al. (2000).
DNA extraction. Genomic DNA was extracted
according to method described by Zhang et al. (2005).
Briefly, 3 ml of overnight cultures of E. coli strains in
Luria broth were pelleted by centrifugation at 2000 xg
for 20 min and resuspended in 80 μl sonication buffer
(50 mM Tris and 10 mM EDTA, pH 7.5 with 100 ng/μl
RNase A). The suspension was transfered into a 0.5 ml
thin wall PCR tube and treated with sonication using
Labo-Plus, Vibra Cell Sonics sonicator. Four treat-
ments of 1 min each at an amplitude setting of 5 were
performed. The disrupted cells were centrifuged at
2500 xg for 20 min and incubated at 98°C in a DNA-
Engine PT200 thermal cycler (MJ Research Waltham,
MA, USA) for 5 min to precipitate out the proteins in
the supernatant by heat denaturation. After next cen-
trifugation at 2500 xg for 20 min approximately 40 μl
clean and fragmented DNA (purity determined spec-
trophotometrically – OD260/280 ranged from 1.8 to 2.0)
was transferred to a new tube. The required size of DNA
fragments ranging from 100 bp to 600 bp was controlled
by capillary gel electrophoresis.
E. coli DNA labeling and hybridization. A 2 μg
of fragmented genomic DNA from each E. coli strain
was labeled with a fluorescent dye Cy3 (green) whereas
DNA from reference strain EDL933 with Cy5 (red)
using commercial chemical labeling kit (Universal
Linkage System (ULS) array CGH Labeling kit, Kreat-
ech Biotechnology, Amsterdam, Nederland) according
to the manufacturer’s protocol. The two labeled DNA
samples were then mixed and hybridized to the micro-
array. Hybridization was performed for 16 h at 42°C
in a slide hybridization chamber (Hybridization Sys-
tem Maui, France). After washing three times in 0.1 xg
SSC buffer (15 mM NaCl, 1.5 mM trisodium citrate,
pH 7.0) with 0.1% sodium dodecyl sulphate (SDS) and
one washing in 0.1 × SSC buffer without SDS at 37°C
for 5 min under agitation, the array was scanned using
InnoScan 700 (Microarray Scanner Innopsys, France).
The fluorescence emission of Cy5 and Cy3 dyes were
measured at 635 nm and 532 nm, respectively. The rela-
tive intensity of each the dyes for each of the microarray
spots was measured and the relative abundance of each
DNA was calculated.
DNA microarray. A DNA microarray developed by
Bruant et al. (2006) was used to determine the presence
of virulence genes among E. coli strains. The version
of the microarray used in the study was arranged of
234 70-mer oligonucleotide probes specific for 159 vir-
ulence genes characteristic for all known E. coli patho­
types, 4 positive (lacY-Ec, lacZ, tnaA, and uidA) and
2 E. coli virulence genes revealed by microarray
5 negative controls (lacY-Cf, Sf0315, Sf3004, At3g51820,
and green fluorescent protein gfpmut 3.1). Probes spe-
cific for targeted genes are presented in Table S1 (sup-
plemental material available from the authors). Four
independent arrays were printed on the same slide and
each nucleotide in the array was printed fourfold. The
positive and the negative controls as well as seven print-
ing buffer spots were added in each array. The refer-
ence EDL933 strain was used to validate the specific-
ity of the virulence oligonucleotides. Virulence genes
detected in EDL933 reference strains are presented
in Table I. Microarrays were spotted in the Institute
of Bioorganic Chemistry, Polish Academy of Science,
using Nanoprint LM60 printing system (Telechem) and
Corning Epoxide Slides (cat. No. 40044). 70-mer long
DNA probes synthesized by Syngen Biotech (Wrocław,
Poland) were diluted in Schott Nexterion Spot buffer to
the final concentration 20 μM. Each probe was spotted
in four replicates and each slide contained four identi-
cal microarrays that were hybridized using compatible
MAUI chamber. All hybridization experiments were
repeated between two and five times per genome.
Table I
Virulence genes and phylogroups detected in reference E. coli
strains used in the study
E. coli strain Pathotype
Virulence genes
Phylogroup
EDL933 EHEC (O157:H7) csgE, fimA, fimH, lpfAO157, ehx,
hlyE
D eae, eae-gamma, paa, espA1
and 2, espB1, tir2, stx1A and B,
stx2A and B, astA, nleA, ccdB,
efa1, espP, etpD, fliC, katP,
fliC(H7), wzy(O157:H7), rfbE,
fepC
Statistical analysis. Genes with differential quan-
tity of DNA were identified using the nonparametric
Kruskal-Wallis test. The FDR-adjusted p-value for the
selected genes was in the range 0.056 to 0.18.
Results and Discussion
Phylogroups distribution. Most commensal E. coli
strains belong to A or B1 phylogroups, whereas many
pathogenic E. coli strains e.g. EPEC, ETEC as well as
enteroinvasive E. coli strains (EIEC) are distributed
across all four phylogroups, but are mainly associ-
ated with A, B1 and D phylogroups (Ishii et al., 2007;
Sahl et al., 2011; Turner et al., 2006). On the other
hand, E. coli isolates causing extraintestinal infec-
tions (ExPEC) not only contain more virulence fac-
107
Table II
Phylogenetic groups and subgroups distribution among E. coli
strains examined
№ of E. coli isolates (%)
CD IBS AD Total
n = 28 n = 26 n = 24 n = 78
Phylogroups
A   1 (3.6)   2 (7.7)   2 (8.3)   5 (6.4)
B1  3 (10.7)  0  1 (4.2)  4 (5.1)
B2 19 (67.8) 14 (53.8) 11 (45.8) 44 (56.4)
D   5 (17.8) 10 (38.5) 10 (41.7) 25 (32)
CD, Crohn’s disease; IBS, irritable bowel syndrome; AD, acute diarrhea
tors than strains from A and B1 phylogroups, but also
derive predominantly from B2 and to a lesser extent D
phylogroups (Rolland et al., 1998; Duriez et al., 2001).
In our study, only a minority of E. coli strains belonged
to A and B1 phylogroups (6.4% and 5.1%, respectively).
Most E. coli isolates belonged to B2 phylogroup (56.4%)
independently of the strain origin (Table II). Phyloge-
netic D group was mainly associated with E. coli from
AD and IBS (41.7% and 38.5%, respectively) and only
a minority (17.8%) of E. coli from CD. In general, most
E. coli strains from CD belonged to B2 group, whereas
E. coli from IBS and AD derived from both, B2 and
D phylogroups. In several studies E. coli strains belong-
ing to B2 phylogroup have been associated with IBD
(Kotlowski et al., 2007; Petersen et al., 2009), what is
in concordance with the results of our study. In con-
trast to the literature data, the B2 group dominated
among all tested E. coli examined, indicating that the
group is common among E. coli associated with acute
and chronic intestinal diseases or is widely distributed
among clones colonizing intestinal tract of the popula-
tion living on the area of Lower Silesia in Poland.
The comparative analysis of virulence genes distri-
bution among E. coli groups examined. We analyzed
distribution of virulence genes in every studied group
of E. coli strains e.g. IBS, CD and AD and then groups of
E. coli strains were compared to each other e.g. IBS vs.
AD, CD vs. AD. Statistical analysis associated IBS group
E. coli with 16 virulence genes that can be divided into
at least four functional categories: 1.  genes encoding
adhesins: i) specific to pathogenic E. coli strains such
as long polar fimbriae (LPF) of EHEC (lpfAEHEC gene)
and EPEC/EHEC O113 serotype (lpfAO113 gene), CS18
fimbriae of ETEC (fotA gene), AfaE-I fimbriae (afaE-I
gene) of Dr family adhesins of diffusely adhering E. coli
(DAEC), and Pic serine protease (pic gene) produced
by EAEC and Shigella flexneri 2a, that degrades mucin
and play an important role in mucosal colonization,
ii)  common among commensal and uropathogenic
E. coli (UPEC) strains such as P-pili (papA and papC
genes); 2. genes associated with biofilm formation such
108 Sobieszczańska B. et al. 2

as hra1 gene encoding an accessory adhesin that confers
bacterial autoaggregation, enhanced biofilm formation
and aggregative adherence to epithelial cells in vitro,
agn43 gene performing function similar to the hra1
gene, and shf gene conferring firm biofilm formation
in EAEC O42 reference strain; 3. genes encoding iron
acquisition systems such as salmochelin (iroN gene)
acquired from Salmonella spp., yersiniobactin (irp2
and fyuA genes) from Yersinia spp., and iutEPEC gene
encoding aerobactin associated with ExPEC; 4. genes
encoding host immunity evading factors e.g. iss gene
conferring increased serum survival and gene encoding
K1 capsule. Furthermore, 6 (23.1%) E. coli strains from
IBS showed the presence of malX gene, the marker of
pathogenicity island (PAI) of UPEC. In addition, more
than one third of E. coli-IBS carried the cva gene encod-
ing microcin V. E. coli from CD were associated with
only a few genes e.g. encoding iron acquisition systems
(yersinibactin and aerobactin) and microcin V. E. coli
from AD were associated with i) genes encoding adhes-
ins (lpfAO113, papA, papC) and iron acqusition system
(aerobactin), ii) genes associated with biofilm forma-
tion (agn43 gene), iii) and iss gene. Moreover, 4 (16.7%)
of these strains showed the presence of genes encoding
colicin ColY and enterotoxin EspC (Table III).
Comparative analysis of virulence genes distribution
among E. coli from chronic intestinal diseases e.g. IBS
and CD showed only three genes in common e.g. genes
encoding yersiniobactin, aerobactin and microcin  V.
E. coli from IBS and AD shared eight genes. Three of
these genes were associated with adhesins and biofilm
formation (LPF, P-pili, and Agn43). Other three genes
included those encoding aerobactin and increased
serum survival, and microcin V. In addition both, E. coli
from IBS and AD groups were associated with pic and
malX genes. Comparison of E. coli strains from AD
and CD demonstrated only two genes in common e.g.
aerobactin and microcin V encoding genes (Figure 1).
Analysis of the association of phylogroups with
virulence genes distribution. In the study all E. coli

Table III
Genes significantly associated with E. coli strains isolated from irritable bowel syndrome (IBS),
Crohn’s disease (CD) and acute diarrhea (AD)

№ of E. coli isolates (%)

Gene Gene description
CD (n = 28) IBS (n = 26) AD (n = 24)
Genes encoding: adhesins/biofilm formation
lpfAO113 Long polar fimbriaea NS 12 (46.1) 8 (33.3)
lpfAEHEC Long polar fimbriae b
NS 10 (38.5) NS
PapA, papC P pili NS 9 (34.6) 4 (16.7)
fotA CS18 fimbriae of ETEC NS 10 (38.5) NS
hra1 Heat-resistant hemagglutinin 1 NS 11 (42.3) NS
afaE-I AfaE-I adhesin of Dr family adhesins NS 5 (19.2) NS
agn43 Protein of autotransporter family
c
NS 13 (50) 10 (41.7)
Iron acquisition systems
iroN Salmochelin receptor-encoding gene NS 12 (46.1) NS
irp2 Yersiniobactin 9 (32.1) 10 (38.5) NS
fyuA Yersiniobactin receptor-encoding gene NS 7 (26.9) NS
iutEPEC Aerobactin receptor 9 (32.1) 11 (42.3) 8 (33.3)
Host immunity evading factors
iss Increased serum survival NS 10 (38.5) 8 (33.3)
neuA K1 capsule NS 5 (19.2) NS
Microcins and colicins
cva Microcin/colicin V 6 (2) 9 (34.6) 7 (29.2)
colY Pore-former colicin ColY NS NS 4 (16.7)
Various function
pic Serine protease of EAEC NS 6 (23.1) 6 (25)
espC Enterotoxin EspC NS NS 4 (16.7)
malX UPEC PAId marker NS 6 (23.1) 7 (29.2)
a
gene encoding the major fimbrial subunit of long polar fimbriae LpfA from EHEC O113:H21 strain; b gene encod-
ing the major fimbrial subunit of long polar fimbriae LpfA from EHEC O157:H7 strains; c gene encoding antigen
43 precursor that confers autoaggregation and biofilm formation; d PAI, pathogenicity island; NS not associated
according to statistical analysis
2 E. coli virulence genes revealed by microarray
Fig. 1. Virulence genes associated with and shared among E. coli
from irritable bowel syndrome (IBS), Crohn’s disease (CD) and
acute diarrhea (AD)
strains from CD, IBS and AD possessing virulence
genes, belonged to B2 and D phylogroups. The only
exceptions there were two E. coli strains. One strain from
child with CD that was classified to the B1 phylogroup
possessed irp2 and iutEPEC genes and in one E. coli strain
of A phylogroup isolated from child with AD lpfAO113
gene was present. These results indicated that, with few
exceptions, all E. coli strains examined corresponded to
ExPEC strains that are believed to exert their pathogenic
potential only when spread beyond the bowel.
The DNA microarray analysis of virulence genes
associated with E. coli strains isolated from IBS demon-
strated a mosaic of virulence genes specific to pathogenic
strains i.e. EPEC/EHEC and ETEC, as well as Shigella
species and EAEC, but also genes common among com-
mensal E. coli strains (Doughty et al., 2002). The associa-
tion of E. coli from IBS with several different adherence
genes may explain their predilection for causing chronic
infections and could have an impact on pathophysio­
logy of IBS syndrome. Numerous adhesion-associated
genetic determinants may confer augmented adherence
and enhanced capability of IBS-associated E. coli strains
to persistently colonize intestinal mucosa. Further-
more, many of these adhesins could stimulate various
receptors in the gut wall, thus inducing an inflamma-
tion and visceral hypersensitivity, a frequent finding in
IBS patients, as well as an alteration in gut microbiota
(Krotkova et al., 2006; Ohman and Simren, 2007).
E. coli from AD were mainly associated with deter-
minants characteristic to ExPEC, especially uropatho-
genic E. coli strains (UPEC) that typically express an
array of adhesins and iron acquisition systems, but lack
of virulence determinants characteristic to diarrhea-
genic E. coli strains (Östblom et al., 2011). Moreover,
E. coli from AD were also associated with genes enhanc-
109
ing advantage in a hostile intestinal milieu e.g. malX,
iss, colY and cva gene encoding microcin V localized
on ColV plasmid in many E. coli strains. According to
Gilson et al. (1987) ColV plasmids are associated with
E. coli invasiveness and pathogenicity. Moreover, these
mobile genetic elements harbor gene encoding aero-
bactin and increased serum survival (iss), as did E. coli
strains from AD. The virulence determinants associated
with diarrheagenic potential of E. coli from AD were
enterotoxin EspC, a member of autotransporter family
of proteins, found in a subset of EPEC (Millies et al.,
2001; Vidal and Navarro-Garcia, 2006) and LPFO113.
According to Afset et al. (2006) the lpfAO113 gene was
significantly associated with diarrhea among Norwe-
gian children less than 5 years old and has been found
exclusively in diarrhea cases. Taking into consideration
virulence determinants and B2 and D  phylogroups
associated with E. coli derived from AD we can assume
that these isolates correspond to commensal E. coli
strains that could acquired some virulence genes (i.e.
espC, lpfA) from their diarrheagenic counterparts
(Nowrouzian et al., 2001).
The peak of incidence of IBD occurs in patients
between the ages of 15 and 25 years, but there is an
increase in incidence in younger children (Benchimol
et al., 2009). The association of E. coli strains of AIEC
pathotype with CD in adult patients is well known, but
there is no reports on the characteristics of E. coli from
childhood-onset CD. The result the study showed that
only few virulence determinants were associated with
E. coli from children with CD (e.g. genes encoding aero-
bactin and microcin V, and irp2 gene encoding yer-
siniobactin). In this regard E. coli from childhood-onset
CD seems to be similar to AIEC.
According to study of Martinez-Medina et al. (2009)
AIEC from adult patients with CD have demonstrated
association with only aerobactin encoding gene, but not
with other genes e.g. encoding adhesins such as P pili
or type 1 fimbriae, what is in concordance with the
results of the study. Martinez-Medina et al. (2009) have
also showed that most of AIEC strains possessed viru-
lence traits characteristic to ExPEC. On the other hand,
AIEC differs from ExPEC by their invasion capabili-
ties. Most characteristic feature of AIEC distinguishing
these isolates from other E. coli strains is their ability to
survive and replicate within macrophages. Although in
the study E. coli strains from children with CD showed
some similarity with AIEC, further analysis of the inva-
sive potential of these isolates is necessary.
In summary, the study found that E. coli from IBS,
CD and AD, apart from some comparability between
E. coli from IBS and AD, differ from each other indi-
cating that the participation of E. coli in chronic intes-
tinal diseases is mostly related to virulence potential of
these strains.
110 Sobieszczańska B. et al.
Acknowledgements
The studies were supported by a grant Nr N N401 040237
(decision of Polish Committee for Scientific Research Nr 0402/B/
P01/2009/37) from Ministry of Science and Higher Education
of Poland.
Literature
Abdel-Hady M. and S.K. Bunn. 2004. Inflammatory bowel disease.
Curr. Pediatr. 14: 598–604.
Afset J.E., G. Bruant, R. Brousseau, J. Harel, E. Anderssen,
L. Bevanger and K. Bergh. 2006. Identification of virulence genes
linked with diarrhea due to atypical enteropathogenic Escherichia
coli by DNA microarray and PCR. J. Clin. Microbiol. 44: 3703–3711.
Benchimol E.I., A. Guttmann, A.M. Griffiths, L. Rabeneck,
D.R. Mack, H. Brill, J. Howard, J. Guan and T. To. 2009.
Increasing incidence of paediatric inflammatory bowel disease in
Ontario, Canada: evidence from health administrative data. Gut 58:
1490–1497.
Bruant G., C. Maynard, S. Bekal, I. Gaucher, L. Masson, R. Brous-
seau and J. Harel. 2006. Development and validation of an oligo­
nucleotide microarray for detection of multiple virulence and
antimicrobial resistance genes in Escherichia coli. Appl. Environ.
Microbiol. 72: 3780–3784.
Clermont O., S. Bonacrosi and E. Bingen. 2000. Rapid and simple
determination of the Escherichia coli phylogenetic groups. Appl.
Environ. Microbiol. 66: 4555–4558.
Darfeuille-Michaud A., J. Boudeau, P. Bulois, C. Neut, A.L. Glasser,
N. Barnich, M.A. Bringer, A. Swidsinski, L.  Beaugerie and
J.F. Colombel. 2004. High prevalence of adherent-invasive Esche­
richia coli associated with ileal mucosa in Crohn’s disease. Gastro­
enterol. 127: 412–421.
Doughty S., J. Sloan, V. Bennet-Wood, M. Robertson, R.M. Robins-
Browne and E. Hartland. 2002. Identification of a novel fimbrial
gene cluster related to long polar fimbriae in locus of enterocyte
effacement-negative enterohemorrhagic strains of Escherichia coli.
Infect. Immun. 70: 6761–6769.
Duriez P., O. Clermont, S. Bonacorsi, E. Bingen, A. Chaventre,
J. Elion, B. Picard and E. Denamur. 2001. Commensal Escherichia
coli isolates are phylogentically distributed among geographically
distinct populations. Microbiol. 147: 1671–1676.
Garcia-Rodrigez L.A. and A. Ruigomez. 1999. Increased risk of
irritable bowel after bacterial gastroenteritis: cohort study. BJM 318:
565–566.
Gilson L., H.K. Mahanty and R. Kolter. 1987. Four plasmid genes
are required for colicin V synthesis, export, and immunity. J. Bac­
teriol. 169: 2466–2470.
Huang D.B., A. Mohanty, H.L. DuPont, P.C. Okhuysen and
T. Chaing. 2006. A review of an emerging enteric pathogen: entero-
aggregative Escherichia coli. J. Med. Microbiol. 55: 1303–1311.
Hunter P.R. 2003. Drinking water and diarrheal disease due to
Esche­richia coli. J. Water Health 1: 65–72.
Ishii S., K.P. Meyer and M.J. Sadowsky. 2007. Relationship between
phylogenetic groups, genotypic clusters, and virulence gene profiles
of Escherichia coli strains from diverse human and animal sources.
Appl. Environ. Microbiol. 73: 5703–5710.
Kaper J.B., J.P. Nataro and H.L. Mobley. 2004. Pathogenic Esche­
richia coli. Nat. Rev. Microbiol. 2: 123–140.
Kaur P., A. Chakraborti and A. Asea. 2010. Enteroaggregative
Escherichia coli: an emerging enteric food borne pathogen. Inter­
discip. Perspect. Infect. Dis. 2010: 254159.
Kotlowski R., C.N. Bernstein, S. Sepehri and D.O. Krause. 2007.
High prevalence of Escherichia coli belonging to the B2 and D phylo­
genetic groups in inflammatory bowel disease. Gut 56: 669–675.
2
Krotkova N., E. Cota, Y. Lebedin, S. Monpouet, J. Guignot,
A.L. Servin, S. Matthews and S.L. Moseley. 2006. A subfamily of
Dr adhesins of Escherichia coli bind independently to Decay-accel-
erating factor and the N-domain of carcinoembryogenic antigen.
J. Biol. Chem. 281: 29120–29130.
Martinez-Medina M., A. Mora, M. Blanco, C. Lopez, M. Pilar
Alonso, S. Bonacorsi, M.H. Nicolas-Chanoine, A. Darfeuille-
Michaud, J. Garcia-Gil and J. Blanco. 2009. Similarity and diver-
gence among adherent-invasive Escherichia coli and extraintestinal
pathogenic E. coli strains. J. Clin. Microbiol. 47: 3968–3979.
Millies J.L., F. Navarro-Garcia, I.N. Okeke, J. Frederickson,
J.P. Nataro and J.B. Kaper. 2001. EspC pathogenicity island of
enteropathogenic Escherichia coli encodes an enterotoxin. Infect.
Immun. 69: 315–324.
Moyer S.M. 2005. A collaborative effort to define the epidemiology
of pediatric inflammatory bowel disease: what can we learn from
children with early-onset disease? J. Pediatr. 146: 7–8.
Nowrouzian F., I. Adlerberth and A.E. Wold. 2001. P fimbriae,
capsule and aerobactin characterize colonic resident Escherichia coli.
Epidemiol. Infect. 126: 11–18.
Ohman L. and M. Simren. 2007. New insights into the pathogenesis
and pathophysiology of irritable bowel syndrome. Dig. Liver Dis.
39: 201–215.
Okeke I.N. and J.P. Nataro. 2001. Enteroaggregative Escherichia
coli. Lancet Infect. Dis. 1: 304–313.
Olden K.W. 2003. The challenge of diagnosis irritable bowel syn-
drome. Rev. Gastroenterol. Disord. 3 Suppl. 3: S3–11.
Östblom A., I. Adlerberth, A.E. Wold and F. Nowrouzian. 2011.
Pathogenicity island markers, virulence determinants malX and usp,
and the capacity of Escherichia coli to persist in infant’s commensal
microbiotas. Appl. Environ. Microbiol. 77: 2303–2308.
Paciorek J. 2002. Virulence properties of Escherichia coli faecal
strains isolated in Poland from healthy children and strains belong-
ing to serogroups O18, O26, O44, O86, O126 and O127 isolated
from children with diarrhea. J. Med. Microbiol. 51: 548–556.
Petersen A.M., E.M. Niessen, E. Litrup, J. Brynskov, A. Mirsepasi
and K.A. Krogfelt. 2009. A phylogenetic group of Escherichia coli
associated with active left-sided inflammatory bowel disease. BMC
Microbiol. 9: 171.
Rolhion N. and A. Darfeuille-Michaud. 2007. Adherent-invasive
Escherichia coli in inflammatory bowel disease. Inflamm. Bowel Dis.
13: 1277–1283.
Rolland K., N. Lambert-Zechvsky, B. Picard and E. Denamur.
1998. Shigella and enteroinvasive Escherichia coli strains are derived
from distinct ancestral strains of E. coli. Microbiol. 144: 2667–2672.
Sahl J.W., H. Steinsland, J.C. Redman, S. V. Angiuoli, J.P. Nataro,
H. Sommerfelt and D.A. Rasko. 2011. A comparative genomic
analysis of diverse types of enterotoxigenic Escherichia coli reveals
pathovar-specific conservation. Infect. Immun. 79: 950–960.
Sobieszczańska B.M., J. Osek, D. Waśko-Czopnik, E. Dworniczek
and K. Jermakow. 2007. Association of enteroaggregative Esche­
richia coli with irritable bowel syndrome. Clin. Microbiol. Infect. 13:
404–407.
Turner S.M., R.R. Chaudhuri, Z. D. Jiang, H. DuPont, C. Gyles,
C.W. Pensi, M.J. Pallen and I.R. Henderson. 2006. Phylogenetic
comparisons reveal multiple acquisition of the toxin gene by entero-
toxigenic Escherichia coli strains of different evolutionary lineages.
J. Clin. Microbiol. 44: 4528–4536.
Vidal J.E. and F. Navarro-Garcia. 2006. Efficient translocation of
EspC into epithelial cells depends on enteropathogenic Escherichia
coli and host cell contact. Infect Immun. 74: 2293–2303.
Weintraub A. 2007. Enteroaggregative Escherichia coli: epidemio­
logy, virulence and detection. J. Med. Microbiol. 56: 4–8.
Zhang L., B. Foxman, J.R. Gilsdorf and C.F. Marrs. 2005. Bacterial
genomic DNA isolation using sonication for microarray analysis.
BioTechiques 39: 640–644.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 111–117

ORGINAL PAPER

Isolation, Characterization and Phylogenetic Analysis of Halophilic Archaea

from a Salt Mine in Central Anatolia (Turkey)

EVRIM YILDIZ, BIRGUL OZCAN* and MAHMUT CALISKAN

Mustafa Kemal University, Biology Department, 31040 Hatay-Turkey

Received 22 October 2011, revised 2 May 2012, accepted 5 May 2012

Abstract

The haloarchaeal diversity of a salt mine, a natural cave in central Anatolia, was investigated using convential microbiological and molecu-
lar biology methods. Eight halophilic archaeal isolates selected based on their colony morphology and whole cell protein profiles were
taxonomically classified on the basis of their morphological, physiological, biochemical properties, polar lipid and protein profiles and
16S rDNA sequences. From the 16S rDNA sequences comparisons it was established that the isolates CH2, CH3 and CHC resembled
Halorubrum saccharovorum by 98.8%, 98.9% and 99.5%, respectively. There was a 99.7% similarity between the isolate CH11 and Halobac­
terium noricense and 99.2% between the isolate CHA1 and Haloarcula argentinensis. The isolate CH8K and CH8B revealed a similarity rate
of 99.8% and 99.3% to Halococcus dombrowskii, respectively. It was concluded that the isolates named CH2, CH3 and CHC were clustered
in the genus Halorubrum and that CHA1 and CH7 in the genus Haloarcula, CH8K and CH8B in the genus Halococcus and CH11 in the
genus Halobacterium.

K e y w o r d s:  Halophilic archaea, Phylogeny, Taxonomy, Salt mine, Turkey

Introduction 2006; 2009; Birbir et al., 2007). Phylogenetic studies

The increasing interest, in recent years, in micro­
organisms from hypersaline environments has resulted
in the discovery of several new species and genera
belonging to the Bacteria and Archaea domains. Halo-
bacteria are a group of microorganisms forming a part
of the domain Archaea that require high salt concen-
tration for growth (Kamekura, 1998). The extremely
halophilic archaea belong to the order Halobacteria-
les, which contains one family, the Halobacteriaceae
(Ozcan et al., 2007). The family Halobacteriaceae in the
domain Archaea presently is comprised of 35 genera
(Euzeby, 2011).
Members of the Halobacteriaceae are dominant
microorganisms in hypersaline environments world-
wide including salt lakes, crystallizer ponds of solar
salterns, salt mines, as well as hypersaline soda lakes
(Oren, 2000). The haloarchaea are well adapted to
hypersaline environments and require at least 1.5 M
NaCl for growth (Castillo et al., 2007).
Hypersaline environments are commonly present in
Turkey. Several studies have been carried out to isolate
and characterize halophilic archaeal strains from vari-
ous saline parts of Turkey (Elevi et al., 2004; Ozcan et al.
revealed that the halophilic archaeal isolates from Tur-
key clustered closely to genera Halorubrum, Haloarcula,
Natrinema, Halobacterium and Natronococcus (Ozcan
et al., 2007; Birbir et al., 2007). However, there has been
little effort to identify these isolates. Current taxonomic
classification of the Halobacteriaceae is mainly based
on DNA-DNA hybridization, 16S rRNA gene sequence
comparison, polar lipid composition and phenotypic
characteristics (Oren et al., 1997; Castillo et al., 2006).
The main purpose of the current research was to
determine the halophilic archaeal diversity of a salt
mine, formerly a natural cave in central Anatolia, by
determining their phenotypic characteristics, polar lipid
composition and 16S rRNA gene sequence comparison.
Experimental
Material and Methods
Physico-chemical analysis of the brine samples.
Physico-chemical properties of the brine samples
taken from the salt mine (Çankaya Salt Mine, Çankırı-
Turkey) were determined with Merc Spectroquant test

*  Corresponding author: B. Ozcan, Mustafa Kemal University, Biology Department, 31040 Hatay-Turkey; phone: + 903262455336/1632;
e-mail: birgulozcan@gmail.com
112 Yildiz E. et al.
kits and ICP-AES instrument. Test kits and Nova 60
spectrophotometer were used to detect the concentra-
tion of SO42–, Cl–, Ca2+, Mg2+, HCO–, CO3–2 , Na+, K+ and
total hardness while a pH meter with glass electrode
(WTW inoLab pH 720brand) was employed for pH
measurement.
Isolation of extremely halophilic archaea. In order
to isolate halophilic archaea, brine samples were col-
lected in sterile bottles from different points in the
salt mine. Each of the samples was inoculated in SG
broth containing penicillin G. Aerobic enrichment cul-
tures showing turbidity were streaked out onto solid
medium containing penicillin G. Plates were incubated
at 37.5°C. After two weeks incubation period, repre-
sentative colonies were transferred to fresh solid SG
medium in order to obtain pure culture. SG medium
contained (gl–1): NaCl, 250; MgSO4 · 7H2O, 20; KCl, 2;
sodium citrate, 3; casamino acids, 7.5; yeast extract, 1;
and FeSO4 · 7H2O, 0.0023. The pH was adjusted to 7.35
with 1 M KOH (Ozcan et al., 2006).
Phenotypic and cultural properties. Phenotypic
tests of isolates were performed according to the pro-
posed minimal standards for the description of new
taxa in the order Halobacteriales (Oren et al., 1997).
Cell motility and morphology were examined by phase-
contrast microscopy of exponentially growing liquid
cultures. Gram staining was carried out as described
by Dussault (1955). Colony morphology was observed
on optimal growth agar medium after incubation at
37.5°C for 7 days. Tests for catalase and oxidase activity
and hydrolysis of starch, casein, gelatin and of esterase
(Tween 20, 40, 60 and 80) were performed as explained
before (Ozcan et al., 2006). Lipolytic activity was tested
on Rhodamine agar plates (Ozcan et al., 2009). Nitrate
reduction, H2S formation, indole formation, utilization
of sugars (Glucose, sucrose, lactose, fructose, maltose,
xylose, mannose and ribose) and anaerobic growth
in the presence of L-arginine and TMAO were tested
according to Oren et al. (1997). Anaerobic growth in
the presence of nitrate was tested according to Manci-
nelli and Hochstein (1986). The salt range for growth
was determined in SG broth modified with NaCl at
final concentrations of 1, 2, 3, 4, 4.5 and 5 M. The pH
range for growth was determined with 50 mM MES
(5.0–6.0), HEPES (6.5–7.0), tricine (7.5–8.5), CHES
(9.0–9.5) and CAPS (10.0) between pH 5.0 and 10.0.
Archaeal growth rates in different pH and salt concen-
trations were determined at 600 nm with spectropho-
tometric measurements.
Biochemical tests. Antibiotic susceptibility was
tested by spreading cell suspensions on plates of SG
medium and applying antibiotic discs (ampicillin,
10 µg; norfloxacin, 10 µg; tetracycline, 30 µg; bacitracin,
10IU; rifampicin, 5 µg; azithromycine, 15 µg; neomy-
cin, 30 µg; chloramphenicol, 30 µg; penicillin G; 10IU;
2
vancomycin, 30 µg; novobiocin, 30 µg; trimethoprim,
5 µg; ttreptomycin, 25 µg; erythromycin 15 µg; sulpha-
methazol/trimethoprim, 25 µg) (Montalvo-Rodriguez
et al., 2000). The results were recorded as sensitive or
resistant after 14 days of incubation at 37.5°C. Polar
lipid analysis was performed as explained before (Oren
et al., 1996; Oren and Litchfield, 1999). SDS-PAGE of
whole-cell proteins was set up as described by Laemmli
(1970) and Hesselberg and Vreeland (1995).
Phylogenetic analysis. Genomic DNA was extracted
from log-phase cells lysed in purified water by phenol
extraction followed by ethanol precipitation according
to Dyall-Smith (2001). The gene encoding 16S  RNA was
amplified by PCR with the forward primer 5’-ATTC-
CGGTTGATCCTGCCGGAGGTC-3’ (positions 1–25
according to Halobacterium cutirubrum NCIMB 763,
GenBank Accession No. AB073366) and the reverse
primer 5’-GATCCAGCCGCAGATTCCCC-3’ (posi-
tions 1465–1446 according to Halobacterium cutiru­
brum NCIMB 763, GenBank Accession No. AB073366)
(Ozcan et al., 2007). PCR was performed for 30 cycles,
each of which consisted of denaturation for 1 min at
94°C, annealing for 1 min at 59°C, and polymerization
for 1.5 min at 72°C. The 16S rRNA gene sequences were
aligned using CLUSTAL W (Thompson et al., 1994) and
the phylogenetic tree were constructed with MEGA 4.1
using a neighbor joining algorithm and Kimura two-
parameter corrections (Tamura et al., 2007).
Results and Discussion
Physico-chemical properties of brine samples.
The brine samples named CSU1, CSU2A, CSU2B and
CSU3 were collected from four different points in the
salt mine. Table I gives the chemical parameters of these
samples in which halophilic archaea strains were iso-
lated. The results indicated that the mineral content,
pH and hardness of brine are suitable for the growth
of extremely halophilic archaea. The most remarkable
nature of halophilic archaea is that they flourish in con-
ditions with very high content of NaCl and KCl. Several
researchers have determined that extreme halophilic
archaea need at least 1.5 M NaCl for growth. They also
point out that most species show optimum growth at
3.5 to 4.5 M NaCl and pH 7.0 to 7.5 (Kushner, 1985;
Arahal et al., 1996; Oren and R.-Valera, 2001).
Extremely halophilic archaeal strains and their
phenotypic properties. It was pointed out that mem-
bers of Halobacteriaceae family displayed extreme poly-
morphism, having several morphologic shapes ranging
from rods to pleomorphic rods, coccus, pleomorphic,
square and triangles (Castillo et al., 2007). In the cur-
rent study 8 halophilic archaeal isolates named CH2,
CH3, CHA1, CHC, CH7, CH8K, CH8B and CH11,
2 Halophilic archaea from salt mine in Turkey 113

Table I
Chemical characteristics of the brine samples studied

Csu1 Csu2A Csu2B Csu3 Pw*

pH       6.61       7.03       7.06       6.72    6.0
Hardness (F)       3.8       3.1       3.8       3.7   <1.2
SO4–2 (mg/L)   7 400   7 400   7 500   7 500   8
Cl– (mg/L) 209 000 230 000 192 000 200 000 <10
CO3–2 (meq/L)    –    –    –    –  –
HCO3– (meq/L)       1.2       1.6       2.2       1.8  –
Ca2+ (ppm)     790     920     970     940  –
Mg2+ (ppm)     530     490     510     560  –
K+ (ppm)     210     190     190     240  –
Na+ (ppm)   67 200   18 600 102 300   88 700   –

*  Purified water

were selected on the basis of their different colony mor-
phology and whole cell profiles for further characteriza-
tion. Table II shows the morphological features of the
isolates, results of several biochemical tests, antimicro-
bial susceptibility patterns, and NaCl and pH concen-
trations required for optimum growth. When whole
cell protein profiles were examined (Fig. 1), seven dis-
tinct protein profiles were observed for eight different
strains. CH8K and CH8B isolates were ascertained to
have the same protein profile but due to their different
colony pigmentations they were named differently.
CH2, CH3 and CHC isolates exhibited different
protein profile (Fig. 1) and among the phenotypical
features obtained, only colony pigmentation and sugar
fermentation were different. CH2 and CHC isolate can
produce acid from sucrose and mannose while CH3
cannot. CH2 can ferment maltose while CH3 and
CHC isolate cannot. One of the notable features is that
Fig. 1.  Protein profiles of the archaeal strains isolated from
Cankırı Cankaya Salt mine.
1: CH8K, 2: CH8B, 3: CH3, 4: CHC, 5: CH11, 6: CH7, 7: CHA1,
8: CH2, 9: Markers
CH2, CH3 and CHC isolates are resistant to the anti­
biotic rifampicin. Several studies point out that rifam-
picin has an inhibiting effect on most halophilic archaea
(Pecher and Böck, 1981; Bonelo et al., 1984) whereas
another research points out that certain halophilic
archaea are resistant to rifampicin (Allen et al., 2008).
All isolates in this study appeared to be resistant to
ampicillin, norfloxacin, tetracycline, azithromycine,
neomycin, chloramphenicol, penicillin G, vancomycin,
trimethoprim, streptomycin, erythromycin and sulpha-
methazol/ trimethoprim.
CH8B and CH8K which are coccus-shaped, non
motile isolates were determined to be Gram-variable
while other isolates were Gram-negative. Three of six
motile Gram-negative isolates were of pleomorphic
shapes while the other three rod shaped. It was reported
that majority of Halobacteriales order were of Gram-
negative nature while some other members with coc-
cus morphology such as Natronococcus and Halococcus
exhibited Gram-variable feature (Oren et al., 1997).
It was observed that colonies of all eight strains are
nonmucoid, circular shaped and convex. They have
smooth surface appearance and that all strains but
CH8B exhibited pink-red colony pigmentation. It was
pointed out in several former studies that colonies of
many Halobacterial members exhibited various tones
pigmentation ranging from red to pink-orange due to
high rate of carotenoid pigments in their cell mem-
brane. In addition, they were reported to appear opaque,
transparent or translucent, mucoid or non mucoid, with
entire edges and convex (Oren and R.-Valera, 2001;
Castillo et al., 2006).
It was ascertained that all strains but CH11 exhib-
ited catalase activity and that all the isolates had oxi-
dase activity. It was also determined that none of the
isolates produced gas from the tested sugars or acid
from lactose. It was established that none of the isolates
exhibited lipolytic activity (Table II).
114 Yildiz E. et al. 2

Table II
Phenotypic features of the 8 strains studied

Characteristic CH2 CH3 CHA1 CHC CH7 CH8K CH8B CH11

Colonial morphology
 
Colony shape circular circular circular circular circular circular circular circular
 
Mukoid – – – – – – – –
  Pigmentation light pink light red dark red light red red pink-red white red
 
Colony elevation convex convex convex convex convex convex convex convex
 Colony density transparent translucent opaque transparent opaque opaque opaque transparent
 
Colony edge entire entire entire entire entire irregular irregular entire
  Colony size (mm) 0.3–0.75 0.25–0.6 0.2–0.5 0.4–0.7 0.2–0.5 0.1–0.2 0.1–0.2 0.15–0.25
Cell morphology
  Cell shape rod rod pleo. rod pleo.1 coccus coccus pleo.1
 
Gram reaction Gr(–) Gr(–) Gr(–) Gr(–) Gr(–) Gr(+/–) Gr(+/–) Gr(–)
 
Motility + + + + + – – +
  Cell size (µm) 2–15 2–10 ND 2–10 ND 1–3 1–3 1–3
Acid production from
 
Glucose + + – + – – – +
 
Sucrose + – – + – – – –
 
Lactose – – – – – – – –
 
Fructose – – + – + – – –
 
Maltose + – + – + – – –
 
Xylose + + + + + – – +
 
Mannose + – – + – – – –
 Ribose – – + – + + + +
Anaerobic growth with
 
L-Arginine – – – – – – – –
 
TMAO – – – – – – – –
 KNO3 – – – – + – – –
Catalase activity + + + + + + + –
Oxidase activity + + + + + + + +
Gelatin hydrolysis – – + – – + + –
Casein hydrolysis – – – – – + + –
Starch hydrolysis – – + – – – – –
Lipolytic activity – – – – – – – –
Tween 20 hydrolysis – – + – + + + +
Tween 40 hydrolysis – – + – + – – +
Tween 60 hydrolysis – – + – – – – –
Tween 80 hydrolysis – – + – – – – –
H2S production + + – + + + + –
Indole production – – + – – + + –
Nitrite from nitrate + + + + + + + –
Gas from nitrate reduction – – + – + – – –
Optimum NaCl (M) 4.5 3.5 4.5 3.5 4.5 4.5 4.5 3.5
Optimum pH 7 7.5 7 7.5 7 7 7 7
Sensitivity to
 Novobiocin (30 µg) S2 S S S S S S S
 
Bacitracin (10 IU) S S S S S S S S
  Rifampicin (5 µg) R3 R S R S S S S
1
pleomorphic,  sensitive,  resistant
2 3
2 Halophilic archaea from salt mine in Turkey 115

No anaerobic growth was observed in any strain

in the presence of L-arginine and TMAO whereas it
yielded a positive result only with CH7 strain in the
presence of KNO3. Most halophilic Archaea have the
ability to grow anaerobically in the presence of different
chemicals due to their relatively low oxygen solubil-
ity under high salinity conditions. They were reported
(Hartmann et al., 1980; Mancinelli and Hochstein,
1986; Oren and Trüper; 1990; Oren and Litchfield,
1999) to have the ability to use alternative electron
acceptors such as fumarate, TMAO and/or nitrate in
order to perform anaerobic growth.
Polar lipid chromatograms of standard strains and
the isolates from the Cankaya Salt Mine are given in
Fig. 2. According to the chromatographic results, all
isolates were found to contain PG and PGP-Me phos- Fig. 2.  Results of thin layer chromatography analysis of polar
pholipids. It was observed that all strains but CH8K and lipids extracted from halophilic archaeal isolates from the Can-
CH8B isolates contain PGS. kaya Salt Mine
Phylogenetic analysis. Phylogenetic analysis of the 1: Halobacterium salinarum (DSM 3754); 2: Natrialba asiatica (DSM
12278); 3: Halorubrum saccharovorum (DSM 1137); 4: Haloferax deni­
extremely halophilic archaeal isolates were performed trificans (DSM 4425); 5: Haloarcula vallismortis (DSM 3756); 6: CH2;
by building a phylogenetic tree which was constructed 7: CH3; 8: CHA1; 9: CHC; 10: CH7; 11: CH8K; 12: CH8B; 13: CH11.
based on the 16S rRNA gene sequences (Fig. 3). When (PG, phosphatidylglycerol; PGP, phosphatidylglycerolphosphate; PGS,
phosphatidylglycerolsulfate; S-DGD-3, sulfated glycosyl diether (man-
16S rRNA sequential analyses are taken into consid-
nose (1 → 4)-glucoseglyceroldiether); S-DGD-1, sulfated glycosyl diether
eration, CH11 strain was determined to resemble (mannose (1  → 2)-glucose glycerol diether); S2-DGD-1, bis-sulfated
Halobacterium noricense by 99.7% ratio. CH11 isolate diglycosyl diether; S-TGD, sulfated triglycosyl diether; S-TeGD, sulfated
is a  strain with a  pleomorphic cellular shape, which tetraglycosyl diether; DGD-2, diglycosyl diether; DGD-1, diglycosyl
diether (mannose (1 → 2)glucose glycerol diether); TGD-1, triglyco-
can utilize glucose and xylose. CH11 is susceptible to syl diether; (galactosylmannosyl-glucosyl diether); TGD-2, triglycosyl
bacitracin antibiotics and cannot grow anaerobically. diether GL, undefined glycolipid)

Fig. 3.  Phylogenetic tree showing the relationships among the16S rRNA gene sequences of Cankaya salt mine isolates
and the closest relatives within the family Halobacteriaceae
Bootstrap values, expressed as percentages of 1000 replicates, are shown for branches with more than 50% bootstrap support.
Bar, 0.02 substitutions per site
116 Yildiz E. et al.
As for H. noricense, it has the form of rod cells, cannot
make use of glucose or xylose sugars and are resistant
to bacitracin and exhibits anaerobic growth in the pres-
ence of L-Arginine (Gruber et al., 2004). While isolate
CH11 was found to contain two undefined glycolip-
ids in addition to PGS, PG and me-PGP lipids, it is
reported that H. noricense contained PG, me-PGP, PGS,
TGD and S-TeGD lipids (Gruber et al., 2004). Taking
into consideration different phenotypical and chemical
features between these two strains, it is suggested that
isolate CH11 might be a separate species within genus
Halobacterium.
The resemblance of CH8K and CH8B isolates to the
species Halococcus dombrowskii is by 99.8% and 99.3%,
respectively. It was revealed that CH8K and CH8B
strains (the current study) and Halococcus dombrowskii
species (Stan-Lotter et al., 2002) shared the properties
of being coccus-shaped nonmotile cells, positive cata-
lase, oxydase, gelatinase activities and nitrate reduction
as well as containing lipids PG, PGP-me and S-DGD1
but PGS. On the other hand, it was established that
CH8K and CH8B isolates, which were Gram-variable
and have colony pigmentations pink-red and white
respectively, could not ferment xylose or fructose sug-
ars and contained one undefined glycolipid in addition
to PG, me-PGP and S-DGD1. Meanwhile, the species
Halococcus dombrowskii was reported to be Gram-
negative, and to exhibit light red pigmentation and to
be able to use fructose and xylose (Stan-Lotter et al.,
2002). Except for colony pigmentation all other features
of CH8K and CH8B isolates were found to be the same.
It was reported that the number of insertion sequences
in the chromosomes of halophilic archaea was rather
high, and this caused a high frequency of spontaneous
mutations (DasSarma, 1993). Such a mutation might be
the cause of the difference in pigmentation of isolates
CH8K and CH8B.
It was established that strain CHA1 resembled Halo­
arcula argentinensis by the ratio of 99.2%. CHA1 and
H. argentinensis (Ihara et al., 1997) have Gram-negative
and motile cells and they exhibit oxydase and catalase
activities and can produce acid from fructose, maltose
and ribose. Moreover, they have TGD-2 as essential
glycolipid. However, unlike H. argentinensis, strain
CHA1 cannot produce acid from glucose, sucrose and
mannose. CHA1 strain differs from H. argentinensis by
having pleomorphic cell shape and DGD-1 in addition
to glycolipid TGD-2.
CH2, CH3 and CHC strains were clustered with
Halorubrum genus and their similarity to Halorubrum
saccharovorum species was found to be 98.8%, 98.9%
and 98.5%, respectively. Isolates CH2, CH3 and CHC
and H. saccharovorum share the properties of being rod
shaped motile cells, stained Gram-negative, strict aero-
bic growth, positive oxidase and catalase activity and
2
nitrate reduction (McGenity and Grant, 1996). They are
also alike by having S-DGD-3 glycolipid in addition to
essential phospholipids.
Isolate CH7 was determined to resemble Haloarcula
hispanica species to the rate of 99.5%. When phenotypi-
cal characteristics of CH7 isolate and H. hispanica (Juez
et al., 1986) species were compared, both strains were
found to have pleomorphic motile Gram-negative cells,
and positive nitrate reduction and nitrate gas formation
and that they could grow anaerobically in presence of
nitrate. Moreover, both strains were found to contain
TGD-2 glycolipid. On the other hand, isolate CH7 did
not exhibit gelatinase, caseinase and amylase activity,
whereas species H. hispanica is positive in gelatinase,
caseinase and amylase activity.
As a result, in the current study we have isolated
and characterized 8 different isolates from a salt mine
located in central Anatolia. The characterization of the
isolates was carried out using a polyphasic approach.
According to 16S rRNA sequential analysis, which is
one of the most determining molecular taxonomic
methods, these eight isolates were found to cluster in
four different genera which are Halobacterium, Halo­
coccus, Haloarcula and Halorubrum. The results pre-
sented herein may contribute to archaeal taxonomy,
particularly to halophilic archaeal species habituating
saltern cave environments.
Acknowledgements
Financial support from TUBITAK (Turkish Science and Tech­
no­logical Research Counsel)-Turkey and Research Council of Mus-
tafa Kemal University-Turkey is gratefully acknowledged.
Literature
Allen A.M., F. Goh; S. Leuko, A. Echigo, T. Mizuki, R. Usami,
M. Kamekura, B.A. Neilan and P. Burns. 2008. Haloferax elon­
gans sp. Nov. And Haloferax mucosum sp. Nov., isolated from micro-
bial mats from Hamelin Pool, Shark Bay, Australia. Int. J. Syst. Evol.
Microbiol. 58: 798–802.
Arahal D.R., F.E. Dewhirst, B.J. Paster, B.E Volcani and A. Ven-
tosa. 1996. Phylogenetic analyses of some extremely halophilic
archaea isolated from dead sea water, determined on the basis of
their 16 S rRNA sequences. Appl. Environ. Microb. 62: 3779–3786.
Birbir M., B. Calli, B. Mertoglu, E.R. Bardavid, A. Oren,
M.N. Ogmen and A. Ogan. 2007. Extremely halophilic archaea
from Tuz Lake, Turkey, and the adjacent Kaldirim and Kayacik
salterns. World J. Microbiol. Biotechnol. 23: 309–316.
Bonelo G., A. Ventosa, M. Megias and F. Ruiz-Berraquero. 1984.
The sensitivity of halobacteria to antibiotics. FEMS Microbiol. Lett.
21: 341–345.
Castillo A.M., M.C. Gutierrez, M. Kamekura, Y. Ma, D.A Cowan,
B.E. Jones, W.D. Grant and A. Ventosa. 2006. Halovivax asiaticus
gen. Nov., sp. Nov., a novel extremely halophilic archaeon isolated
from inner Mongolia, China. Int. J. Syst. Evol. Microbiol. 56: 765–770.
Castillo A.M., M.C. Gutierrez, M. Kamekura, Y. Xue, Y. Ma,
D.A Cowan, B.E. Jones, W.D. Grant and A. Ventosa. 2007. Haloru­
2 Halophilic archaea from salt mine in Turkey
brum ejinorense sp. Nov., isolated from lake Ejinor, inner Mongolia,
China. Int. J. Syst. Evol. Microbiol. 57: 2538–2542.
DasSarma S. 1993. Identification and analysis of the gas vesicle
gene cluster on an unstable plasmid of Halobacterium halobium.
Experientia 49: 482–486.
Dussault H.P. 1955. Am improved technique for staining red halo-
philic bacteria. J. Bacteriol. 70:484–485.
Dyall-Smith M. 2001. The halohandbook: protocols for halobacte-
rial genetics (4.5 version electronic publication).
Elevi R., P. Assa, M. Birbir, A. Ogan and A. Oren. 2004. Charac-
terization of extremely halophilic Achaea isolated from the Ayvalık
Saltern, Turkey. World J. Microbiol. Biotechnol. 20: 719–725.
Euzéby J.P. 2011. List of prokaryotic names with standing in nomen-
clature. Available at: http://www.bacterio.cict.fr/classifgenerafami-
lies.html#Halobacteriaceae. Accessed 09 September 2011.
Gruber C., A. Legat, M. Pfaffenhuemer, C. Radax, G. Weidler,
H.C. Busse and H. Stan-Lotter. 2004. Halobacterium noricense sp.
nov., an archaeal isolate from a bore core of an alpine Permian salt
deposit, classification of Halobacterium sp. NRC-1 as a strain of
H. salinarum and emended description of H. Salinarum. Extremo­
philes. 8: 431–439.
Hartmann R., H.D. Sickinger and D. Oesterhelt. 1980. Anaerobic
growth of halobacteria. Proc. Natl. Acad. Sci. USA 77: 3821–3825.
Hesselberg M. and R.H. Vreeland. 1995. Utilization of protein pro-
files for the characterization of halophilic bacteria. Curr. Microbiol.
31: 158–162.
Ihara K., S. Watanabe and T. Tamura. 1997. Haloarcula argentinen­
sis sp. nov. and Haloarcula mukohataei sp. nov., Two New Extremely
Halophilic Archaea Collected in Argentina. Int. J. Syst. Bacteriol.
47: 73–77.
Juez G., F. Rodriguez-Valera, A. Ventosa and D.J. Kushner. 1986.
Haloarcula hispanica spec. nov. and Haloferax gibbonsii spec. nov.,
two new species of extremely halophilic archaebacteria. Syst. Appl.
Microbiol. 8: 75–79.
Kamekura M. 1998. Diversity of extremely halophilic bacteria.
Extremophiles. 2: 289–295.
Kushner D.J. 1985. The Halobacteriaceae, pp. 171–214. In: Woese,
C.R. and R.S. Wolfe (eds). The bacteria a treatise on structure and
function Archaebacteria. Vol. III. New York, Academic Press.
Laemmli U.K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature. 227: 680–685.
Mancinelli R.L. and L.I. Hochstein. 1986. The occurrence of deni-
trification in extremely halophilic bacteria. FEMS Microbiol. Lett.
35: 55–58.
McGenity T. and W.D. Grant. 1996. Transfer of Halobacterium
saccharovorum, Halobacterium sodomonse, Halobacterium trapa­
nicum NRC 34021 and Halobacterium lacusprofundi to the genus
Halorubrum gen. nov., as Halorubrum saccharovorum comb. nov.,
117
Halorubrum sodomonse comb. nov., Halorubrum trapanicum comb.
nov., and Halorubrum lacusprofundi comb. nov. Syst. Appl. Microbiol.
18: 237–243.
Montalvo-Rodriguez R., J. Lopez-Garriga, H. Vreeland, A. Oren,
A. Ventosa and M. Kamekura. 2000. Haloterrigena thermotolerans
sp. nov., a halophilic archaeon from Puerto Rico. Int. J. Syst. Evol.
Microbiol. 50: 1065–1071.
Oren A. and H.G. Trüper. 1990. Anaerobic growth of halophilic
archaeobacteria by reduction of dimethylsulfoxide and trimethyl-
amine N-oxide. FEMS Microbiol. Lett. 70: 33–36.
Oren A., S. Duker and S. Ritter. 1996. The polar lipid composi-
tion of Walsby’s square bacterium. FEMS Microbiol. Lett. 138:
135–140.
Oren A., A. Ventosa and W.D. Grant. 1997. Proposed minimal
standarts for description of new taxa in the order Halobacteriales.
Int. J. Syst. Bacteriol. 47: 233–238 .
Oren A. and D.C. Litchfield. 1999. A procedure for the enrich-
ment and isolation of Halobacterium. FEMS Microbiol. Lett. 173:
353–358.
Oren A. 2000. Biological processes in the Dead sea as influenced by
short-term and long-term salinity changes. Arch. Hydrobiol. Spec.
Issues. Advanc. Limnol. 55: 531–542.
Oren A. and F. Rodriguez-Valera. 2001. The contribution of halo-
philic bacteria to coloration of saltern crystallizer ponds. FEMS
Microbiol. Ecol. 36: 123–130.
Ozcan B., C. Cokmus, A. Coleri and M. Caliskan. 2006. Char-
acterization of extremely halophilic archaea isolated from saline
environment in different parts of Turkey. Microbiology. 75: 739–748.
Ozcan B., G. Ozcengiz, A. Coleri and C. Cokmus. 2007. Diversity
of halophilic archaea from six distinct parts of Turkey. J. Microbiol.
Biotechnol. 17: 985–992.
Ozcan B., G. Ozyilmaz, C. Cokmus and M. Caliskan. 2009. Char-
acterization of extracellular esterase and lipase activities from five
halophilic archaeal strains. J. Ind. Microbiol. Biotechnol. 36: 105–110.
Pecher T. and A. Böck. 1981. In vivo susceptibility of halophilic
and mathanogenic organisms to protein synthesis inhibitors. FEMS
Microbiol. Lett. 10: 295–297.
Stan-Lotter H., M. Pfaffenhuemer, A. Legat, H.J. Busse, C. Radax
and C. Gruber. 2002. Halococcus dombrowskii sp. nov., an archaeral
isolate from a permian alpine salt deposit. Int. J. Syst. Evol. Microbiol.
52: 1807–1814.
Tamura K., J. Dudley, M. Nei and S. Kumar. 2007. MEGA4: Molec-
ular Evolutionary Genetics Analysis (MEGA) Software Version 4.0.
Mol. Biol. Evol. 24(8): 1596–1599.
Thompson J.D., D.G. Higgins and T.J. Gibson. 1994. Clustal In:
Improving the sensitivity of progressive multiple sequence align-
ment through sequence weighting positionspecific gap penalties and
weight matrix choice. Nucleic Acids Res. 22: 4673–4680.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 119–128

ORGINAL PAPER

Antagonistic Effects of Bacillus cereus Strain B-02 on Morphology,

Ultrastructure and Cytophysiology of Botrytis cinerea

FENG-XIA LI, HUI-QUAN MA*, JING LIU and CHAO ZHANG

School of Life Sciences, Shan Dong University of Technology, Zibo 255049, China

Received 22 November 2011, revised 1 March 2012, accepted 6 May 2012

Abstract

The study on antagonistic mechanism of biocontrol strains gives the premise and basis for efficient and stable biological control. This study
aimes to overcome of biocontrol agent in aspects of complicated and diversified mode of action, short-lasting and unstable efficacy in
the production processes. This study elucidated the antagonistic mechanism of Bacillus cereus strain B-02 on Botrytis cinerea by detecting
changes in morphology, ultrastructure and physiology in affected hyphae of Botrytis cinerea. Which provided certain theoretical and practi-
cal significance for biological control of gray mould caused by B. cinerea. B. cereus strain B-02 isolated from tomato rhizosphere mightily
suppressed gray mold in tomato caused by B. cinerea. Spore germination and hyphal growth of B. cinerea were inhibited by B. cereus strain
B-02. Changes of cell morphology such as distortion, shrinking and swelling were observed by SEM. TEM observation further indicated the
ultrastructural alterations of hyphae, including mitochondrion reduction, un-membranous inclusion in cytoplasm, considerable thickening
of cell walls, and electronic density enhancement. LSCM observation revealed the fluorescence intensity of nucleus DNA, mitochondrion
DNA and reactive oxygen radical in treated hyphae were all stronger than control and the difference was significant (P < 0.01). These results
indicated that the antagonistic effects of B. cereus strain B-02 on B. cinerea were likely due to a combination of abnormal synthesis of nucleus
DNA and mitochondrion DNA and multifarious ultrastructural alterations in hyphal cell.

K e y w o r d s:  B. cereus, B. cinerea, affected hyphae, antagonistic effect

Introduction a new microorganism in the environment but also may

Gray mould, caused by B. cinerea Pers. Ex. Fr., is
a severe and constant threat to field and greenhouses-
grown tomatoes in many countries worldwide (Emine
et al., 2010). Chemical control has become increasingly
difficult due to the development of resistant B. cinerea
strains as well as the increasing worldwide concern
about pesticide use due to environmental problems
(Saligkarias et al., 2002; Trotel-Aziz et al., 2008). Bio-
logical control using natural antagonistic microorgan-
isms has been extensively studied, and some fungi, and
bacteria have been demonstrated to be effective against
gray mold (Jae et al., 2006). A great number of reports
indicate that certain bacterial strains are beneficial for
the growth of plants, these are called plant growth-
promoting rhizobacteria (PGPR). An important trait
of these bacteria is their ability to maintain a stable rela-
tionship with the associated plant species (Smith and
Goodman, 1999; Miethling et al., 2000). Microorgan-
isms isolated from the rhizosphere are not only non-
exotic, thereby presenting no risk of proliferation of
be better adapted to that plant and therefore provide
better control of diseases than organisms originally iso-
lated from other plant species (Trotel-Aziz et al., 2008).
Biocontrol bacteria may protect plants against patho-
gens by bacteriostatic mode and bactericidal mode.
In tomato, much of research reported on the use
of the genus Bacillus to control gray mold, mainly
including Bacillus subtilis, Bacillus polymyxa, B. cereus,
Bacillus megaterium and Bacillus pumilis (Asaka et al.,
1996; Kavitha et al., 2005). Some strains of the genus
Bacillus have been reported as potential candidates
for biological control of fungal pathogens (Dik et al.,
1999; Du et al., 2004; Chen et al., 2004; Wang and Yang,
2004; Touré et al.,2004; Qi et al., 2005; Li et al., 2005;
Tang et al., 2005; He et al., 2006; Li and Jiang, 2006;
Yin et al., 2007). The genus Bacillus depends on a wide
variety of traits, such as the production by the strain
of various antibiotics and cell wall degrading enzymes
(protease, lipase, chitinase, and glucanase) to control
pathogen (Tang et al., 2005; Li and Jiang, 2006). Recently,
a  commercial biofungicide Serenade, which contains

*  Corresponding author: H.Q. Ma, No. 12 Zhangzhou Road, Zhangdian, Zibo, Shandong 255049, China; phone: 13864432562;
e-mail: mhqswp@sdut.edu.cn
120 Feng-Xia Li et al.
a  Bacillus subtilis strain (QST 713), was reported to
be effective against various pathogenic fungi (Trotel-
Aziz et al., 2008). Previous studies reported that the
biocontrol bacterium, B. cereus or its metabolite, can
inhibit hyphal growth of B. cinerea by alterations in the
hyphal morphology, and the formation and germina-
tion of B.  cine­rea spore. Recent studies have shown that
fermentation broth treatment of biocontrol bacteria
not only is effective in halting pathogen growth (Pusey
and Wilson, 1984; Janisiewicz, 1987; El-Ghaouth et al.,
1998; Jijakli and Lepoivre, 1998; Ippolito et al., 2000),
but also results in marked morphological changes,
structural alterations, and molecular disorganisation of
the fungal cells (Roze and Line, 1998; Kamisaka et al.,
1999; Wang et al., 2000; Yazgana et al., 2001; Lin and Li,
2003; Hagelina et al., 2004; Mendo et al., 2004; Sun et al.,
2005; Xie et al., 2005; Manteca et al., 2005; Leiter et al.,
2005). The objectives of this study were to (i) evaluate
inhibitory effects of B. cereus strain B-02 on spore ger-
mination and hyphal growth of B. cinerea; (ii) illustrate
ultrastructural alterations occurring in hyphal cells of
B. cinerea during interaction with B. cereus strain B-02
by scanning electron microscope (SEM) and transmis-
sion electron microscope (TEM) to elucidate the bio-
control mechanism; and (iii) visualize the molecular
standard of nucleus DNA, mitochondrion DNA and
reactive oxygen radical in the affected hyphae of B. cine­
rea by laser scanning confocal microscope (LSCM) to
predict the possible target of B. cereus strain B-02 on
Botrytis cinerea.
Experimental
Materials and Methods
Microorganisms. The pathogen B. cinerea used as
a cell material for ultrastructural and cytophysiologi-
cal study was isolated from infected tomato fruit in
Zibo, China. The bacterium, B. cereus strain B-02, was
originally isolated from the tomato rhizosphere and had
very strong inhibitory activity against B. cinerea.
Identification of B. cereus strain B-02. B. cereus
strain B-02 was identified through the analysis of
morphological and biochemical characteristics and
16S rDNA sequence in our previous experiment (Li
et al., 2007). Morphological characteristics of B. cereus
strain B-02 were represented after gram staining,
spore staining and imaged by Leica TCS-SP2 LSCM.
Characteristics of Bacillus from “Bergey’s Manual of
Determinative Bacteriology” was used to identify the
biochemical characteristics of B. cereus strain B-02.
Genome DNA of B. cereus strain B-02 was extracted
according to CTAB method and amplified by primers
63F and 1494R. B. cereus strain B-02 homology was
2
analyzed in NCBI by 16S rDNA sequence. We chose
a strain with the strongest inhibitory activity in our iso-
lation experiment by inhibition zone method for the
subsequent experiment.
Pretreatment of B. cereus strain B-02 fermenta-
tion broth. B. cereus strain B-02 was inoculated into
50 mL LB in a conical flask at 30°C, 140 r/min for 36 h.
The supernatant was filtered by microporous mem-
brane (0.22 μm, Ф25 mm) after centrifuging of B. cereus
strain B-02 fermentation broth at 4°C, 8000 r/min for
10 min. According to cylinder plate method B. cereus
strain B-02 filtrate was used to process B. cinerea
hyphae in the subsequent experiment. B. cinerea grown
on PDA supplemented with the same proportion of
sterile distilled water was used as a control. Each plate
was replicated 3 times.
Preparation of B. cinerea hyphal cell and spore sus-
pension. Interactions between B. cinerea and B. cereus
strain B-02 were studied by well test. Plates supple-
mented with B. cereus strain B-02 fermentation broth
at 1%, 5%, 10% and in the center of the plates ino­cu­
lated B. cinerea agar disks (Ф6 mm) were allowed to
grow at 28°C in the dark for 3~5 d, after which time
B. cinerea hyphae grown on PDA were harvested for
SEM, TEM and LSCM. For comparisons, controls
supplemented with the same proportion of ster-
ile distilled water were harvested from PDA plates
with only B. cinerea for SEM, TEM and LSCM visu-
alization, respectively. Each treatment was replicated
3 times and the experiment was repeated twice. B. cine­
rea spores were removed from 2-week-old PDA cul-
ture, and suspended in 5 mL of sterile distilled water
containing 0.05% (v/v) Tween 80. The spore suspen-
sion was filtered through 4  layers of sterile cheese
cloth to remove adhering hyphae and the concentra-
tion was adjusted using a hemocytometer prior to use
(Li et al., 2009).
Observation of B. cinerea hyphal growth and spore
germination. To assess the effects of B. cereus strain
B-02 fermentation broth on hyphal growth of B. cinerea,
B. cinerea agar disks (Ф6 mm) was placed in the center
of PDA plates containing B. cereus strain B-02 fermen-
tation broth at 1%, 5%, 10% at 28°C in the dark. Hyphal
growth was determined by measuring the colony diam-
eter after 3~5 d of inoculation. Controls were supple-
mented with the same proportion of sterile distilled
water. Each treatment was replicated 3 times and the
experiment was repeated twice. The effects of B. cereus
strain B-02 fermentation broth on spore germination
of B. cinerea were assessed according to Zhao (2003).
Mixture containing 400 μL LB fluid medium and 200 μL
B. cinerea spore suspension was added 200 μL B. cereus
strain B-02 fermentation broth at original concentra-
tion and cultivated at 28°C in the dark (Figure 1). The
experiment was replicated 3 times.
2 Antagonistic effects of B.cerreus on B. cinerea
SEM specimen preparation and observation.
Sample preparation and SEM observation were done
as described previously by Chen et al. (2007). Briefly,
hyphal samples excised from the 5-day-old culture of
B. cinerea treated with sterile distilled water and 10%
B. cereus strain B-02 fermentation broth were fixed in
2.5% glutaraldehyde at 4°C for 2 h, washed in phosphate
buffered saline (PBS) for 4 times (15 min each), soaked
in 1% osmium tetroxide at 4°C for 2.5 h, dehydrated in
a graded ethanol series (30%, 50%, 70%, 80%, 90%, and
100%) (10 min each), metathesized in isoamyl acetate
for 25 min, hexanenitrile-dried and sputter-coated with
gold in vacuum. Micrographs were taken by a Hitachi
H-800 SEM. This experiment was repeated 3 times and
each treatment was also replicated at least 3 times.
TEM specimen preparation and observation.
High-resolution images of hyphal cellular changes in
10% B. cereus strain B-02 fermentation broth treated
samples were obtained by a Hitachi H-800 TEM. Sam-
ple preparation was according to Chen et al. (2004).
Hyphal samples excised from the 5-day-old culture
of B. cinerea were fixed in 3% glutaraldehyde at 4°C
for 2 h. The samples were then thoroughly rinsed with
0.1 mol PBS (pH7.2) for 3 times (10 min each), post-
fixed with osmium tetroxide at 4°C for 1 h and rinsed
with PBS again. Samples were then dehydrated in
a graded ethanol series (50%, 70%, and 90%) and 100%
acetone for 3 times (10 min each), embedded with Epon
812 and polymerized at 60°C for 24 h. Ultra-thin sec-
tions (80 nm thickness) were cut with a diamond knife
(LKB-V, LKB Company, Sweden) and stained with 2%
uranylacetate for 30 min. Then samples were washed
with PBS and sections were stained with lead citrate for
30 min. The control group was treated with the same
procedure. This experiment was repeated 3 times and
each treatment was also replicated at least 3 times.
LSCM specimen preparation and observation.
Hyphal samples excised from the 5-day-old culture
of B. cinerea treated with B. cereus strain B-02 fer-
mentation broth at 1%, 5% and 10% were successively
stained with 0.1% AO (Sigma) for 30 min, 10 μg/mL
Rhodamine 123 for 40 min, 5 μg/mL DCFH-DA for 1 h
and rinsed with PBS (pH 7.4) (Kamisaka et al., 1999;
Manteca et al., 2005; Leiter et al., 2005). Samples of
DNA and reactive oxygen signed were excited by the
488 nm excitation wavelength with Ar ion laser, the
excitation wavelength of samples mitochondrion signed
was 514 nm. Hyphae were dealt from the control group
by the same method. This experiment was repeated
3 times and each treatment was also replicated at least
3 times. Representative images taken by Leica TCS-SP2
LSCM were presented here. The means and standard
deviations of hyphal cellular fluorescence intensity were
calculated. T-test was used to analysis the difference
between experimental group and control group.
121
Results
Identification of B. cereus strain B-02. In this study we
isolated five strains in total having inhibitory activity
against B. cinerea. The inhibitory activity of B. cereus
strain B-02 was the strongest (Table I). Therefore
B. cereus strain B-02 was used in the following experi-
ment. Values in Table I like ± 1.5 mean standard devia-
tion (SD). So are values in Table III. Observation of
morphological characteristics revealed that B. cereus
strain B-02 was rod shape, had flagella, could move,
had elliptical heatproof spora, were Gram-positive
under the light microscope and LSCM (Fig. 1). The
biochemical characteristics of B. cereus strain B-02
were described in the Table II. B. cereus strain B-02 was
Table I
Inhibition of the five Bacillus strains on Botrytis cinerea
Strain Inhibition zone (mm) Inhibitory rate (%)
B-02 17.0 ± 1.5 81.6a
B-04 14.0 ± 2.0 60.9b
B-01 11.0 ± 1.5 55.2b
B-07 9.0 ± 2.0 44.1c
B-03 6.0 ± 1.0 43.5c
Note: χ2 test, 5% significance of difference
Table II
Partial biochemical characteristics of the five Bacillus strains
Strain B-01 B-02 B-03 B-04 B-07
Shape rod rod rod rod rod
Spore + + + + +
Gram staining + + + + +
Moveability + + + + +
15°C cultivation + + + + +
50°C cultivation + + + + +
pH5.7 cultivation + + + + +
Anaerobic cultivation + + + + –
Catalase + + + + +
Glucose ++ ++ ++ ++ +
Sucrose ++ ++ ++ ++ +
Lactose – – – – –
Fructose + + + + +
Xylose – – – – +
Arabinose – – – – +
V.P experiment – – – – +
M.R experiment + + + + +
Indole experiment – – – – –
H2S experiment + + + + ++
Gelatin liquefaction + + + + –
Amylolysis + + + + –
Note: +, positive; –, negative
122 Feng-Xia Li et al. 2

Fig. 1.  The comparison of antagonistic activity of Bacillus cereus strain B-02 fermentation broth (0.22 μm) in different dilute multiple
(a) control, (b) strain B-02 fermentation broth in dilute multiple of 1:100, (c) strain B-02 fermentation broth in dilute multiple of 1:20, (d) strain B-02
fermentation broth in dilute multiple of 1:10

Fig. 2.  Effect of Bacillus cereus strain B-02 fermentation broth on the germination of Botrytis cinerea spores

99% homologous to B. cereus by 16S rDNA sequence
analysis. In the evolutionary, the phylogenetic tree of
the five strains also indicated that B. cereus strain B-02
closed to B. cereus (Fig. 2). All the evidence, including
analysis of morphological characteristics, biochemical
characteristics and 16S rDNA sequence, showed that
B. cereus strain B-02 belonged to B. cereus.
Effects of B. cereus strain B-02 fermentation broth
on hyphal growth and spore germination of B. cine-
rea. Table III showed that B. cereus strain B-02 fermen-
tation broth at different concentrations inhibited mark-
edly hyphal growth of B. cinerea. The inhibitory rate of
B. cinerea treated with 10% B. cereus strain B-02 fer-
mentation broth was up to 33.7%. When B. cereus strain
B-02 fermentation broth was diluted to 100 times, its
inhibitory action almost disappeared. Fig. 3 showed
that the control group, normal hyphal morphology,
the rapid speed of hyphal growth, flat and off-white
colony, compared with the experimental group. The
experimental group was just the reverse. The higher
the concentration of B. cereus strain B-02 fermentation
broth was, the heavier the hyphal colour was.
B. cinerea spores untreated with B. cereus strain B-02
fermentation broth germinated normally and B. cine­
rea hyphae were slim and uniform after 12 h by the
light microscope (Fig. 4a). Even after 48 h the germi-
nation of B. cinerea spores was still normal. B. cinerea
spores treated with B. cereus strain B-02 fermentation
broth germinated partially and the germinal germ tube
appeared distorted after 12 h (Fig. 4b and 4c).

Table III
Inhibition of Bacillus cereus strain B-02 fermentation broth on Botrytis cinerea

Dilute 2d 3d 4d 7d
multiple MD IRM MD IRM MD IRM MD IRM
  10 21.0 ± 2.2 33.7a 33.6 ± 1.4 28.5a 42.6 ± 0.9 25.3a 50.8 ± 2.7 24.8a
  20 23.8 ± 2.6 21.0a 37.0 ± 3.9 19.7a 43.4 ± 0.8 24.2a 53.8 ± 2.3 19.8a
100 28.1 ± 1.6   2.2b 44.4 ± 1.8   0.7b 54.6 ± 1.1   0.8b 65.3 ± 1.5   0.42b
CK 28.6 ± 1.4 44.6 ± 1.2 55.0 ± 1.2 65.5 ± 0.8

MD (mm): Colony diameter; IRM (%): Inhibitory rate

Note: χ2 test, 5% significance of difference
2 Antagonistic effects of B.cerreus on B. cinerea 123

Fig. 3.  Scanning electron micrographs of Botrytis cinerea hypha treated and untreated with Bacillus cereus strain
B-02 fermentation broth (×5000) a, b, c, d: untreated normal hypha (arrows)
e, f, g: strongly destroyed hypha (arrows); h: distorted and collapsed hypha (arrow)

Fig. 4. Untreated hyphal cell con-

figuration of Botrytis cinerea under
transmission electron micrographs
(×5000) A, B: normal cell section
M: mitochondrion; N: nucleus; ER: endo-
plasmic reticulum; CW: cell wall; a: con-
tinuous outer surface layer around the
hyphal cell wall (CW). Treated hyphal
cell configuration of Botrytis cinerea
under transmission electron micrographs
(×5000) C, D, E, F: The treated hyphal
cell configuration was destroyed and
there was a lot of un-membrane material
in cell. M: mitochondrion; N: nucleus;
C: vacuole; U: un-membrane material;
a: continuous outer surface layer around
the hyphal cell wall (CW); d: heavily
stained material
124 Feng-Xia Li et al.
Effects of B. cereus strain B-02 fermentation broth
on hyphal ultralstructure of B. cinerea. The external
features of B. cinerea hyphae untreated with B. cereus
strain B-02 fermentation broth were slim, uniform
and smooth by the SEM (Fig. 5A, 5B, 5C, and 5D). The
treated hyphae were destroyed strongly and the external
structures were incomplete (Fig. 5E, 5F, and 5G). Part of
the treated hyphae were even distorted, malformed and
collapsed (Fig. 5H). The cell nucleus and mitochondrion
of the untreated hyphal cell were normal, uniform and
clear by the TEM (Fig. 6A and 6B). There was a continu-
ous outer surface layer around the hyphal cell wall and
no extravasation outer the hyphal cell wall (Fig. 6A).
Part of the treated hyphal cell mitochondrion disap-
peared crista and its number decreased. The cell nucleus
was not obvious and the unknown un-membranous
material appeared in cell (Fig. 6C and 6D). Comparing
with the untreated hyphal cell wall (Fig. 6A and 6B),
the treated hyphal cell wall was thickened irregularly
(Fig. 6E). There was a lot of un-membrane material in
cell (Fig. 6D and 6E). Heavily stained material occurred
out of the treated hyphal cell wall (Fig. 6E and 6F) and
the electronic density of partial treated hyphal cell
increased (Fig. 6F).
Effects of B. cereus strain B-02 fermentation broth
on the hyphal cell DNA content of B. cinerea. The
DNA fluorescence intensity of the treated hyphae
with B. cereus strain B-02 fermentation broth at dif-
2
Fig. 5.  Laser scanning confocal
micrographs (LSCM) of Botrytis
cinerea hypha treated and untreated
with Bacillus cereus strain B-02 fer-
mentation broth (×1000)
(A) untreated hyphal cell DNA configu-
ration under LSCM; (B) treated hyphal
cell DNA configuration under LSCM.
Bars = 30 μm.
ferent concentration was obviously lower than that of
the untreated hyphae by LSCM (Fig. 7A and 7B). The
fluorescence intensity values of the treated hyphal cell
DNA were 80.90 ± 15.71, 109.74 ± 25.64, 119.8 ± 27.11
with the different concentration of B. cereus strain B-02
fermentation broth (× 10, × 20, × 100), respectively.
The fluorescence intensity value of the untreated hyphal
cell DNA was 153.89 ± 24.52. All the values of experi-
mental group were lower than that of the control group
and the difference was significant between the two
groups (P < 0.01). The reduction of the treated hyphal
cell DNA content showed that the normal synthesis of
DNA was disturbed.
Effects of B. cereus strain B-02 fermentation broth
on hyphal cell mitochondrial membrane potential of
B. cinerea. Comparison of the control group and exper-
imental group showed that the fluorescence intensity of
the control group was stronger than that of the experi-
mental group and the control group was more uni-
form staining than the experimental group by LSCM
(Fig. 8A and 8B). The fluorescence intensity values of
mitochondrion DNA in the treated hyphal cells were
72.70 ± 27.03, 82.18 ± 26.49, 97.40 ± 29.89 with the differ-
ent concentration of B. cereus strain B-02 fermentation
broth (× 10, × 20, × 100), respectively. The fluorescence
intensity value of the control group was 108.35 ± 28.59
and the difference was significant between the two
groups (P < 0.01). So B. cereus strain B-02 fermentation
2 Antagonistic effects of B.cerreus on B. cinerea 125

Fig. 6.  Laser scanning confocal

micrographs (LSCM) of Botrytis
cinerea hypha treated and untreated
with Bacillus cereus strain B-02
fermentation broth (×1000)
(A) untreated hyphal cell mitochon-
drion configuration under LSCM;
(B) treated hyphal cell mitochondrion
configuration under LSCM. Bar, 7.5 μm

Fig. 7.  Laser scanning confocal

micrographs (LSCM) of Botrytis
cinerea hypha treated and untreated
with Bacillus cereus strain B-02
fermentation broth (×1000)
(A) Fluorescence micrograph of
untreated hypha showing reactive oxy-
gen standard (ROS); (B) Fluorescence
micrograph of treated hypha showing
ROS. Bar, 15 μm
126 Feng-Xia Li et al.
broth could result in the reduction of B. cinerea hyphal
cell mitochondrial membrane potential.
Effects of B. cereus strain B-02 fermentation broth
on hyphal cell reactive oxygen standard of B. cinerea.
The fluorescence intensity of the hyphal cell reactive
oxygen standard was obviously lower than that of the
control group by LSCM (Fig. 9A and 9B). The fluo-
rescence intensity values of the treated hyphae were
44.45 ± 13.49, 50.01 ± 19.89, 53.67 ± 15.19 with the dif-
ferent concentration of B. cereus strain B-02 fermen­
tation broth (× 10, × 20, × 100), respectively. The fluo­-
rescence intensity value of the control group was
75.42 ± 17.78 and the difference was significant between
the two groups (P < 0.01). The reason why the hyphal
cell reactive oxygen standard of the experimental group
was higher than that of the control group was that
the hyphal metabolism and its growth speed became
slowly caused by the increase of the hyphal cell reactive
oxygen standard.
Discussion
The antagonistic mechanism was studied at the level
of cell morphology and cell physiology. Certain con-
centration of B. cereus strain B-02 fermentation broth
resulted in abnormal germination of B. cinerea spores
and distorted hyphae. The configuration of hyphal cell
treated with B. cereus strain B-02 fermentation broth was
destroyed and there were a lot of un-membranous mate-
rial and vacuoles in cell. Fluorescence intensity of the
treated cell and that of the control group was different
significantly. Heavily stained material occurred out of
the treated hyphal cell wall. We inferred that the mem-
brane permeability of the treated cell was influenced
and then the cytoplasm leaked and gathered as a result
(Huang et al., 2007). The B. cinerea hyphal cell treated
with B. cereus strain B-02 fermentation broth didn’t col-
lapse or die directly. The changes of the treated hyphal
cell may be a result of indirect effects or comprehensive
effects of multiple factors by B. cereus strain B-02 fer-
mentation broth. The relationship between the effects of
the chemical bactericide (e.g. triadimenfon) to hyphal
external feature was related to its action mechanism
closely. The main action mechanism of chemical bac-
tericide was to make hyphae swollen or distorted, and
influence the formation of fungal cell wall (Huang et al.,
2007; Chen et al., 2007). It was obvious that the effects of
B. cereus strain B-02 fermentation broth on the hyphal
feature and ultrastructure were different from that of the
chemical bactericide. The treated hyphal cell configura-
tion was changed especially in cell nucleus, mitochon-
drion, and so on. Which provided morphological basis
for the study on antagonistic mechanism of beneficial
microorganisms against fungal pathogen.
2
Mitochondrion, a sensitive organelle in cell, was
damaged quite easily and revealed the damaged degree
of cell. It was related to the production of oxygen radical
and cell apoptosis. The mitochondrion was abnormal,
so was the whole cell. Mitochondrial membrane poten-
tial, the main part of mitochondrial electrochemistry
gradient, reflected the configuration of inner mitochon-
drial membrane. Mitochondrial membrane potential
decrease indicated the configuration of inner mitochon-
drial membrane was changed and the permeability of
it increased (Cortopassi and Wong, 1999). Studies also
showed that the descent of mitochondrial membrane
potential was one of the important indicators in early
cell apoptosis and indicated the cell would access the
irreversible process of cell apoptosis. The mitochondrial
membrane potential and DNA content in this study
decreased markedly. Which indicated B. cereus strain
B-02 might cause the alteration of mitochondrial mem-
brane configuration and hyphal cell apoptosis in further.
Reactive oxygen, including superoxide radical, hydro­-
gen peroxide, hydroxy radical, and so on, was one of the
main factors inducing cell apoptosis (Shi et al., 2002).
Above 95% reactive oxygen radical from respiratory
chain of mitochondrion in our bodies played an impor-
tant role in cell signal regulation. Nevertheless, exces-
sive reactive oxygen would attack the mitochondrion
by oxidation (Factor et al., 2000). The cause and effect
relationship between the reactive oxygen and mito-
chondrion was a common mechanism of cell apoptosis
inducing factors. In this study the reactive oxygen stan-
dard of treated hyphal cell decreased obviously. Because
the normal physiological activity of hyphae was dam-
aged and the reactive oxygen standard measured might
be of the damaged hyphae.
From the above, the synthesis of DNA, mitochon-
drial membrane potential and reactive oxygen quantity
of B. cinerea hyphae were greatly influenced by B. cereus
strain B-02 fermentation broth. So we draw a conclusion
that B. cereus strain B-02 against B. cinerea may act on
DNA and mitochondrion firstly. Further the physiologi-
cal and biochemical process of hyphal cell is influenced
and even cell apoptosis is induced. Which lead to hyphal
growth slowly eventually. HPLC-MS, which would cer-
tainly have provided new and interesting information,
concerning the presence of bacteriocins, toxins and
other metabolites produced by B. cereus in the experi-
mental conditions. What metabolites of B. cereus strain
B-02 fermentation broth might be responsible for the
changes produced. So the chemical analysis of B. cereus
strain B-02 fermentation broth will be performed on the
supernatant met by HPLC-MS in future.
Acknowledgements
This work was realised as project supported by Fund of Shan-
dong Natural Sciences, ZR 2011CL006.
2 Antagonistic effects of B.cerreus on B. cinerea
Literature
Asaka O. and M. Shoda. 1996. Biocontrol of Rhizoctonia solani
damping-off of tomato with Bacillus subtilis RB-14. Applide and
Environmental Microbiology 62: 4081–4085.
Chen L., G.J. Tan and K.J. Ding. 2004. Inhibiting effect of Bacillus
subtilis on four Botrytis cinerea. Journal of Fungal Research 2: 44–47.
Chen A.L., M.J. Feng and J.T. Feng. 2007. Effects of propamidine
on mycelial morphology and ultrastructure of Botrytis cirerea. Sci­
entia Agricultura Sinica 40: 633–637.
Cortopassi G.A. and A. Wong. 1999. Mitochondria in organismal
aging and degeneration. Biochimica et Biophysica Acta 1410: 183–193.
Du L.X., S.L. Feng and K.Q. Cao. 2004. Study on biological control
of B. cinerea by Bacillus subtilis strains BS-208 and BS-209. Chinese
Journal of Pesticide Science 6: 37–42.
Dik A.J., G. Koning and J. Köhl. 1999. Evaluation of microbial
antagonists for biological control of B. cinerea stem infection in
cucumber and tomato. European Journal of Plant Pathology 105:
115–122.
Emine M.S., K. Sener K. and S. Soner. 2010. In vitro and in vivo
antifungal activities of the essential oils of various plants against
tomato grey mould disease agent Botrytis cinerea. International Jour­
nal of Food Microbiology 143: 183–189.
El-Ghaouth A., C.L. Wilson and M.Wisniewski. 1998. Ultrastruc-
tural and cytochemical aspects of the biological control of B. cinerea
by Candida saitoana in apple fruit. Biological Control 88: 283–291.
Factor V.M., D. Laskowska and M.R. Jensen, J.T. Woitach, N.C.
Popescu and S.S. Thorgeirsson. 2000. Vitamin E reduces chromo-
somal damage and inhibits hepatic tumor formation in a transgenic
mouse model. Proceedings of the National Academy of Sciences of the
United States of America 97: 2196–2201.
He Y.J., H.M. Liu and H.B. Hu. 2006. Isolation and characteriza-
tion of a new Pseudomonas strain against Phytophthora capsici. Acta
Microbiologica Sinica 46: 516–521.
Huang L.L., Z.S. Kang and Q.M. Han. 2007. Effects of fungicide
triadimefon on development of Curvularia lunata in vitro. Myco­
systema 26: 226–233.
Han Q.M., Z.S. Kang, L.L. Huang and J. Zhao. 2005. Cytolo­-
gical studies of effects of tebuconazole on infection process of Fusar­
ium graminearum on wheat spikes. Acta Phytopathologica Sinica
32: 57–62.
Hagelina G., I. Ouliea and Å. Raknesa. 2004. Preparative high-
performance liquid chromatographic separation and analysis of
the Maltacine complex – a family of cyclic peptide antibiotics from
Bacillus subtilis. Journal of Chromatography B 811: 243–251.
Ippolito A., A. El-Ghaouth and C.L. Wilson. 2000. Control of
postharvest decay of apple fruit by Aureobasidium pullulans and
induction of defense responses. Postharvest Biology and Technolog.
19: 265–272.
Jae P.L., L. Seon-Woo, S.K. Choul, H.S. Ji, H.S. Ju, Y.L. Kwang,
J.K. Hyun, J.J. Soon and J.M. Byung. 2006. Evaluation of formula-
tions of Bacillus licheniformis for the biological control of tomato
gray mold caused by Botrytis cinerea. Biological Control 37: 329–337.
Janisiewicz W.J. 1987. Postharvest biological control of blue mold
on apples. Phytopathology 77: 481–485.
Jijakli M.H. and P. Lepoivre. 1998. Characterization of an exo-
1,3-glucanase produced by Pichia anomala strain antagonist of
B. cinerea on apples. Biological Control 88: 335–343.
Kavitha S., S. Senthilkumar, S. Gnanamanickam, I. Mohammed,
and J. Rajadas. 2005. Isolation and partial characterization of anti-
fungal protein from Bacillus polymyxa strain VLB16. Process Bio­
chemistry 40: 3236–3243.
Kamisaka Y., N. Noda and T. Sakai. 1999. Lipid bodies and lipid
body formation in an oleaginous fungus, Mortierella ramanniana
var. angulispora. Biochimica et Biophysica Acta 1438: 185–198.
127
Li H.B., J. Peng and Y. Bao. 2005. Preliminary studies on isolation
and screening of Fluorescent Pseudomonas spp. for biocontrol sclero-
tinia sclerotiorum. Chinese Agricultural Science Bulletin 21: 334–337.
Li W.J. and R.B. Jiang. 2006. The isolation and characteristic analy-
sis of antagonistic substances produced by Brevibacillus laterosporus
X10. Journal of Biology 23: 16–19.
Leiter E., H. Szappanos and C. Oberparleiter. 2005. Antifungal
protein PAF severely affects the integrity of the plasma membrane
of Aspergillus nidulans and induces an apoptosis-like phenotype.
Antimicrob Agents Chemother 49: 2445–53.
Lin F.C. and D.B. Li. 2003. Cell-lyric effect of Bacillus subtilis on
plant fungal pathogens; Acta Phytopathologica Sinica 33: 174–177.
Li G.X., H.Q. Ma, J. Liu and J. Dong. 2007. Identification and
inhibitory research of antagonistic bacteria against Botrytis cinerea.
Shandong Agricultural Sciences 2: 69–72.
Li Y.C., X.J. Sun, Y. Bi, Y.H. Ge and Y. Wang. 2009. Antifungal
activity of chitosan on Fusarium sulphureum in relation to dry rot
of potato tuber. Agricultural Sciences in China 8: 597–604.
Li Y., X.P. Zhang and K.Q. Zhang. 2005. Optimization of Conditions
on Submerged Fermentation of B. cereus. Microbiology 32: 45–49.
Liu J.G., Y. Pei, W. Cong and Y.F. Ou. 2001. Studies on fer­men­ta­
tion conditions of B. cereus strain S1. Industrial Microbiology 31: 4–7.
Miethling R., G. Wieland, H. Backhaus and C.C. Tebbe. 2000.
Variation of microbial rhizosphere communities in response to crop
species, soil origin, and inoculation with Sinorhizobium melilotiL33.
Microb Ecol. 40: 43–56.
Manteca Á., M. Fernández and J. Sánchez. 2005. A death round
affecting a young compartmentalized mycelium precedes aerial
mycelium dismantling in confluent surface cultures of Streptomyces
antibioticus. Microbiology 151: 3689–3697.
Mendo S., N.A. Faustino and A.C. Sarmento. 2004. Purification
and characterization of a new peptide antibiotic produced by a ther-
motolerant Bacillus licheniformis strain. Biotechnology Letters 26:
115–119.
Pusey P.L. and C.L. Wilson. 1984. Postharvest biological control of
stone fruit brown rot by Bacillus subtilis. Plant Disease 68: 753–756.
Qi D.M., M. Hui and Q.M. Liang. 2005. Postharvest Biological
Control of Blue Mold and Black Spot on Appale-Pear (Pyrus Brest-
schneideri Rehd) Fruit by Bacillus Subtilis H110. Chinese Journal of
Applied and Environmental Biology 11: 171–174.
Roze L.V. and J.E. Line. 1998. Lovastain triggers an apoptosis-like
cell death process in the fungus Mucor racemosus. Fnugal Genet
Biol. 25: 119–133.
Saligkarias I.D., F.T. Gravanis and H.A.S. Epton. 2002. Biological
control of B. cinerea on tomato plants by the use of epiphytic yeasts
Candida guilliermondii strains 101 and US 7 and Candida oleophila
strain I-182:I.in vivo studies. Biological Control. 25: 143–150.
Smith K.P. and R.M. Goodman. 1999. Host variation for interac-
tions with beneficial plant-associated microbes; Annu Rev Phyto­
pathol. 37: 473–491.
Shi G.P., H.X. Du and Z.W. Liu. 2002. Effects of Hydrogen Peroxide
on Producing Intracellular ROS of WB-344 Rat Liver Epithelial Cell.
Acta Biophysica Sinica 18: 462–466.
Tang L.J., Z.L. Ji and J.Y. Xu. 2005. Mechanisms of action to B. cine­
rea and antimicrobial substance of Bacillus licheniformis W10.
Chinese Journal of Biological Control. 21: 203–205.
Touré Y., M. Ongena and P. Jacques. 2004. Role of lipopeptides
produced by Bacillus subtilis GA1 in the reduction of grey mould
disease caused by B. cinerea on apple. Journal of Applied Microbio­
logy 96: 1151–1160.
Trotel-Aziz P., M. Conderchet, S. Biagianti and A. Aziz. 2008.
Characterization of new bacterial biocontrol agents Acinetobacter,
Bacillus, Pantoea and Pseudomonas spp. mediating grapevine resis-
tance against Botrytis cinerea. Environmental and Experimental
Botany 64: 21–32.
128 Feng-Xia Li et al.
Wang G. and Z.W. Yang. 2004. Inhibitory action of Pseudomonas
fluorescens P2-5 strain to Gaeumannomyces graminis var.tritici;
Plant Protection 30: 32–34.
Wan D.H., Z.J. Wu and Deng Y.L. 2006. Factors Affecting Produc-
tion of Antagonistic Substance by Bacillus subtilis B75, a Potential
Biocontrol Agent against Tobacco Brown Spot; Chinese Journal of
Biological Control. 22: 244–247.
Wang L.D., Guo D.A. and Yuan L. 2000. Antifungal effect of Three
Natural Products on the Genetic Substance of Saccharomyces Cere-
visiaegl and Pototheca Wckerhamii. Acta Phytopathologica Sinica
35: 860–863.
Xie X.M., K. Long and Y. Xu. 2005. Effect of cinnamaldehyde and
citral on DNA and RNA in Aspergillus flavus and A. fumigatus cells.
Chinese Traditional and Herbal Drugs. 36: 558–560.
2
Yin J.F., W.H. Zhang and J.Q. Li. 2007. Screening and antagonistic
mechanism of biocontrol agents against pepper Phytophthora blight.
Acta Phytopathologica Sinica 37: 88–94.
Yazgana A., G. Özcengiza and E. Özcengizb. 2001. Bacilysin bio-
synthesis by a partially-purified enzyme fraction from Bacillus sub­
tilis. Enzyme and Microbial Technology 29: 400–406.
Zhao D.L., L.Z. Zeng and H. Li. 2006. Fermentation of Bacillus
polymyxa JW-725 and preliminary extraction of the antifungal sub-
stances. Plant Protection 32: 47–50.
Zhao J.H. 2003. The study of the biocontrol activity against B. cine­
rea by Bacillus subtilis 728 isolated from marine environment. Doc-
toral Dissertation.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 129–135

ORGINAL PAPER

Ultrastructure of Candida albicans Pleomorphic Forms:

Phase-Contrast Microscopy, Scanning and Transmission Electron Microscopy

Monika Staniszewska1*, Małgorzata Bondaryk1, Katarzyna Siennicka2

and Wiesław Kurzątkowski1

National Institute of Public Health-National Institute of Hygiene, Warsaw, Poland

1 

2 
Warsaw University of Life Sciences, Poland

Received 13 November 2011, revised 30 January 2012, accepted 9 February 2012

Abstract

A modified method of glutaraldeyde-osmium tetroxide fixation was adjusted to characterize the ultrastructure of Candida albicans pleo-
morphic forms, using phase-contrast microscopy, scanning electron microscopy and transmission electron microscopy. The discovered
morphological criteria defining the individual morphotypes are discussed in terms of mycological and histopathological diagnostics of
candidiasis. The relations are discussed between fungal pleomorphism, virulence and susceptibility of different morphotypes to fungicides.

K e y w o r d s: Candida albicans, diagnostics, morphotypes, ultrastructure

Introduction Melchinger, 2006) and therefore for this yeast a novel

Candida albicans exists in different morphotypes.
From the evolutionary point of view the round blasto-
conidia are adjusted to a fluid medium where the round
single cells can be easily disseminated through micro
streaming. On the contrary, the mycelium building true
hyphae and pseudohyphae are adjusted to grow into
solid and half solid substrates. All these morphotypes
are adaptations to maximal exploitation of nutrition
elements from fluid and solid substrates (Müller and
Melchinger, 2006). On the other hand, these morpho­
types are also related to virulence and fungicidal resis-
tance of C. albicans clinical isolates (Salfelder et al., 1990;
Kurzątkowski et al., 2010; Staniszewska et al., 2010).
Candida albicans is an opportunistic pathogen
(Okawa et al., 2007; Raška et al., 2007; Netea et al., 2008;
Nguyen et al., 2011). This fungus exist in few morpho-
logical phenotypes, which are genetically determined
and therefore the exactly defined criteria of these
morphotypes will provide important attributes in the
mycological and histopathological diagnostics of can-
didiasis. At present, ultrastructural attributes of these
morphotypes should be completed. So far released pub-
lications suggest that the extremely thick and compact
cell wall of C. albicans prevents the cytoplasm fixation
hampering the ultrastructure presentation (Müller and
and better adjusted method should be employed.
This experimental study was designed to provide
some exact ultrastructural criteria defining C. albicans
morphotypes using a novel modified method of glutar-
aldehyde-osmium tetroxide fixation.
Experimental
Material and Methods
Strain. The Candida albicans 82 clinical strain exam-
ined in this experimental program was isolated from
a  blood sample taken from a three-years-old child
treated for an ependymoma anaplasticum. The strain was
identified using: CHROMagar Candida (BioMèrieux)
(Staniszewska et al., 2011b), API23C AUX (BioMèrieux,
Lyon, Marcy-l’ Etoile, France) (Staniszewska et al., 2011a)
and genetic procedures (in preparation). The investigated
strain created pleomorphic cells viable under phase-
contrast microscopy (Docuval, Carl Zeiss, Jena) (Sta­ni­­-
szewska et al., 2011a), scanning electron microscopy
(SEM Quanta-200, FEI, Czech Republic) (Kurzątkowski
et al., 2010; Staniszewska et al., 2011b) and transmission
electron microscopy (TEM Zeiss EM LIBRA 120, Carl
Zeiss, Germany) (Kurzątkowski et al., 2010).

* Corresponding author: M. Staniszewska, Division of Epidemiology and Microbiology, National Institute of Public Health-National Insti-
tute of Hygiene, Chocimska 24, Warsaw 00-791, Poland; phone: + 48 22 542 1228; fax: + 48 22 849 7484; e-mail: mstaniszewska@pzh.gov.pl
130 Staniszewska M. et al.
Induction of blastoconidial forms in YEPD
medium. A single colony of blastoconidia grown on
Sabouraud medium was inoculated in 5 ml of YEPD
(Ness et al., 2010) liquid medium (pH 5.7) and the cul-
ture was incubated at 30°C for 18 h (stationary phase)
to a final concentration of: 1.5 × 107 CFU ml–1, estimated
using the Thomas Chamber under a phase-contrast
microscopy.
Induction of pseudohyphae in 5% human serum.
The human serum was obtained from healthy volun-
teers (Institute of Hematology and Transfusion Medi-
cine in Warsaw) as a kind gift from Ph.D. G. Smoleńska-
Sym. The serum was filtered using Millex filter with
0.45 μm millipore membrane (Millipore, Carrigtwohill,
Ireland). The filtered serum was diluted with sterile
distilled water to a final concentration of 5%. Fifty μl
of blastoconidial cells (stationary phase) of the strain
C. albicans 82 grown on YEPD medium were added
to Eppendorf vials containing diluted human serum
(500 μl, pH 8.0–8.2). To examine the transfer of blasto-
conidia into pseudohyphae incubation was conducted
at 37°C for 48 h.
Induction of germ tubes and true hyphae in undi-
luted human serum. Fifty μl of blastoconidial cells
(stationary-phase) of the analysed strain C. albicans
82 grown on YEPD medium were added to Eppen-
dorf vials containing filtered undiluted human serum
(500 μl, pH 7.1–7.4). To examine the transfer of blas-
toconidia into filaments, incubation was conducted at
37°C for the following period: 1–18 h.
Phase-contrast microscopy. Pleomorphic cells were
washed once with sterile water and then suspended in
500 µl of water. Ten µl of the suspension were pipetted
onto slide and a coverslip was placed over the sample,
and then examined under the phase-contrast micro­s-
copy (Staniszewska et al., 2011a).
Transmission and scanning electron micro­
copy. Blastoconidia, germ tubes, pseudohyphae and
true hyphae (5 ml of cultures) were harvested by cen-
trifugation at 1600 g for 5 min (MPW-360; Mechanika
Precyzyjna, Warsaw, Poland). The pellets were used
to prepare samples for transmission electron micros-
copy and scanning electron microscopy. Preparation
for transmission electron microscopy was performed
as described previously (Kuryłowicz et al., 1980) with
the exception of the fixation methods which were con-
ducted in 3.5% or 4.5% glutaraldehyde (Sigma-Aldrich,
Milwaukee, WI, USA) for 6 h at 2°C, and then con-
tinued with 1.2% osmium tetroxide (Sigma-Aldrich,
Milwaukee, WI, USA) solution for 2 h. All samples
were dehydrated in increasing concentrations of ethyl
alcohol and embedded in Epon 812 (Serva-Electropho-
resis, Heidelberg, Germany) at room temperature. The
blocs were polymerized at 37°C for 24 h and at 65°C for
48 h, and cut on LKB III Ultra Microtome (Diversified
2
Equipment, Inc., Lorton, VA, USA). The sections were
stained with uranyl acetate solution and then treated
with Reynold’s reagent (Serva-Electrophoresis, Heidel-
berg, Germany). The ultra thin sections were exam-
ined under transmission electron microscopy JOEL,
JEM1220 (Tokyo, Japan).
Scanning electron microscopy (FEI QUANTA 200,
Hillsboro, OR, USA) was conducted as described pre­
viously (Kurzątkowski et al., 2010). The samples were
coated with a gold film (thickness approximately 20 nm)
under vacuum in an argon atmosphere using a sputter
coater (Emscope SC500, Island Scientific Ltd, Isle of
Wight, Ventor, UK) prior to SEM analysis.
Morphology index (Mi). The morphotypes were
examined under TEM and classified on the basis of
Mi = ls/d2 (Merson-Davies and Odds, 1989) The length
of the cell (l), maximum diameter of the cell (d) and
diameter at the septal junction (s) were determined
for 118 randomly selected cells. The Mi values of dif-
ferent pleomorphic forms were analyzed by descriptive
statistics (number of cells measured, average, SD, mini-
mum and maximum). Analysis was done using SPSS
12.0/ (//SPSS for Windows, Rel 12.0.1, 2004, Chicago:
SPSS INC/).
Results
Candida albicans cells exhibit typically eukaryotic
ultrastructure, i.e.: nucleus, endoplasmic reticulum,
Golgi cisternae and mitochondria. Depending on the
cultural conditions this fungus is able to develop the fol-
lowing pleomorphic forms: blastoconidia, germ tubes,
pseudohyphae and true hyphae. Classification of mor-
photypes based on Mi value is presented in Table I. The
morphological attributes of these forms are different.
s­
Table I
Morphology index (Mi) values for pleomorphic cells
of Candida albicans 82 grown from 4 to 48 h in 5% human serum
at 37°C. Data estimated by measuring the pleomorphic cells
documented by transmission electron micrographs
Morphology index (Mi)
Range* No.
Pleomorphic Standard of cells
foms Mini- Maxi- Average deviation examined
mum mum
Yeast 1.0 1.5 1.17 0.1401 71
Germ tube 1.6 2.4 1.90 0.3327 15
Pseudo hyphae 2.5 3.4 2.74 0.3291 15
True hyphae 4.1 17.8 7.62 3.3039 17
Total 1.0 17.8 2.39 2.5419 118
*  Classification of tetramorphic forms based on the Mi value: blastoco-
nidia, 1.0–1.5; germ-tube, 1.6–2.4; pseudo-hyphae, 2.5–3.4; true-hyphae
> 3.4 (Merson-Davies and Odds, 1989)
2 Ultrasructure of C.albicans pleomorphic forms 131

Fig. 1. (a, b, c, d) Blastoconidia of Candida albicans 82 grown in YEPD medium (pH 5.7) at 30°C for 18 h: (a, a-1) scanning electron
micrographs, (a-2) transmission electron micrograph, (a-3) phase-contrast micrograph, (b, c, d) transmission electron micrographs.
(a) Polar budding, (a-1) polar arranged rings of scars (arrows), (a-2) nucleus (N) associated with areas of polar budding (arrows),
(a-3) oval budding blastoconidial cells. (b) Massive cell wall (cw) and a longitudinal section through a nucleus (N) at an early state
of mitosis. (c) Breakable septum (s). (d) Telophase nucleus (N). The nuclear envelope has broken down in the equatorial region of the
nucleus and is reforming around the clusters of chromosomes (ch), thus excluding the spindle which soon breaks down

Blastoconidia appear as oval or spherical cells. The
poles of this morphotype are privileged areas of bud-
ding or germinating (Figure 1). Massive cell wall of
this morphotype is abundantly covered with fibrous
material (Figure 1b). The breakable septum is com-
posed of the mother cell wall and a thinner daughter
layer (Figure 1c). Using our modified fixation method
in the cytoplasm a telophase plasmodial nucleus was
documented (Figure 1d). Pseudohyphae can be char-
acterized as chain of elongated budding blastoconidial
cells with fragile septa. Pseudohyphae develop directly
from blastoconidia or as branches of true hyphae (Fig-
ure 2a). The true hyphae grow from adhesive blastoco-
nidia which build after 1 h of cultivation conglomerates
of germ tubes. Polar germination of blastoconidia is
a characteristic attribute initiating the growth of true
hyphae. After 2 h of cultivation the length of the radi-
ate extending true hyphae ranges from 5 to 7 μm and
between 3–6 h from 10 to 15 μm. Finally at 18 h of cul-
tivation the radiate arranged true hyphae build massed
conglomerates of about 700 μm (average of 25 measure-
ments in diameter) (Figure 2b).
In a distance of about 70 μm from the apex of the
conglomerate building true hyphae young cells are
located. In a further range of the hyphae mature and
senescent cells with large vacuoles are visible (Fig-
ure 3a). Generally, in comparison with blastoconidial
mother cell the surface of hyphal part of germ tube is
less covered with fibrous material (Figure 3b). The mas-
sive true hyphal septum fast joined with the cell wall is
located in the place of the strongest mechanical stability.
The massive septum is a cellular linking binder which is
responsible for the extreme durability of the true hyphal
structure (Figure 3c). In the examined cultivation con-
ditions until 18 h of growth budding of true hyphae is
very less noticeable. After this period of cultivation in
protein exhausted human serum the true hyphae begin
the processes of budding or pseudohyphae branching.
Privileged areas for these processes are the cytoplasm
regions located at the poles of the elongated true hyphal
132 Staniszewska M. et al. 2

Fig. 2. (a, b) Candida albicans 82. (a) Scanning electron micrograph. (b) Phase-contrast micrograph. (a) Growth in 5% human
serum (pH 8.2) at 37°C for 48 h. Pleomorphic forms are visible, i.e. (b) oval blastoconidia with fragile septa (arrows), (ph) chains
of elongated blastoconidial cells with fragile septa (arrows) forming pseudohyphae (ph1) from an oval mother cell, (th) uniformly
elongated true hyphae. (b) Mycelium building true hyphae grown in undiluted human serum (pH 7.0) at 37°C for 18 h form aggre-
gates of blastoconidia (circular dark area)

Fig. 3. (a, b, c, d) True hyphae of Candida albicans 82 grown in undiluted human serum (pH 7.0) at 37°C for 18 h. (a) Phase-
contrast micrographs. (b, c) Transmission electron micrographs. (d) Scanning electron micrographs. (a) Young cells at the hyphal
apex (arrows). In a further range from the apex mature and senescent cells with increasing in the length vacuoles from about
10 μm to 50 μm are visible (light areas). In the direct neighborhood of both sites of the septa dense cytoplasm is located (inter-
rupted dark areas). (b) Blastoconidial mother cell extending into tubular hyphae. Note the dense and strong structure of blasto-
conidial cell wall (cw). Note the fibrous appearance at the outer surface of the cell wall (f). In contrast, the cell wall of the tubular
extending hyphae is less covered with fibrilles. In the cytoplasm vacuoles (v) are visible. (c) Massive true hyphal septum (s) fast
joined with the cell wall (cw). (d) Ring of bud scars (arrows) located at one side of the massive true hyphal septum exhibiting privi-
leged places of hyphal budding or branching
2 Ultrasructure of C.albicans pleomorphic forms
Fig. 4. Candida albicans 82, fixation with 3.5% glutaraldehyde,
1.2% osmium tetroxide fixation. The cytoplasm is poorly visible.
The novelty of our study is the elaborated fixation method, i.e.
4.5% instead of 3.5% glutaraldehyde continued with 1.2% osmium
tetroxide. The improved method allowed the presentation of the
ultrastructural details described in Figs. 1a-2, 1b, 1c, 3b, 3c
cells, i.e. at the septa where rings of buds and bud scars
(Figure 3d) or pseudohyphal branches were visible. At
3.5% glutaraldehyde pre-fixation the cytoplasm of the
cell is less visible (Figure 4).
Discussion
The high frequency of occurrence of candidiasis as
well as the high mortality of patients with immunosup-
pression cause a tendency toward better understanding
of C. albicans virulence factors and developing sensi-
tive and specific diagnostic methods, and appropri-
ate strategies for candidiasis treatment. Diagnostics
of mycoses is based on microscopic, microbiological,
serological (detection of antigens and antibodies) as
well as molecular methods (Woods and Schnadig, 2003;
Przyjałkowski, 2006).
Patients deficient in antibody immune response
value and titer give frequently false negative results
(Warzocha and Seferyńska, 2006). Moreover, lack
of characteristic symptoms in this group of patients
impairs recognition of fungal infection based on the
clinical picture (Stradomska, 2006). Interpretation of
microbiological or molecular results should be corre-
lated with occurring clinical symptoms.
In many cases, obtaining a positives result from
a direct clinical material preparation is the only certain
way of recognizing mycoses (Warzocha and Seferyńska,
2006). Therefore, the discrimination of the morpho-
logical elements of all C. albicans pleomorphic forms is
indispensable in the mycological and histopathological
diagnostics of fungal infections caused by C. albicans
(Müller and Melchinger, 2006). At present, precise cri-
teria should be completed in the medical mycological
133
literature. Despite multiple experimental results pub-
lished so far, the ultrastructure of C. albicans pleomor-
phic forms has not been sufficiently studied.
Previous ultrastructural analyses of C. albicans pleo-
morphic forms encountered difficulties (Müller and
Melchinger, 2006). It is the reason of noticeable lack
of precise ultrastructural characteristics of C. albicans
ultrastructure, including: Spitzenkörper (Crampin et al.,
2005), organization of mitosis (interphase, prophase,
metaphase, anaphase, telophase), process of budding or
branching, privileged areas of budding, exact features
of breakable blastoconidial septum and massive true
hyphal septa, occurrence of Woronon bodies, fibrillar
surface of the cell wall of particular morphotypes, orga-
nization of the endoplasmic reticulum and Golgi-like
structures (vesicles, cisternae), structure of biofilm and
structural formation and organization of the so-called
“Candida fungus ball” (Salfelder et al., 1990; Dignani
et al., 2003), relations between ultrastructural charac-
teristics and the virulence of pleomorphic forms.
The main goals of our experimental program was to
search for ultrastructural characteristics of C. albicans
pleomorphic forms using phase-contrast microscopy,
scanning electron microscopy and transmission elec-
tron microscopy using improved 4,5% glutaraldehyde
pre-fixation method. In this paper some of the char-
acteristics of morphotypes were discussed in terms of
diagnostics, virulence of particular pleomorphic forms
and sensitivity to disinfectants or antimycotics.
The findings of our study provided precise crite-
ria of C. albicans morphotypes i.e.: precise criteria of
breakable septa typical for blastoconidia and pseudo-
hyphae, exact features of massive septa characterizing
true hyphae, privileged areas of budding or branching,
relations between the cultivation conditions and growth
of particular pleomorphic forms, fibrous appearance at
the outer surface of the cell wall of different morpho­
types, cellular and hyphal organization of mycelium-like
aggregates. Additionally, using our modified method of
glutaraldehyde fixation some ultrastructural attributes
were documented, e.g. the telophase nucleus.
The previously elaborated methods for the growth
of individual morphotypes allowed us to estimate some
virulence features of C. albicans pleomorphic forms,
such as: profiles of enzymatic activity using the api®
ZYM test (Staniszewska et al., 2010), expression of
aspartic protease isoenzymes Sap1-3 and Sap4-6 using
immunoelectron microscopy and immunofluorescence
microscopy (immunolabelling). In comparison with
blastoconidia the immunomarker of aspartic protease
isoenzymes increased two times in germ tubes and four
times in both pseudohyphae and true hyphae.
Biofilm-similar structures and other types of massed
growth were also analyzed previously (in preparation).
The so called “fungus ball” of C. albicans massed growth
134 Staniszewska M. et al.
was described in diffuse parietal mycotic endocarditis.
The “fungus ball” was located in the right heart ven-
tricle and pulmonary artery of a dehydrated infant
which received intravenous infusions (Salfelder et al.,
1990). Our present observations allowed characterize
the conglomerate arrangements composed of radiate
extending true hyphae developing in undiluted human
serum from aggregates of blastoconidia. The young
hyphal cells located at the apex of the true hyphae
which are arranged at the periphery of these spherical
conglomerates seem to exhibit some enhanced viru-
lence attributes, such as: secretion of aspartic prote-
ase isoenzymes, increased activity of tissue degrada-
tion (in preparation) and ability to develop micelial
aggregates. All these results connected with profiles
of enzyme activity, cellular localization and frequency
of aspartic protease expression in individual morpho­
types and ability to build hyphal conglomerates elu-
cidate the relation between C. albicans pleomorphism
and its virulence.
The present study shows that undiluted human
serum, the temperature 37°C and pH ≥ 7.0 were prefer-
able to true hyphae formation and a large fraction of the
cells were induced to germinate (Fig. 2b and Fig. 3a).
We modified the pH by transferring blastoconidia from
YEPD (pH 5.7) into both undiluted (pH 7.1–7.4 ) and
diluted (pH 8.0–8.2) human sera. Findings presented
in this study are consistent with observations made by
other authors (Barnet, 2008; Kruppa, 2009; Noble et al.,
2010). The latter showed that interconversions among
the cell types are induced in vitro by modifying the pH,
temperature, and/or serum concentration in the growth
medium. The morphological transition of C. albicans in
response to changing environmental conditions rep-
resent a means by which the strain adapts to different
biological niches (Barnet, 2008).
Presently little is known about the ultrastructural
mode of fungicide action. Our previous investigations
using transmission electron microscopy and scanning
electron microscopy exhibited the young and very thin
cell wall of buds emerging from the blastoconidial poles
of C. albicans clinical isolates. At the thin cell wall of
buds a collocation of mitochondrion and nucleus at the
stage comparable to metaphase/anaphase was docu-
mented. Under the action of the following disinfectants:
Lysoformine 3000, Medicarine, Incidin Plus, Incidin
Liquid Spray and Spitaderm (antiseptic) damage of
buds was presented, i.e. peeling of the outer layer of the
cell wall, explosion of buds and polar holes in the cell
wall. These results allowed us to suggest that during the
antifungal action the blastoconidial buds are neuralgic
places of the cell. This suggestion might also explain
the reduction levels of viable blastoconidia exposed to
the lowest concentrations of disinfectants and antiseptic
(according to EN 1275:2005) which were expressed by
2
the data from 6.2 to 7.0 log, and the survivability of the
remaining blastoconidia at not budding life cycle. The
authors suggested also that the speculation on different
resistance and strain difference to the tested fungicides
should be rooted in the composition of the especially
thick and compact cell wall of C. albicans blastoconidia
(Kurzątkowski et al., 2010). The resistance of particular
pleomorphic forms to antibiotics is diverse and is a sub-
ject of our further investigations.
The conclusions of our work can be summarized
as follows: the modified glutaraldehyde pre-fixation
method allowed us more exact presentation of the fine
structure of C. albicans morphotypes, the presented
attributes of morphology of the particular morpho-
types will facilitate the mycological and histopatho-
logical diagnostics of candidiasis, the discussed results
elucidated the virulence of individual morphotypes as
well as the ultrastructural mode of fungicides action.
Acknowledgements
This work was supported by Ministry of Sciences and Higher
Education, Scientific Grant NN404 113639. We are very grateful
to Prof. D.D. Dzierżanowska-Madalińska for kindly supplying the
C. albicans strain 82.
Literature
Barnet J.A. 2008. A history of research on yeasts 12: medical yeasts
part I, Candida albicans. Yeast. 25: 385–417.
Crampin H., K. Finley, M. Gerami-Nejad, H. Court, C. Gale,
J. Berman and P. Sudbery. 2005. Candida albicans hyphae have
a Spitzenkörper that is distinct from the polarisome found in yeast
and pseudohyphae. J. Cell. Sci. 118: 2935–2947.
Dignani M.C., J.S. Solomkin and E.J. Anaissie. 2003. Candida,
pp. 195–239. In: Anaissie E.J., M.R. McGinnis and M.A. Pfaller (eds)
Clinical Mycology. Churchill Livingstone, Philadelphia, USA.
Kruppa M. 2009. Quorum sensing and Candida albicans. Mycoses.
52: 1–10.
Kuryłowicz W., W. Kurzątkowski, W. Wożnicka, H. Połowniak-
Pracka, A. Paszkiewicz, J. Luba and J. Piorunowski. 1980. Atlas
of the Ultrastructure of Penicillium Chrysogenum in the Course of
Biosynthesis of Penicillin. Chemia. Warsaw.
Kurzątkowski W., M. Staniszewska and S. Tyski. 2010. Damage
of Candida albicans blastoconidia exposed to biocides. Mycoses.
doi:10.1111/j.1439-0507.2010.01900.x
Merson-Davies L.A. and F. Odds. 1989. A morphology index of
characterization of cell shape in Candida albicans. J. Gen. Microbiol.
135: 3143–3152.
Müller J. and W. Melchinger. 2006. Ultrastructural characters
defining the terms ‘yeast cell’, ‘pseudonycelium’ and ‘true mycelium
in Candida albicans. Mycoses. 49: 24–30.
Ness F., V. Prouzet-Mauleon, A. Vieillemard, F. Lefebvre, T. Noёl,
M. Crouzet, F. Doignon and D. Thoraval. 2010. The Candida albi-
cans Rgd1 is a RhoGAP protein involved in the control of filamen-
tous growth. Fungal Genetics and Biology 47: 1001–1011.
Netea M.G., G.D. Brown, B.J. Kullberg and N.A.R. Gow. 2008.
An integrated model of the recognition of Candida albicans by the
innate immune system. Nat. Rev. Microbiol. 6: 67–78.
Nguyen K.A., G. Zmeter, O. Claris and B. Kassai. 2011. Epidemio­
logy of invasive Candida infection in a neonatal intensive care unit
2 Ultrasructure of C.albicans pleomorphic forms
in France. Acta Paediatrica. DOI:10.1111/j. 1651-2227.2011.02514.x
Noble S.M., S. French, L.A. Kohn, V. Chen and A.D. Johnson.
2010. Systematic Screens of Candida albicans homozygous deletion
library decouple morphogenetic switching and pathogenicity. Nat.
Genet. 42: 590–598.
Okawa Y., M. Miyauchi, S. Takahashi and H. Kobayashi. 2007.
Comparison of pathogenicity of various Candida albicans and
C. Stellatoidea strains. Biol. Pharm. Bull. 10: 1870–1873.
Przyjałkowski W. 2006. Fungal infections of the central nervous sys-
tem (in Polish). In: Dzierżanowska D. (ed). pp. 154–165. Zakażenia
grzybicze – wybrane zagadnienia. α-medica Press, Bielsko-Biała.
Raška M., J. Běláková, M. Křupka and E. Weigl. 2007. Candidia-
sis – do we need to fight or to tolerate the Candida fungus? Folia
Microbiol. 52: 297–312.
Salfelder K., T.R. de Liscano and E. Sauertaig. 1990. Atlas of Fun-
gal Pathology. Kluwer Academic Publishing, Dordrecht, Boston,
London.
Staniszewska M., B. Rozbicka, A. Rajnisz, E. Bocian, E. Wasińska,
B. Jakimiak, E. Röhm-Rodowald, W. Kurzątkowski and S. Tyski.
135
2010. Susceptibility of Candida spp. Clinical isolates to antimycotics
and disinfectans. Cent. Eur. J. Biol. 5: 821–826.
Staniszewska M., M. Bondaryk and W. Kurzątkowski. 2011a. Mor-
photypes of Candida albicans. Phase-contrast microscopy. Mikologia
lekarska. 18: 5–10.
Staniszewska M., D. Rabczenko and W. Kurzątkowski. 2011b. Dis-
crimination between the enzymatic activities of Candida albicans
pleomorphic forms determined using the api® ZYM test. Mycoses.
doi.10.1111/j.1439-0507.2010.02011.x
Stradomska T.J. 2006. Metabolites detection in the diagnosis of sys-
temic fungal infections (in Polish). pp. 71–78. In: D. Dzierżanowska
(ed). Zakażenia grzybicze – wybrane zagadnienia. α-medica Press,
Bielsko-Biała.
Warzocha K. and I. Seferyńska. 2006. Fungal infections in haemato­
logy (in Polish). pp. 137–153. In: D. Dzierżanowska (ed). Zaka­żenia
grzybicze – wybrane zagadnienia. α-medica Press, Bielsko-Biała.
Woods G.L. and V. Schnadig. 2003. Histopathology of fungal infec-
tions. pp. 80–95. In: E.J. Anaissie, M.R. McGinnis and M.A. Pfaller
(eds). Clinical Microbiology. Churchill Livingstone, Philadelphia.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 137–142

ORGINAL PAPER

Modifications Influencing Widal Test Reactivity

in a Novel Microplate Assay

Adel Almogren1, Zahid Shakoor1*, Mustafa Hussein Adam1,

Mohammad Osman GadElRab1 and Hassan Abdulaziz Musa2

Department of Pathology, King Khalid University Hospital, King Saud University, Kingdom of Saudi Arabia
1 

2
 Faculty of Medicine, National Rabat University, Khartoum, Sudan

Received 2 November 2011, revised 5 April 2012, accepted 9 April 2012

Abstract

Reliability of the Widal tube agglutination test has been the subject of many controversies over the years. This study was performed to
assess the effect of certain modifications on the performance of Widal test in a novel microplate assay. Sera from 37 patients (21 males;
16 females) (mean age 28 + 7 years) were tested in the Immunology Unit at King Khalid University Hospital, Riyadh. Among them were
26 patients with suspected typhoid fever and 11 had bacteriologically confirmed diagnosis of Salmonella infection. The modifications
included either the use of 0.5% bovine serum albumin (BSA), absorption of sera with sheep red blood cells (SRBC) or heat inactivation of
sera. Compared with Widal tube agglutination test, microplate assay with SRBC absorption of the sera from patients with suspected typhoid
fever was not only associated with enhancement of detection titers for both H (p < 0.001) and O (p < 0.005) Salmonella agglutinins but also
the percentage of reactivity. The presence of BSA augmented detection titers for Salmonella H agglutinins (p < 0.02) only. Heat inactiva-
tion of sera however was found to be associated with reduction in the detectable titers for both H (p < 0.03) and O (p < 0.01) agglutinins.
Increased titers of Salmonella agglutinins were also evident in 11 patients with confirmed diagnosis of Salmonella infection. The novel
microplate agglutination assay using the SRBC absorption was associated with enhancement in Widal test reactivity and appears to be
a useful alternative for the diagnosis of Salmonella infection.

K e y w o r d s: Salmonella typhi, microplate agglutination assay, Salmonella agglutinins, Widal tube agglutination test

Introduction nins have been regarded as diagnostically significant

The diagnosis of typhoid fever is usually made by
detection of Salmonella typhi organisms in blood that
is less sensitive than isolation of the organism from
bone marrow which is considered as the gold stan-
dard (Farooqui et al., 1991). Bone marrow aspiration
is an invasive procedure and requires skilled labora-
tory personnel often not available at primary healthcare
facilities (Wain et al., 2008). Similarly in the developing
countries where typhoid fever is endemic a relatively
small number of laboratories at primary healthcare cen-
tres are equiped with the culture facilities requried for
isolation of Salmonella organisms and the diagnosis of
typhoid fever only on clinical evidence remains a prob-
lem (Parry et al., 1999; Pang et al., 1983; Choo et al.,
1993; Saha et al., 1996). Detection of circulating anti-
bodies against Salmonella typhi in serum is therefore
useful in the diagnosis of typhoid fever. Rising titers
over time or a single high titer of Salmonella agglutin-
(Wain et al., 2008). However, there are several factors
which tend to obscure the serological picture; the most
important is the sharing of antigens that stimulate anti-
body production by a large number of organisms from
the same genus or from other related organisms yelid-
ing false positive results (Jindal et al., 1992; Chart et al.,
1994a; Chart et al., 1994b).
A number of attempts have been made in the past to
develop a reliable serological technique for the diagno-
sis of typhoid fever (Duthie and French, 1990). These
include the Widal agglutination test, haemagglutination
test, enzyme-linked immunosorbent assay, immuno-
electrophoresis and polymerase chain reaction test (Rai
et al., 1989; Barrett et al., 1983; Nardiello et al., 1984;
Verdugo-Rodriguez et al., 1993; Jesudason et al., 1998;
Chart et al., 1997; Sharma et al., 1997). None of these
tests could be adopted for routine use on account of
various reasons whereby the Widal tube agglutination
test remained a simple, inexpensive, semiquantitative

*  Corresponding author: Z. Shakoor, Department of Pathology, King Khalid University Hospital, King Saud University, Riyadh 11461,
Kingdom of Saudi Arabia; phone: 00966-1-4671299; fax: 00966-1-4671842; e-mail: shakoor_zahid@yahoo.com
138 Almogren A. et al.
agglutination test for detecting Salmonella agglutinins
(Parry et al., 1999; Choo et al., 1993; Saha et al., 1996;
Coovadia et al., 1986).
Despite being used most frequently the specific-
ity and sensitivity of the Widal test has been debated
for many years, especially in the endemic areas where
typhoid fever co-exists with non-typhoid febrile ill-
nesses such as malaria and tuberculosis (Rai et al., 1989;
Ghosh et al., 2001; Bakr et al., 2011; Keddy et al., 2011).
Because of its limited diagnostic capability (Omuse
et al., 2010) several modifications of the Widal test such
as the slide agglutination test, (Hoffman et al., 1986)
plate micro-agglutination test (Pang et al., 1983; Clegg
et al., 1994; Barsoum and Awad, 1972), use of 2-mer-
captoethanol for the detection of IgM (Jindal et al.,
1992) and Salmonella para A, para B and Escherichia
coli absorption (Rai et al., 1989) have been investigated
but none of these could gain a reasonable acceptance.
The need for a tangible test for the diagnosis of Sal­
monella infection therefore remains (Baker et al., 2010)
and this study examines the effect of certain modifica-
tions on the performance of Widal test.
Experimental
Materials and Methods
Study population. A total of 37 patients includ-
ing 21  males and 16 females with the mean age of
28 + 7 years were included in the study. This group
of patients comprised of 26 patients with a febrile ill-
ness with clinical suspicion of typhoid fever where the
treating physician did not request bacterial cultures
for isolation of the Salmonella organism. The remain-
ing 11 patients had a definitive diagnosis of typhoid
fever based on the isolation of Salmonella organisms
either from blood or stool specimens. The diagnostic
titers for H and O agglutinins were either equal to or
greater than 1:160 and 1:80, respectively. Means were
compared using Student t test and p ≤ 0.05 was consid-
ered significant.
Blood sample collection. 3 ml of venous blood was
collected by venipuncture and serum was obtained
by allowing the blood to clot at the room temperature.
A  0.5 ml aliquot was used for Widal tube agglutina-
tion and the rest of the serum sample was stored at
–20°C until use.
Determination of optimal concentration of BSA.
The optimal concentration of BSA was determined
by checkerboard titration. Various concentrations of
BSA in normal saline ranging from 0.1% to 5% were
tested and 0.5% BSA in normal saline was shown to
perform best in terms of interpretation of the results
and reproducibility.
2
SRBC absorption. Commercially prepared 10%
non-sensitized sheep erythrocytes (Carter Wallace Inc,
USA) were used for absorption. To 190 μl of absorbent
cells in a test tube 10 μl of undiluted serum sample was
added to obtain a serum dilution of 1:20. The contents
were mixed gently using a microplate shaker and incu-
bated at room temperature for one hour and then cen-
trifuged at 3000 rpm for 10 minutes. Supernatant was
collected and used for microplate agglutination assay.
Heat inactivation of sera. Serum samples were
placed in a water bath at 56°C for 30 minutes and then
cooled immediately in running tap water prior to be
used in the microplate agglutination assay.
Microplate agglutination assay. 50 μl of 0.5% BSA
in normal saline was dispensed in all the wells of
a U-type micro-titer plate. In the first well of each row
50 μl of serum sample was added and double dilu-
tions were made along the rows up to a final dilution
of 1:20480. Aliquots of 50 μL each from 1:100 diluted
homogenous Salmonella typhi suspensions (Murex,
UK) for H  and O  antigens were then added to the
respective wells. The microplate was sealed with a plas-
tic cover, the contents were mixed by gentle shaking and
this was followed by incubation at 37°C for 18 hours.
After incubation the seal was removed from the plate
and the agglutination was read on a Microtitre mirror.
A positive reaction was indicated by a smooth or irreg-
ular mat shape settlement at the bottom of each well in
the microtitre plate, whereas the settling of antigen to
a button shape was interpreted as a negative reaction.
The titer was determined as the last dilution of serum
sample showing a mat formation.
Widal tube agglutination test. The standard Widal
tube agglutination test was performed using a commer-
cial kit (Murex Biotech Limited, UK) in accordance with
the instructions of the manufacturers. Briefly, serum
dilutions were made for each antigen to be tested using
saline. One drop of bacterial suspension was added to
each tube, the contents were mixed and incubated at
50°C for four and two hours for O and H suspensions
respectively and agglutination was observed at the end
of incubation.
Results
Table I shows comparison of results for detection of
antibodies against H and O Salmonella antigens using
the Widal tube test and the modified microplate agglu-
tination assays for the 26 patients suspected to be suf-
fering from Salmonella infection. Widal tube agglutina-
tion test detected H and O Salmonella agglutinins in
17 and 22 patients respectively. Microplate assay using
0.5% BSA as a blocking agent enhanced the level of
detection of H and O Salmonella agglutinins but sta-
2 Modified Widal test in a microplate 139

Table I
Comparison of Widal tube agglutination test with modified microplate agglutination assay
in patients suspected to have typhoid fever

Microplate Microplate Microplate

Widal
S. Agglutination Agglutination Agglutination
Tube test
No. with 0.5% BSA SRBC absorption Heat inactivation
H titer O titer H titer O titer H titer O titer H titer O titer
 1 40 80 80 160 320 320 – –
 2 320 40 40 40 5120 80 – –
 3 – 80 80 80 40 160 – –
 4 – 80 80 80 80 160 – –
 5 – 80 80 80 80 160 – –
 6 320 40 40 80 1280 160 – –
 7 – 80 80 80 40 80 160 –
 8 40 160 160 160 320 160 – –
 9 – 160 160 160 80 640 – 80
10 40 80 80 80 160 320 – –
11 – 80 80 80 – 320 – –
12 80 80 80 320 320 640 – 80
13 80 80 80 160 320 320 – –
14 160 320 320 320 640 320 – 160
15 320 320 320 320 1280 640 160 320
16 40 80 80 160 80 320 320 40
17 160 – – – 640 80 40 –
18 640 – – – 5120 – – –
19 – 80 80 160 80 160 – –
20 80 40 40 40 320 40 – –
21 640 – – 40 2560 40 – –
22 160 – – – 640 – – –
23 – 80 80 80 80 80 – 80
24 – 40 40 80 – 160 80 –
25 320 80 80 80 2560 160 – 80
26 320 – – 40 1280 40 80 –
p value 0.02 ns 0.005 0.001 0.03 0.01

–  represents a negative test; ns = not significant

Diagnostic titers for H and O agglutinins were ≥ 1:160 and 1:80 respectively.

tistically significant difference was observed only for
H  agglutinins (p ≤ 0.02) when compared with Widal
tube agglutionation test. Absorption of sera with SRBC
was also associated with significant enhancement of the
detectable titers for both H (p ≤ 0.001) and O (p ≤ 0.005)
Salmonella antigens when compared with the titers
obtained by Widal tube agglutination test. Heat inacti-
vation on the other hand had an opposite effect where
both H (p ≤ 0.03) and O (p ≤ 0.01) agglutinin detection
significantly decreased when compared with the Widal
tube agglutination test. Table II shows the comparison
of data from 11 patients with bacteriologically con-
firmed Salmonella infection. All the patients were found
to have high titers of antibodies against O and H Salmo­
nella antigens when tested with the Widal tube agglu-
tination test. Comparative analysis revealed further
enhancement in the titers for both H (p ≤ 0.0002) and
O (p ≤ 0.015) agglutinins when sera samples were sub-
jected to SRBC absorption. In the presence of 0.5% BSA
significant enhancement was noted only for H agglu-
tinins. Table III compares data for the percentages of
positive tests for Salmonella agglutinins in 26 patients
suspected to have Salmonella infection. Compared to
the Widal tube agglutination test, the modified micro-
plate agglutination test detected a higher percentage
of positive tests for H and O  Salmonella agglutinins,
either in the presence of 0.5% BSA or when the sera
were absorbed with SRBCs. Heat inactivation however
was associated with decreased percentage of positive
tests for both H and O Salmonella agglutinins.
140 Almogren A. et al. 2

Table II
Comparison of Widal tube agglutination test with modified microplate agglutination assay
in patients with bacteriologically confirmed typhoid fever

Microplate Microplate Microplate

Widal
S. Agglutination Agglutination Agglutination
Tube test
No. with 0.5% BSA SRBC absorption Heat inactivation
H titer O titer H titer O titer H titer O titer H titer O titer
 
1 2560 160 5120 160 10240 640 1280 160
 
2 320 160 640 320 5120 640 160 320
 
3 640 1280 1280 1280 5120 2560 1280 640
 
4 640 1280 5120 1280 10240 5120 1280 640
 
5 320 320 1280 320 2560 640 320 160
 6 2560 320 5120 640 10240 1280 1280 320
 
7 2560 5120 10240 5120 20480 10240 1280 2560
 
8 2560 320 5120 640 20480 10240 640 640
 9 640 640 2560 1280 10240 5120 320 640
10 640 640 1280 640 5120 1280 640 640
11 1280 160 2560 320 2560 2560 640 320
p value 0.009 ns 0.0002 0.01 ns ns

ns = not significant
Diagnostic titers for H and O agglutinins were ≥ 1:160 and 1:80 respectively

Table III
Comparison of diagnostic titers for Salmonella agglutinins between Widal tube agglutination test
and modified microplate agglutination assay in 26 patients with suspected typhoid fever

Salmonella O agglutinins Salmonella H agglutinins

Type of test
No. (%) No. (%)
Widal tube agglutination test 17 (65.3) 10 (38.4)
Microplate agglutination test using 0.5% BSA 19 (73) 15 (57.6)
Microplate agglutination test with SRBC absorption 21 (80.7) 16 (61.5)
Microplate assay with heat inactivation 7 (26.9) 8 (30.7)

Diagnostic titers for O and H agglutinins were ≥ 1:80 and 1:160 respectively.

Discussion and could have contributed to enhancement in detec-

Using the novel microplate agglutination assay this
study shows significant enhancement in the detection
of titers for H and O Salmonella agglutinins both in
the presence of 0.5% BSA and SRBC absorption, when
compared with the results of the routine Widal tube
agglutination test.
The presence of 0.5% BSA was shown to enhance
the detection of Salmonella agglutinins. Since BSA
as a blocking agent was used for the first time in the
microplate agglutination assay, various concentra-
tions of BSA diluted in normal saline were tested; BSA
concentration of 0.5% was found to be optimal where
a  clear-cut well-defined and smooth settlement was
obtained consistently. Since BSA is known for its abil-
ity to block vacant binding sites in microplate wells
(Steinitz, 2000), this blocking action may have allowed
all antigen and antibody molecules to react uniformly
tion of titers for Salmonella agglutinins. A 0.5% BSA
concentration has been previously shown to enhance
the titers for Salmonella O agglutinins in the passive
haemagglutination assay (Coovadia et al., 1986), sup-
porting the role for BSA as an enhancing agent in the
detection of Salmonella agglutinins.
The role of BSA as an enhancing agent has already
been documented under various settings. For example,
Polymerase Chain Reaction (PCR) for DNA amplifica-
tion is limited, in part, by the presence of inhibitors in
biological samples that reduce the amplification effi-
ciency. The addition of BSA to reaction mixtures of PCR
has clearly been shown to decrease the inhibitory effect
of blood and allow DNA amplification (Abu Al-Soud
and Rådström, 2000). For the detection of Mycobacte­
rium tuberculosis in respiratory specimens the presence
of BSA in the PCR reaction has been regarded as man-
datory (Forbes and Hicks, 1996). Similarly the presence
2 Modified Widal test in a microplate
of BSA in ELISA also eliminates interference resulting
from the use of human, rat or mouse serum albumins in
the assay (Pestka and Chu, 1984). These data along with
the findings of this study highlight the role of BSA as an
amplification facilitator, though the exact mechanism
of action remains obscure.
Significantly high titers of Salmonella agglutinins
both for H and O antigens were detected using the
microplate agglutination assay compared with those
detected by the Widal tube agglutination test when
serum samples were absorbed with SRBCs. Using non-
motile Salmonella typhi organisms in a haemagglutina-
tion assay absorption of serum with SRBC has previ-
ously been shown to enhance the level of detection of
O agglutinins, with no effect on detecting H agglutinins
(Jesudason et al., 1991). On the basis of this finding
antibody response against the non-flagellar proteins
was proposed to be more important in Salmonella
infection. In disagreement with this proposition it is
possible that the use of non-motile Salmonella typhi
organisms may have resulted in subsequent precipita-
tion of non-flagellar proteins only. The enhancement of
both H and O agglutinin titers observed in the present
study could be due to the fact that commercially pre-
pared suspensions of both O and H antigens were used.
The findings of both studies, however, are consistent
with regards to enhancement in the level of detection
of Salmonella agglutinins when the sera were absorbed
with SRBCs prior to being tested.
SRBCs in routine laboratory practice are used to
detect heterophile antibodies. These antibodies are
characteristically found in the sera of patients suffering
from infectious mononucleosis, along with other clini-
cal conditions, where the serum levels of heterophile
antibodies have also been related to disease activity
(Duverlie et al., 1989; Yoshida et al., 1980; Satoh et al.,
1980; Moore and Dorner, 1980; Tamura et al., 1984).
Since heterophile antibodies can be detected in an oth-
erwise healthy population (Kakoma et al., 1987) their
presence in the serum samples, sent to the laboratory
for routine investigations and their ability to interfere
with the results, cannot be ignored. There are no reli-
able data regarding heterophile antibodies in Salmonella
infection. The findings of this study, however, provide
indirect evidence that these antibodies could be present
in the samples tested. The enhancement of titers and the
percentage for Salmonella agglutinins, observed conse-
quent to SRBC absorption, may be due to the depletion
of heterophile antibodies in serum samples.
Heat inactivation was found to be associated with
a  decreased level of detection titers for Salmonella
agglutinins. Using the indirect haemagglutination test,
indirect fluorescent antibody test and enzyme-linked
immunosorbent assay, heat inactivated serum samples
yielding low titers of Salmonella agglutinins in patients
141
with a confirmed diagnosis of typhoid fever has been
reported in the past (Rai et al., 1989); this was attributed
to partial antibiotic therapy prior to presentation. Since
reduction in the titers of Salmonella agglutinins, both
for H  and O  antigens was noticed uniformly in this
study, heat induced protein denaturation appears to be
the most likely cause. This is evident from the fact that
heating mouse serum has been shown to cause a selec-
tive loss of immunoglobulin isotypes (Schetters et al.,
1988). Alternatively this observation may indicate the
presence of a thermolabile factor in the serum modulat-
ing antigen antibody interactions.
Conclusion. Findings of this study reveal that the
novel modified microplate agglutination assay using the
SRBC absorption technique, apart from being a useful
alternative, performs better than the Widal tube agglu-
tination test for the serological diagnosis of typhoid
fever. It offers the advantages of simplicity, rapidity,
economy and flexibility for handling a large numbers
of specimens. This microplate assay appears to a useful
assay not only for the detection of Salmonella infec-
tion but may be applied for diagnosis of other bacterial
infections. This study was limited by relatively small
number of patients investigations involving a  larger
group of patients are recommended to further evalu-
ate the microplate assay.
Literature
Abu Al-Soud W. and P. Rådström. 2000. Effects of amplification
facilitators on diagnostic PCR in the presence of blood, Feces, and
Meat. J. Clin. Microbiol. 38: 4463–4470.
Bakr W.M., L.A. El Attar, M.S. Ashour and A.M. El Toukhy. 2011.
The dilemma of widal test – which brand to use? a study of four dif-
ferent widal brands: a cross sectional comparative study. Ann. Clin.
Microbiol. Antimicrob. 10–17.
Baker S., M. Favorov and G. Dougan. 2010. Searching for the elu-
sive typhoid diagnostic. BMC Infect. Dis. 10: 45–52
Barrett TJ., P.A. Blake, S.L. Brown, K. Hoffman, J. Mateullort
and J.C. Feeley. 1983. Enzyme linked immunosorbent assay for
detection of human antibodies to Salmonella Vi antigen. J. Clin.
Microbiol. 17: 625–627.
Barsoum IS. and A.Y. Awad. 1972. Microtitre plate agglutination
test for Salmonella antibodies. Appl. Microbiol. 23: 42–50.
Chart H., B. Rowe and S.S. Cheesbrough. 1997. Serological response
of patients infected with Salmonella typhi. J. Clin. Pathol. 50: 944–946.
Chart H., D.J. Waghorn and B. Rowe. 1994a. Serological detection
of patients infected with Salmonella enteritidis. Serodiagn Immuno­
ther Infect. Dis. 6: 79–81.
Chart H., D.J. Waghorn and B. Rowe. 1994b. Serological response
of patients infected with Salmonella enteritidis PT4. Serodiagn
Immunother Infect. Dis. 6: 21–24.
Choo K.E., A.R. Raazib, S.J. Oppenheimer, W.A. Ariffin, J. Lau
and T. Abraham. 1993. Usefulness of the Widal test in diagnosing
childhood typhoid fever in endemic areas. J. Paedia. Child. Health.
29: 36–39
Clegg A., M. Passey, M. Omena, K. Karigifa and N. Suve. 1994.
Re-evaluation of the Widal agglutination test in response to the
142 Almogren A. et al.
changing pattern of typhoid fever in the highlands of papua New
Guinea. ACTA Tropica. 57: 255–263.
Coovadia YM., V. Sing, R.H. Bhana and N. Moodley. 1986. Com-
parison of passive haemagglutination test with Widal agglutination
test for serological diagnosis of typhoid fever in an endemic area.
J. Clin. Pathol. 39: 680–683.
Duthie R. and G.L. French. 1990. Comparison of methods for the
diagnosis of typhoid fever. J. Clin. Pathol. 43: 863–865.
Duverlie G., M. Driencourt, C. Roussel and J. Orfila. 1989. Hetero­
phile IgM, IgA, and IgE antibodies in infectious mononucleosis.
J. Med. Virol. 28: 38–41.
Farooqui B.J., M. Khurshid, M. K. Ashfaq and M. A. Khan. 1991.
Comparative yield of Salmonella typhi from blood and bone marrow
cultures in patients with fever of unknown origin. J. Clin. Pathol.
44: 258–9.
Forbes B.A. and K.E. Hicks. 1996. Substances Interfering with
Direct Detection of Mycobacterium tuberculosis in Clinical Speci-
mens by PCR: Effects of Bovine Serum Albumin. J. Clin. Microbiol.
34: 2125–2128.
Ghosh K., K.N. Javeri, D. Mohanty, B.D. Parmar, R.R. Surati and
S.H. Joshi. 2001. False positive serological tests in acute malaria. Br.
J. Biomed. Sci. 58: 20–3.
Hoffman SL., T.P. Flanigan, D. Klaucke, B. Leksana, R.C. Rock-
hill, N.H. Punjabi, S.P. Pulungsih, A. Sutomo and M.A. Moech-
tar. 1986. Widal slide agglutination test, a valuable rapid diagnostic
test in typhoid fever patients at the infectious diseases Hospital of
Jakarta. Am. J. Epidemiol. 123: 869–875.
Jesudason MV., G. Sridharan, R. Arulselvan, P.G. Babu, PG and
T.J. John. 1998. Diagnosis of typhoid fever by the detection of anti-
LPS and anti-flagellin antibodies by ELISA. Indian. J. Med. Res. 107:
204–7.
Jesudason MV., G. Sridharan, M. Santhossh and T.J. Lohn. 1991.
Measuring antibody to non-flagellar proteins of Salmonella typhi
for diagnosis of typhoid fever. Trans. R. Soci. Trop. Med. Hyg. 85:
117–118.
Jindal N., I.B. Aggarwal, Arora. A and S. Arora. 1992. Diagnostic
accuracy of IgM antibody detection in typhoid by a modification
in Widal test. Indian. J. Med. Res. 95: 224–226.
Kakoma I., R.M. Mwendapole, M. Bulsara, S. Mabenga, C.S. Syab-
ula and K.F. Wurapa. 1987. Profiles of heterophile antibody to
various mammalian erythrocytes in rural populations of Zambia.
Comp. Immunol. Microbiol. Infect. Dis. 10: 51–57.
Keddy KH., A. Sooka, M.E. Letsoalo, G. Hoyland, C.L. Chaignat
and A.B. Moore TL. and R.W. Dorner. 1980. 19S IgM Forssman-
type heterophile antibodies in juvenile rheumatoid arthritis. Arthri­
tis. Rheum. 23: 1262–1267.
Morrissey, J.A. Crump. 2011. Sensitivity and specificity of typhoid
fever rapid antibody tests for laboratory diagnosis at two sub-Saha-
ran African sites. Bull. World. Health. Organ. 89: 640–647.
2
Nardiello S., T. Phizzella, M. Russo and B. Galanti. 1984. Serodi-
agnosis of typhoid fever by enzyme linked immunosorbent assay of
anti-Salmonella typhi lipopolysaccharide antibodies. J. Clin. Micro­
biol. 20: 718–721
Omuse G., R. Kohli and G. Revathi. 2010. Diagnostic utility of
a single Widal test in the diagnosis of typhoid fever at Aga Khan
University Hospital (AKUH), Nairobi, Kenya. Trop. Doct. 40: 43–44.
Pang T. and S.D. Putucheary. 1983. Significance and value of the
Widal test in the diagnosis of typical fever in an endemic area.
J. Clin. Pathol. 36: 471–475.
Parry C.M., T.T.H. Nguyen, D. To Song, W. John and T.C. Nguyen.
1999. Value of a single-tube Widal test in diagnosis of typhoid fever
in Vietnam. J. Clin. Microbiol. 37: 2882–2886.
Pestka J.J. and F.S. Chu. 1984. Aflatoxin B1 dihydrodiol antibody:
production and specificity. Appl Environ Microbiol. 47: 472–477.
Rai GP., K. Zachariah and S. Shrivastava. 1989. Comparative efficacy
of indirect haemagglutination test, indirect fluorescent antibody
test and enzyme linked immunosorbent assay in serodiagnosis of
typhoid fever. J. Trop. Med. Hyg. 92: 431–434.
Saha S.K., M. Ruhulamin, M. Hanif, M. Islam and W.A. Khan.
1996. Interpretation of the Widal test in the diagnosis of typhoid
fever in Bangladeshi children. Ann. Trop. Peadiatr. 16: 75–78.
Satoh PS., A.J. Elberg, W.E. Fleming, H.J. Baluarte and A.B.
Gruskin. 1980. Heterophile antibodies in the serum of children
with nephrotic syndrome. Vox. Sang. 39: 128–133.
Schetters T., J. Van Run-Van Breda, A. and W. Eling. 1988. Selec-
tive depletion of immunoglobulin isotypes after decomplementation
of mouse sera by heat treatment. J. Immunol. Methods. 109: 193–197.
Sharma M., U. Datta, P. Roy, S. Verma and S. Sehgal. 1997. Low
sensitivity of counter-current immuno-electophresis for serodiag-
nosis of typhoid fever. J. Med. Microbiol. 46: 1039–1042.
Steinitz M. 2000. Quantitation of the blocking effect of tween 20
and bovine serum albumin in ELISA microwells. Anal. Biochem.
282: 232–238.
Tamura T., F. Merino, K. Kano, P. Ramirez-Duque and
F. Milgrom. 1984. Heterophile antibodies in sera of patients with
Chediak-Higashi syndrome. Int Arch Allergy Appl Immunol. 73:
186–188.
Verdugo-Rodriguez A., Y. Lopez-Vidal, J.L. Puente, G.M. Ruiz-
Placios and E. Calva. 1993. Early diagnosis of typhoid fever
by Enzyme Immunoassay using Salmonella typhi outer mem-
brane protein preparation. Eur. J. Clin. Microbiol. Infect. Dis. 12:
248–254.
Wain J. and S. Hosoglu. 2008. The laboratory diagnosis of enteric
fever. J. Infect. Dev. Ctries. 2: 421–5.
Yoshida H., N. Takeda, T. Nishimaki, T. Morito, R. Kasukawa,
K. Kano and F. Milgrom. 1980. Heterophile antibodies in Japanese
patients with various diseases including infectious mononucleosis.
Immunol. Commun. 9: 403–408.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 143–145

SHORT COMMUNICATION

Susceptibility of Polish Bartonella henselae Strains

Edyta Podsiadły1*, Dorota Żabicka2, Urszula Demkow3, Waleria Hryniewicz2
and Stanisława Tylewska-Wierzbanowska1

National Institute of Public Health – National Institute of Hygiene, Warsaw, Poland

1

2
National Medicines Institute, Warsaw, Poland, 3Warsaw Medical University

Received 10 December 2011, revised 5 April 2012, accepted 20 April 2012

Abstract

Due to the fastidious nature of B. henselae and the limited number of available isolates worldwide, there are few data on its in vitro suscep-
tibility to antibiotics. We determined the minimal inhibitory concentrations (MIC) of ten antimicrobial agents against 11 feline isolates
of B. henselae by Etest method. The lowest MICs were obtained for rifampicin ≤ 0.002 mg/L. MICs of all isolates were < 0.016 mg/L for
ampicilin, amoxicillin/clavulanic acid, tetracycline and ranged from 0.016 to 0.032 mg/L for azithromycin. The MICs for two tested fluoro-
quinolones: ciprofloxacin and levofloxacin ranged from 0.016 to 0.125 mg/L. The highest MICs were obtained for gentamicin ranging from
0.025 to 2.0 mg/L. Sulphonamide resistance genes sul 1, sul 2, sul 3 were not found in any of the tested isolates. Etest methodology seems
to be a reliable method for determination of B. henselae susceptibility, however standardization is strongly desired.

K e y w o r d s: Bartonella henselae, MIC, antibiotics

Over the last decade the number of Bartonella spe-
cies has increased rapidly. Simultaneously some new
species have been associated with clinical syndromes
in humans (Chomel et al., 2006). Treatment of human
bartonellosis depends on the clinical presentation of
the disease. Recommendations for treatment are based
on a few case reports and a few clinical studies (Rolain
et al., 2004). Because of limited number of isolates,
specially human isolates, also data regarding in vitro
susceptibility are very limited. Isolation of Bartonella
spp. from clinical specimens requires long incubation
times, special growth conditions and is rarely possible.
As feline strains are easier to culture, susceptibility test-
ing can be done on these isolates. The aim of the present
study was to determine the MICs of 10 antibiotics by
Etest method for 11 B. henselae feline strains. More-
over, the presence of sul genes conferring sulphonamide
resistance was determined in the examined isolates.
Eleven B. henselae strains were collected from
healthy, stray cats in 2004–2005 in urban areas of War-
saw and surroundings. For susceptibility study the
strains were recovered from frozen stocks onto choco-
late blood agar supplemented with VITOX (Choc  V,
Oxoid) and cultured at 37°C in 5% CO2 enriched atmo-
sphere. Microorganisms were harvested, from second
passage after refreezing, from logarithmic growth on
chocolate agar (7–8 days), centrifuged and suspended in
2 ml of sterile 0.9% NaCl and adjusted to a McFarland
standard of 3.0. The suspension was swabbed on the
entire surface of a chocolate blood agar plate supple-
mented with VITOX (Choc V, Oxoid) 3 times, rotating
the plate approximately 90 degrees each time. Excess
moisture was allowed to absorb for about 10 to 15 min-
utes. Susceptibility testing was performed for: trime-
thoprim-sulphamethoxazole (0.002–32), ampicilin
(0.016–256), amoxicillin/clavulanic acid (0.016–256),
cefotaxime (0.016–256), azithromycin (0.016–256), cip-
rofloxacin (0.002–32), levofloxacin (0.002–32), tetracy-
cline (0.016–256), gentamicin (0.016–256), clindamy-
cin (0.016–256), rifampicin (0.002–32) using E-tests
(bioMèrieux, former AB BIODISK, Sweden). Zones of
inhibition were recorded on the 4th and 7th day of incu-
bation as a point of intersection between the inhibition
ellipse edge and Etest strip. A growth control plate was
inoculated with each test run.
In order to check the performance of Etest CLSI
reference strains: Enterococcus faecalis ATTC 29212
for gentamicin and clindamycin, E. coli ATCC 35218 for
amoxicillin/clavulanic acid and Haemophilus influenzae
ATCC 49247 for remaining tested antibiotics were used
as the quality control.
Studied strains of B. henselae were screened for sul 1,
sul 2 and sul3 genes using specific oligonucleotide prim-
ers, as previously described (Kerrn et al., 2002; Perreten

*  Corresponding author: E. Podsiadły, Laboratory of Rickettsiae, Chlamydiae and Spirochetes, National Institute of Public Health-
National Institute of Hygiene, 24 Chocimska Street, 00-791 Warsaw; phone: +4822 4521250; e-mail: epodsiadly@onet.pl
144 Podsiadły E. et al. 2

and Boerlin, 2003). Total genomic DNA was extracted
from Bartonella isolates, cultured for 7 days in condi-
tions described above with QIAamp Tissue kit (Qiagen,
Hilden, Germany) according to manufacturer instruc-
tion. The PCR conditions were as follows: initial dena-
turation 94°C for 5 min followed by 35 cycles: 94°C for
1 min, 60°C (sul 1, sul 2)/51°C (sul 3) 1 min, 72°C 1 min
and final extension 72°C 10 min (Gradient Mastercy-
cler, Eppendorf). Two E. coli strains susceptible and
two resistant to trimethoprim-sulphamethoxazole in
a standard disc diffusion method were run as controls.
Among 11 tested feline isolates of B. henselae by
Etest method the lowest MICs were obtained for rifam-
picin ≤ 0.002 mg/L (Table I). All isolates were highly
susceptible to tetracycline with MICs ≤ 0.016 mg/L.
Also the macrolide – azithromycin was highly active
with MICs ranging from 0.016 to 0.032 mg/L.
The tested B. henselae strains were highly suscep-
tible to β-lactams. MICs of tested antibiotics from
this group were as follows: ampicilin and amoxicillin/
clavulanic acid < 0.016 mg/L; cefotaxime ranged from
0.016 mg/L to 0.047 mg/L. This fact however has lim-
ited clinical value as bactericidal effect of this group
of antibiotics is restricted only to extracellular bacteria
whereas intraerythrocytic Bartonella are protected from
their activity.
The highest MICs were obtained for gentamicin,
ranging from 0.25 mg/L to 2.0 mg/L. MICs determined
for gentamycin were higher than for other antibiotics
and ranged up to 2.0 mg/L. Among aminoglycosides
netilmicin was reported to be the most active agent
(Dorbecker et al., 2006).
For two tested fluoroquinolones: ciprofloxacin and
levofloxacin MICs ranged from 0.016 to 0.125 mg/L.
Eight of 11 (72.7%) tested strains had MIC for levo-
floxacin higher or equal to 0.094 mg/L whereas for
ciprofloxacin for the majority of strains (63.3%, 7/11)
values of MIC were 0.047 mg/L and lower. Comparing
the obtained MICs for ciprofloxacin and levofloxacin it
seems that ciprofloxacin is slightly more active against
Bartonella spp. than levofloxacin however,a higher dos-
age is applied in case of the latter. Despite the fact that
fluoroquinolones have the ability to achieve high intra-
cellular concentrations, their potential role in the ther-
apy of Bartonella infections remains unclear. Although
successful treatment of Bartonella infections with fluo-
roquinolones has been reported, there have also been
failures and relapses with these drugs (Wolfson et al.,
1996). Recently Angelakis et al. (2009) reported that
B. henselae can easily become resistant to fluoroqui-
nolones. A ciprofloxacin-resistant strain of B. henselae
was obtained in vitro after only four passages, MIC for
the strain increased from 0.38 to > 32 mg/L. Barton­
ella spp. present a natural Ser-83-Ala mutation (E. coli
numbering) in the QRDR region of the DNA gyrase
that is responsible for decreased susceptibility to fluo-
roquinolones. Additional mutation Asp-87-Gly in the
gyrase A  protein results in a high level of resistance
to all quinolone compounds (Angelakis et al., 2008).
According to some authors, a second mutation may be
obtained easily with consequent high level of resistance
to fluoroquinolones. It is suggested that fluoroquino-
lone compounds should be avoided for treatment of
bartonellosis. Bacterial resistance to fluoroquinolones
developing during treatment is not restricted to Bar­
tonella but is also observed in other bacteria species.
According to EUCAST (version 2.0, valid from
January 1, 2012, www.eucast.org) for the non-species

Table I
MIC distribution (mg/L) determined by Etest method for 11 B. henselae isolates

No 16S rRNA MLVA

Am XL CT AZ CI LE TC TS GM CM RI
strain type profile1
   3 II 9, 14, 5, 1, 2 0.016 0.016 0.016 0.016 0.047 0.125 0.016 nd 0.094 0,25 0.003
  12 II 11, 20, 10, 1, 2 0.016 0.016 0.016 0.016 0.047 0.094 0.016 nd 0.5 >256 0.002
  13 I 12, 24, 2, 5, 3 <0.016 <0.016 0.016 0.016 0.094 0.125 0.016 nd 0.25 0.75 0.004
  28 II 10, 14, 2, 2, 1 0.016 <0.016 0.032 0.032 0.125 0.064 0.016 nd 1.0 >256 0.003
  30 II 14, 24, 10, 7, 3 0.016 0.016 0.016 0.016 0.047 0.094 0.016 nd 0.5 >256 0.002
129 II 9, 15, 18, 1,1 0.016 0.016 0.016 0.016 0.047 0.032 0.016 nd 1.0 0.064 0.002
130 II 9, 15, 18, 1, 1 0.16 0.016 0.016 0.016 0.064 0.125 0.016 nd 0.38 0.25 0.003
150 II 9, 15, 2, 2, 1 0.016 0.016 0.016 0.023 0.125 0.094 0.016 nd 1.0 >256 0.004
154 II 12, 15, 2, 2, 4 0.016 0.016 0.016 0.016 0.047 0.064 0.016 nd 0.75 >256 0.002
159 II 9, 15, 2, 1, 1 <0.016 <0.016 0.047 0.032 0.016 0.125 0.016 nd 2.0 3 0.030
163 II 12,23,18,5,3 0.016 0.016 0.016 0.016 0.047 0.125 0.016 nd 0.5 6 0.002

profiles shown as numbers (alleles) corresponding in order with the loci BHV-A, BHV-B, BHV-C, BHV-D, BHV-E; nd – not detectable;
1

Am-ampicillin, XL-amoxicillin/clavulanic acid, CT-cefotaxim, AZ-azithromycin, CI-ciprofloxacin, LE-levofloxacin, TC-tetracycline,

TC-trimetoprim/sulfamethoxazole (1/19), GM-gentamicin, CM-clindamycin, RI-rifampicin
2 Short communication
related breakpoints based on standard dosages and
pharmacokinetic and pharmacodynamic properties
of an antibiotic all analyzed drugs were in the range
of susceptible values. However the gentamicin MIC
= 2.0 mg/L obtained for one strain in our study is the
highest possible value for susceptible strains.
Reading and interpretation zones of inhibition
for sulphonamides and trimethoprim was not pos-
sible because the point of complete inhibition was not
distinguishable at the edge of E-test. PCR testing for
the presence of sulphonamide resistance genes was
applied. In none of our tested strains sulphonamide
resistance genes sul 1, sul 2, sul 3 were found. Sulfon-
amides, especially in the combination as trimethoprim-
sulfamethoxazole, are widely used to treat bacterial
and protozoal infections (Perreten and Boerlin, 2003).
These agents are also effective in the treatment of CSD
(Rolain et al., 2004). Sulfonamides alone are widely used
to prevent and treat diarrhea and other infectious dis-
eases in intensive animal husbandry. That can have an
impact on the spread of sulphonamide resistance genes,
which are associated with class 1 integrons residing in
plasmids or the bacterial chromosome. Especially that
persistent asymptomatic bacteriemia in cats is reported
to last up to 2 years (Chomel et al., 2006). This is to our
knowledge the first study searching for the presence of
sulfonamide resistance genes in Bartonella.
The susceptibility of the strains was set against pre-
vious molecular characteristics of the strains (Podsiadly
et al., 2012). No significant variation in susceptibility
with genotype (16S rRNA type) was detected. However,
three already described profiles for BHV A-B-C-D-E
(9-15-2-1-1, 10-14-2-2-1 and 9-15-2-2-1) correspond-
ing to three common European VNTR profile for
feline isolates, presented four dilutions higher MIC for
gentamicin and six dilutions higher MICs for cipro-
floxacin (Table I).
Etest methodology seems to be a reliable method for
determination of B. henselae. susceptibility. Our results
correlate with MICs reported by Pendle et al. (2006) and
Angelakis et al. (2009). MICs obtained for fluoroquino-
lones and gentamicin are compatible with the results of
testing other Bartonella spp. isolates (Tsuneoka et al.,
2010). However, the differences in MICs between stud-
ies are also visible. For example in the study by Dor-
becker et al. (2006) MICs for gentamicin were up to
8 mg/L whereas in our study only in 1 of 11 strains MIC
equaled 2 and in 3 strains MIC = 1.0 mg/L. A similar
situation was found for the MICs of ciprofloxacin and
levofloxacin for which recorded MICs were 4  times
145
higher than in our study. The discrepancies in MIC
values might be influenced by many factors such as:
medium, inoculum and others. Standardization should
be proposed to monitor the development of resistance
in isolates and to enable comparison of results reported
in the different studies.
Routine susceptibility testing of B. henselae isolates
is impossible, therefore the surveillance studies made
by specialized reference centres are important to review
treatment recommendations, specially of persistent bar-
tonella infections and for monitoring the emergence of
resistance in this group of bacteria.
Literature
Angelakis E., S. Biswas, C. Taylor, D. Raoult and J.M. Rolain.
2008. Heterogeneity of susceptibility to fluoroquinolones in Bar-
tonella isolates from Australia reveals a natural mutation in gyrA.
J. Antimicrob. Chemother. 61: 1252–1255.
Angelakis E., D. Raoult and J.M. Rolain. 2009. Molecular charac-
terization of resistence to fluorochinolones in Bartonella henselae
and Bartonella quintana. J. Antimicrob. Chemother. 63: 1288–1289.
Chomel B.B., H.J. Boulouis, S. Maruyama and E.B. Breitschwerdt.
2006. Bartonella spp. in pets and effect on human health. Emerg.
Infect. Dis. 12: 389–394.
Dorbeckler C., A. Sander, K. Oberle and T. Schulin-Casonato.
2006. In vitro susceptilibity of Bartonella species to 17 antimicrobial
compounds: comparision of Etest and agar dilution. J. Antimicrob.
Chemother. 58: 784–788.
Kerrn M.B., T. Klemmensen, N. Frimodt-Moller and F. Espersen.
2002. Susceptibility of Danish Escherichia coli strains isolated from
urinary tract infections and bacteraemia, and distribution of sul
genes conferring sulphonamide resistance. J. Antimicrob. Chemother.
50: 513–516.
Pendle S., A. Ginn and J. Iredell. 2006. Antimicrobial susceptibil-
ity of Bartonella henselae using Etest methodology. J. Antimicrob.
Chemother. 57: 761–763.
Perreten V. and P. Boerlin. 2003. A new sulfonamide resistance
gene (sul 3) in Escherichia coli is widespread in the pig population
of Switzerland. Antimicrob. Agents Chemother. 47: 1169–1172.
Podsiadly E., N. Haddad, M. Berrich , R. Bouchouicha, B. Durand,
M. Monteil, HJ Boulouis and S. Tylewska-Wierzbanowska. 2012.
Characterization of Polish feline B. henselae isolates by multiple-
locus tandem repeat analysis and pulse field electrophoresis. Ann.
Agric. Environ. Med. 19: 39–44.
Rolain J.M., P. Brouqui, J.E. Kohler, C. Maguina, M.J. Dolan and
D. Raoult. 2004. Recommendations for treatment of human infec-
tions caused by Bartonella species. Antimicrob. Agents Chemother.
48: 1921–1933.
Tsuneoka H, M. Yanagihara, J. Nojima and K. Ichihara. 2010.
Antimicrobial susceptibility by Etest of Bartonella henselae isolated
from cats and human in Japan. J. Infect. Chemother. 16: 446–448.
Wolfson C., J. Branley and T. Gottlieb. 1996. The Etest for antimi-
crobial susceptibility testing of Bartonella henselae. J. Antimicrob.
Chemother. 38: 963–968.
Polish Journal of Microbiology
2012, Vol. 61, No 2, 147–150

SHORT COMMUNICATION

The Relationship between H. pylori Virulence Genotypes

and Gastric Diseases

Yun en Liu, Yue hua Gong, Li ping Sun, Qian Xu and Yuan Yuan*

Tumor Etiology and Screening Department of Cancer Institute and General Surgery,
the First Affiliated Hospital of China Medical University
and Key Laboratory of Cancer Control in Liaoning Province, Shenyang, China

Received 22 September 2011, revised 7 February 2012, accepted 7 May 2012

Abstract

There have been no reports on the relationship between virulence genes and gastric diseases based on the same bacterial colonization den-
sity. Our results indicated that Helicobacter pylori virulence genes were more relevant than colonization density as a pathogenic mechanism
of gastric diseases, which helps elucidate the pathogenic mechanisms of bacteria and aids in the development of improved strategies for
the treatment of gastric disease.

K e y w o r d s:  H. pylori, colonization density, cagA, vacA, iceA

Approximately half of the world’s population is
infected with Helicobacter pylori and it has been asso-
ciated with chronic gastritis, peptic ulcer and gastric
carcinoma (Momtaz et al., 2010). Most infected people
remain asymptomatic, and only 15–20% of H. pylori
positive individuals develop the associated diseases
(Franco et al., 2008). Why some infected people develop
these sequelae and others do not is unknown, but one
possible explanation is that some H. pylori strains are
more pathogenic than others. Over the last few years,
increased attention has been given to the significance of
H. pylori virulence genes, such as the vacuolating cyto-
toxin (vacA), the cytotoxin associated gene A(cagA)
and a gene induced by contact with the gastric epithe-
lium (iceA)(Boyanova et al., 2009). Nevertheless, the
clinical relevance of the virulence associated genes of
H. pylori is still a matter of controversy. Several stud-
ies have reported an influence of virulence genes on
the clinical outcomes of H. pylori infections in differ-
ent geographical regions. One hypothesis for why these
strains are associated with different clinical outcomes is
that there is a marked discrepancy between the number
of individuals colonized and those with clinical symp-
toms. Low bacterial colonization density was correlated
significantly with mild degrees of gastric neutrophil
infiltration (Kaklikkaya et al., 2006) and macroscopic
erosions (Molnar et al., 2008), and high bacterial den-
sity was more significantly associated with peptic ulcers
than chronic gastritis (Boyanova, 2007). Therefore,
quantified bacterial density is optimal for helping eluci-
date the pathogenic mechanisms of H. pylori and aiding
in the development of improved strategies for the treat-
ment of gastric disease.
The aim of our study was to explore the relationship
between virulence-associated genes and gastric diseases
based on the same bacterial colonization density.
This study was approved by the Ethics Committee
of the China Medical University and all subjects signed
an informed consent form before inclusion. A total of
174 patients (99 males and 75 females, 30–82 y, mean
age 53 y) were involved in the study. Three biopsy
specimens from each patient were placed in 10% for-
malin and processed in paraffin blocks. All sections
were stained with hematoxylin and eosin and a single
experienced pathologist reviewed all the slides accord-
ing to the criteria proposed in the updated Sydney sys-
tem. The distribution of clinical disease was as follows:
67  patients had superficial gastritis (SG); 20 patients
had gastric ulcer (GU); 63 patients) had atrophic gas-
tritis (AG) and 24 patients had gastric cancer (GC).
Detection of H. pylori was carried out by immu-
nohistochemical staining using polyclonal anti-H. py-
lori antibody and peroxidase-conjungated streptavi-
din (DAKO A/S, Denmark). We graded the density of

*  Corresponding author: Y. Yuan, The First Affiliated Hospital of China Medical University, 155 Northern Nanjing Street, Heping
District, Shenyang 110001, Liaoning Province, China; phone: 024-83282292, e-mail: yyuan3@hotmail.com
148 Yun En Liu et al. 2

Fig. 1. Representative gastric sections stained immunohistochemically for anti-H. pylori-IgG. H pylori(arrow) were stained brown
and were demonstrated on the apical and/or lateral surface of the surface mucous cells on which H. pylori were seen as small aggregates
with detached epithelial cells.
A: low bacterial density (original magnification ×200); B: moderate to severe bacterial density (original magnification ×100)

H. pylori infection according to the number of indi-
vidual bacteria that were counted in a highly magni-
fied visual field (×1000 light-microscopy) (Fig. 1). The
density of H. pylori infection was defined as follows:
0 = 0; 1 + = 1 – 9; 2 + = 10 – 29; and 3 + = 30 – 99. Details of
the method have been published elsewhere (Tokunaga
et al., 2000).
In this study, we extracted H. pylori-DNA directly
from gastric tissues infected by H. pylori. PCR ampli-
fications (Table I) were performed in an automated
thermal cycler. PCR products were analyzed by 1% aga-
rose gel electrophoresis with ethidium bromide staining
and were visualized under a short wavelength ultra-
violet light source. The results were analyzed using the
x2 test and with Yates continuity correction and the
Fisher exact test. Results were considered statistically
significant when the p-values were less than 0.05.
The results showed that patients suffering from
SG, GU, AG and GC were predominantly affected by
moderate to severe bacterial infection. Bacterial colo-
nization density was moderate to severe (grades 2–3)
in 53/67 of SG strains and 47/63 of AG strains, show-
ing there was no significant correlation between the
density of the bacterial colonization and the presence

Table I
Polymerase chain reaction for amplification of cagA, vacA and iceA genes

Region Prime Nucleotide sequence(5’-3’) Size of product (bp)

cagA CAGAF GGCAATGGTGGTCCTGAGGCTAGGC 324
CAGAR GAGAATCTTTAATCTCAGTTCGG
vacAs1/s2 VA1-F ATGAGAATACAACAAACACAC 259/286
VA1-R CTGCTTAGATGCGCCAAAC
vacA m1a VA3-F GGTCAAAATGCGGTCATGG 290
VA3-R CCATTGGTACCTGTAAGAAC
vacAm1b VAM-F3 GGCCCCAATGCAGTCATGAGT 291
VAM-R3 GCTGTTAGTGCCTAAAAGAGCAT
vacAm2 VA4-F GAGGCCCCAGAGAACATTG 352
VA4-R CATAACTAGCGCCTTGCAC
iceA1 ICEA1F GTGTTTTTAACCAAAGTATC 247
IVEA1R CTATAGCCASTYTCTTTGCA
iceA2 ICEA2F GTTGGGTATATCACAATTTAT 334
ICEA2R TTRCCCTATTTTCTAGTAGGT
2 Short communication 149

Table II gastric diseases compared to the density of bacterial

Distribution of bacterial colonization density in patients colonization, it should be recognized that most patients
Bacterial colonization density
suffering from SG, AG and GC that were infected by
Gastric
diseases
Total bacteria were from areas with a higher prevalence of
0–1 2–3
gastric cancer and where moderate to severe density of
SG 14 (20.90) 53 (79.10) 67
H. pylori was prevalent, which suggests that the high
GU   3 (15.00) 17 (85.00) 20
a
bacterial colonization density, to a lesser degree, may be
AG 16 (25.40) 47b (74.60) 63 a factor in the development of H. pylori induced gastric
GC   9 (37.50) 15c (62.50) 24 diseases. Many more cases need to be further evaluated
Total 34 66 174 to provide more reliable results about the relationship
0–1,low bacterial density; 2–3, moderate to severe bacterial density; between specific genotypes and gastric diseases based
a
p = 0.7931vs SG; b p = 0.689vs SG; c p = 0.183vs SG on the same density of bacteria.

Table III
Distribution of bacterial genotypes in patients based on the same bacterial density (grade 2–3)

H. pylori genotypes (%)

Diseases Total
cagA vacAs1 vacAm1 vacAm2 iceA1 iceA2
SG 30 (56.60)   48 (90.57) 36 (67.92) 17 (32.08) 35 (66.04) 30 (56.60) 53
GU 10 (58.82)   17 (100.00) 10 (58.82) 12d (70.59) 10 (58.82) 11 (64.71) 17
AG 21 (44.68)   30 (63.83) 15a (31.91) 40c (85.11) 22 (46.81) 20 (42.55) 47
GC   7 (46.67)   11 (73.33)   3 (20.00)  7 (46.67)  4 (26.67)   7 (46.67)
b e
15
Total 68 (51.52) 106 (80.30) 64 (48.48) 76 (57.58) 71 (53.79) 68 (51.52) 132
a
P = 0.000vs SG; b P = 0.001vs SG; c P = 0.000vs SG; d P = 0.002vs SG; e P = 0.015vs SG

of atrophic gastritis (p = 0.689). In addition, bacterial
density was moderate to severe (grades 2–3) in 53/67
of SG strains and 15/24 of GC strains, showing there
was no significant correlation between the density of
the bacterial colonization and GC (p = 0.183)(Table II).
SG patients more often harbored strains with the
vacAm1 genotype (67.92%, 36 of 53 cases) than the
AG or GC patients (31.91%, 15 of 47 cases, p = 0.000
and 20.00%, 3 of 15 cases, p = 0.001, respectively). In
addition, AG patients more often harbored strains
with the vacAm2 genotype (85.11%, 40 of 47 cases)
than the SG patients (32.08%, 17 of 53 cases, p = 0.000)
(Table III).
In order to exclude interference from the density of
bacteria, we explored the relationship between H. pylori
virulence genes and gastric diseases based on the same
colonization density. We first found the vacAm2 strain
was significantly associated with AG. Few have reported
an association between vacAm2 and gastric diseases
except vacAm2 strains were associated with gastritis in
Iranian patients (Dabiri et al., 2010). The reason why
vacAm alleles induce different types of gastritis might
be that the m1 and m2 forms of the VacA cytotoxin may
recognize different receptors on human gastric epithe-
lial cells (Nogueira et al., 2001), and there is a higher
level of cytotoxin production by vacA s1/m1 strains as
compared to vacA s1/m2 strains. Although the results
suggested virulence genes might play a critical role in
In conclusion, our results indicated that H. pylori
virulence genes were more relevant than colonization
density as a pathogenic mechanism of gastric diseases,
which helps elucidate the pathogenic mechanisms of
bacteria and aids in the development of improved strat-
egies for the treatment of gastric disease.
Acknowledgments
This study was funded partly by the National Key Basic Research
Program of China, (973 Program No.2010CB529304) and the Foun-
dation of the Key Laboratory in Liaoning Province (No.LS2010167)
and the Foundation of the Technology Project of Liaoning Province
(2008–621).
Literature
Franco A.T., E. Johnston and U. Krishna. 2008. Regulation of gas-
tric carcinogenesis by Helicobacter pylori virulence factors. Cancer
Res. 68: 379–87.
Boyanova L. 2007. Detection of Helicobacter pylori infection in
symptomatic Bulgarian adults. Clin. Microbiol. Infect. 13: 908–914.
Nogueira C., C. Figuiredo and F. Carneiro. 2001. Helicobacter
pylori genotypes may determine gastric histopathology. Am. J. Pathol.
158: 647–654.
Dabiri H., M. Bolfion and A. Mirsalehian. 2010. Analysis of
Helicobacter pylori genotypes in afghani and Iranian isolates. Pol.
J. Microbiol. 59: 61–66.
Momtaz H., N. Souod and H. Dabiri. 2010. Comparison of the
virulence factors of Helicobacter pylori isolated in Stomach and
Saliva in Iran. Am. J. Med. Sci. 340: 345–349.
150 Yun En Liu et al. 2

Boyanova L., R. Markovska and D. Yordanov. 2009. High preva-
lence of virulent Helicobacter pylori strains in symptomatic Bulgar-
ian patients. Diagn. Micr. Infec. Dis. 64: 374–380.
Molnar B., D. Szoke and A. Ruzsovics. 2008. Significantly elevated
Helicobacter pylori density and different genotype distribution in
erosions as compared with normal gastric biopsy specimen detected
by quantitative real-time PCR. Eur. J. Gastroenterol. Hepatol. 20:
305–313.
Kaklikkaya N., K. Cubukcu and F. Aydin. 2006. Significance of
cagA status and vacA subtypes of Helicobacter pylori in determining
gastric histopathology: Virulence markers of H. pylori and histo­
pathology. J. Gastroen. Hepatol. 21: 1042–1047.
Tokunaga Y., H. Shirahase and E. Yamamoto. 2000. Modified rapid
urease test for Helicobacter pylori detection in relation to an immu-
nohistochemical stain. J. Gastroen. Hepatol. 15: 617–621.