SCIENCE ADVANCES | RESEARCH ARTICLE

CELL BIOLOGY Copyright © 2021

The Authors, some
The major mechanism of melanoma mutations is based rights reserved;
exclusive licensee
on deamination of cytosine in pyrimidine dimers American Association
for the Advancement
as determined by circle damage sequencing of Science. No claim to
original U.S. Government
Works. Distributed
Seung-Gi Jin1, Dean Pettinga2, Jennifer Johnson1, Peipei Li3, Gerd P. Pfeifer1* under a Creative
Commons Attribution
Sunlight-associated melanomas carry a unique C-to-T mutation signature. UVB radiation induces cyclobutane NonCommercial
pyrimidine dimers (CPDs) as the major form of DNA damage, but the mechanism of how CPDs cause mutations is License 4.0 (CC BY-NC).
unclear. To map CPDs at single-base resolution genome wide, we developed the circle damage sequencing
(circle-damage-seq) method. In human cells, CPDs form preferentially in a tetranucleotide sequence context
(5′-Py-T<>Py-T/A), but this alone does not explain the tumor mutation patterns. To test whether mutations arise at
CPDs by cytosine deamination, we specifically mapped UVB-induced cytosine-­deaminated CPDs. Transcription
start sites (TSSs) were protected from CPDs and deaminated CPDs, but both lesions were enriched immediately
upstream of the TSS, suggesting a mutation-promoting role of bound transcription factors. Most importantly, the
genomic dinucleotide and trinucleotide sequence specificity of deaminated CPDs matched the prominent muta-
tion signature of melanomas. Our data identify the cytosine-deaminated CPD as the leading premutagenic lesion
responsible for mutations in melanomas.

INTRODUCTION
Cancer genome sequencing has identified millions of somatic
mutations in different types of human cancer (1–4), in some cases
pointing to a potential origin of these mutations. Cancers linked to
environmental exposures show tumor-specific mutational signatures
electronic excited states. Any two adjacent pyrimidine bases can
dimerize via their 5,6 double bonds. The second most frequent lesion
produced by UVB irradiation is the pyrimidine (6-4) pyrimidone
photoproduct [(6-4) photoproduct]. In comparative mutagenesis
experiments, the CPD has been shown to be at least five times more

Downloaded from https://www.science.org on September 19, 2021

(5). For example, smoking-associated lung cancers carry a prevalent
C/G to A/T mutation signature, as initially defined by Alexandrov
et al. (1, 6). Another example is urothelial carcinomas linked to
consumption of plants that contain the mutagen aristolochic acid,
which produces characteristic A-to-T transversions (7). The theory
that a particular exposure is linked to a cancer is particularly
compelling when it is supported by epidemiological evidence and
by mechanistic studies that attempt to recapitulate the mutagenesis
process in vitro or in vivo.
Most melanomas and nonmelanoma skin cancers are linked to
sunlight exposure. The ultraviolet B (UVB) component of sunlight
(280 to 315 nm) is strongly carcinogenic in mouse models (8), and
of particular relevance is the wavelength above 300 nm, which
reaches the earth’s surface. For most sequenced melanoma genomes,
C-to-T mutations at dipyrimidine sequences (for example, at TC or
CC) are highly prevalent, suggesting that UVB radiation from sun
exposure is involved in their formation (9, 10). Individual melanoma
genomes may harbor thousands of such mutations. These same
mutations are observed in various experimental systems when UV
radiation is used as the mutagen (11, 12). However, it is unknown
what specific mechanism is responsible for these melanoma mutations.
UVB radiation induces various forms of DNA damage in ex-
posed cells (13). The most frequent damage type is the cis-syn
cyclobutane pyrimidine dimer (CPD), which arises after absorption
of photons by DNA bases and occurs through the formation of
1
Department of Epigenetics, Van Andel Institute, Grand Rapids, MI 49503, USA.
2
Bioinformatics and Biostatistics Core, Van Andel Institute, Grand Rapids, MI 49503,
USA. 3Department of Neurodegenerative Science, Van Andel Institute, Grand Rapids,
MI 49503, USA.
*Corresponding author. Email: gerd.pfeifer@vai.org
mutagenic than the (6-4) photoproducts (14). One reason for this
difference is the generally rapid global repair of (6-4) photoproducts
(within minutes or hours) relative to CPDs, which can persist for
days in irradiated cells or human skin. In addition to CPDs and
(6-4) photoproducts, other DNA photoproducts can be produced
in DNA at lower levels and may be relevant for atypical, non–C-to-T
mutations in melanoma (15). In addition, (6-4) photoproducts are
produced at even lower levels relative to CPDs when the irradiation
wavelength is greater than 300 nm (16), which is the most physiologi-
cally relevant part of the UV spectrum. Experiments with transgenic
mice in which either the CPDs or the (6-4) photoproducts were removed
by a specific repair enzyme have shown that removal of CPDs pro-
vides powerful protection against UVB-induced skin cancers (17).
The high frequencies of C-to-T and CC-to-TT double mutations
in melanoma and nonmelanoma skin cancers are therefore best ex-
plained by proposing the CPD as a premutagenic lesion. However,
it has remained unclear how CPD lesions induce the characteristic
C-to-T mutations in skin cancer. There are two major models: The
first one proposes that CPDs that contain cytosine are replicated by
DNA polymerases that incorporate adenine across from cytosine in an
error-prone pathway. This model has been referred to as the “A-rule”
for polymerase bypass of non-instructional DNA lesions (18). When
the CPD contains thymine, pairing with adenine will not lead to a
mutation. The lesion-tolerant DNA polymerase eta (POLH) has been
shown to bypass TT CPDs correctly by incorporating two adenines
(19, 20). A competing model suggests that cytosines, when part of a
CPD, are much more susceptible to hydrolytic deamination, a pathway
that generates CPDs containing uracil. When these U-containing
dimers are then bypassed by a polymerase with incorporation of
adenine, a C-to-T mutation is the outcome, and it occurs because of
the deamination reaction and not because of a polymerase error.

Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021 1 of 13

SCIENCE ADVANCES | RESEARCH ARTICLE

In this study, we set out to investigate the CPD deamination
mechanism with the goal of determining whether this specific pathway
can be linked to the frequent C-to-T mutations found in melanoma.
To perform this work, we first developed a new method for base
resolution and whole-genome analysis of DNA damage. We used
this new methodology, termed circle damage sequencing (circle-­
damage-seq), to separately map CPDs and deaminated CPDs in
human UVB-irradiated cells at the genome scale and at the single-base
level. Our data provide strong support for the CPD deamination
model being the mechanistic cause of most melanoma mutations.
RESULTS
Development of the circle-damage-seq method
To determine mutational mechanisms at the whole-genome scale, it is
critical to map the underlying DNA damage at single-base resolution
and genome wide. However, these methods need to be specific and
require high sensitivity. Because of the limitations often associated
with currently used methods, we developed a new strategy, which
we named circle-damage-seq. This method is based on DNA
damage–specific repair enzymes and allows sensitive detection and
genome-scale mapping of DNA base damage. The general outline
of this method is depicted in Fig. 1. The cells are first exposed to a
DNA-damaging agent and then harvested. DNA is purified and
sonicated to an average size of 300 to 400 base pairs (bp), a suitable
range for DNA circularization and downstream sequencing analysis
(see Methods). After sonication and end repair, a DNA circulariza-
tion step is carried out using a diluted ligation reaction with T4
DNA ligase. T4 ligase also repairs DNA single-strand breaks that would
contribute to background signals. Any remaining noncircularized
fragments are eliminated by applying an exonuclease mixture
(Fig. 1A). Then, the lesion is excised with a lesion-specific DNA repair
enzyme and abasic site–processing enzymes within the circularized
DNA to introduce a 1-nucleotide (nt) gap. Next, a double-strand
break is created at the DNA damage position by removing the single
nucleotide on the opposite strand of the gapped DNA molecules
with single-strand specific S1 nuclease, thus producing a double-­
strand break (Fig. 1B). The use of multiple enzymes has the potential

A B C
Circularization and DNA double-strand break Library sequencing
remove linear DNA (DNA repair enzymes) and analysis
Ligated bp Adaptor
DNA damage

Downloaded from https://www.science.org on September 19, 2021

Library
enrichment
N
DNA damage Adduct:

N
Repair enzyme Nick:
Plasmid-safe ATP-dependent DNase
S1 nuclease DSB:

Damage selective
1-bp gap sequencing
at damage site

Adaptor ligation ( ) Divergent paired reads

with 1-bp gap in the center

D O
CPD
NH2
CH3

N 5 5 N F
6 6 hg19: chr12:64,959,118-64,959,184
O N N O

E
UVB damage CPD:

T4-PDG & APE1 Nick: hg19: chr12:64,943,869-64,943,929

Photolyase Repair:

S1 nuclease DSB:

Fig. 1. Outline of circle-damage-seq. (A) DNA containing damaged bases (red) is sonicated, circularized, and then treated with an exonuclease cocktail. (B) DNA lesions
(arrows) are processed into DNA double-strand breaks (DSB) by base excision repair enzymes and S1 nuclease. Sequencing adaptors are ligated to the breaks. (C) DNA
library preparation for DNA damage–specific sequence enrichment. Divergent paired-end reads with single-base gaps indicate the damaged base positions. (D) Structure
of a CPD at a TC sequence. (E) Method for mapping of UVB-induced CPDs at single-nucleotide resolution. (F) Divergent paired reads of CPD mapping by circle-damage-seq.
Purple and lavender segments represent reads mapped to the plus and minus strands, respectively. Green arrows indicate single-base gaps matching the 5′ base of a
pyrimidine dimer. ATP, adenosine triphosphate; DNase, deoxyribonuclease.

Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021 2 of 13

SCIENCE ADVANCES | RESEARCH ARTICLE
to increase background of the procedure. We carefully optimized
each enzymatic step including enzyme concentrations, incubation
temperatures, and incubation times to minimize nonspecific DNA
cleavage. Circle-damage-seq uniquely enables sequencing of both
sides of the single cleavage site in one DNA molecule using paired-end
sequencing. Closed circular DNA without any recognized damaged
bases is excluded from the breakage and ligation steps, resulting in
lesion-selective DNA library enrichment by polymerase chain reac-
tion (PCR) (Fig. 1C). Notably, sequencing reads obtained from circle-­
damage-seq show a specific aligned read pattern, divergent reads
with a single-base gap in the center representing the damaged DNA
base, because each paired-end read is derived from a single opened
circular DNA molecule (Fig. 1C). Thus, circle-damage-seq provides
high selectivity for DNA damage mapping at single-nucleotide
resolution with low background at reduced sequencing depth. This
method should be applicable for mapping of any type of DNA dam-
age for which a DNA excision repair or cleavage enzyme is available.
We first tested the feasibility of circle-damage-seq by analyzing
the endogenous DNA modification N6-methyladenine (N6mA) in
Escherichia coli dam+ cells (fig. S1). DNA double-strand breakage at
N6mA bases within circularized DNA was achieved through Dpn I
cleavage, which generates a blunt end by splitting the target DNA
between 5′GN6mA and TC sequences. N6mA could readily be
mapped in E. coli (fig. S1).
Genomic mapping of UVB-induced CPDs
To map UVB-induced CPDs (Fig. 1D), the major mutagenic UVB-­
induced lesion at dipyrimidine sequences (14), we irradiated human
skin fibroblasts with UVB and immediately isolated the DNA. We
cleaved DNA at CPDs with T4 endonuclease V (also known as
A B
PyPyN3'
0.5
Event rate (relative to hg19 genome)
UVB (1000 J/m2)
0.4
0.3
0.2
0.1
0.0
0.02
Event rate (relative to hg19 genome)
NT
0.01
0.00
Fig. 2. Sequence context of CPD formation in human fibroblasts irradiated with UVB. (A) Distribution plot of trinucleotide sequences (PyPyN3′) undergoing CPD
formation in UVB-irradiated human cells (green). NT, nontreated control (red). Some background is seen in the NT samples at non-dipyrimidine sequences (the four trinu-
cleotides to the right). (B) Distribution plot of trinucleotide sequences (5′NPyPy) undergoing CPD formation in UVB-irradiated human cells (green). Data in (A) and (B) are
normalized for the trinucleotide frequencies of the human genome.
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
T4-PDG) (21). This enzyme can also cleave abasic sites; therefore, it
is important to minimize depurination during DNA isolation steps.
CPD induction was confirmed by gel electrophoresis after cleavage
of DNA with T4-PDG and S1 nuclease. As shown in Fig. 1E, to create
double-strand breaks at the CPD positions after T4-PDG incision,
we first used AP endonuclease 1 (APE1) to cleave the 5′ side of the
sugar-phosphate backbone at pyrimidine dimers. We followed this
treatment by incubation with E. coli photolyase under long-wave
UVA light to remove dimerized pyrimidine bases that remain after
the DNA glycosylase incision. Next, S1 nuclease treatment generated
ligatable DNA double-strand breaks within the circularized DNA.
The combined treatment creates a single-nucleotide gap representing
the 5′ pyrimidine of the dimer. We aligned the sequencing reads from
circle-damage-seq to the human reference genome. We observed the
divergent paired reads with a single-base gap in the center and con-
firmed the matching bases in the gaps as pyrimidines that have another
pyrimidine base in the 3′ position (Fig. 1F). We found this pattern with
a high frequency at 5′TT and 5′TC sites and at lower frequency at
5′CT and 5′CC dinucleotide sequences, consistent with the known
specificity of CPD formation at dipyrimidine sequences (10). Addi-
tional examples of genomic CPD mapping are shown in fig. S2.
Sequence specificity of CPD formation
Previous work has focused mainly on the dinucleotide specificity of
genomic UV damage (10, 12, 13, 22–24). We now analyzed tri-
nucleotide sequences that reflect the sequence specificity of CPD for-
mation in human fibroblasts using ~100 million aligned, divergent
read pairs with single-nucleotide gaps (Fig.  2). When normalized
Downloaded from https://www.science.org on September 19, 2021
for the known trinucleotide content of the human genome, the
most frequent sequence contexts considering the base flanking the
5'NPyPy
0.6
Event rate (relative to hg19 genome)
UVB (1000 J/m2)
0.5
0.4
0.3
0.2
0.1
0.0
0.02
Event rate (relative to hg19 genome)
NT
0.01
0.00
3 of 13
SCIENCE ADVANCES | RESEARCH ARTICLE
dimerized pyrimidines at the 3′ side were 5′TTA and 5′TCT (CPD
underlined), followed by 5′TCA (Fig. 2A). Thus, T is preferred in
the first position of the dimer, and T and A are the preferred bases
3′ to the most abundant CPDs (5′TT and 5′TC). The most highly
enriched trinucleotide sequences considering the 5′ neighboring
base of the CPDs were 5′CTT and 5′CTC, followed by 5′TTC and
5′TTT (Fig. 2B) showing a preference for having another pyrimidine
5′ to a pyrimidine dimer. Divergent reads with single-base gaps
were >300 times less frequent in nontreated (NT) cells than in
UVB-irradiated cells with no particular enrichment of sequencing
reads associated with such trinucleotides in the control samples
[Fig. 2, A and B (bottom)].
We also analyzed the preferred tetranucleotide sequence con-
texts for CPD formation (fig. S3), which were generally consistent
with the trinucleotide patterns. The sequence enrichments for the
5′NPyPyN tetranucleotide context (fig. S3C) were dominated by a
T in the second position and by having another pyrimidine as the
first base. This pattern is similar to one obtained after in vitro irra-
diation of DNA with UVB (25).
To identify even broader possible sequence motifs, we obtained
a base enrichment on 20-nt regions around the gapped base pair
using ~100 million aligned, divergent read pairs (Fig. 3A). Position
11 represents the nucleotide in the gap between divergent reads (the
5′ pyrimidine of the CPD). We observed a strong enrichment of
5′TT or 5′TC contexts at positions 11 and 12, representing the
pyrimidine dimers. In this motif, T or C was enriched at position
10, and T and A bases were enriched at position 13, consistent with
the tri- and tetranucleotide patterns. Unexpectedly, no further
sequence enrichment was observed outside of this tetranucleotide
context (positions 10 to 13). Our findings define a distinct tetra-
nucleotide sequence preference, 5′-Py-T<>Py-T/A, for the major type
of UVB damage in the human genome. This sequence is also found
at sites hypersensitive to UV radiation (24).
Gene level distribution of CPDs
Next, using ~36 million aligned, divergent read pairs, we examined
the global patterns of CPDs, with emphasis on their distribution
along genes. CPD formation in cells is chiefly uniform along the
genome and is largely dependent on DNA sequence, where 5′TY
sequences show the strongest accumulation of CPDs. In the meta-
gene profiles, we observed high levels of CPD formation immedi-
ately upstream of transcription start sites (TSSs) but a dip of CPDs
right around the GC-rich TSS sequences themselves at many gene
promoter regions (Fig. 3, B to D; see Fig. 3F and fig. S2 for specific
gene examples). This finding suggests that transcription factors at
promoter upstream regions may enhance CPD formation at many
sites, consistent with previous studies (22, 24, 26–30), even in the
absence of modulation by DNA repair. Melanoma mutations are
also sharply enriched just upstream of the TSS (31).
The metagene profile of CPD formation reveals a notable spike
of CPDs near the transcription end sites (TESs) of genes (Fig. 3E).
Human and mouse genes have an AT-rich sequence context near
the TES that contains polyadenylation signals (AATAAA) and their
surrounding sequences (32), which may lead to an enrichment of
CPDs containing thymine. However, a GC-rich sequence content is
only inversely correlated with CPD frequency right at the TSS. Just
upstream of the TSS, high GC content and CPD levels are correlated,
directly pointing to a role of DNA-bound proteins in CPD induc-
tion rather than the DNA sequence itself.
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
Genome-wide mapping of cytosine-deaminated CPDs
CPDs are known to be the most prevalent and most mutagenic
UVB-induced DNA lesions (14, 10). CPDs containing cytosine are
unstable. Owing to saturation of the 5,6 double bond of cytosine
upon dimer formation (Fig. 1D), they are prone to undergo hydro-
lytic cytosine deamination to form uracil, which could be a potentially
mutagenic pathway (33–35). We next applied the circle-damage-seq
method to analyze the extent of CPD cytosine deamination. We
irradiated human fibroblast cells with UVB and harvested them
24 and 48 hours later to allow time for deamination. To specifically
map the deaminated CPDs, we applied a photolyase-mediated re-
versal of the CPDs first, followed by the excision of U bases by uracil
DNA glycosylase (UDG) in the circle-damage-seq method (Fig. 4A).
This method successfully displays CPDs containing deaminated
cytosines at single-base resolution and shows cytosine in the single-­
base gap, as predicted (Fig. 4B and fig. S4A). With this method,
deamination of CPDs that contain 5-methylcytosine cannot be
detected because the deaminated base is thymine. We note that we
also observed double-base gaps at CC bases, indicating likely double
deamination events, but these were difficult to quantify because of
the unknown efficiency of UDG incision at UU sequences. There-
fore, we focused on the single C gaps.
The patterns of deaminated CPDs were largely independent of
total CPD patterns (fig. S4, B and C) because of their respective
differential sequence requirements. At a genomic scale, deaminated
CPDs were strongly depleted at many TSS regions and even more so
than total CPDs (Figs.  4,  C  and  D,  and  5, A and B, and fig. S5).
Genes with CpG island (CGI) promoters showed a dip of total
Downloaded from https://www.science.org on September 19, 2021
CPDs near the TSS, but this dip was missing in genes with non-CGI
promoters (Fig. 5, A and B). However, a lower level of deaminated
CPDs was still visible around the TSS, even in non-CGI promoters
(Fig. 5B). Overall, levels of deaminated CPDs increased with time
(Fig. 4C). Since deamination of CPDs is strictly a chemical reaction,
substantial levels of deaminated CPDs were found at the 0-hour
time point because the deamination reaction is expected to contin-
ue during DNA processing in vitro. The reasons for the lower levels
of deaminated CPDs at the TSS could be the reduced propensity of
TSS sequences to be transiently single stranded (which favors cyto-
sine deamination), the shielding of these regions by general tran-
scription factors, and/or the particularly rapid repair of these regions
(28, 36–38), which may proceed to some extent during the 48-hour
deamination time span even at the relatively high UV dose that we
used. At the TES, there is a spike of total CPDs but a dip of deami-
nated CPDs, which is likely based on DNA sequence features, i.e.,
AT richness of these regions (Fig.  5C). The highest level of CPD
formation and deaminated CPD formation was found at the regions
immediately upstream of the TSS of CGI promoters (Fig. 5A). This
finding suggests that bound protein factors can sensitize DNA to
UV light and promote mutagenesis (26–31, 39).
Sequence specificity of cytosine-deaminated CPDs
and relationship to melanoma mutations
Although TT and TC are the sequences most susceptible to CPD
formation (Fig. 2, A and B, and fig. S3), the thymine positions of
CPDs are not very mutagenic because of incorporation of adenine
opposite to thymine by POLH (19) or other DNA polymerases.
However, the mechanism of how CPDs containing cytosines cause
C-to-T mutations has remained unknown. Existing models include
error-prone DNA polymerases that incorporate adenine across
4 of 13
SCIENCE ADVANCES | RESEARCH ARTICLE

A B
70

% G+C (hg19 reference)

60
Probability

50

40

30
–1.5 TSS TES 1.5 kb

C D E

2.10
2.10 2.20

2.05
CPD coverage

CPD coverage

CPD coverage
2.05
2.00 2.10

2.00
1.95

2.00
1.90 1.95

–1.5 TSS TES 1.5 kb –1.5 TSS 1.5 kb –1.5 TES 1.5 kb

Downloaded from https://www.science.org on September 19, 2021

Genes

Genes

Genes

–1.5 TSS TES 1.5 kb –1.5 TSS 1.5 kb –1.5 TES 1.5 kb
Gene distance (bp) Gene distance (bp) Gene distance (bp)

hg19 chr2:27,710,100-27,721,800

Fig. 3. CPD mapping by circle-damage-seq shows the distribution of CPDs at the sequence and gene level. (A) Nucleotide composition of mapped CPD positions.
Position 11 and 12 represent UVB-damaged dipyrimidine sequences undergoing CPD formation. At each base position, the height of each letter represents the relative
frequency of that nucleic acid base. (B) G+C sequence enrichment along human genes (hg19). (C) Heatmap and metagene profiles of CPD distribution along all genes of
the hg19 human genome. CPD coverage is sorted from high (top, blue) to low (bottom, red). The CPD signals were mapped and binned in 50-bp windows from 1.5 kb
upstream of the transcription start site (TSS) and then normalized relative to gene length over the gene bodies to the transcription end site (TES) and 1.5 kb downstream
of the TES. (D) Heatmap and profile of CPD distribution around the TSS and 1.5 kb of flanking sequence of all hg19 genes. (E) Heatmap and profile of CPD distribution
around the TES and 1.5 kb of flanking sequence of all hg19 genes. (F) Example of CPD sequence read distribution along several genes on chr2. There is a reduced frequency
of CPDs near the TSS (blue arrows).

Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021 5 of 13

SCIENCE ADVANCES | RESEARCH ARTICLE

A UDG
APE1
UVB damage Deamination Photolyase S1 nuclease
Sequencing
library

Circularization
Circle damage sequencing

B C
NT
T Deamination
Deami
minatio
n on (0 h) Deamination
Deamin
nation
on (24 h) Deamination
Deamina
nation
a on (48 h)
hg19: chr11

Deaminated CPD coverage

CCT –3.0 TSS 3.0 kb –3.0 TSS 3.0 kb –3.0 TSS 3.0 kb –3.0 TSS 3.0 kb
GCC TES TES TES TES
TCT
CCA

TCC TCA
Genes

TCA
TCA
CCA
CCT TCC

Downloaded from https://www.science.org on September 19, 2021

–3.0 TSS TES 3.0 kb –3.0 TSS TES 3.0 kb –3.0 TSS TES 3.0 kb –3.0 TSS TES 3.0 kb
Gene distance (bp) Gene distance (bp) Gene distance (bp) Gene distance (bp)

D hg19: chr11:12,009,675-12,040,000 (DKK3)

Total CPDs
Deaminated CPDs

Fig. 4. Mapping of deaminated CPDs at the sequence and gene level. (A) Outline of the method used for mapping of deaminated CPDs. The red “=” symbol indicates
a CPD. (B) Divergent paired reads of deaminated CPDs obtained by circle-damage-seq. Purple and lavender segments represent reads mapped to the plus and minus
strands, respectively. Green arrows indicate single-base gaps at cytosine bases matching the deaminated base of a pyrimidine dimer. The trinucleotide context of the
deaminated cytosine is indicated. (C) Heatmaps and metagene profiles of deaminated CPDs in UVB-irradiated human fibroblasts. Total signal is sorted from high to low
(top to bottom). Metagene profiles are shown for untreated cells (NT) and at 0, 24, and 48 hours following UVB irradiation. (D) Browser views of total CPDs (top) and cytosine-­
deaminated CPDs (bottom) along the DKK3 gene on chromosome 11 in human fibroblasts. Note the reduced levels of deaminated CPDs at the TSS containing a CGI (red bar).

Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021 6 of 13

SCIENCE ADVANCES | RESEARCH ARTICLE

$ %
TSSs with CpG islands TSSs without CpG islands
Total CPDs Deaminated CPDs Total CPDs Deaminated CPDs
1.40 1.30

1.4

1.20
Coverage

Coverage
1.30 1.2

1.0

1.10
1.20
0.8

–1.5 TSS 1.5 kb –1.5 TSS 1.5 kb –1.5 TSS 1.5 kb –1.5 TSS 1.5 kb

4.0
4.0

3.5
3.5

3.0
3.0

2.5
2.5
Genes

Genes
2.0
2.0

1.5 1.5

1.0 1.0

0.5 0.5

0.0 0.0
–1.5 TSS 1.5 kb –1.5 TSS 1.5 kb –1.5 TSS 1.5 kb –1.5 TSS 1.5 kb
Gene distance (bp) Gene distance (bp) Gene distance (bp) Gene distance (bp)

&
Total CPDs Deamination CPDs

Downloaded from https://www.science.org on September 19, 2021

1.0
Deaminated CPD coverage

2.2
0.9
CPD coverage

2.1 0.8

0.7
2.0

0.6
–1.5 TES 1.5 kb –1.5 TES 1.5 kb

3
Genes

Genes

0
–1.5 TES 1.5 kb –1.5 TES 1.5 kb
Gene distance (bp) Gene distance (bp)

Fig. 5. Levels of total CPDs and deaminated CPDs at TSSs and TESs. (A) Human genes with G+C-rich promoters (CGIs) show low frequencies of total CPDs and deaminated
CPDs near TSS (red arrows) and increased levels just upstream of the TSS. (B) Human genes without CGI promoters do not show CPD depletion near the TSS but still show
reduced levels of deaminated CPDs near the TSS albeit at a lesser extent than at CGIs (see scales). (C) Heatmap and metagene profile of total CPDs and deaminated CPDs
near the TES ± 1.5 kb in human UVB-irradiated fibroblasts. The data in this figure were prepared using 100 million aligned, divergent read pairs with single-base gaps.

C-containing CPDs (the A-rule). A competing model proposes that aligned reads and observed a prominent enrichment of TCC, TCA,
cytosines within CPDs first undergo deamination to form uracil, be- TCT, CCT, and CCC sequences (Fig. 6, B to D). The trinucleotide
fore “error-free” polymerase bypass, e.g., by POLH, incorporating data also suggest that cytosine needs to be in the second position of a
adenines across the deaminated, uracil-containing CPDs (Fig. 6A). CPD to score as a prominent deaminated CPD (Fig. 6, C and D; see for
To evaluate the deamination model, we next determined the tri- example the much higher levels of deaminated CPDs at trinucleotides
nucleotide sequence preference of deaminated CPDs using ~100 million beginning with 5′TC versus those beginning with 5′CT). A broader

Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021 7 of 13

SCIENCE ADVANCES | RESEARCH ARTICLE

A B

UVB :

Probability
Deamination :

Bypass by Pol eta :

Mutation (C T) :

C
NPyPy for total CPDs
NPyN for deaminated CPDs and mutation
Percentage of trinucleotide sequences

Downloaded from https://www.science.org on September 19, 2021

Total CPDs Deaminated CPDs Mutation signature SBS7

D E
PyPyN for total CPDs, deaminated CPDs,
and mutation
Percentage of trinucleotide sequences

Total CPDs Deaminated CPDs Mutation signature SBS7

Fig. 6. Sequence specificity of deaminated CPDs in the UVB-irradiated human genome and melanoma mutations. (A) Outline of CPD deamination and potential
mutagenic consequences. (B) Sequence context of the occurrence of deaminated CPDs at 48 hours following UVB irradiation. Position 11 is the deaminated cytosine.
(C) Trinucleotide sequence specificity of total CPD formation, formation of deaminated CPDs, and the prominent mutational signature 7 (SBS7) in melanoma. For total CPDs,
we show the sequences in the context of 5′N-dipyrimidine (NPyPy; blue line plot, ranked according to levels; CPDs at NPyPy are underlined). For deaminated CPDs and
mutations, the NPyN (n = 32) trinucleotide context is shown (green and red bars, respectively). (D) Trinucleotide sequence specificity of total CPD formation, formation of
deaminated CPDs, and the mutation signature SBS7 in melanoma genomes. We show the sequences in the context 5′dipyrimidine-N (PyPyN) (n = 16). Data in (B) to (D)
are not normalized for total genomic trinucleotide frequencies (see also fig. S6). (E) Heatmap showing the cosine similarity scores for total CPDs (NPyPy, n = 32), deami-
nated CPDs, and the prominent mutational signature 7 (SBS7/SBS7a/SBS7b) in melanoma along with the 30 COSMIC v2 mutational signatures. We only used the C-to-T
and T-to-C mutation windows for comparisons with the COSMIC trinucleotide signatures. Dark blue colors indicate high similarity (see also fig. S7).

Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021 8 of 13

SCIENCE ADVANCES | RESEARCH ARTICLE
sequence analysis defined the preferred sequence context of deami-
nated CPD formation as 5′-Py-C-T/A/C (deaminated C is underlined)
(Fig. 6B). These data were not corrected for trinucleotide frequencies
of the human genome, which therefore leads to an underestimation
of the relative event frequencies at TCG or CCG sequences, but see
fig. S6 for the normalized values. The common occurrence of deam-
inated CPDs at these preferred sequence contexts can at least partially
be attributed to high levels of CPDs forming at the sequences, in par-
ticular at 5′TC (Fig. 2). This difference was also observed in an in vitro
study of flanking sequence effects on CPD deamination and was
attributed to a more facile attack of water at the 3′-C than at the 5′-C
because of greater steric interference from pi stacking at the 5′-C (40).
Notably, the deaminated CPD trinucleotide distribution rep-
resents an excellent match with the mutated trinucleotide sequences
from melanoma genomes, particularly in its similarity to single-base
substitution signature 7a (SBS7a) or the classical COSMIC (v2) mu-
tation signature 7 (SBS7; cosine similarities between 0.83 and 0.85)
(Fig. 6E and fig. S7) (1, 23). These signatures are highly enriched in
melanoma genomes, where the classical signature 7 appears like a
composite of SBS7a and SBS7b. The similarity between the deami-
nation signature and SBS7b was somewhat lower (cosine similarity
0.78 to 0.79). The most enriched trinucleotide contexts for both the
deaminated CPDs and the melanoma mutation datasets were TCC,
TCA, TCT, CCC, CCA, and CCT (Fig. 6, C and D). The sequences TCG
and CCG represent a special case; they cannot be mapped in their
deaminated form by our approach using uracil excision when they
originally contain 5-methylcytosine, which deaminates to thymine,
and their levels are therefore underestimated. Using in vitro studies, it
was found that a G flanking the 3′-side of a C in a CPD greatly ac-
celerated the deamination of CPDs, followed second by a 3′-A (41).
On the other hand, total CPDs, because of their enrichment with
T-containing dimers, did not correlate well with the mutational sig-
natures (Fig. 6, C and D) (cosine similarity between 0.10 and 0.16;
Fig. 6E and fig. S7). Other cosine similarities of higher values were
noted for SBS2, which is related to apolipoprotein B mRNA editing
enzyme, catalytic polypeptide-like (APOBEC)-induced cytosine
deamination (not prevalent in melanoma), SBS11, which is due to
temozolomide treatment of patients with glioma, or SBS30, thought
to be due to rare mutations in the DNA repair enzyme NTHL1 (42).
We also focused on the dinucleotide specificity of deaminated
CPD formation after considering only those positions in which the
cytosine can be assigned unambiguously to only one position of the
dimer by requiring a purine as the flanking base (e.g., 5′PuCT and
5′PuCC versus 5′TCPu and 5′CCPu) (fig. S8). These cases can dis-
tinguish deamination at the 5′C of a dimer from deamination of the
3′C of a dimer. The frequency of CPDs with 3′C deamination is
about three times greater than that of CPDs with 5′C deamination,
and melanoma C-to-T mutations are also three to four times more
common at the 3′C position (fig. S8A).
In conclusion, the sequence-specific distribution of deaminated
CPDs in the human genome presents an excellent match with the
mutational signature of melanoma genomes, thus providing strong
mechanistic support for a biochemical/biophysical pathway by which
UVB mutagenesis leads to cancer mutations.
DISCUSSION
Our results are based on the development of a new method for map-
ping of DNA damage at base-level resolution in the human genome.
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
Other methods are available to accomplish DNA damage mapping
by next-generation sequencing (22, 24, 37, 43). The advantages of
circle-damage-seq over comparable DNA damage mapping tech-
niques are several-fold. (i) The single incision point of the modified
base and the divergent reads emanating from this break position give
a clear indication of where the damage is located. (ii) Background
signals are minimized by removal of DNA molecules that did not
undergo circularization. (iii) Most single-strand breaks that also
contribute to background are removed during circular ligation. (iv)
The method represents DNA damage–specific sequencing because DNA
circles or linear molecules without damaged bases are not sequenced,
thus contributing to lower background and lower sequencing costs.
The circle-damage-seq method depends on the ability to convert
the modified base into a DNA single-strand break. Cleavage with S1
nuclease on the opposite DNA strand then creates a damage-specific
ligatable double-strand break. DNA glycosylase enzymes, which
operate at the initial step of the base excision repair pathway, can
easily be adapted for this technique. By choosing the appropriate DNA
glycosylase, for example, 8-oxoguanine DNA glycosylase (OGG1) for
8-oxoguanine or alkyladenine DNA glycosylase (AAG) for alkylated
adenines, specific types of base damage can be mapped. The nucle-
otide excision repair (NER) complex could be used for more bulky
DNA lesions (44). The longer single-stranded gap remaining after
excision with NER enzymes should be a good substrate for S1 nu-
clease, leading to an 11-nt gap for each divergent read pair after
circle-damage-seq, for example, when benzo[a]pyrene DNA ad-
ducts are excised with the UvrABC complex from DNA (45, 46). It
should also be feasible to map rare endogenous DNA bases with
Downloaded from https://www.science.org on September 19, 2021
respective cleavage enzymes, for example, 5-formylcytosine and
5-carboxylcytosine with thymine DNA glycosylase or 6-methylade-
nine with Dpn I at GATC sequences (fig. S1).
Using circle-damage-seq, we derived a genome-wide tetranucleotide
consensus sequence for CPD formation, (5′PyPy<>PyT/A) with
unexpectedly no further sequence enrichment outside of this con-
text. However, this consensus sequence pattern alone did not match
with the sequences commonly mutated in melanomas. We there-
fore focused on the analysis of a mutagenesis pathway that proposes
deamination of cytosine within CPDs as a major premutagenic
mechanism. We were able to specifically detect and map cytosine-­
deaminated CPDs by developing a variation of circle-damage-seq
that uses photolyase reversal of the CPD and uracil excision as the
initial steps. Although uracil-containing CPDs are known to exist
in vitro and in vivo after UV irradiation (33–35), their relevance for
UV mutagenesis has remained unclear. In vitro, synthetic CPDs
containing uracil can be bypassed with incorporation of adenine by the
lesion-tolerant DNA polymerase eta (47). If a similar bypass reaction
occurs in vivo, perhaps catalyzed also by other DNA polymerases,
the mutation occurs by deamination and not by a polymerase error.
Note, in this context, that both the yeast and human forms of the
Pol Eta enzyme insert G opposite 5-methylcytosine in a CPD with
greater than 100:1 selectivity in vitro, favoring the idea that the C
has to deaminate to U to efficiently cause the insertion of A (48).
The trinucleotide sequence patterns of CPD cytosine deamina-
tion and the C-to-T mutation patterns in melanoma provided an
excellent match (Fig. 6), supporting the deamination mutagenesis
model. The concept of CPD deamination being the major premuta-
genic step is particularly appealing for a lesion that is repaired
inefficiently in most genomic regions and for human skin cells,
which divide slowly, allowing sufficient time for deamination to
9 of 13
SCIENCE ADVANCES | RESEARCH ARTICLE
occur before DNA replication. Since cytosine deamination in CPDs
is strictly a chemical reaction, it will be difficult to prevent it from
occurring, although CPD removal by skin-penetrating CPD-specific
DNA repair enzymes appears to be a reasonable concept, as pro-
posed earlier (49), and these enzymes work on uracil-containing
CPDs. In summary, our data support a specific mutational mecha-
nism of how a prevalent form of sunlight-induced DNA damage
induces specific types of mutations found at high frequency in
human skin cancer genomes.
METHODS
Cell culture
Human skin fibroblasts cells were obtained from the American
Type Culture Collection (ATCC; catalog no. PCS-201-012) and
grown using the Fibroblast Growth Kit (ATCC, catalog no. PCS-
201-041) supplemented with 2% fetal bovine serum. The cells were
used at passage number <5.
UVB irradiation and genomic DNA isolation
For mapping of UVB-induced CPDs, fibroblasts at 80 to 90%
confluence on 10-cm culture plates were washed with 1× phosphate-­
buffered saline (PBS) and were irradiated in PBS with a UVB dose
of 1000 J/m2. The UVB lamp (Thermo Fisher Scientific, UVP 3UV
lamp) had a peak spectral emission at 302 nm. The UVB dose was
determined using a UVX radiometer with a UVB probe (Ultraviolet
Products; Upland, CA). After irradiation, the cells were immediate-
ly trypsinized and collected, and then, genomic DNA was isolated
using Quick-DNA Miniprep Plus Kit (Zymo Research; Irvine, CA)
according to the manufacturer’s instruction manual. For mapping
deaminated CPDs, we replenished the culture medium of the cells
after UVB radiation with 4000 J/m2 and incubated the cells for 24 or
48 hours at 37°C before harvesting and DNA isolation.
Circle-damage-seq mapping of CPDs
DNA preparation and circularization
To prepare fragmented genomic DNA, the DNA from UVB-irradiated
cells was sheared at 4°C to an average length of 300 to 400 bp by
sonication with a Covaris E220 sonicator (Covaris; Woburn, MA)
under the following conditions: peak incident power (W), 140; duty
factor, 10%; cycles per burst, 200 times, 80 s; then, the frag-
mented DNA was purified with DNA Clean & Concentrator-5 Kit
(Zymo Research, DCC-5) according to the manufacturer’s proto-
col. DNA was eluted in 42 l of 10 mM tris-HCl (pH 7.5). Next, the
sonicated DNA was end-repaired to prepare blunt-ended DNA. One
microgram of the sonicated DNA was incubated in 1× T4 DNA
ligase buffer [New England Biolabs (NEB); Ipswich, MA] with the
following components: 50 mM tris-HCl (pH 7.5), 10 mM MgCl2,
1 mM adenosine triphosphate (ATP), 10 mM dithiothreitol (DTT),
1 l (2 U/l) of RNase H (NEB), 1 l (3 U/l) of T4 DNA polymerase
(NEB), 1 l (10 U/l) of T4 polynucleotide kinase (NEB), and 1 l of
10 mM deoxynucleoside triphosphates (dNTPs) in a final volume of
50 l at 24°C for 30 min; then, the reaction was heat-inactivated by
further incubation at 70°C for 20 min. The DNA was purified using
DCC-5 Kit (Zymo Research) and eluted in 100 l of 10 mM tris-
HCl (pH 7.5). The purified DNA was quantitated using NanoDrop
(Thermo Fisher Scientific).
To circularize the DNA, 1 g of the blunt-ended DNA was incu-
bated in 1× T4 DNA ligase buffer (NEB) with 4 l (400 U/l) of T4
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
DNA ligase (NEB) in a final volume of 200 l at 16°C overnight.
Then, the reaction mixture was cleaned up with DCC-5 kit, and the
DNA was eluted in 42 l of 10 mM tris-HCl (pH 7.5). To remove
noncircularized linear DNA from the circularized DNA pool, the
ligase-treated DNA was incubated with 2 l (10 U/l) of Plasmid-Safe
ATP-Dependent DNase (Lucigen; Middleton, WI) in 1× reaction
buffer [33 mM tris-acetate (pH 7.5), 66 mM potassium acetate, 10 mM
magnesium acetate, 0.5 mM DTT, and 1 mM ATP] in a final
volume of 50 l at 37°C for 30 min and then at 70°C for 20 min to
stop the reaction. Then, the DNA was purified with 90 l (1.8×) of
AMPure XP beads (Beckman Coulter; Indianapolis, IN) and eluted
in 35 l of 10 mM tris-HCl (pH 8.0).
Cleavage of DNA at CPD sites
To generate DNA double-strand breaks at CPD sites, the circular-
ized DNA was treated with the following DNA repair enzymes.
First, to specifically incise DNA at CPD positions, the circularized
DNA was incubated in 1× NEBuffer 4 reaction buffer (NEB) [50 mM
potassium acetate, 20 mM tris-acetate (pH 7.9), 10 mM magnesium
acetate, and 1 mM DTT] and 0.4 l of bovine serum albumin
(20 mg/ml) with 1 l (10 U/l) of T4-PDG (NEB) and 1 l (10 U/l)
of APE1 (NEB) in a final volume of 40 l at 37°C for 20 min. Then,
the DNA was cleaned up with 72 l (1.8×) of AMPure XP beads and
eluted in 25 l of 10 mM tris-HCl (pH 8.0). To revert the dimerized
pyrimidines remaining after T4-PDG incision, the DNA from above
was treated with 3 l (0.25 g/l) of E. coli phrB photolyase (Novus
Biologicals; Centennial, CO) in 1× reaction buffer [50 mM tris-HCl
(pH 7.0), 50 mM NaCl, and 10 mM DTT] in a final volume of 50 l.
The reaction tube was placed at a distance of 15 cm under a UVA
Downloaded from https://www.science.org on September 19, 2021
lamp (Thermo Fisher Scientific) that has a peak spectral emission at
365 nm and incubated under UVA illumination for 90 min at room
temperature. Then, the DNA was cleaned up with 90 l (1.8×) of
AMPure XP beads and eluted in 32 l of 10 mM tris-HCl (pH 8.0).
To cleave the opposite strand of the nicked DNA, the DNA from
above was incubated with 1 l (5 U/l) of single-strand specific
S1 nuclease (Thermo Fisher Scientific) in 1× reaction buffer [40 mM
sodium acetate (pH 4.5), 300 mM NaCl, and 2 mM ZnSO4] in a
final volume of 40 l for 4 min at room temperature. We stopped
the reaction by adding 2 l of 0.5 M EDTA and 1 l of 1 M tris-HCl
(pH 8.0) to the reaction mixture and further incubated the mix-
ture for 10 min at 70°C. The DNA sample was cleaned up with
72 l (1.8×) of AMPure XP beads and eluted in 48 l of 10 mM
tris-HCl (pH 8.0).
Cleavage of DNA at deaminated CPD sites
To generate double-strand breaks at deaminated CPD sites, the cir-
cularized DNA was initially treated with 3 l (0.25 g/l) of E. coli
phrB photolyase, as described above to revert the dimerized pyrim-
idines. Then, the DNA was cleaned up with 90 l (1.8×) of AMPure
XP beads and eluted in 35 l of 10 mM tris-HCl (pH 8.0). To specifi-
cally incise DNA at deaminated CPD positions, the circularized
DNA was incubated in 1× NEBuffer 4 reaction buffer (NEB) with
1 l (5 U/l) of UDG (NEB) and 1 l (10 U/l) of APE1 (NEB) in a
final volume of 40 l at 37°C for 20 min. Then, the DNA was cleaned
up with 72 l (1.8×) of AMPure XP beads and eluted in 32 l of
10 mM tris-HCl (pH 8.0). To cleave the opposite strand of the
nicked DNA, the DNA was then incubated with 1 l (5 U/l) of
single-strand specific S1 nuclease and cleaned up as described above.
Adapter ligation
The double-strand cleaved DNA was subsequently A-tailed in 1×
NEBNext dA-tailing reaction buffer (NEB) [10 mM tris-HCl (pH 7.9),
10 of 13
SCIENCE ADVANCES | RESEARCH ARTICLE
10 mM MgCl2, 50 mM NaCl, and 1 mM DTT] and 0.2 mM dATP,
with 2 l (5 U/l) of Klenow fragment exo- (NEB) in a final volume
of 55 l by incubation at 37°C for 30 min, and then, the reaction was
heat-inactivated by further incubation at 70°C for 30 min. To per-
form adaptor ligation, 30 l of NEBNext Ultra II Ligation Master
Mix, 1 l of NEBNext Ligation Enhancer (NEB), and 3 l of 1.5 M
NEBNext adaptors for Illumina sequencing (NEB) [5′-phos-GATC-
GGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/
ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3′ and
5′-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/
ACACTCTTTCCTACACGACGCTCTTCCGATC*C-3′ (*; phos-
phorothioate linkage)] were added to the dA-tailing reaction mix-
ture in a total volume of 93 l and incubated at 20°C for 15 min, and
this reaction step was followed by incubation with 3 l (1 U/l) of
USER enzyme (NEB) at 37°C for 20 min. Then, the adaptor-ligated
circle-damage-seq library was cleaned up with 96 l (1×) of AMPure
XP beads and size-selected (300 to 1000 bp) with 0.5 volumes of
AMPure XP beads, and the DNA was eluted in 25 l of 10 mM
tris-HCl (pH 8.0).
Library amplification and sequencing
To amplify the circle-damage-seq library by PCR, the eluted library
was mixed with 25 l of NEBNext Ultra II Q5 Master Mix (2×), 2.5 l
of 10 M NEBNext i5, and 2.5 l of 10 M NEBNext i7 primers
(NEB) in a final volume of 50 l. The amplification reaction mixture
was incubated at 98°C for 30 s, and then, 12 cycles of PCR at 98°C
for 10 s and 65°C for 75 s were performed, followed by a final exten-
sion step at 65°C for 5 min. The PCR product was purified with
50 l (1×) of AMPure XP beads and eluted in 20 l of 10 mM tris-
HCl (pH 8.0). The purified library was quantitated using a Qubit
3.0 fluorometer and dsDNA HS Assay kit (Thermo Fisher Scientific).
The size distribution of the circle-damage-seq library was determined
using Bioanalyzer (Agilent; Santa Clara, CA), and the circle-damage-­
seq library was quantified using KAPA Library Quantification kit
(Kapa Biosystems) according to the manufacturer’s instruction.
The circle-damage-seq library was sequenced as 150-bp paired-end
sequencing runs on an Illumina HiSeq 2500 platform to obtain be-
tween 10 million and 800 million reads. From the 800 million read
samples, approximately 200 million paired aligned reads were re-
tained specifically as divergent read pairs with single-base gaps after
removal of duplicates.
Circle-damage-seq mapping of Dpn I cuts in the  (−) strand. For deaminated CPDs, the gapped nucleotide would be
E. coli genome
As a pilot experiment, we initially performed the mapping of Dpn I
cut sites to optimize the circle-damage-seq method. To test the
sensitivity of circle-damage-seq toward different percentages of Dpn
I–cleaved sites, we mixed E. coli DNAs from two different strains,
dam(+) and dam(−) to prepare 0, 2, and 10% of dam(+) DNA in
a background of dam(−) input DNA. We subjected this mixture
to the circle-damage-seq procedure, as described above. Briefly,
to prepare fragmented DNAs, Rsa I and Alu I restriction enzymes
(NEB) that leave blunt ends were used to digest 1 g of E. coli
genomic DNA. The cleaved DNAs were subjected to A-tailing using
a NEBNext Ultra II End Prep kit (NEB) and followed by ligation of
an annealed hairpin adaptor (5′-phos-CGGTGGACCGATGATC/
ideoxyU/ATCGGTCCACCG*T-3′) using NEBNext Ultra II Ligation
Master Mix. The adaptor-ligated DNAs were treated with USER
enzyme and circularized with T4 DNA ligase, followed by treat-
ment with Plasmid-Safe ATP-Dependent DNase. To generate
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
double-­strand breaks at Dpn I cleavage sites, the circularized E. coli
DNAs were incubated in 1× CutSmart buffer (NEB) with 1 l (20 U/l)
of Dpn I restriction enzyme (NEB) in a final volume of 20 l at 37°C
for 1 hour. Then, circle-damage-seq library preparation and ampli-
fication by PCR were performed, as described above. The circle-­
damage-seq library was sequenced as 75-bp paired-end reads on an
Illumina NextSeq500 platform to obtain ~15 million reads.
Bioinformatics analysis
All libraries were hard-clipped from the 3′ end to 2 × 80 nucleotide
length using Trim_Galore (www.bioinformatics.babraham.ac.uk/
projects/trim_galore/). Reads were then adapter-trimmed and quality-­
trimmed (phred < 20) in a single pass using Trim_Galore default
parameters. Trimmed reads were aligned to the hg19 reference
genome using BWA-MEM version 0.7.17 (50) with default param-
eters. Duplicate alignments were marked and removed with the
“removeDups” SAMBLASTER option (51). SAMtools version 1.11
(52) was then used to remove reads with low mapping quality
(MAPQ < 20) and to sort reads by genomic coordinates.
Divergently aligned read pairs (pairs facing away from each
other) with a single-nucleotide gap between reads were selected by
selecting SAM records with TLEN of 3. TLEN equals the distance
between the mapped end of the template and the mapped start of
the template. Records with TLEN = 3 represent divergently aligned
reads with one nucleotide between mates. Sequences for the three
nucleotides representing the last nucleotide of each read and the
gapped base were identified using BEDtools (53). To visualize the
reads, bam files were produced by selecting SAM records with
Downloaded from https://www.science.org on September 19, 2021
TLEN of 3 and visualized with the Integrative Genomics Viewer
version 2.8.9. The tracks were displayed with a “view as pairs” option
to show pairs together with a line joining the ends.
Single-base substitution mutational signatures associated with
skin cancer (SBS7/SBS7a/SBS7b) were obtained from the COSMIC
database (http://cancer.sanger.ac.uk/cosmic/signatures/SBS/). Nor-
malized forms of trinucleotide sequence signatures were presented
by dividing the numbers by the relative abundance of the hg19
genome trinucleotide frequencies.
When treating cells with UVB to produce CPDs, if the gapped
nucleotide was T or C in the (+) strand, the damage would have
occurred on the (+) strand, whereas a gapped A or G in the (+)
strand would indicate that the damage must have occurred on the
a cytosine on the (+) strand that is flanked by a pyrimidine on either
side. When there is a G as the gapped nucleotide, the damage would
have occurred on the (−) strand and another purine is seen as a
flanking base. The Dpn I treatment protocol probes 6mA formed at
5′GATC sequences from dam(+) E. coli, producing sequencing
libraries with no gap between divergently aligned read pairs (fig. S1).
Hence, alignment records with TLEN = 2 were selected.
Chromosome name, start position, stop position, and inferred
strand (+/−) for all selected read pair loci were written to a BED file,
sorted, and indexed with tabix (54) for downstream analyses. Logo
plots were drawn using ggseqlogo (55) or Seq2Logo (www.cbs.dtu.
dk/biotools/Seq2Logo/) for fig. S6. “bamCoverage,” “computeMatrix,”
and “plotHeatmap” programs in deepTools (56) were used to
generate heatmap plots of genomic regions. Gene-centered analysis
included 1.5 kb upstream of the TSS and 1.5 kb downstream of the
TES with average coverage calculated in non-overlapping 50-nt
bins and normalized to gene length.
11 of 13
SCIENCE ADVANCES | RESEARCH ARTICLE
Cosine similarity analyses were performed using R (version 4.0.2)
package “coop” www.R-project.org/ (57). Since we have only 32 or
16 combinations of trinucleotides for CPDs and deamination avail-
able, we could only use the C-to-T and T-to-C mutation windows
for the NPyPy (n  =  32) and the C-to-T windows for the PyPyN
(n  =  16) to compare with the COSMIC trinucleotide signatures.
Other mutations, such as C to G, C to A, T to G, and T to A, were
ignored. This explains some level of similarity between, for example,
SBS4 and SBS7, which are otherwise mostly unrelated (SBS4 is
dominated by C-to-A mutations).
Data availability
All data are available from the GEO database (accession number
GSE159807).
Code availability
All code for this project is available at https://github.com/
deanpettinga/CDseq.
SUPPLEMENTARY MATERIALS
Supplementary material for this article is available at http://advances.sciencemag.org/cgi/
content/full/7/31/eabi6508/DC1
View/request a protocol for this paper from Bio-protocol.
REFERENCES AND NOTES
1. L. B. Alexandrov, S. Nik-Zainal, D. C. Wedge, S. A. J. R. Aparicio, S. Behjati, A. V. Biankin,
G. R. Bignell, N. Bolli, A. Borg, A.-L. Børresen-Dale, S. Boyault, B. Burkhardt, A. P. Butler,
C. Caldas, H. R. Davies, C. Desmedt, R. Eils, J. E. Eyfjörd, J. A. Foekens, M. Greaves,
F. Hosoda, B. Hutter, T. Ilicic, S. Imbeaud, M. Imielinski, N. Jäger, D. T. W. Jones, D. Jones,
S. Knappskog, M. Kool, S. R. Lakhani, C. López-Otín, S. Martin, N. C. Munshi, H. Nakamura,
P. A. Northcott, M. Pajic, E. Papaemmanuil, A. Paradiso, J. V. Pearson, X. S. Puente, K. Raine,
M. Ramakrishna, A. L. Richardson, J. Richter, P. Rosenstiel, M. Schlesner, T. N. Schumacher,
P. N. Span, J. W. Teague, Y. Totoki, A. N. J. Tutt, R. Valdés-Mas, M. M. van Buuren,
L. van ‘t Veer, A. Vincent-Salomon, N. Waddell, L. R. Yates; Australian Pancreatic Cancer
Genome Initiative; ICGC Breast Cancer Consortium; ICGC MMML-Seq Consortium; ICGC
Ped Brain, J. Zucman-Rossi, P. Andrew Futreal, U. M. Dermott, P. Lichter, M. Meyerson,
S. M. Grimmond, R. Siebert, E. Campo, T. Shibata, S. M. Pfister, P. J. Campbell, M. R. Stratton,
Signatures of mutational processes in human cancer. Nature 500, 415–421 (2013).
2. B. Vogelstein, N. Papadopoulos, V. E. Velculescu, S. Zhou, L. A. Diaz Jr., K. W. Kinzler,
Cancer genome landscapes. Science 339, 1546–1558 (2013).
3. T. Helleday, S. Eshtad, S. Nik-Zainal, Mechanisms underlying mutational signatures
in human cancers. Nat. Rev. Genet. 15, 585–598 (2014).
4. I. Martincorena, P. J. Campbell, Somatic mutation in cancer and normal cells. Science 349,
1483–1489 (2015).
5. G. P. Pfeifer, How the environment shapes cancer genomes. Curr. Opin. Oncol. 27, 71–77
(2015).
6. L. B. Alexandrov, Y. S. Ju, K. Haase, P. Van Loo, I. Martincorena, S. Nik-Zainal, Y. Totoki,
A. Fujimoto, H. Nakagawa, T. Shibata, P. J. Campbell, P. Vineis, D. H. Phillips, M. R. Stratton,
Mutational signatures associated with tobacco smoking in human cancer. Science 354,
618–622 (2016).
7. T. A. Rosenquist, A. P. Grollman, Mutational signature of aristolochic acid: Clue
to the recognition of a global disease. DNA Repair (Amst) 44, 205–211 (2016).
8. F. R. de Gruijl, H. Rebel, Early events in UV carcinogenesis—DNA damage, target cells
and mutant p53 foci. Photochem. Photobiol. 84, 382–387 (2008).
9. E. D. Pleasance, R. K. Cheetham, P. J. Stephens, D. J. McBride, S. J. Humphray,
C. D. Greenman, I. Varela, M. L. Lin, G. R. Ordóñez, G. R. Bignell, K. Ye, J. Alipaz, M. J. Bauer,
D. Beare, A. Butler, R. J. Carter, L. Chen, A. J. Cox, S. Edkins, P. I. Kokko-Gonzales,
N. A. Gormley, R. J. Grocock, C. D. Haudenschild, M. M. Hims, T. James, M. Jia, Z. Kingsbury,
C. Leroy, J. Marshall, A. Menzies, L. J. Mudie, Z. Ning, T. Royce, O. B. Schulz-Trieglaff,
A. Spiridou, L. A. Stebbings, L. Szajkowski, J. Teague, D. Williamson, L. Chin, M. T. Ross,
P. J. Campbell, D. R. Bentley, P. A. Futreal, M. R. Stratton, A comprehensive catalogue
of somatic mutations from a human cancer genome. Nature 463, 191–196 (2010).
10. G. P. Pfeifer, Mechanisms of UV-induced mutations and skin cancer. Genome Instability
Disease 1, 99–113 (2020).
11. G. P. Pfeifer, A. Besaratinia, UV wavelength-dependent DNA damage and human
non-melanoma and melanoma skin cancer. Photochem. Photobiol. Sci. 11, 90–97 (2012).
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
12. D. E. Brash, UV signature mutations. Photochem. Photobiol. 91, 15–26 (2015).
13. J. Cadet, A. Grand, T. Douki, Solar UV radiation-induced DNA bipyrimidine photoproducts:
Formation and mechanistic insights. Top. Curr. Chem. 356, 249–275 (2015).
14. Y. H. You, D. H. Lee, J. H. Yoon, S. Nakajima, A. Yasui, G. P. Pfeifer, Cyclobutane pyrimidine
dimers are responsible for the vast majority of mutations induced by UVB irradiation
in mammalian cells. J. Biol. Chem. 276, 44688–44694 (2001).
15. M. F. Laughery, A. J. Brown, K. A. Bohm, S. Sivapragasam, H. S. Morris, M. Tchmola,
A. D. Washington, D. Mitchell, S. Mather, E. P. Malc, P. A. Mieczkowski, S. A. Roberts,
J. J. Wyrick, Atypical UV photoproducts induce non-canonical mutation classes
associated with driver mutations in melanoma. Cell Rep. 33, 108401 (2020).
16. A. Besaratinia, J. I. Yoon, C. Schroeder, S. E. Bradforth, M. Cockburn, G. P. Pfeifer,
Wavelength dependence of ultraviolet radiation-induced DNA damage as determined by
laser irradiation suggests that cyclobutane pyrimidine dimers are the principal DNA
lesions produced by terrestrial sunlight. FASEB J. 25, 3079–3091 (2011).
17. J. Jans, W. Schul, Y.-G. Sert, Y. Rijksen, H. Rebel, A. P. M. Eker, S. Nakajima, H. van Steeg,
F. R. de Gruijl, A. Yasui, J. H. Hoeijmakers, G. T. J. van der Horst, Powerful skin cancer
protection by a CPD-photolyase transgene. Curr. Biol. 15, 105–115 (2005).
18. B. S. Strauss, The "A" rule revisited: Polymerases as determinants of mutational specificity.
DNA Repair (Amst) 1, 125–135 (2002).
19. R. E. Johnson, S. Prakash, L. Prakash, Efficient bypass of a thymine-thymine dimer by yeast
DNA polymerase, Poleta. Science 283, 1001–1004 (1999).
20. C. Masutani, R. Kusumoto, A. Yamada, N. Dohmae, M. Yokoi, M. Yuasa, M. Araki, S. Iwai,
K. Takio, F. Hanaoka, The XPV (xeroderma pigmentosum variant) gene encodes human
DNA polymerase eta. Nature 399, 700–704 (1999).
21. E. H. Radany, E. C. Friedberg, A pyrimidine dimer-DNA glycosylase activity associated
with the v gene product of bacterophage T4. Nature 286, 182–185 (1980).
22. P. Mao, M. J. Smerdon, S. A. Roberts, J. J. Wyrick, Chromosomal landscape of UV damage
formation and repair at single-nucleotide resolution. Proc. Natl. Acad. Sci. U.S.A. 113,
9057–9062 (2016).
23. M. Lindberg, M. Bostrom, K. Elliott, E. Larsson, Intragenomic variability and extended
sequence patterns in the mutational signature of ultraviolet light. Proc. Natl. Acad. Sci. U.S.A.
116, 20411–20417 (2019).
24. S. Premi, L. Han, S. Mehta, J. Knight, D. Zhao, M. A. Palmatier, K. Kornacker, D. E. Brash,
Genomic sites hypersensitive to ultraviolet radiation. Proc. Natl. Acad. Sci. U.S.A. 116,
Downloaded from https://www.science.org on September 19, 2021
24196–24205 (2019).
25. C. Lu, N. E. Gutierrez-Bayona, J. S. Taylor, The effect of flanking bases on direct and triplet
sensitized cyclobutane pyrimidine dimer formation in DNA depends on the dipyrimidine,
wavelength and the photosensitizer. Nucleic Acids Res. 49, 4266–4280 (2021).
26. G. P. Pfeifer, R. Drouin, A. D. Riggs, G. P. Holmquist, Binding of transcription factors
creates hot spots for UV photoproducts in vivo. Mol. Cell. Biol. 12, 1798–1804 (1992).
27. S. Tornaletti, G. P. Pfeifer, UV light as a footprinting agent: Modulation of UV-induced
DNA damage by transcription factors bound at the promoters of three human genes.
J. Mol. Biol. 249, 714–728 (1995).
28. J. Hu, O. Adebali, S. Adar, A. Sancar, Dynamic maps of UV damage formation and repair
for the human genome. Proc. Natl. Acad. Sci. U.S.A. 114, 6758–6763 (2017).
29. K. Elliott, M. Bostrom, S. Filges, M. Lindberg, J. Van den Eynden, A. Stahlberg, A. R. Clausen,
E. Larsson, Elevated pyrimidine dimer formation at distinct genomic bases underlies
promoter mutation hotspots in UV-exposed cancers. PLOS Genet. 14, e1007849 (2018).
30. P. Mao, A. J. Brown, S. Esaki, S. Lockwood, G. M. K. Poon, M. J. Smerdon, S. A. Roberts,
J. J. Wyrick, ETS transcription factors induce a unique UV damage signature that drives
recurrent mutagenesis in melanoma. Nat. Commun. 9, 2626 (2018).
31. D. Perera, R. C. Poulos, A. Shah, D. Beck, J. E. Pimanda, J. W. H. Wong, Differential DNA
repair underlies mutation hotspots at active promoters in cancer genomes. Nature 532,
259–263 (2016).
32. B. Tian, J. Hu, H. Zhang, C. S. Lutz, A large-scale analysis of mRNA polyadenylation
of human and mouse genes. Nucleic Acids Res. 33, 201–212 (2005).
33. R. B. Setlow, W. L. Carrier, F. J. Bollum, Pyrimidine dimers in UV-irradiated poly dI:dC.
Proc. Natl. Acad. Sci. U.S.A. 53, 1111–1118 (1965).
34. N. Jiang, J.-S. Taylor, In vivo evidence that UV-induced C→T mutations at dipyrimidine
sites could result from the replicative bypass of cis-syn cyclobutane dimers or their
deamination products. Biochemistry 32, 472–481 (1993).
35. Y. Tu, R. Dammann, G. P. Pfeifer, Sequence and time-dependent deamination of cytosine
bases in UVB-induced cyclobutane pyrimidine dimers in vivo. J. Mol. Biol. 284, 297–311 (1998).
36. Y. Tu, S. Tornaletti, G. P. Pfeifer, DNA repair domains within a human gene: Selective
repair of sequences near the transcription initiation site. EMBO J. 15, 675–683 (1996).
37. J. Hu, S. Adar, C. P. Selby, J. D. Lieb, A. Sancar, Genome-wide analysis of human global
and transcription-coupled excision repair of UV damage at single-nucleotide resolution.
Genes Dev. 29, 948–960 (2015).
38. J. Jiang, W. Li, L. A. Lindsey-Boltz, Y. Yang, Y. Li, A. Sancar, Nucleotide excision repair
hotspots and coldspots of UV-induced DNA damage in the human genome. bioRxiv
2020.04.16.045369 [Preprint]. 2021. https://doi.org/10.1101/2020.04.16.045369.
12 of 13
SCIENCE ADVANCES | RESEARCH ARTICLE
39. R. Sabarinathan, L. Mularoni, J. Deu-Pons, A. Gonzalez-Perez, N. Lopez-Bigas, Nucleotide
excision repair is impaired by binding of transcription factors to DNA. Nature 532,
264–267 (2016).
40. V. J. Cannistraro, J. S. Taylor, Acceleration of 5-methylcytosine deamination
in cyclobutane dimers by G and its implications for UV-induced C-to-T mutation hotspots.
J. Mol. Biol. 392, 1145–1157 (2009).
41. V. J. Cannistraro, S. Pondugula, Q. Song, J. S. Taylor, Rapid deamination of cyclobutane
pyrimidine dimer photoproducts at TCG sites in a translationally and rotationally
positioned nucleosome in vivo. J. Biol. Chem. 290, 26597–26609 (2015).
42. J. Drost, R. van Boxtel, F. Blokzijl, T. Mizutani, N. Sasaki, V. Sasselli, J. de Ligt, S. Behjati,
J. E. Grolleman, T. van Wezel, S. Nik-Zainal, R. P. Kuiper, E. Cuppen, H. Clevers, Use
of CRISPR-modified human stem cell organoids to study the origin of mutational
signatures in cancer. Science 358, 234–238 (2017).
43. A. Canela, S. Sridharan, N. Sciascia, A. Tubbs, P. Meltzer, B. P. Sleckman, A. Nussenzweig,
DNA breaks and end resection measured genome-wide by end sequencing. Mol. Cell 63,
898–911 (2016).
44. A. Sancar, Mechanisms of DNA excision repair. Science 266, 1954–1956 (1994).
45. M. F. Denissenko, A. Pao, M. Tang, G. P. Pfeifer, Preferential formation of benzo[a]pyrene
adducts at lung cancer mutational hotspots in P53. Science 274, 430–432 (1996).
46. M. S. Tang, J. B. Zheng, M. F. Denissenko, G. P. Pfeifer, Y. Zheng, Use of UvrABC nuclease
to quantify benzo[a]pyrene diol epoxide-DNA adduct formation at methylated versus
unmethylated CpG sites in the p53 gene. Carcinogenesis 20, 1085–1089 (1999).
47. K. Takasawa, C. Masutani, F. Hanaoka, S. Iwai, Chemical synthesis and translesion
replication of a cis–syn cyclobutane thymine–uracil dimer. Nucleic Acids Res. 32,
1738–1745 (2004).
48. Q. Song, S. M. Sherrer, Z. Suo, J. S. Taylor, Preparation of site-specific T=mCG cis-syn
cyclobutane dimer-containing template and its error-free bypass by yeast and human
polymerase . J. Biol. Chem. 287, 8021–8028 (2012).
49. D. B. Yarosh, A. Rosenthal, R. Moy, Six critical questions for DNA repair enzymes in
skincare products: A review in dialog. Clin. Cosmet. Investig. Dermatol. 12, 617–624 (2019).
50. H. Li, R. Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform.
Bioinformatics 25, 1754–1760 (2009).
51. G. G. Faust, I. M. Hall, SAMBLASTER: Fast duplicate marking and structural variant read
extraction. Bioinformatics 30, 2503–2505 (2014).
Jin et al., Sci. Adv. 2021; 7 : eabi6508 30 July 2021
52. H. Li, B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis,
R. Durbin; 1000 Genome Project Data Processing Subgroup, The Sequence Alignment/
Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
53. A. R. Quinlan, BEDTools: The Swiss-army tool for genome feature analysis. Curr. Protoc.
Bioinformatics 47, 11.12.1-34 (2014).
54. H. Li, Tabix: Fast retrieval of sequence features from generic TAB-delimited files.
Bioinformatics 27, 718–719 (2011).
55. O. Wagih, ggseqlogo: A versatile R package for drawing sequence logos. Bioinformatics
33, 3645–3647 (2017).
56. F. Ramírez, D. P. Ryan, B. Grüning, V. Bhardwaj, F. Kilpert, A. S. Richter, S. Heyne, F. Dündar,
T. Manke, deepTools2: A next generation web server for deep-sequencing data analysis.
Nucleic Acids Res. 44, W160–W165 (2016).
57. D. Schmidt, Co-operation: Fast correlation, covariance, and cosine similarity, R package
version 0.6-2 (2019).
Acknowledgments: We thank D. Fu, E. Wolfrum and H. Lyong for help with bioinformatics
and biostatistics analysis. Funding: This work was supported by NIH grant CA228089 to G.P.P.
Author contributions: S.-G.J. and G.P.P. conceptualized and designed the project. S.-G.J. and
J.J. performed experiments. D.P., P.L., S.-G.J., and G.P.P. performed data analysis. G.P.P. and
S.-G.J. wrote the manuscript. All authors commented on the manuscript. Competing
interests: The authors declare that they have no competing interests. Data and materials
availability: All data needed to evaluate the conclusions in the paper are present in the paper
and/or the Supplementary Materials. All sequencing data are available from the GEO database
(accession number GSE159807). Additional data related to this paper may be requested from
the authors.
Submitted 22 March 2021
Accepted 14 June 2021
Published 30 July 2021
10.1126/sciadv.abi6508
Citation: S.-G. Jin, D. Pettinga, J. Johnson, P. Li, G. P. Pfeifer, The major mechanism of melanoma
mutations is based on deamination of cytosine in pyrimidine dimers as determined by circle
damage sequencing. Sci. Adv. 7, eabi6508 (2021).
Downloaded from https://www.science.org on September 19, 2021
13 of 13
 The major mechanism of melanoma mutations is based on deamination of cytosine
in pyrimidine dimers as determined by circle damage sequencing
Seung-Gi JinDean PettingaJennifer JohnsonPeipei LiGerd P. Pfeifer

Sci. Adv., 7 (31), eabi6508.

View the article online

https://www.science.org/doi/10.1126/sciadv.abi6508
Permissions
https://www.science.org/help/reprints-and-permissions

Downloaded from https://www.science.org on September 19, 2021

Use of think article is subject to the Terms of service

Science Advances (ISSN ) is published by the American Association for the Advancement of Science. 1200 New York Avenue NW,
Washington, DC 20005. The title Science Advances is a registered trademark of AAAS.
Copyright © 2021 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim
to original U.S. Government Works. Distributed under a Creative Commons Attribution NonCommercial License 4.0 (CC BY-NC).