Accepted Manuscript

Development and optimization of an efficient qPCR system for olive authenti-

cation in edible oils

Alba Alonso-Rebollo, Sonia Ramos-Gómez, María D. Busto, Natividad Ortega

PII: S0308-8146(17)30650-7
DOI: http://dx.doi.org/10.1016/j.foodchem.2017.04.078
Reference: FOCH 20951

To appear in: Food Chemistry

Received Date: 23 August 2016

Revised Date: 10 November 2016
Accepted Date: 13 April 2017

Please cite this article as: Alonso-Rebollo, A., Ramos-Gómez, S., Busto, M.D., Ortega, N., Development and
optimization of an efficient qPCR system for olive authentication in edible oils, Food Chemistry (2017), doi: http://
dx.doi.org/10.1016/j.foodchem.2017.04.078

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
 1 Development and optimization of an efficient qPCR system

2 for olive authentication in edible oils

3 Alba Alonso-Rebollo, Sonia Ramos-Gómez, María D. Busto, Natividad

4 Ortega*

5 Department of Biotechnology and Food Science, University of Burgos, Plaza Misael Bañuelos,

6 s/n. 09001 Burgos, Spain.

7 ABSTRACT

8 The applicability of qPCR in olive-oil authentication depends on the DNA obtained from the

9 oils and the amplification primers. Therefore, four olive-specific amplification systems based on

10 the trnL gene were designed (A-, B-, C- and D-trnL systems). The qPCR conditions, primer

11 concentration and annealing temperature, were optimized. The systems were tested for

12 efficiency and sensitivity to select the most suitable for olive oil authentication. The selected

13 system (D-trnL) demonstrated specificity toward olive in contrast to other oleaginous species

14 (canola, soybean, sunflower, maize, peanut and coconut) and showed high sensitivity in a

15 broad linear dynamic range (LOD and LOQ: 500 ng - 0.0625 pg). This qPCR system

16 enabled detection, with high sensitivity and specificity, of olive DNA isolated from oils

17 processed in different ways, establishing it as an efficient method for the authentication of olive

18 oil regardless of its category.

19 Keywords: olive oil, qPCR, trnL, olive-specific primers, authentication, LOD, LOQ, dynamic

20 range.

21 1. Introduction

22 Olive (Olea europaea) is one of the most ancient and important crops in the

23 Mediterranean basin (Raieta, Muccillo, & Colantuoni, 2015). Olive oil is recognized

1
24 worldwide for its nutritional value and health benefits, and it is appreciated for its

25 particular aroma and taste. Olive oil, unlike seed oils, is not a commodity with one

26 world reference price due to the heterogeneity of the physical product and its

27 categorization by quality (Raieta et al., 2015). The International Olive Council (IOC,

28 2006) classified olive oil, depending on the extraction procedure, as extra-virgin olive

29 oil (EVOO), virgin (VOO), refined (OO) or pomace refined olive oil (PO). EVOOs and

30 VOOs are obtained only through a mechanical process, while OOs and POs combine

31 both mechanical and refining processes.

32 On the basis of these considerations olive oils command a premium price, leading to

33 a great temptation to adulterate them with vegetable seed oils (Cercaci, Rodriguez-

34 Estrada, & Lercker, 2003), thus resulting in either a reduced benefit or a potential

35 hazard that endangers human life (Agrimonti, Vietina, Pafundo, & Narmiroli, 2011;

36 Ben-Ayed, Kamoun-Grati, & Rebai, 2013). High grade olive oils can be blended with

37 other lower grade oils, yet continue to be labeled as high quality. Thus, several

38 analytical techniques are used to detect adulteration of virgin olive oil and to establish

39 its authenticity (Ben-Ayed et al., 2013).

40 The authentication of olive oil has been studied using different techniques divided

41 into two large groups: the chemical methods and the DNA-based methods.

42 Traditionally, olive oil authentication methods were based on analytical chemistry

43 methods to measure the composition of different metabolites (Ulberth & Buchgraber,

44 2000). These advanced sensing methods, combined with complementary analytical

45 techniques, can improve the determination of olive oil adulteration (Ou, Hu, Zhang, Li,

46 Luo, & Zhang, 2015). Recently, chemometric analysis combined with multivariate

47 analysis of experimental data has been used to distinguish extra virgin olive oils from

48 different cultivars (Gouvinhas, de Almeida, Carvalho, Machado, & Barros, 2015) and to

2
49 detect adulteration with canola oil (Rohman, Che Man, & Yusof, 2014). However, the

50 metabolite composition of a given olive variety is greatly affected by environmental

51 conditions (Gómez-Rico et al., 2007), as well as postharvest and postproduction

52 treatments (Ben-Hassine et al., 2013). Moreover, the detection limits of these methods

53 may be not sufficient to ensure edible oil authenticity.

54 DNA-based assays have proven to be very useful to authenticate the species used in

55 processed food, due to their greater stability during physical and chemical food

56 processing treatments than proteins or lipids. The PCR techniques with DNA-based

57 markers are a tool increasingly valued in authenticating species and cultivars and in

58 food safety and traceability. The application of these techniques to edible oils has the

59 advantage of overcoming the limitations of environmental variations and alterations

60 derived from the processing of seeds. In fact, many researchers have applied these

61 biomolecular methodologies for olive/olive oil genetic characterization and

62 identification, and for authentication of cultivars and oil traceability (Pasqualone,

63 Montemurro, di Rienzo, Summo, Paradiso, & Caponio, 2016).

64 Nevertheless, the reliability and reproducibility of molecular marker profiles are

65 determined by the quality of the DNA extracted from the oil (Testolin & Lain 2005;

66 Ben-Ayed, Grati-Kamoun, Moreau, & Rebaï, 2009). The DNA extraction from the oil is

67 a key step (Agrimonti et al., 2011). The amount of DNA isolated from olive oil is low

68 and highly degraded by the nucleases (Muzzalupo & Perri, 2002; Testolin & Lain,

69 2005; Pafundo, Agrimonti, Maestri, & Marmiroli, 2007; Ben-Ayed et al., 2009).

70 Moreover, phenolic compounds and residual polysaccharides can inhibit or alter PCR

71 amplifications (Testolin & Lain, 2005). Besides, the processing steps of olive oil

72 production affect the quantity and quality of the DNA. Amplifiable DNA, although

73 partially degraded and in low quantities, can be extracted from virgin oils, even those

3
74 that have been filtered (Pasqualone et al., 2015). Therefore, the DNA extraction method

75 needs to be carefully chosen and optimized to obtain enough good quality DNA (He et

76 al., 2013), even though the most current trends point to the use of more sensitive

77 technologies such as quantitative real-time PCR (Ben-Ayed et al., 2013).

78 Quantitative PCR (qPCR) is characterized by higher sensitivity than conventional

79 PCR, enabling detection of DNA in very low amounts, and it is also more reliable and

80 specific. This technique also allows DNA to be quantified. In addition, molecular

81 markers used in qPCR are designed to amplify small DNA fragments, reducing the

82 problems resulting from DNA degradation, and in the last few years qPCR has been

83 used in the authentication of edible oils (Debode, Jassen, Marien, & Barden, 2012; He

84 et al., 2013; Ramos-Gómez, Busto, Pérez-Mateos, & Ortega, 2014).

85 qPCR has been studied for its specific application in the detection and authentication

86 of virgin olive oils (Giménez, Pistón, Martín, & Atienza, 2010; Vietina, Agrimonti, &

87 Marmiroli, 2013; Ramos-Gómez, Busto, Albillos, & Ortega, 2016). Nevertheless,

88 DNA-based methods, and specifically qPCR, present challenges to be overcome in their

89 application in olive oil authentication: to obtain high quality DNA from olive oils

90 obtained using different processes, including refining, and to design an efficient and

91 highly sensitive qPCR system which allows detection and quantification of the

92 expectedly low DNA.

93 In order to overcome these challenges, the aim of the study was to establish an

94 efficient method for the authentication of olive oil regardless of the olive oil category,

95 according to specific olive qPCR systems based on the chloroplast trnL (UAA).

96 2. Materials and methods

97 2.1. Plant tissue and oil samples

4
98 This study included leaf tissue from olive (Olea europaea), maize (Zea mays),

99 sunflower (Helianthus annuus), soybean (Glycine max), peanut (Arachis hypogaea),

100 coconut (Cocos nucifera) and canola (Brassica napus). 22 commercial olive oils were

101 purchased from olive oil mills, local grocery retailers and supermarkets: 12 extra virgin

102 olive oils (EVOOs), 5 virgin olive oils (VOOs), 4 refined olive oils (OOs) and 1

103 pomace refined olive oil (PO) (Table 1).

104 2.2. DNA extraction

105 2.2.1. Leaf tissue

106 DNA extraction from leaves was carried out following the

107 hexadecyltrimethylammonium bromide (CTAB) based method (Doyle & Doyle, 1990)

108 with minor modifications. Briefly, leafy samples (100 mg) were mixed with 1 mL of

109 CTAB buffer (2% (w/v) CTAB, 1.4 M NaCl, 50 µM dithiothreitol (DTT), 20 mM

110 ethylenediaminetetraacetic acid (EDTA), 100 mM Tris-HCl (pH 8.0), 2% (v/v) Tween-

111 20, 0.4% (v/v) 2-mercaptoethanol). The resulting DNA pellet was dissolved in 40 µL of

112 0.1X TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA).

113 The quantity and quality of the extracted DNA was determined by measuring the

114 absorbance at 260 nm and the 260/280 nm ratio using a UV spectrophotometer

115 (PowerWave XS2, BioTek Instruments, Inc., Saint Quentin, France).

116 The DNA integrity was checked by electrophoresis in 0.8% agarose gels in 1X TAE

117 (40 mM Tris-acetate (pH 8.0), 1 mM EDTA) buffer with 0.35X SYBR® Safe

118 (Invitrogen, Barcelona, Spain) using the Lambda DNA/HindIII Marker as standards.

119 The electrophoresis was run at 100 V and the gels were subsequently visualized using

120 the Molecular Imager Gel Doc XR System transilluminator and the software Quantity

121 One® v 4.5.2 (Bio-Rad Laboratories, Milan, Italy).

5
122 DNA was effectively extracted from an assortment of six different leaf samples with

123 similar results in term of quantity (0.99 ± 0.08 µg/µL), quality (A260/A280: 1.86 ± 0.02),

124 and integrity (data non shown).

125 2.2.2. Olive oil

126 DNA extraction from olive oils was carried out following the CTAB based method

127 optimized by Ramos-Gómez et al. (2014), with some modifications. Briefly, 6 mL of

128 olive oil was mixed with 3 mL of pre-warmed lysis buffer (2% (w/v) CTAB, 1.4 M

129 NaCl, 50 µM DTT, 20 mM EDTA, 100 mM Tris-HCl (pH 8.0), 2% (v/v) 2-

130 mercaptoethanol and 100 µg mL-1 proteinase K) and incubated for 15 min at 65 ºC with

131 stirring at 850 rpm. The upper phase was mixed with 2 mL of cold

132 phenol:chloroform:isoamyl alcohol (25:24:1) and the mixture was centrifuged for 25

133 min at 11,000 rpm (4 ºC). This step was repeated under the same conditions. After

134 precipitation with isopropanol and DNA drying, the pellet was dissolved in 30 µL of

135 0.1X TE buffer by incubation at 37 ºC at 125 rpm for 15 min.

136 The quantity and quality of the extracted DNA was determined by measuring the

137 absorbance at 260 nm and the 260/280 nm ratio using a UV spectrophotometer

138 (PowerWave XS2, BioTek Instruments, Inc., Saint Quentin, France).

139 2.3. trnL-based PCR and primer design

140 The primers’ design was based on the intron region of the chloroplast tRNA trnL

141 (UAA) gene, whose PCR product size is variable among species (Taberlet, Gielly,

142 Pautou, & Bouvet, 1991; Spaniolas, Bazakos, Awad, & Kalaitzis, 2008). The olive trnL

143 sequence was obtained by amplifying olive DNA extracted from leaf by PCR using the

144 universal amplification system described by Taberlet et al. (1991) consisting of the

145 following primers: 5´CGAAATCGGTAGACGCTACG–3´ (F0) and 5´–

146 GGGGATAGAGGGACTTGAAC3´ (R0). The PCR reaction was carried out in a 50 µL

6
147 total reaction volume containing 100 ng of DNA, 1X PCR buffer, 2.5 mM MgCl2, 200

148 µM dNTPs (each), 0.3 µM of each forward (F0) and reverse (R0) primers, and 1.5 U of

149 OptiTaq DNA polymerase (Invitrogen, Barcelona, Spain). The PCR amplification was

150 performed in a Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) using the

151 following program: an initial denaturation at 95 ºC for 3 min, with 40 cycles at 95 ºC for

152 30 s, 50 ºC for 30 s and 72 ºC for 60 s, and a final extension at 72 ºC for 10 min.

153 The product was detected by 1.5% agarose electrophoresis in a TAE buffer and its

154 size was estimated by using the PerfectTM 100 bp DNA Ladder (EURx, Gdansk,

155 Poland) and visualized by 0.35X SYBR® Safe (Invitrogen, Barcelona, Spain) staining

156 on a UV transilluminator in the Molecular Imager Gel Doc XR System transilluminator

157 and the software Quantity One® v 4.5.2 (Bio-Rad Laboratories, Milan, Italy).

158 The olive trnL amplicon was sequenced using an ABI Prism™ 3130XL Genetic

159 Analyzer (Applied Biosystems, Foster City, USA). This sequence was checked with the

160 trnL olive gene (O. europaea) available in the GenBank database (DQ131560).

161 The sequence obtained from the olive trnL amplicon was aligned using Clustal

162 Omega software (http://www.ebi.ac.uk/Tools/msa/clustalo/) with the trnL gene

163 sequences from several oleaginous species: maize (Z. mays: KF285453), sunflower (H.

164 annuus: DQ131547), soybean (G. max: DQ131548), peanut (A. hypogaea: DQ131551),

165 coconut (C. nucifera: DQ131551) and canola (B. napus: DQ131546). The multiple

166 sequence alignment was analyzed to detect polymorphic regions between the olive

167 sequence and all the other species (Fig. 1).

168 The polymorphic regions detected by the alignment were used to design olive-

169 specific amplification systems using Primer-BLAST software

170 (http://www.ncbi.nlm.nih.gov/tools/primer-blast/), enabling a search for primer pairs

7
171 specific to the intended PCR template. As a result, two specific forward primers (F) and

172 three specific reverse primers (R) were designed (Fig. 1):

173 F1: 5´GGGCAATCCTGTAGCCAAA–3´

174 F2: 5´TGACGACTCGAATCTCTATCTGT–3´

175 R1: 5´–TCAGACTATGGAGTGAATGATTTGA–3´

176 R2: 5´ACGCAGTCCACTCCATTTGT–3´

177 R3: 5CAGATAGAGATTCGAGTCGTCATTA–3´

178 As combinations of these primers and covering different trnL regions, four systems

179 were established to amplify different product sizes which were valid to be used in

180 SYBR Green-based qPCR (Table 2): A-trnL (F1 and R1, 302 bp), B-trnL (F1 and R3,

181 212 bp), C-trnL (F2 and R1, 112 bp) and D-trnL (F1 and R2, 110 bp). All the primers

182 were synthetized by Metabion (Martinsried, Germany).

183 2.4. qPCR optimization

184 The four systems designed (Table 2) were tested by SYBR Green-based qPCR. The

185 assay was carried out in 25 µL final reaction volume. The mixture contained 1X SYBR

186 Green Master Mix (EURx, Gdańsk, Poland) and 50 µg of olive DNA. The qPCR

187 conditions for all systems were an initial denaturation step at 95 ºC for 3 min, 40 cycles,

188 followed by another denaturation step at 95 ºC for 30 s and an annealing step at 50 to

189 58 ºC for 30 s. Finally, one more denaturation step carried out at 95 ºC for 1 min. The

190 melting curve analysis was 30 cycles of 0.5 ºC increments (10 s each) beginning at

191 70 ºC. The qPCR assays were performed in a fluorometric thermal cycler iCycler

192 IQTM Real-Time Detection System (Bio-Rad Laboratories, Hercules, USA). All

193 samples were analyzed in triplicate and no template control (NTC) was included in any

194 assay to ensure the absence of contamination.

8
195 Optimization of qPCR conditions was designed for the development of robust assays.

196 The optimization process took into account two main factors: the concentration of

197 primers and the annealing temperature.

198 The concentration of the primers was optimized for each system. The optimization

199 assays were performed at 100, 200 and 300 nM for forward (F) and reverse (R) primers.

200 The primer concentration was considered to be optimal when the amplicon resulted in

201 an expected size and the following conditions were met: a low Cq value, a low standard

202 deviation between replicates, robust levels of fluorescence intensity, and that no primer

203 dimers were present.

204 The annealing temperature for each primer pair was also optimized. The temperature

205 range analyzed was between 50 and 58 ºC by using a thermal gradient PCR. The

206 optimal annealing temperature was selected based on the one that resulted in the lowest

207 Cq with no nonspecific amplification detected by melting curves.

208 2.5. Evaluation and selection of the qPCR systems

209 2.5.1. Linear dynamic range and qPCR efficiency

210 The linear dynamic range of all systems was determined by performing a standard

211 curve for each system. The standard curves were designed including three replicates of

212 seven logs of olive leaf DNA (from 500 ng to 0.5 pg). All systems included an NTC to

213 detect DNA contamination. The efficiency (E = 10(-1/slope)-1) and the correlation

214 coefficient (R2) were calculated from the equation of the curve for each system

215 (Cq = a log [DNA] + b).

216 2.5.2. Sensitivity and specificity of the qPCR systems

217 The sensitivity of the methods, based on the standard curve, was evaluated by

218 determining the limit of detection (LOD), defined as the lowest concentration at which

219 the analyte can reliably be detected with a probability of 95%, and the limit of

9
220 quantification (LOQ), understood as the lowest concentration at which there is some

221 confidence in the accuracy of the reported measurement. The statistical significance of

222 differences between the values of the quantification cycles (Cq) was evaluated by

223 analysis of variance (ANOVA) with a significance level of 95% (p < 0.05). LOQ was

224 determined by the following equation: LOD = 10 x standard deviation (SD)/slope and

225 checked by DMS post hoc test, and LOD was calculated with the following equation:

226 LOD = 3.3 x standard deviation (SD)/slope (Bustin et al., 2009).

227 The specificity of the systems was determined by checking that the melting curves

228 corresponded to single peak curves at the expected temperature.

229 The best system in terms of linear dynamic range, efficiency, specificity and

230 sensitivity was selected for further analysis.

231 2.6. Detection of olive in commercial oils

232 The DNA isolated from 22 commercial olive oils (Table 1) was amplified by qPCR

233 with the system selected. The conditions of amplification were the same as described

234 above. The olive oils were grouped by quality into sets of six samples, including in each

235 set an NTC and a sample of 1 pg of olive DNA as a positive control. All the samples

236 were analyzed in triplicate. The results were analyzed by ANOVA and Games-Howell

237 post hoc analysis to determine differences between samples and qualities.

238 3. Results and discussion

239 3.1. Design of olive-specific primers for olive identification by qPCR

240 The chloroplast trnL gene was chosen to design specific primers for olive

241 identification (Fig. 1). Chloroplast DNA is more abundant and more resistant than

242 nuclear DNA (Raieta et al., 2015) and its sequence is better conserved for

243 discriminating between food crops (James & Schmidt, 2004). The oleaginous species

10
244 have been differentiated, based on the chloroplast trnL gene, without showing intra-

245 specie variability (Spaniolas et al., 2008).

246 The specificity to the olive of the A-, B-, C- and D-trnL systems was tested in silico

247 by searching for amplification products on potentially unintended templates using the

248 NCBI Primer-BLAST tool, specifically selecting maize, sunflower, soybean, peanut,

249 coconut and canola. This study showed the absence of homology between the primers

250 designed and the sequence databases of NCBI, so non-specific amplifications in other

251 oleaginous species would not be expected.

252 The four oligonucleotide primer pairs amplified olive DNA samples positively. The

253 melting curves showed only one peak, suggesting the specific DNA amplification (Fig.

254 2B). Moreover, the agarose gel electrophoresis confirmed the expected size of the

255 amplicon and revealed the absence of non-desirable secondary products (Fig. 2A).

256 3.2. Optimization of qPCR conditions

257 Optimization of the reaction conditions (primer concentration and annealing

258 temperature) can increase the efficiency, specificity and sensitivity of the amplification

259 process. The concentrations tested for each primer pair that was designed were 100, 200

260 and 300 nM. For all systems an inhibition of the qPCR was observed at 300 nM,

261 whereas at both 100 and 200 nM the results obtained showed high reproducibility in Cq

262 values (standard deviation less than 0.3 between replicates) and one peak at expected

263 temperatures in the melting curves (data not shown). The concentration selected for the

264 primers was 100 nM.

265 The annealing temperatures were evaluated in a range from 50 to 58 ºC and the

266 optimum temperatures determined according to the amplification and melting curves

267 (data not shown). The electrophoresis verifications were 55 ºC (A-trnL), 56.5 ºC (B-

268 trnL) and 53 ºC (C-trnL and D-trnL).

11
269 3.3. Selection of the qPCR system

270 Having optimized the qPCR conditions, the applicability of the A-, B-, C- and D-

271 trnL systems was evaluated by determining their effiency (E) and sensititivy (LOD and

272 LOQ). All the systems revealed good linear dynamic ranges except system A-trnL,

273 which did not show linearity in the range evaluated (Table 2). The correlation

274 coefficients (R2) were higher than 0.99 for systems B-trnL and C-trnL, and 0.96 for D-

275 trnL. The efficiency of C-trnL was quite low, suggesting this system is inaccurate for

276 quantification. By contrast, the most efficient system was D-trnL with 92.96%

277 efficiency. Furthermore, the D-trnL system showed a wide linear range, which covered

278 six of the log10 concentrations.

279 The upper limit of DNA detection was achieved by C-trnL, allowing detection from

280 50 ng, but the lowest DNA concentration detected, determined by LOD, was 0.5 pg by

281 system D-trnL, with a maximum Cq value of 26.93. The lower limit of DNA

282 quantification (LOQ) was 5 pg in all four systems. Taking into account that most DNA

283 isolation methods have yielded values between 0.5 and 40 ng/µ L (Consolandi et al.,

284 2008; Testolin & Lain, 2005; Ramos-Gómez et al., 2014), the selected system should

285 display LOD and LOQ as low as possible.

286 From the results obtained, the D-trnL system was selected for the detection of DNA

287 in olive oil because of its high efficiency, optimum LOQ and enhanced detection

288 capability.

289 In addition, the shorter amplicons (110 bp) yielded by the D-trnL system suggested

290 its possible use in olive oil DNA analysis. The processing methods applied to oil

291 production affect the DNA integrity. The amplification fragments need to be an

292 appropriate fragment size in food products in which a high degradation of DNA may

293 occur (Murray, Butler, Hardacre, & Timmerman-Vaughan, 2007). Amplification

12
294 products longer than 300 bp could not be amplified for this nature of degraded DNA

295 from oil (Pasqualone, Montmurro, Caponio, & Blanco, 2004; Testolin & Lain, 2005).

296 Besides, 200 bp has been proposed for food authentication when degradation of DNA is

297 expected (Unseld, Beyermann, Brandt, & Hiesel, 1995), and shorter than 118 bp for

298 DNA from refined oils (Costa, Mafra, Amaral, & Oliveira, 2010).

299 3.4. Evaluation of the D-trnL system

300 3.4.1. Olive specificity against other oleaginous species

301 The specificity of the D-trnL system toward olive against other oleaginous species

302 (canola, soybean, sunflower, maize, peanut and coconut) was experimentally

303 determined. The qPCR assays were performed in triplicate under the optimized

304 conditions and the amplification product sizes were checked by agarose electrophoresis.

305 The specificity against other oleaginous species was absolute for maize, sunflower,

306 soybean, peanut and, coconut, which did not amplify either of their replicates (Fig. 3A)

307 and no amplicon was detected in electrophoresis (Fig. 3B). Nevertheless, both canola

308 and NTC showed Cq above 36 and 34.77, respectively (Fig. 3A). For canola replicates

309 the melting curves showed a single peak at 78.5 ºC (data not shown), and the

310 electrophoresis analysis a weak band (Fig. 3B). Thus, canola samples can be detected

311 by the D-trnL system and could be identified and olive differentiated by the melting

312 curve (olive Tm 80 ºC, Fig. 2B). The NTC replicates showed low repeatability, both in

313 Cq values and Tm peaks, and these results indicate the probability of being amplified

314 non-specifically or the presence of primer dimers. The agarose gel only detected a low

315 signal of primers at the bottom of the gel (Fig. 3B).

316 3.4.2. Sensitivity: linear dynamic range

317 The linear dynamic range and LOD are essential in validating qPCR (Bustin et al.,

318 2009), especially considering the low yield of DNA obtained from oils, so these

13
319 parameters should cover the widest possible sensitivity to the lowest concentration of

320 DNA. Therefore, LOD and LOQ for the D-trnL system were recalculated. A new

321 standard curve with a wider dynamic range was constructed with different dilutions: 10-

322 fold (from 500 ng to 5 pg), 5-fold (1 pg), and 2-fold (0.5 pg to 0.0625 pg) of olive

323 DNA, using six replicates for each standard (Fig. 3C). The results obtained showed that

324 the Cq standard deviations were less than or equal to 0.3, and the correlation coefficient

325 was 0.999 (R2), demonstrating good accuracy of the data, with a 105% efficiency.

326 Moreover, the LOD and LOQ coincided and both covered the full dynamic range (500

327 ng - 0.0625 pg), with a maximum Cq value of 32.15.

328 This maximum Cq value also confirms the specificity of the D-trnL system to detect

329 olive because canola and NTC amplification curves shown in the specificity analysis Cq

330 were above 34 (Fig. 3A), higher than the upper Cq value established from the LOD and

331 LOQ of this system.

332 The lower limit was below the limit set by other authors, like the LOD of 0.1 pg/mL

333 for olive DNA detection by PCR capillary electrophoresis single strand conformation

334 polymorphism (PCR-CE-SSCP) (Wu et al., 2011) of another plastid gene (rbcL), or the

335 LOD of 10 pg/µL of DNA from olive oil based on suspension bead arrays (Li, Wu,

336 Han, Wang, Ge, & Chen, 2012). The analytical sensitivity of PCR with the use of

337 chloroplast DNA, more abundant and stronger than nuclear DNA (Raieta et al., 2015),

338 has contributed to the LOD and LOQ obtained.

339 3.4.3. Application in olive oil

340 All the studies published so far have shown that the reliability and reproducibility of

341 molecular marker profiles are determined by the quality of the DNA extracted from the

342 oil (Breton, Claux, Metton, Skorski, & Bervillé, 2004; Testolin & Lain, 2005;

343 Muzzalupo, Pellegrino, & Perri, 2007; Ben-ayed et al., 2009). Ramos-Gómez et al.

14
344 (2014) described the optimization of the DNA extraction method from commercial

345 vegetable oils. The use of chloroform, as organic reagent, in a volume equal to the

346 volume of the olive oil, the use of phenol: chloroform: isoamyl alcohol (25:24:1) and

347 the avoiding of too many repetitions of DNA precipitation washes are in agreement with

348 the recommendations established for an increased yield of isolated DNA from edible

349 oils (He et al., 2013).

350 The DNA obtained from all the olive oils was quantified at 260 nm, obtaining a

351 minimum concentration, in a final volume of 30 µl, of 26 ng/µL from EVOO 11 and a

352 maximum of 411 ng/µL from EVOO 07. These concentrations were sufficient for

353 amplification. The quality, determined by the 260/280 nm ratio, was similar in all

354 samples: 1.51 ± 0.01. Similar low absorbance ratios have been detected in DNA isolated

355 from olive oils in previous works, indicating the presence of protein, phenol or other

356 contaminants (Consolandi et al., 2008; Ramos-Gómez et al., 2014), but they also

357 reported the amplificability of these samples.

358 The efficiency of D-trnL along with its specificity and high sensitivity in its

359 application to olive DNA suggested the suitability of this system for its application in

360 oil DNA. For this purpose, different olive oils were analyzed (Table 1). The processing

361 methods to obtain the different categories of olive oils may differentially affect the

362 integrity and quantity of the recovered DNA. A total of 12 EVOOs, 5 VOOs, 4 OOs and

363 1 PO were analyzed by qPCR with system D (Fig. 4). All samples were positively

364 amplified and fitted into the range of LOD and LOQ previously established by the

365 calibration curve. The melting curves showed a single melting peak, with a difference of

366 less than 0.5 ºC from the expected melting temperature, 79.5 ºC. The mean Cq value for

367 each type of oil was 30.85 (EVOOs), 30.73 (VOOs), 30.53 (OOs) and 30.75 (PO),

368 respectively.

15
369 The Cq values from all analyzed oils were between 29.2 and 32.8, which

370 corresponded to 1 pg and 0.125 pg of olive DNA respectively, per reaction. The olive

371 genome size, as a C-value (haploid genome mass) is approximately 3 pg/2 C (Loureiro,

372 Rodriguez, Costa, & Santos, 2007). Therefore, between 316 and 24 copies were

373 detected from 6 mL of olive oil. These yield results, 52.67 - 4 C/mL, are greater than

374 those obtained by Costa et al. (2010), who extracted less than 50 C per 200 mL from

375 blended soybean oil, but lower than those obtained by He et al. (2013), 1396 - 311

376 C/mL from different blended oils. These discrepancies may be due to the starting

377 volumes (30 vs 6 mL), the resuspension volume (50 vs 30 µL) and the intrinsic

378 differences among blended oils and their refining processes.

379 Although the literature reported the need to process the olive oil as fresh as possible,

380 within no more than month, in order to avoid DNA damage (Pafundo, Busconi,

381 Agrimonti, Fogher, & Marmiroli, 2010), the olive oil samples used in this study were

382 collected at different times from different sources, without prior knowledge of their

383 processing dates, and several of them had been stored for over a year until used in DNA

384 extraction. Nevertheless, we have been able to obtain amplifiable DNA from different

385 olive oils even one year after milling, as did the results obtained by Raieta et al. (2015).

386 The ANOVA and Games-Howell post hoc analysis revealed no significant

387 differences between the amount of DNA obtained from the different olive oils based on

388 quality (EVOO, VOO, OO, or PO), regardless of geographical origin or other

389 characteristics such as acidity or variety. Moreover, the different samples analyzed

390 included mono and multi-varietal commercially available olive oils; all of them were

391 processed with positive and reliable results, without significant differences among them.

392 The D-trnL system allowed detection of olive DNA regardless of varietal origin or

393 olive oil category, and is therefore suitable for olive oil authentication.

16
394 The time and economic costs of the D-trnL qPCR system presented in this work are

395 very reasonable. DNA extraction from 6 mL of olive oil can be reduced to 3.0-3.5 hours

396 with the CTAB-based method described, and the qPCR amplification can be achieved in

397 2.0-2.5 hours. Therefore, this process can be completed within the duration of a working

398 day. The application of a conventional DNA isolation protocol, compared to using

399 commercial kits, and the SYBR-Green chemistry used in qPCR, compared with other

400 chemistries such as TaqMan, reduced the economic costs of these authentication

401 systems.

402 4. Conclusions

403 The high nutritional and health values of olive oil makes it susceptible to fraudulent

404 practices, mainly adulteration. These illegal practices should be prevented, so it is

405 necessary to implement tools to authenticate olive oil. We detail a qPCR-based method

406 to specifically detect olive DNA in olive oils. The proposed method includes DNA

407 isolation from olive oils and the description of an amplification system of the isolated

408 DNA in an optimal way. Four trnL-based systems, specifically designed for olive, were

409 optimized and evaluated for efficiency and sensitivity. The D-trnL system was found to

410 be the most efficient in a wide linear dynamic range; this system was contrasted

411 experimentally, determining its high sensitivity and high degree of specificity.

412 Moreover, its suitability for application in olive oils proved to be optimal, allowing the

413 detection of olive oils quickly and inexpensively, notwithstanding the varied differential

414 characteristics of various olive oils that are commercially available, as for example

415 category or cultivar.

416

17
417 References

418 Agrimonti, C., Vietina, M., Pafundo, S., & Marmiroli, N. (2011). The use of food

419 genomics to ensure the traceability of olive oil. Trends in Food Science &

420 Technology, 22, 237-244.

421 Ben-Ayed, R., Grati-Kamoun, N., Moreau, F., & Rebaï, A. (2009). Comparative study

422 of microsatellite profiles of DNA from oil and leaves of two Tunisian olive

423 cultivars. European Food Research & Technology, 229, 757-762.

424 Ben-Ayed, R., Kamoun-Grati, N., & Rebai, A. (2013). An overview of the

425 authentication of olive tree and oil. Comprehensive Reviews in Food Science and

426 Food Safety, 12, 218-227.

427 Ben-Hassine, K., Taamalli, A., Ferchichi, S., Mlaouah, A., Benincasa, C., Romano, E.,

428 Flamini, G., Lazzez, A., Grati-Kamoun, N., Perri, E., Malouche, D., & Hammami,

429 M. (2013). Physicochemical and sensory characteristics of virgin olive oils in

430 relation to cultivar, extraction system and storage conditions. Food Research

431 International, 54, 1915-1925.

432 Breton, C., Claux, D., Metton, I., Skorski, G., & Bervillé, A. (2004). Comparative study

433 of methods for DNA preparation from olive oil samples to identify cultivar SSR

434 alleles in commercial oil samples: possible forensic applications. Journal of

435 Agricultural and Food Chemistry, 52, 531-537.

436 Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., Mueller,

437 R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J., & Wittwer, C. T.

438 (2009). The MIQE guidelines: minimum information for publication of quantitative

439 real-time PCR experiments. Clinical Chemistry, 55, 611-622.

440 Cercaci, L., Rodriguez-Estrada, M. T., & Lercker, G. (2003). Solid-phase extraction-

441 thin-layer chromatography-gas chromatography method for the detection of

18
442 hazelnut oil in olive oils by determination of esterified sterols. Journal of

443 Chromatography A, 985, 211-220.

444 Consolandi, C., Palmieri, L., Severgnini, M., Maestri, E., Marmiroli, N., Agrimonti, C.,

445 Baldoni, L., Donini, P., De Bellis, G., & Castiflioni, B. (2008). A procedure for

446 olive oil traceability and authenticity: DNA extraction, multiplex PCR and LDR–

447 universal array analysis. European Food Research and Technology, 227, 1429-

448 1438.

449 Costa, J., Mafra, I., Amaral, J. S., & Oliveira, M. B. P. P. (2010). Detection of

450 genetically modified soybean DNA in refined vegetable oils. European Food

451 Research and Technology, 230, 915-923.

452 Debode, F., Janssen, E., Marien, A., & Berben, G. (2012). DNA detection by

453 conventional and real-time PCR after extraction from vegetable oils. Journal of the

454 American Oil Chemists' Society, 89, 1249-1257.

455 Doyle, J. J., & Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus, 12,

456 13-15.

457 Giménez, M. J., Pistón, F., Martín, A., & Atienza, S. G. (2010). Application of real-time

458 PCR on the development of molecular markers and to evaluate critical aspects for

459 olive oil authentication. Food Chemistry, 118, 482-487.

460 Gómez-Rico, A., Salvador, M. D., Moriana, A., Pérez, D., Olmedilla, N., Ribas, F., &

461 Fregapane, G. (2007). Influence of different irrigation strategies in a traditional

462 Cornicabra cv. olive orchard on virgin olive oil composition and quality. Food

463 Chemistry, 100, 568-578.

464 Gouvinhas, I., de Almeida, J. M. M. M., Carvalho, T., Machado, N., & Barros, A. I. R.

465 N. A. (2015). Discrimination and characterisation of extra virgin olive oils from

19
466 three cultivars in different maturation stages using Fourier transform infrared

467 spectroscopy in tandem with chemometrics. Food Chemistry, 174, 226–232.

468 He, J., Xu, W., Shang, Y., Zhu, P., Mei, X., Tian, W., & Huang, K. (2013).

469 Development and optimization of an efficient method to detect the authenticity of

470 edible oils. Food Control, 31, 71-79.

471 IOC (International Olive Council) (2016). Designations and definitions of olive oils.

472 URL http://www.internationaloliveoil.org/estaticos/view/83-designations-and-

473 definitions-of-olive-oils. Accessed 16.08.10.

474 James, D., & Schmidt, A. (2004). Use of an intron region of a chloroplast tRNA gene

475 (trnL) as a target for PCR identification of specific food crops including sources of

476 potential allergens. Food Research International, 37, 395-402.

477 Li, Y., Wu, Y., Han, J., Wang, B., Ge, Y., & Chen, Y. (2012). Species-specific

478 identification of seven vegetable oils based on suspension bead array. Journal of

479 Agricultural and Food Chemistry, 7, 2362-2367.

480 Loureiro, J., Rodriguez, E., Costa, A., & Santos, C. (2007). Nuclear DNA content

481 estimations in wild olive (Olea europaea L. ssp. europaea var. sylvestris Brot.) and

482 Portuguese cultivars of O. europaea using flow cytometry. Genetic Resources and

483 Crop Evolution, 54, 21-25.

484 Murray, S. R., Butler, R. C., Hardacre, A. K., & Timmerman-Vaughan, G. M. (2007).

485 Use of quantitative Real-time PCR to estimate maize endogenous DNA degradation

486 after cooking and extrusion or in food products. Journal of Agricultural and Food

487 Chemistry, 55, 2231-2239.

488 Muzzalupo, I., & Perri, E. (2002). Recovery and characterization of DNA from virgin

489 olive oil. European Food Research & Technology, 214, 528-531.

20
490 Muzzalupo, I., Pellegrino, M., & Perri, E. (2007). Detection of DNA in virgin olive oils

491 extracted from destoned fruits. European Food Research and Technology, 224, 469-

492 475.

493 Ou, G., Hu, R., Zhang, L., Li, P., Luo, X., & Zhang, Z. (2015). Advanced detection

494 methods for traceability of origin and authenticity of olive oils. Analytical Methods,

495 7, 5731-5739.

496 Pafundo, S., Agrimonti, C., Maestri, E., & Marmiroli, N. (2007). Applicability of SCAR

497 markers to food genomics: olive oil traceability. Journal of Agricultural and Food

498 Chemistry, 55, 6052–6059.

499 Pafundo, S., Busconi, M., Agrimonti, C., Fogher, C., & Marmiroli, N. (2010). Storage-

500 time effects on olive oil DNA assessed by amplified fragments length

501 polymorphisms. Food Chemistry, 123, 787-793.

502 Pasqualone, A., di Rienzo, V., Miazzi, M.M., Fanelli, V., Caponio, F., & Montemurro,

503 C. (2015). High resolution melting analysis of DNA microsatellites in olive pastes

504 and virgin olive oils obtained by talc addition. European Journal of Lipid Science

505 and Technology, 117, 2044-2048.

506 Pasqualone, A., Montemurro, C., Caponio, F., & Blanco, A. (2004). Identification of

507 virgin olive oil from different cultivars by analysis of DNA microsatellites. Journal

508 of Agricultural and Food Chemistry, 52, 1068-1071.

509 Pasqualone, A., Montemurro, C., di Rienzo, V., Summo, C., Paradiso, V. M., &

510 Caponio, F. (2016). Evolution and perspectives of cultivar identification and

511 traceability from tree to oil and table olives by means of DNA markers. Journal of

512 the Science of Food and Agriculture, 96, 3642-3657.

21
513 Raieta, K., Muccillo, L., & Colantuoni, V. (2015). A novel reliable method of DNA

514 extraction from olive oil suitable for molecular traceability. Food Chemistry, 172,

515 596-602.

516 Ramos-Gómez, S., Busto, M. D., Albillos, S. M., & Ortega, N. (2016). Novel qPCR

517 systems for olive (Olea europaea L.) authentication in oils and food. Food

518 Chemistry, 194, 447-454.

519 Ramos-Gómez, S., Busto, M. D., Pérez-Mateos, M., & Ortega, N. (2014). Development

520 of a method to recovery and amplification DNA by real-time PCR from commercial

521 vegetable oils. Food Chemistry, 158, 374-383.

522 Rohman, A., Che Man, Y. B., & Yusof, F. M. (2014). The use of FTIR spectroscopy

523 and chemometrics for rapid authentication of extra virgin olive oil. Journal of the

524 American Oil Chemists' Society, 91, 207-213.

525 Spaniolas, S., Bazakos, C., Awad, M., & Kalaitzis, P. (2008). Exploitation of the

526 chloroplast trnL (UAA) intron polymorphisms for the authentication of plant oils by

527 means of a lab-on-a-chip capillary electrophoresis system. Journal of Agricultural

528 and Food Chemistry, 56, 6886-6891.

529 Taberlet, P., Gielly, L., Pautou, G., & Bouvet, J. (1991). Universal primers for

530 amplification of 3 noncoding regions of chloroplast DNA. Plant Molecular Biology,

531 17, 1105-1109.

532 Testolin, R., & Lain, O. (2005). DNA extraction from olive oil and PCR amplification

533 of microsatellite markers. Journal of Food Science, 70, 108-112.

534 Ulberth, F., & Buchgraber, M. (2000). Authenticity of fats and oils. European Journal

535 of Lipid Science and Technology, 102, 687-694.

22
536 Unseld, M., Beyermann, B., Brandt, P., & Hiesel, R. (1995). Identification of the

537 species origin of highly processed meat products by mitochondrial DNA sequences.

538 PCR Methods and Applications, 4, 241-243.

539 Vietina, M., Agrimonti, C., & Marmiroli, N. (2013). Detection of plant oil DNA using

540 high resolution melting (HRM) post PCR analysis: a tool for disclosure of olive oil

541 adulteration. Food Chemistry, 141, 3820-3826.

542 Wu, Y., Zhang, H., Han, J., Wang, B., Wang, W., Ju, X., & Chen, Y. (2011). PCR-CE-

543 SSCP applied to detect oil blended in olive oil. European Food Research and

544 Technology, 233, 313-324.

545

23
546 FIGURE CAPTIONS

547 Fig. 1. Alignment of trnL gene sequence of oleaginous species using Clustal Omega

548 software. The polymorphic regions detected were used to design olive-specific

549 amplification systems. Two forward primers (F1 and F2) and three reverse

550 primers (R1, R2 and R3) were selected. A schematic representation of the

551 systems designed in this study (A-, B-, C- and D-trnL) has been included at the

552 bottom of the figure.

553 Fig. 2. A) Agarose gel electrophoresis of trnL product PCR amplified from olive leaf.

554 Lane M: molecular weight marker (100-bp ladder), lane 1: D-trnL system; lane

555 2: B-trnL system; lane 3: C-trnL system; lane 4: A-trnL system; lane 5: system

556 described by Taberlet et al. (1991); NTC: no template control. B) Melting curves

557 of the trnL amplicons from olive obtained with the systems designed in this

558 study (A-, B-, C- and D-trnL) and that described by Taberlet et al. (1991).

559 Fig. 3. Study of the specificity and sensitivity of the D-trnL system. A) qPCR

560 amplification by the D-trnL system of DNA from oleaginous species (olive,

561 canola, soybean, sunflower, maize, peanut and coconut). Cq values are

562 expressed as means ± standard deviation. B) Agarose gel electrophoresis of D-

563 trnL product PCR amplified. Lane M: molecular weight marker (100-bp ladder);

564 lane 1: olive; lane 2: maize; lane 3: sunflower; lane 4: soybean; lane 5: peanut;

565 lane 6: coconut; lane 7: canola; lane 8: no template control. C) Olive DNA

566 standard curves based on serial dilution, ranging from 500,000 to 0.0625 pg of

567 DNA per reaction.

568 Fig. 4. Olive DNA qPCR amplification by the D-trnL system in commercial oils.

569 Melting curves are shown in the inset. Cq values are expressed as means ±

24
570 standard deviation. A) Extra virgin olive oil (EVOO 01-06); B) extra virgin oil

571 (EVOO 07-12), C) virgin olive oil (VOO 01-05) and pomace refined olive oil

572 (PO); D) refined olive oil (OO 01-04). NTC: no template control.

573

25
 Table 1
Detailed information about commercial olive oils used in this study.
Oil samples a Olive cultivar PDO b Characteristics
EVOO-01 – – First grinding
EVOO-02 Picual – Recently harvested, maximum acidity 0.4º
EVOO-03 Cornicabra – Puertollano olive oil mill
EVOO-04 Picual Sierra Mágina –
EVOO-05 – Sierra de –
Cazorla
EVOO-06 Arbequina – –
EVOO-07 Picual Segura Cold pressed, maximum acidity 0.3º
EVOO-08 Arbequina – Recently harvested, maximum acidity 0.1º
EVOO-09 Hojiblanca – Recently harvested, maximum acidity 0.5º
EVOO-10 – Estepa Cold pressed
EVOO-11 Arbequina – Puertollano olive oil mill
EVOO-12 Cornicabra – Cold pressed, unfiltered
VOO-01 – – Maximum acidity 0.8º
VOO-02 – – –
VOO-03 – – Jaén olive oil mill
VOO-04 – – –
VOO-05 – – –
OO-01 – – Maximum acidity 0.1º
OO-02 – – –
OO-03 – – Maximum acidity 1º
OO-04 – – Maximum acidity 0.4º
PO-01 – – –
a
EVOO: extra virgin olive oil; VOO: virgin olive oil, OO; refined olive oil; PO: pomace refined olive oil
b
PDO: Protected Designation of Origin
574
Table 2.
System based on trnL gene used for the specific detection of olive by qPCR: Efficiency,
sensitivity and specificity of system
Amplico Standard LOD e LOQ f
System Prime n curve b E
ra size (bp) Slop R 2c
(%) Max Cq ADN Max Cq ADN
d
e (pg) (pg)
Taberl F0- 532 3.95 0.99 79.0 27.88±0.1 5- 27.88±0.1 5-
et et al. R0 3 7 4 9 50,00 9 50,00
(1991) 0 0
A-trnL F1- 302 - - - - - - -
R1
B-trnL F1- 212 3.74 0.99 85.0 29.29±0.5 5- 29.29±0.5 5-
R3 3 6 0 1 5,000 1 5,000
C-trnL F2- 112 4.60 0.99 64.8 31.61±0.2 5- 31.61±0.2 5-
R1 5 5 7 3 50,00 3 50,00
0 0
D-trnL F1- 110 3.50 0.96 92.9 26.93±0.0 0.5- 24.93±0.0 5-

26
 R2 3 0 6 0 5,000 1 5,000
a
Primer Forward (F0, F1 and F2) and reverse (R0, R1, R2 and R3) have been defined in material and methods
section
b
Based on serial dilution of the olive DNA standard, ranging from 500,000 to 0,5 pg of DNA per reaction. Each
standard was analyzed by triplicate.
c
Correlation coefficient
d
PCR efficiency
e
Limit of detection
f
Limit of quantification
575
576

27
 1 85 195 285 385 532

F0 System described by Taberlet et al. (1991) (532 bp) R0

F1 A-trnL system (302 bp) R1
F1 B-trnL system (212 bp) R3
F1 (110 bp) R2 F2 (112 bp) R1
D-trnL system C-trnL system
577
578 Fig. 1. Alignment of trnL gene sequence of oleaginous species using Clustal Omega
579 software. The polymorphic regions detected were used to design olive-specific
580 amplification systems. Two forward primers (F1 and F2) and three reverse primers (R1,
581 R2 and R3) were selected. A schematic representation of the systems designed in this
582 study (A, B, C and D-trnL system) has been included in the bottom of the figure.
583

28
584
585 Fig. 2. A) Agarose gel electrophoresis of trnL product PCR amplified from olive leaf.
586 Lane M: molecular weight marker (100-bp ladder), lane 1: D-trnL system; lane 2:
587 B-trnL system; lane 3: C-trnL system; lane 4; A-trnL system; lane 5; system described
588 by Taberlet et al. (1991); NTC: no template control. B) Melting curves of the trnL
589 amplicons from olive obtained with the systems designed in this study (A, B, C and
590 D-trnL system) and that described by Taberlet et al. (1991).

591

29
592 Fig. 3. Study of the specificity and sensitivity of the D-trnL system. A) qPCR
593 amplification by D-trnL system of DNA from oleaginous species (olive, canola,
594 soybean, sunflower, maize, peanut and coconut. Cq values are expressed as means ±
595 standard deviation. B) Agarose gel electrophoresis of D-trnL product PCR. Lane M:
596 molecular weight marker (100-bp ladder), lane 1: olive; lane 2: maize; lane 3:
597 sunflower; lane 4; soybean; lane 5; peanut; lane 6: coconut; lane 7: canola; lane 8: no
598 template control. C) Olive DNA standard curves based on serial dilution, ranging from
599 500,000 to 0.0625 pg of DNA per reaction.

30
600
601 Fig. 4. Olive DNA qPCR amplification by the D-trnL system in commercial oils.
602 Melting curves are shown in the inset. Cq values are expressed as means ± standard
603 deviation. A) Extra virgin olive oil (EVOO 01-06); B) extra virgin oil (EVOO 07-12),
604 C) virgin olive oil (VOO 01-05) and pomace refined olive oil (PO); D) refined olive oil
605 (OO 01-04). NTC: no template control.
606

31
607
608
609 Olive oil authentication by qPCR depends on primer design and DNA
610 amplificability.

611 Four olive-specific qPCR systems, based on trnL, are designed and validated.

612 The D-trnL system is selected on account of its high specificity and sensitivity.

613 DNA from different categories of olive oils was detected by the D-trnL system.

614 The design of the D-trnL system is suitable for olive oil authentication.

615
616

32