GASTROENTEROLOGY 2005;129:550 –564

Interleukin-13 Is the Key Effector Th2 Cytokine in Ulcerative

Colitis That Affects Epithelial Tight Junctions, Apoptosis, and
Cell Restitution

FRANK HELLER,* PETER FLORIAN,‡ CHRISTIAN BOJARSKI,* JAN RICHTER,‡ MELANIE CHRIST,‡
BERND HILLENBRAND,* JOACHIM MANKERTZ,* ALFRED H. GITTER,‡,§ NATALY BÜRGEL,*
MICHAEL FROMM,‡ MARTIN ZEITZ,* IVAN FUSS,¶ WARREN STROBER,¶ and JÖRG D. SCHULZKE*
*Departments of Gastroenterology and ‡Clinical Physiology, Charité, Campus Benjamin Franklin, Berlin, Germany; §Department of Medical
Engineering, Jena University of Applied Sciences, Jena, Germany; and ¶Mucosal Immunity Section, Laboratory of Clinical Investigation,
National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland

Background & Aims: Ulcerative colitis (UC) is character-
ized by a Th2 immune response with inflammation and
epithelial barrier dysfunction. So far, Th2 cytokines have
not been shown to directly influence epithelial barrier
function. Methods: Lamina propria mononuclear cells
(LPMCs) were stimulated and interleukin (IL)-13 was
measured by enzyme-linked immunosorbent assay.
Functional IL-13 and IL-4 effects were studied on HT-
29/B6 colonic epithelial cells in Ussing chambers and by
conductance scanning. Apoptosis was detected by ter-
minal deoxynucleotidyl transferase–mediated deoxyuri-
dine triphosphate nick-end labeling assays. IL-13/IL-4
receptors were analyzed by reverse-transcription poly-
merase chain reaction and immunofluorescence. West-
ern blotting combined with immunofluorescence was
used to detect tight junction proteins. Furthermore, res-
titution velocity was measured. Finally, mucosal biopsy
specimens from patients with UC were compared with
cultured cells for these features. Results: LPMCs from
patients with UC produced large amounts of IL-13 (985
ⴞ 73 pg/mL), much more than from controls or patients
with Crohn’s disease. IL-13R␣1 and IL-4R␣ receptors
were present in HT-29/B6 cells and colonic epithelial
cells of control patients and patients with UC. IL-13 had
a dose-dependent effect on transepithelial resistance of
HT-29/B6 monolayers (reduction to 60% ⴞ 4%),
whereas IL-4 had no effect. This was due to an increased
number of apoptotic cells (5.6-fold ⴞ 0.9-fold) and an
increased expression of the pore-forming tight junction
protein claudin-2 to 295% ⴞ 37%, both of which con-
tributed equally. Finally, epithelial restitution velocity
decreased from 15.1 ⴞ 0.6 to 10.6 ⴞ 0.5 ␮m/h after
treatment with IL-13. Parallel changes were observed in
human samples, with an increase in claudin-2 expres-
sion to 956% ⴞ 252%. Conclusions: IL-13 was identified
as an important effector cytokine in UC that impairs
epithelial barrier function by affecting epithelial apopto-
sis, tight junctions, and restitution velocity.
lcerative colitis (UC) and Crohn’s disease (CD) are
U chronic inflammatory bowel diseases (IBDs) char-
acterized by an activated mucosal immune system lead-
ing to impaired epithelial barrier function and tissue
destruction. Current experimental data suggest that the
intestinal flora is an important antigenic stimulus. This
has been shown in animal models of IBD, where the gut
flora is essential for disease induction, and in humans,
because antibiotic treatment or diversion of the fecal
stream can ameliorate disease activity.1
Whereas an inflammatory response to these antigens
from the lumen is suppressed in healthy individuals, a
destructive immune response is initiated in patients with
IBD. This immune response is mediated by lymphocytes
that can either be of a Th1 or a Th2 phenotype. In CD,
the inflammation is clearly a Th1 response because it is
associated with high levels of interleukin (IL)-12 and
interferon (IFN)-␥ secretion.2 These cytokines lead to
macrophage and granulocyte activation and thus the
release of multiple downstream inflammatory cytokines
such as tumor necrosis factor (TNF)-␣ and IL-6. The
result is a transmural (sometimes granulomatous) inflam-
mation that is not primarily centered on epithelial cells,
although collateral damage to the epithelium may occur.
Until recently, the inflammation in UC has been
difficult to classify using the Th1/Th2 paradigm.
Abbreviations used in this paper: EGTA, ethylene glycol-bis(␤-ami-
noethyl ether)-N,N,N=,N=-tetraacetic acid; FACS, fluorescence-activator
cell sorting; IFN, interferon; IL, interleukin; LDH, lactate dehydroge-
nase; LPMC, lamina propria mononuclear cell; NF-␬B, nuclear factor
␬B; NKT cell, natural killer T cell; PCR, polymerase chain reaction;
P-STAT-6, phosphorylated STAT-6; Rt, transepithelial electrical resis-
tance; TNF, tumor necrosis factor; TUNEL, terminal deoxynucleotidyl
transferase–mediated deoxyuridine triphosphate nick-end labeling.
© 2005 by the American Gastroenterological Association
0016-5085/05/$30.00
doi:10.1053/j.gastro.2005.05.002
August 2005
Whereas in patients with UC the secretion of IFN-␥ or
IL-12 is not increased and thus the inflammation is
clearly not a Th1 response, IL-4 (messenger RNA
[mRNA] or protein) is also reduced.2,3 A breakthrough
in our understanding of the disease came initially from
the study of oxazolone colitis, a murine model of mucosal
inflammation that resembles UC and is caused by IL-13–
producing natural killer T cells (NKT cells). Based on
these observations, we have recently shown that UC is
also associated with increased IL-13 production by NKT
cells and that the latter cells manifest reactivity to anti-
gens presented by epithelial cells.4 These immunologic
changes may explain the fact that the inflammation in
UC is different from that in CD in that it is a relatively
superficial process marked by abnormalities of the epi-
thelium. Ulcers ranging in size from microerosions to
large defects disrupt the line of epithelial cells. Abscesses
can be found in the base of the crypts. Already early in
the disease process, the barrier function of the mucosa is
severely impaired.5 This arises from widespread apoptosis
of epithelial cells and a decreased complexity of the tight
junctions between epithelial cells causing increased para-
cellular permeability.6
Here we report findings indicating that most of the
functional defects of the mucosa can in fact be traced to
direct effects of IL-13 on epithelial cells. This includes
epithelial tight junction alterations and stimulation of
epithelial apoptosis together with epithelial restitution
arrest. Thus, IL-13 emerges as a key effector cytokine in
UC acting adversely on various aspects of epithelial cell
function that ultimately lead to the severe destructive
inflammation seen in patients with UC.
Materials and Methods
Lamina Propria Mononuclear Cell
Cytokine Production
Lamina propria mononuclear cells (LPMCs) were iso-
lated from surgical specimens of patients undergoing colec-
tomy as described previously.2 Six patients had chronic active
UC, and 5 patients had CD; 4 patients without intestinal
inflammation with colonic adenocarcinoma served as nonin-
flammatory controls. The institutional review boards approved
the collection of surgical specimens. Because repetitive culture
of cells from the same surgical specimen showed almost iden-
tical cytokine production, we used each specimen only once for
LPMC stimulation experiments and each measurement was
obtained from another specimen. Freshly isolated LPMCs were
cultured and stimulated in vitro with soluble antibodies to
CD2 and CD28. IL-13, IL-4, and IFN-␥ were measured by
enzyme-linked immunosorbent assay (R&D Systems, Minne-
apolis, MN; Pierce Chemical Co, Rockford, IL; and BD
IL-13 IN ULCERATIVE COLITIS 551
PharMingen, New York, NY) in culture supernatants col-
lected 48 hours after stimulation as described previously.4
Detection of IL-13 Receptors
and Claudin-2 mRNA
IL-13R␣1, IL-13R␣2, and IL-4R␣ were detected by
reverse-transcription polymerase chain reaction (PCR) and im-
munofluorescence. Claudin-2 mRNA was quantified by real-
time PCR. RNA was isolated from IL-13–treated (48 hours;
10 ng/mL) or control cultures of HT-29/B6 cells with RNAzol
B (Wak-Chemie Medical GmbH, Steinbach, Germany) ac-
cording to the manufacturer’s protocol. After reverse transcrip-
tion of 1.5 ␮g total RNA for real-time PCR or 2 ␮g total
RNA for receptor PCR (Omniscript RT Kit; Qiagen, Hilden,
Germany) (60 minutes at 37°C, 5 minutes at 93°C), IL-13 or
IL-4 receptor complementary DNA (cDNA) was amplified (35
cycles of 45 seconds at 95°C, 60 seconds at 60°C, and 60
seconds at 68°C) with the following primer pairs:
hIL13R␣1FOR ggagccagctcaatttgtag, hIL13R␣1REV ca-
cacgggaagttaaaggca, hIL13R␣2FOR ggagagaggcaatatcaagg,
hIL13R␣2REV ggccatgactggaaactgt, hIL4RFOR gacctggag-
caacccgtatc, and hIL4RREV catagcacaacaggcagacg. The am-
plified products were verified by agarose gel electrophoresis
and showed single bands of predicted sizes for each sample and
no products in negative controls. In biopsy samples from
patients with UC or noninflammatory controls, IL13R␣1 and
IL4R␣ (both with antibodies from R&D Systems, Minneapo-
lis, MN) were detected by immunofluorescence according to
the protocol listed in the following text. cDNA prepared from
untreated or IL-13–treated HT-29/B6 cells as described pre-
viously was amplified with claudin-2 specific primers:
CLDN2F gaatcccgagccaaagacagagtg and CLDN2B tcagg-
gagaacagggaagaaataa. Quantitative LightCycler-PCR was per-
formed using the FastStart DNA Master SYBR Green I Kit
according to the manufacturer’s instructions (Roche, Mann-
heim, Germany). The final MgCl2 concentration was 3
mmol/L. Each sample contained 3 ␮L cDNA preparation. The
reaction mixture was denatured for 10 minutes at 95°C and
subjected to 40 cycles in a 3-step PCR (95°C for 15 seconds,
60°C for 5 seconds, and 72°C for 10 seconds). Detection of
fluorescence occurred at the end of the 72°C elongation step.
Specificity of PCR products was verified by melting curve
analysis subsequent to the amplification. Amplification, data
acquisition, and analysis were performed by LightCycler
(Roche). Standardization was performed with a standard dilu-
tion of a pCR2.1-TOPO vector construct (Invitrogen,
Karlsruhe, Germany) containing the 199 – base pair amplicon
generated by the primer pair CLDN2F and CLDN2B. Clau-
din-2 mRNA copies were expressed per nanograms total RNA.
Cell Culture of HT-29/B6 Cells
HT-29/B6 cells represent a subclone of the human
colorectal cancer cell line HT-29, which grow as highly dif-
ferentiated polarized epithelial monolayers.7 The cells were
routinely cultured in 25-cm2 culture flasks (Nunc, Wiesbaden,
Germany). The culture medium contained RPMI 1640, 2%
552 HELLER ET AL
L-glutamine, and 10% fetal calf serum (all from Biochrom,
Berlin, Germany), and the pH was 7.4 in all experiments.
Cultures were incubated at 37°C in a 95% air/5% CO2 atmo-
sphere. Cells were seeded on Millicell PCF filters (Millipore,
Schwalbach, Germany; effective membrane area, 0.6 cm2) at an
average concentration of 7 ⫻ 105 cells/cm2. Three inserts were
placed together into one conventional culture dish (OD, 60
mm). Confluence of polarized monolayers was reached after 7
days. Experiments were performed on day 7 or 8, giving
transepithelial resistances (Rt) of 400 – 600 ⍀ · cm2. The apical
compartment was routinely filled with 600 ␮L culture me-
dium, and the basolateral compartment contained 10 mL.
Cytokines (TNF-␣, TEBU, Offenbach, Germany; IL-4 and
IL-13, R&D Systems, Wiesbaden, Germany) were added
24 – 48 hours before an experiment to cultures to the basolat-
eral compartment at 10 ng/mL IL-13 unless stated otherwise.
The IL-13 receptor type I was blocked with 100 ng/mL of
anti–IL-4R antibodies (R&D Systems, Wiesbaden, Germany).
Monitoring of Rt
Rt of the monolayers was measured by a modification
of the method described by Kreusel et al.7 Electrical measure-
ments were performed in the culture dishes by 2 fixed pairs of
electrodes (World Precision Instruments, Sarasota, FL). Rt was
calculated from the voltage deflections caused by an external
⫾10-␮A, 21-Hz rectangular current. Depth of immersion and
position of the filters were standardized mechanically. The
temperature was maintained at 37°C during the measure-
ments. Resistance values were corrected for the resistance of
the empty filter and the bathing solution.
Flux Measurements
For flux experiments, filters were incubated with 10
ng/mL IL-13 for 48 hours. The complete inserts were mounted
into modified Ussing chambers, which were driven by a
6-channel computer-controlled voltage clamp device (CVC 6;
Fiebig, Berlin, Germany). Measurements were performed un-
der short-circuit conditions. The resistance of the bathing
solution was determined before each experiment and sub-
tracted from the raw data. Flux studies from the mucosal to the
serosal side were performed with 3H-mannitol, 3H-lactulose,
and 3H-polyethylene glycol (PEG) 4000 (Biotrend, Köln, Ger-
many) as described previously.8 After equilibration, samples
for flux measurements were collected every 15 minutes.
Cytotoxicity Assay
As a monitor of cell deterioration, lactate dehydroge-
nase (LDH) release from the cells was measured. The postex-
perimental LDH content in the supernatant of controls and of
IL-13–treated cells was determined. After detergent extraction
with 2% Triton X-100 for 30 minutes, the total LDH content
of the residual cells was measured. Thereby, the percentage of
LDH released into the supernatant could be calculated.
GASTROENTEROLOGY Vol. 129, No. 2
Conductance Scanning
Conductance scanning was performed as described pre-
viously.9 Confluent monolayers were mounted horizontally in
a modified Ussing-type chamber, which gave access to a scan-
ning probe to be positioned close to the apical side of the
tissue. The probe consisted of a pair of microelectrodes with
tips set apart vertically by 20 – 40 ␮m (⌬z) that were con-
nected to a differential amplifier and an AC bridge system with
synchronous demodulation and kept at a distance of 25 ␮m
from the epithelial surface. While a constant electric current
(sinusoidal AC, 0.1 mA/cm2, 24 Hz) was passed through the
monolayer, the resulting electric field was detected. The cur-
rent in the probe induced a decrease in voltage across ⌬z and
thereby the apparent conductivity GA of the probe could be
calculated from the scanning signal. The conductivity of the
cell culture filter support (22 mS/cm2) was subtracted, and the
conductance of apoptotic leaks was computed by spatial inte-
gration of GA.
Western Blot Analysis
Tight junction protein expression was determined by
Western blot analysis of membrane extracts as described pre-
viously.10 Briefly, cells or colonic biopsy specimens were ho-
mogenized with iced lysate buffer containing 20 mmol/L Tris,
pH 7.4, 5 mmol/L MgCl2, 1 mmol/L EDTA, 0.3 mmol/L
ethylene glycol-bis(␤-aminoethyl ether)-N,N,N=,N=-tetraace-
tic acid (EGTA), 1 ␮L/mL aprotinin, 16 ␮g/mL benzamidine
HCl, 10 ␮g/mL phenanthroline, 10 ␮g/mL leupeptin, 10
␮g/mL pepstatin, 1 mmol/L phenylmethylsulfonyl fluoride,
210 ␮g/mL sodium fluoride, 2.16 mg/mL ␤-glycerophos-
phate, 18.5 ␮g/mL NaVO4, and 1 ␮L/mL trypsin inhibitor (all
from Sigma Chemical Co, St Louis, MO). Subsequently, the
lysate was passaged through a 26-gauge needle and then
centrifuged at 200g for 5 minutes at 4°C. The membrane
fraction was then sedimented by centrifugation at 43,000g for
30 minutes at 4°C. Phosphorylated STAT-6 (P-STAT-6) was
detected in total cell lysate. HT-29/B6 cells were homogenized
with iced lysate buffer containing 10 mmol/L imidazole, pH
6.8, 0.1 mol/L KCl, 0.3 mol/L sucrose, 2 mmol/L MgCl2, 10
mmol/L EGTA, 1 mmol/L NaF, 1 mmol/L MbO42⫺, 1 mmol/L
NaVO3, 0.2% Triton X-100 (vol/vol), and Complete Mini
EDTA-Free Protease Inhibitor Cocktail Tablets (Roche,
Mannheim, Germany) for 10 minutes at 4°C. After centrifu-
gation (10 minutes, 4°C, 19000g), the protein content of the
supernatant was determined. Protein concentrations were de-
termined by bicinchoninic acid assay (Pierce Chemical Co).
Aliquots of 2.5 ␮g (for occludin), 5 ␮g (for claudin-1, clau-
din-2, and claudin-4), or 20 ␮g protein (for P-STAT-6 or
biopsy samples) were separated by polyacrylamide gel electro-
phoresis (8.5% for occludin and STAT-6, 12.5% for claudins)
and transferred to a polyvinylidene difluoride transfer mem-
brane (NEN, Boston, MA). Blots were first blocked for 2 hours
in 5% milk powder (not for P-STAT-6) and then overnight or
for 2 hours (for P-STAT-6) in 5% bovine serum albumin
followed by incubation with a primary antibody (Zymed, San
August 2005
Francisco, CA, or New England Biolabs, Frankfurt am Main,
Germany). POD-conjugated secondary antibodies and the
chemiluminescence system Lumi-LightPLUS (Roche) were used
to detect bound antibodies.
Immunohistochemistry
Tight junctions were localized by immunofluorescence
after 48 hours of incubation with 10 ng/mL IL-13. Nuclear
factor ␬B (NF-␬B) translocation was detected in confluent
HT-29/B6 cells after 24 hours of serum-free culture. TNF-␣
(10,000 U/mL) or IL-13 (10 ng/mL) were added for 15 min-
utes. All samples were washed with phosphate-buffered saline
(PBS) and fixed in ice-cold methanol for 10 minutes. Then,
cells were washed with PBS and permeabilized with 0.5%
Triton X-100 for 5 minutes. The samples were blocked with
0.5% goat serum for 30 minutes at room temperature before
addition of the 1:50 diluted primary antibodies for tight
junction proteins (Zymed; for monoclonal ZO-1, BD Trans-
duction, Heidelberg, Germany) or 1:100 diluted antibody
against the p65 subunit of NF-␬B (Santa Cruz, Heidelberg,
Germany). After 30 minutes of incubation at room tempera-
ture and 2 washing steps with PBS 0.5%, goat serum 1:500
diluted secondary antibodies (Alexa Fluor; MoBiTec, Göttin-
gen, Germany) were added for 30 minutes at room tempera-
ture. In some samples, nuclei were counterstained with 4=,6-
diamidino-2-phenylindole 1:1000. Finally, samples were
mounted in ProTaqs MountFluor (Biocyc, Luckenwalde, Ger-
many) and images were taken with a confocal microscope
(Zeiss LSM 510 META, Jena, Germany).
Epithelial Restitution Assay
HT-29/B6 cells were cultured for 7– 8 days in regular
culture medium and then incubated with IL-13 (10 ng/mL, 48
hours), epidermal growth factor (20 nmol/L), or regular me-
dium (control). A longitudinal defect with a width of 200 ␮m
was scraped with a glass microelectrode driven by a computer-
controlled micromanipulator. The monolayers were returned
to regular cell culture conditions for 2 hours before the cells
were fixed and stained for ZO-1. The exact width of the gap
was measured in samples without restitution. As a marker of
epithelial restitution, the velocity of defect closure was deter-
mined in micrometers per hour.
Apoptosis Assays
Apoptotic cells were stained with terminal deoxy-
nucleotidyl transferase–mediated deoxyuridine triphosphate
nick-end labeling (TUNEL) assay (Roche) according to the
manufacturer’s instructions. In one set of experiments, cells
were grown on glass slides. After cytokine treatment, the
cells were fixed with formaldehyde, stained for TUNEL, and
analyzed by microscopy. Samples of IL-13–treated (10 ng/
mL), IFN-␥–treated (100 U/mL), or untreated cells were
compared. The apoptotic rate was calculated as percentage
of TUNEL-positive cells within total cells. In other exper-
iments, monolayers were brought into single-cell suspen-
sions with trypsin and resuspended at 2 ⫻ 107 cells/mL in
IL-13 IN ULCERATIVE COLITIS 553
PBS. After fixation with paraformaldehyde, cells were per-
meabilized with 0.1% Triton X-100 in 0.1% sodium ci-
trate. Then, apoptotic cells were stained with a TUNEL
assay according to the manufacturer’s instructions. Samples
were analyzed by fluorescence-activator cell sorting (FACS)
with a FACSCalibur (BD Biosciences, Heidelberg, Ger-
many). The apoptotic rate was calculated as percentage of
TUNEL-positive cells within total cells. Apoptosis was
inhibited with 2 different caspase inhibitors: Z-VAD-FMK
(N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone;
Enzyme Systems Products, Livermore, CA) or Z-DEVD-
FMK (Z-Asp-Glu-Val-Asp-fluoromethylketone; Alexis Deutsch-
land, Grünberg, Germany).
Statistical Analysis
All values are given as mean ⫾ SEM. The unpaired
2-tailed t test was used to determine the significance of dif-
ferences. P ⬍ .05 was considered significant.
Results
LPMCs From Patients With UC Produce
IL-13
To quantify cytokine production from inflamma-
tory T cells, LPMCs were isolated from intestinal spec-
imens of patients with UC and respective controls (ob-
tained at surgery) and stimulated in culture with
antibodies to CD2 and CD28. After 3 days of stimula-
tion, cytokine release in the supernatant was measured by
enzyme-linked immunosorbent assay. Cells from patients
with UC produced significantly higher levels of IL-13
(985 ⫾ 273 pg/mL) than cells from patients with CD or
noninflammatory controls (216 ⫾ 39 and 51 ⫾ 24
pg/mL, respectively) (Figure 1A). In contrast, cells from
patients with CD produced significantly higher levels of
IFN-␥ (26,496 ⫾ 6365 pg/mL) than cells from patients
with UC or controls (1548 ⫾ 380 pg/mL and 1188 ⫾
406 pg/mL, respectively) (Figure 1B). As already shown,2
LPMCs from all 3 groups did not produce significant
levels of IL-4 (data not shown).
Because the LPMCs were stimulated with antibodies
to CD2 and CD28, unstimulated cells do not produce
significant levels of cytokines, and CD2 is only expressed
on T cells, this type of stimulation has to be assumed to
induce cytokine production specifically by T cells.
Both Types of IL-13 Receptors Are
Expressed in Colonic Epithelium
By reverse-transcription PCR, we found IL-
13R␣1 and IL-4R␣ but not IL-13R␣2 to be expressed
on HT-29/B6 cells (Figure 1C). To identify receptors on
epithelial cells, immunofluorescence was used for analysis
of colonic biopsy specimens. Both receptors IL-13R␣1
554 HELLER ET AL GASTROENTEROLOGY Vol. 129, No. 2

Figure 1. (A) IL-13 and (B) IFN-␥ production of LPMCs. LPMCs were isolated from colectomy specimens of noninflammatory controls (NIC),
patients with active CD, and patients with UC. T cells were stimulated with soluble antibodies for CD2 and CD28. Cytokines were measured by
enzyme-linked immunosorbent assay in culture supernatants collected after 48 hours of culture. Cells did not produce any cytokines without
stimulation. (C) IL-13 receptors are expressed on HT-29/B6 cells and epithelial cells in the colon. RNA was isolated from untreated (lanes 1– 6)
and IL-13–treated (lanes 7–12) HT-29/B6 cells. After reverse transcription, DNA of IL-13R␣1 (lanes 1, 4, 7, and 10), IL-13R␣2 (lanes 2, 5, 8,
and 11), and IL-4R␣ (lanes 3, 6, 9, and 12) was amplified. (D) HT-29/B6 monolayers and colonic biopsy specimens from noninflammatory
controls and patients with UC were stained with antibodies for IL-4R (green) and IL-13R␣1 (red).

and IL-4R␣ were detected on colonic enterocytes of
noninflammatory controls and patients with UC (Figure
1D). The expression of these receptors on human epithe-
lial cells has also been shown previously by other
groups.11
IL-13 Impairs the Epithelial Barrier Function
of Human Colonic Epithelial Cells
To study the effect of increased production of
IL-13 on the function of the epithelial barrier, we deter-
mined the Rt of a monolayer of HT-29/B6 cells after the
addition of IL-13 to the basolateral surface of the cells.
IL-13 (10 ng/mL) caused a decrease in Rt from 512 ⫾ 29
to 317 ⫾ 36 ⍀ · cm2 after 48 hours, corresponding to a
decrease to 60% ⫾ 4% from the initial resistance (P ⬍
.001, n ⫽ 9; Figure 2A). In a subgroup of cultures, we
extended Rt monitoring to 96 hours. At these late time
points, Rt remained diminished to 51% ⫾ 3% of the
initial resistance (P ⬍ .001, n ⫽ 6). This effect of IL-13
on Rt was characterized by a sigmoidal curve of dose de-
pendency with a point of inflection at 1 ng/mL (Figure 2B).
A significant effect of IL-13 on the barrier function was
only observed when IL-13 was added to the basolateral
side, whereas apical addition, even at very high concen-
trations, did not affect Rt (80 ⫾ 2% [n ⫽ 6] at 10 ng/mL
IL-13 vs 91 ⫾ 5% in controls [n ⫽ 6; not significant]).
Within the initial 24 hours, 10 ng/mL IL-13 had only
a modest effect on Rt (76% ⫾ 2%). In parallel, at 500
U/mL, TNF-␣ induced a decrease in Rt to 73% ⫾ 2%
after 24 hours. However, this effect of small amounts of
TNF-␣ on Rt was considerably intensified by IL-13.
When combined with IL-13, TNF-␣ reduced Rt to 47%
August 2005 IL-13 IN ULCERATIVE COLITIS 555

Figure 2. Effect of IL-13 on Rt. (A) Time course of Rt after basolateral addition of 10 ng/mL IL-13 and without IL-13. Values are means ⫾ SEM
of 6 –9 filters. (B) Dose-response curve 48 hours after basolateral addition of IL-13 (n ⫽ 6 –9; **P ⬍ .01, ***P ⬍ .001). (C) Rt after addition
of IL-13, IL-4, TNF-␣, or blocking antibodies to IL-4R␣. (D) IL-13 leads to STAT-6 phosphorylation but not nuclear translocation of NF-␬B. Western
blot of untreated (lanes 1 and 3) and IL-13–treated (lanes 2 and 4) HT-29/B6 cells for phosphorylated STAT-6 at indicated times. Immunoflu-
orescence localization of the p65 subunit of NF-␬B (red) and nuclei (4=,6-diamidino-2-phenylindole, blue). Only HT-29/B6 cells treated with TNF-␣
but not control or IL-13–treated cells show nuclear translocation of NF-␬B.

⫾ 1% of initial resistance (P ⬍ .0001) (Figure 2C). Signaling Pathways of IL-13 Action

Finally, we studied the effect of IL-4 on epithelial barrier
function. At concentrations of 10 ng/mL or 100 ng/mL,
IL-4 did not affect Rt of HT-29/B6 monolayers (Figure
2C). Combined with TNF-␣, IL-4 did not amplify the
decrease of Rt induced by TNF-␣ but attenuated the
effect of TNF-␣ (Figure 2C).
Because both types of IL-13 receptors, the het-
erodimeric IL-4R␣/IL-13R␣1 and the IL-13R␣1 mono-
mer, are expressed on colonic epithelial cells (see Discus-
sion), we inhibited signaling with antibodies to the
IL-4R␣ chain to elucidate the functional role of the
IL-13R␣1 monomer. In these experiments, Rt was de-
creased to 58% ⫾ 1% after the addition of IL-13 com-
pared with 53% ⫾ 2% when both receptors remained
active (Figure 2C).
We performed Western blot analysis of
P-STAT-6. As shown in Figure 2D, IL-13 induced the
phosphorylation of STAT-6 in colonic HT-29/B6 epi-
thelial cells. While untreated cells did not have detect-
able levels, P-STAT-6 became detectable after 30 min-
utes of incubation with IL-13. In contrast, translocation
of the p65 subunit of NF-␬B into the nucleus was only
induced with TNF-␣, not with IL-13 (Figure 2D).
Effect of IL-13 on Paracellular Permeability
In the next set of studies, we determined if IL-13
alters the transepithelial transport of ions or large mol-
ecules (Table 1). Accordingly, the initial short-circuit
current of HT-29/B6 cells incubated with or without 10
556 HELLER ET AL
Table 1. Effect of IL-13 on Mannitol, Lactulose, and PEG4000 Mucosal-to-Serosal Flux, Rt, and Short-Circuit Current of HT-
29/B6 Cells
Jmannitolms Jlactulosems
(nmol · h⫺1 · cm⫺2) (nmol · h⫺1 · cm⫺2)
Control 184 ⫾ 8 60 ⫾ 2
IL-13 572 ⫾ 88 81 ⫾ 1
P value ⬍.05 ⬍.001
NOTE. Data are means ⫾ SEM of filters under control conditions and after addition of 10 ng/mL IL-13.
Jmannitolms, mannitol mucosal-to-serosal flux (n ⫽ 4); Jlactulosems, lactulose mucosal-to-serosal flux (control, n ⫽ 5; IL-13, n ⫽ 6); JPEG4000ms,
PEG4000 mucosal-to-serosal flux (n ⫽ 6); NS, not significantly different from controls.
aControl, n ⫽ 15; IL-13, n ⫽ 16.
ng/mL IL-13 was measured. The initial short-circuit
current of control and IL-13–treated cells was not dif-
ferent in both groups (9 ⫾ 1 ␮A · cm2) and remained
constant throughout the experiment. As shown previ-
ously, Rt was diminished after incubation with IL-13 for
48 hours (control cells, 562 ⫾ 16 ⍀ · cm2; IL-13–treated
cells, 274 ⫾ 13 ⍀ · cm2; P ⬍ .001). Because short-
circuit current was not affected by IL-13, the decrease in
Rt is not due to activation of transporters involved in
rheogenic ion transport.
In related studies, we determined the paracellular
permeability of HT-29/B6 monolayers for molecules of
different size by measuring the flux of radioisotopes from
the mucosal to the serosal site. We found that the
addition of IL-13 increased the mucosal-to-serosal flux of
3H-mannitol, 3H-lactulose, and 3H-PEG4000. This ef-
fect of IL-13 was dependent on the size of the respective
tracer. While the flux of mannitol (182 daltons) in-
creased 3-fold after incubation with IL-13, the flux of the
larger tracers lactulose (344 daltons) and PEG (4000
daltons) increased only 1.4-fold and 1.2-fold, respec-
tively.
Necrosis Does Not Contribute
to the IL-13 Effect
First, HT-29/B6 cell size was not altered by IL-13,
because cell count per power field was not significantly
changed (433 ⫾ 40 [n ⫽ 5] in controls vs 477 ⫾ 48 [n ⫽
5; not significant] after IL-13 exposure). We next deter-
mined if the observed effects of IL-13 on epithelial cells are
secondary to necrosis of cells. For this purpose, we measured
LDH released into culture supernatants before and after the
addition of Triton X-100, with the latter value representing
total cellular LDH. We found that LDH activity in the
supernatant was 82 ⫾ 8 U/L in controls (n ⫽ 6) and 79 ⫾
1 U/L in IL-13–treated cultures (n ⫽ 6; not significant),
and both groups released the same amount of LDH after
addition of Triton X-100 (3675 ⫾ 29 and 3925 ⫾ 83 U/L,
respectively; not significant). Based on these results, the
percentage of LDH released into the supernatants was not
GASTROENTEROLOGY Vol. 129, No. 2
JPEG4000ms Rt Short-circuit current
(nmol · h⫺1 · cm⫺2) (⍀ · cm2)a (␮A · cm⫺2)a
5.6 ⫾ 0.1 562 ⫾ 16 9⫾1
6.7 ⫾ 0.2 274 ⫾ 13 9⫾1
⬍.001 ⬍.001 NS
significantly different in controls and IL-13–treated cells
(2.2% ⫾ 0.2% vs 2.0% ⫾ 0.04%; not significant), which
indicates that the IL-13–induced decrease in Rt was not due
to cell necrosis.
IL-13 Induces Epithelial Cell Apoptosis
Because up-regulation of epithelial cell apoptosis
is a typical feature of the changes found in UC,6 the effect
of IL-13 on epithelial apoptosis was investigated in HT-
29/B6 monolayers. In these studies, we determined the
apoptotic ratio in control, TNF-␣–, and IL-13–treated
cells after 48 hours of incubation with either cytokine.
TUNEL staining of adherent cells showed typical
changes associated with epithelial apoptosis-like conden-
sation of chromatin, its compaction along the periphery
of the nucleus, and segmentation of the nucleus in
TUNEL-positive cells. The number of apoptotic cells
was determined by manual counting in monolayers and
by FACS scanning of single-cell suspensions. We found
that control monolayers exhibited a rate of 1.0% ⫾ 0.5%
(n ⫽ 6) apoptotic cells, whereas in IL-13–treated cul-
tures the rate of apoptotic cells was increased to 5.6% ⫾
0.9% (n ⫽ 6, P ⬍ .001; Figure 3A). By FACS scanning,
the number of apoptotic cells in untreated cultures was
1.6 ⫾ 0.3 (Figure 3B). After incubation with 10 ng/mL
IL-13, 11.2% ⫾ 0.7% stained positive for apoptosis. In
comparison, TNF-␣ induced apoptosis in 11.8% ⫾
0.6% of cells. Monolayers treated with the combination
of IL-13 and TNF-␣ showed 17.2% ⫾ 0.7% of apoptotic
cells. Apoptosis induced by either cytokine could be
completely blocked by the addition of Z-VAD-FMK
(Figure 3B), which is very important for the interpreta-
tion of the relation of apoptotic and tight junctional
contributions to the IL-13–induced barrier effect (see
below).
IL-13 Increases the Conductance of
Apoptotic Lesions
In epithelial cell layers, apoptosis of single cells
occurs spontaneously. Around such lesions, the surrounding
August 2005 IL-13 IN ULCERATIVE COLITIS 557

Figure 3. Epithelial cell apoptosis is induced by IL-13. (A) Apoptosis of HT-29/B6 monolayers stained with TUNEL (original magnification 20⫻).
Condensed chromatin fragments in nuclei and segmentation of the nuclei indicate epithelial cell apoptosis. Apoptotic rate is the percentage of
TUNEL-positive cells per total counted cells. (B) HT-29/B6 monolayers were treated with the indicated cytokines and/or Z-VAD-FMK as apoptosis
inhibitor. After 48 hours, cells were brought into single-cell suspension and stained with TUNEL. Cell suspensions were then analyzed by FACS.
***P ⬍ .001.

epithelial cells form apoptotic rosettes. The local conduc-
tance of individual rosettes was studied by conductance
scanning in HT-29/B6 monolayers treated with or without
IL-13. In control cultures, the median conductance of spon-
taneous apoptotic rosettes was 106 ⫾ 25 nS (n ⫽ 16) and
the maximum conductivity was 360 nS. After IL-13 incu-
bation, the median conductance of the rosettes was in-
creased about 8-fold to 826 ⫾ 185 nS (n ⫽ 16; P ⬍ .002).
The minimal conductance was 0 nS, and the maximal
conductance was 2830 nS. Only 25% of the analyzed apo-
ptotic rosettes exhibited a conductance ⬍400 nS (Figure
4B). These findings show that in areas of apoptotic cells, the
conductance can vary and is significantly increased by
IL-13.
558 HELLER ET AL
Contribution of Epithelial Cell Apoptosis to
the Effect of IL-13
To determine whether the previously described
effects of IL-13 on the epithelial barrier are primarily due
to induction of epithelial cell apoptosis, the caspase
inhibitors Z-VAD-FMK and Z-DEVD-FMK were added
to cell cultures. We found that both caspase inhibitors
partially prevented the decrease in Rt induced by IL-13.
As shown in Figure 4C, Rt decreased to 61% ⫾ 1% of
control values 48 hours after addition of IL-13, whereas
Rt of cultures treated with IL-13 and Z-VAD-FMK only
decreased to 81% ⫾ 1% (P ⬍ .001). Z-VAD-FMK alone
had no significant effect on Rt (95% ⫾ 2%), indicating
that the spontaneous apoptotic rate is low in control cells
and does not contribute significantly to overall conduc-
tivity under control conditions. A similar inhibiting
effect on IL-13 action was also achieved by the second
caspase inhibitor, Z-DEVD-FMK. Finally, it should be
noted that after inhibition of apoptosis with Z-VAD-
FMK or Z-DEVD-FMK, the Rt of IL-13–treated cul-
tures was still decreased compared with controls (Figure
4C), indicating that a second mechanism besides apopto-
GASTROENTEROLOGY Vol. 129, No. 2
sis must contribute to the effect of IL-13 on epithelial
barrier function.
IL-13 Modifies the Composition of Tight
Junctions
To determine if the observed IL-13–induced de-
crease in Rt is due to changes in tight junction function,
we first performed immunofluorescence studies of tight
junction proteins in IL-13–treated and untreated HT-
29/B6 monolayers using antibodies to ZO-1, occludin,
and claudin-2. Microscopic analysis revealed that the
tight junction network is still intact after IL-13 treat-
ment. Z-scans of the monolayers showed that the tight
junction proteins were still located at the level of the
tight junctional network, pointing against significant
degradation or internalization under the influence of
IL-13 (Figure 5). To investigate if changes in tight
junction structure contribute to the decrease in epithelial
resistance, Western blot analysis of cell membrane frac-
tions was performed for the tight junction proteins clau-
din-1, claudin-2, and claudin-4 and occludin and their
expression quantified by densitometry (Figure 6A).
Figure 4. IL-13 causes an increase in
conductance of apoptotic leaks. (A)
Representative image of a single-cell
apoptosis (arrows) in colonic epithelial
cells after staining of the tight junction
proteins occludin (red) and ZO-1
(green) and merging those 2 images
(overlay in yellow). The blue lines in
the z-stacks indicate the level of focus
for the top image. (B) After identifica-
tion of the single-cell apoptosis, con-
ductance scanning revealed an in-
crease in conductance of single
apoptosis after IL-13 incubation. In
control specimens, median conduc-
tance was 100 nS (white columns)
and after IL-13 incubation was 630 nS
(gray columns). (C) Z-VAD-FMK or Z-
DEVD-FMK can inhibit the effect of
IL-13 only partially. HT29/B6 cells
were incubated with or without IL-13
and the apoptosis inhibitors Z-VAD-
FMK or Z-DEVD-FMK. The decrease of
Rt after IL-13 incubation is significantly
ameliorated (**P ⬍ .001) but not
completely prevented.
August 2005
Figure 5. Immunofluorescence localization of the tight junction proteins ZO-1, occludin, and claudin-2 in HT-29/B6 epithelial cells. Under control
conditions and after incubation with IL-13 (10 ng/mL) for 48 hours (original magnification 6300⫻), some regions of the monolayer slightly leave
the focus level of single pictures. Refocusing of these respective regions clearly revealed an intact monolayer at all sites.
While occludin (n ⫽ 5), claudin-1 (n ⫽ 6), and clau-
din-4 (n ⫽ 6) remained unchanged by IL-13, we found
that IL-13 induced a 3-fold increase in expression of the
pore-forming tight junction protein claudin-2 (295% ⫾
37% compared with controls, n ⫽ 6, P ⬍ .01).
The increased expression of claudin-2 is at least par-
tially a result of increased transcription of the claudin-2
gene, because IL-13 induces a significant increase of
claudin-2 mRNA as shown by real-time PCR (Figure
6B). The amount of claudin-2 mRNA increases in HT-
29/B6 cells after 48 hours of treatment with 10 ng/mL
IL-13 from 713 ⫾ 38 to 1208 ⫾ 40 copies/ng total
RNA (n ⫽ 5, P ⬍ .001). This increase of claudin-2
expression may represent the mechanism by which Rt is
decreased by IL-13 besides the induction of apoptosis. As
already mentioned, the relative contribution of epithelial
apoptosis induction and tight junction alteration caused
by IL-13 in HT-29/B6 monolayers was quantified by the
blocking effect of the caspase inhibitor Z-VAD-FMK on
apoptosis. It turned out that about half of the IL-13 effect
was due to the increase in apoptotic rate and the other half
to the regulation of tight junctions (Figure 4C).
IL-13 Impairs Epithelial Restitution
Under physiologic conditions, epithelial cells can
close gaps in the epithelium by migration of neighboring
cells into the defect. This physiologic repair mechanism
was studied under the influence of IL-13. In control
cultures, artificially induced lesions with a width of 200
␮m were closed by cell migration at a velocity of 15.1 ⫾
0.6 ␮m/h (n ⫽ 12). IL-13 reduced the velocity of this
restitution by 30% to 10.6 ⫾ 0.5 ␮m/h (n ⫽ 11, P ⬍
.001; Figure 7). In contrast, as shown previously,12 epi-
dermal growth factor used as a positive control increased
restitution velocity by 82% when compared with con-
trols (data not shown).
IL-13 IN ULCERATIVE COLITIS 559
Claudin-2 Expression Is Increased in UC
The previously described effects of IL-13 on cul-
tured cells prompted us to study tight junction proteins
in colonic biopsy specimens from patients with UC and
controls in a similar manner. Indeed, Western blot anal-
ysis of biopsy specimens from patients with UC showed
a 10-fold higher expression of claudin-2 (density, 956%
⫾ 252%; P ⬍ .01) when compared with controls. Ex-
pression of occludin, claudin-1, and claudin-4 was lower
than in controls (Figure 8).
Discussion
UC is associated with an epithelial barrier defect
characterized by reduced active absorption and increased
mucosal leakiness13,14; these abnormalities, rather than
active secretion, are responsible for the diarrhea seen in
patients with UC. However, the pathologic mechanisms
leading to this barrier defect are still far from clear.
One potential factor leading to the observed changes
in barrier function is cytokines secreted from lympho-
cytes infiltrating the lamia propria. In patients with CD,
the Th1 cytokines TNF-␣ and IFN-␥ play an important
role.15 However, so far, it remained unclear which cyto-
kines regulate inflammation and induce the significant
barrier disturbance in UC. The Th2 marker cytokine
IL-4 is not produced in relevant amounts,2,3 and other
cytokines described (eg, IL-5) do not have an effect on
epithelial barrier function. We have recently shown that
IL-13 plays a central role in an animal model of UC:
oxazolone colitis. In this animal model, IL-13 is pro-
duced by CD1-reactive NKT cells.16 Such IL-13–pro-
ducing NKT cells can also be found in the lamina
propria and peripheral blood of patients with acute UC.4
Therefore, we characterized the role of IL-13 as an effec-
tor cytokine that induces the intestinal pathology seen in
560 HELLER ET AL
UC. Because intestinal epithelial cells express CD1d 17,18
and are able to present glycolipid antigens directly to
NKT cells, in inflamed mucosa epithelial cells must
receive a constant IL-13 signal from NKT cells.
Recently, IL-13 has been found to be the key mediator
for the development of allergic asthma.19,20 Similar to
our findings in colonic epithelial cells, this was due to a
direct effect of IL-13 on bronchial epithelial cells.21
Although IL-4 is the marker cytokine in Th2 cell re-
GASTROENTEROLOGY Vol. 129, No. 2
Figure 6. Expression of the pore-
forming tight junction protein
claudin-2 is increased by IL-13 in
HT-29/B6 cells. (A) Expression of
tight junction proteins in crude
membrane fractions by Western
blotting. Lanes 1–3 represent
samples from controls, and lanes
4 – 6 represent samples from IL-
13–treated cells. Protein expres-
sion was quantified by densitom-
etry. The Table shows protein
expression after IL-13 incubation
in percent of the control. (B) RNA
was isolated from control or IL-
13–treated cells. After adjusting
RNA concentration and reverse
transcription, claudin-2 cDNA was
quantified by real-time PCR (n ⫽ 5
each, ***P ⬍ .001).
sponses,22 biologic activities of IL-4 and IL-13 have been
shown to overlap.23 This is in part due to the use of
common receptors. IL-4 binds to IL-4R␣ and can recruit
either the common ␥ chain (IL-2R␥c) or the IL-13R␣1
into the receptor complex. IL-13, on the other hand,
binds to IL-13R␣1, and this complex can recruit the
IL-4R␣ chain but can act as IL-13 receptor also as a
monomer.24 Both receptors are differentially regulated.
IL-13R␣1 is down-regulated in activated T cells, ren-
August 2005 IL-13 IN ULCERATIVE COLITIS 561

dering them unresponsive to IL-13.25 However, many

Figure 7. The velocity of epithelial restitution is impaired by IL-13.
HT29/B6 cells were treated with 10 ng/mL IL-13 (gray column) and
compared with untreated control samples (white column). After scrap-
ing of standardized 200-␮m-wide gaps, the velocity of epithelial res-
titution was estimated from the time until the gap is completely
closed.
nonhematopoietic (eg, epithelial) cells express IL-13R␣1
and thereby are responsive to IL-13.26 In the present
study, both IL-4R␣ and IL-13R␣1 were shown to be
expressed in HT-29/B6 cells and in human colon epi-
thelium of controls and patients with UC. It had been
shown before that human colonic epithelial cell lines
express heterodimeric receptors for IL-4 and IL-13 that
are composed of the IL-4R␣ and IL-13R␣1 chain but not
of the ␥c chain of cytokine receptors.27 The fact that
IL-13 can signal through the heterodimeric receptor
IL-4R␣/IL-13R␣1 and through the IL-13R␣1 monomer
can also explain our present finding that the blockade of
the heterodimeric form with antibodies resulted only in
a slight inhibition of IL-13 signaling in HT-29/B6 cells.
To assess the effect of IL-13 on epithelial cell function,
we measured the capacity of IL-13 to alter the Rt of
monolayers of differentiated colonic epithelial cells. We
found that compared with other cytokines or mediators,
IL-13 has a profound effect on epithelial barrier function.
A decrease in resistance developed rapidly within 24
hours and was long lasting and dose dependent. A sig-

Figure 8. Expression of clau-

din-2 is increased in UC. Expres-
sion of tight junction proteins in
crude membrane fractions of bi-
opsy specimens by immunoblot-
ting. Lanes 1–3 represent sam-
ples from noninflammatory
controls, and lanes 4 – 6 repre-
sent samples from patients
with active UC. Statistical data
of densitometric quantification
represent protein expression of
the samples from 6 to 8 con-
trols and from 5 to 7 patients
with UC (in percent of the con-
trols).
562 HELLER ET AL
nificant effect was only observed when IL-13 was added
to the basolateral site of layers. This suggests that IL-13
depends on receptors expressed on the basolateral mem-
brane of enterocytes. Although IL-13 had already a dra-
matic effect when given alone, it was even enhanced
when TNF-␣ was added. This could, for example, be
explained by the observation of Lugli et al in endothelial
cells that TNF-␣ enhances IL-13–induced STAT-6 acti-
vation.28 In contrast, the other important Th2 cytokine
IL-4 had no significant effect on epithelial barrier in
HT-29/B6 cell function, stressing the important role of
IL-13 as a Th2-effector cytokine.
IFN-␥, a marker cytokine of Th1 responses, also has
synergistic effects together with TNF-␣. Aggarwal and
Eessalu have described the induction of TNF receptors by
IFN-␥, although this was not the only mechanism be-
cause not only IFN-␥ but also other IFNs acted syner-
gistically with TNF-␣ but only IFN-␥ induced TNF
receptor expression.29 The synergism between IL-13 and
TNF-␣ could also explain the response in some patients
with UC to treatment with TNF-␣ inhibitors.30,31
In follow-up of these basic studies of epithelial barrier
function, we conducted several additional studies to un-
derstand the mechanism of the effect of IL-13 on epithe-
lial cells. We used an LDH release assay to exclude
significant cytotoxic effects, and indeed there was no
evidence for induction of necrosis by IL-13. IL-13–
treated cells did not appear to be different from control
cells on light microscopy. Also, immunofluorescence lo-
calization of occludin and ZO-1 did not indicate that
IL-13 disrupts any part of the cell monolayer, a result
that is in accordance with the negative LDH assay. In
addition to that, IL-13 did not influence short-circuit
current in HT-29/B6 cells. Because the IL-13 effect on
resistance was not due to cytotoxicity and not to activa-
tion of a rheogenic transport, the IL-13–induced decrease
in resistance should be most likely based on an increase
in paracellular permeability. To yield further evidence
for this hypothesis, mucosal-to-serosal fluxes of 3H-man-
nitol, 3H-lactulose, and 3H-PEG4000 were measured.
Very much indeed, IL-13 increased tracer fluxes of either
size, the magnitude of which depended on the molecular
size of the respective tracer. Also in support of this
concept, the conductance scanning technique identified a
higher number of spots with elevated conductivity in
HT-29/B6 monolayers after treatment with IL-13.
It had been suggested before that epithelial apoptosis
contributes to the destruction of the mucosa in UC.32 To
study the effect of IL-13 on the apoptosis of epithelial
cells in UC, we quantified the number of apoptotic cells
in HT-29/B6 monolayers in IL-13–treated cultures. A
dramatic increase was found in response to IL-13. In
GASTROENTEROLOGY Vol. 129, No. 2
contrast, the Th1 cytokine IFN-␥ did not significantly
affect epithelial apoptosis. Whether epithelial cell apo-
ptosis contributes to the impairment of the intestinal
barrier has been controversially discussed. Extrusion of
cells from the epithelium is a physiologic event and
accompanied by tight junction rearrangement with
maintenance of the macromolecular barrier. Therefore,
apoptosis of epithelial cells was often assumed to occur
without relevant disruption of epithelial integrity.33
However, recent measurements of ion permeability di-
rectly at the site of apoptotic rosettes have clearly shown
local leaks of apoptotic sites.8,34 Accordingly, IL-13 in-
creases the conductance of apoptotic lesions. In support
of the latter view, about half of the decrease in Rt was
blocked if caspase inhibitors were added to HT-29/B6
monolayers before treatment with IL-13. This indicates
that apoptosis contributes to approximately 50% of the
decrease in Rt after treatment with IL-13. However,
similar to the effect of IFN-␥ on epithelial cells,35 this
experiment suggested an additional apoptosis-indepen-
dent pathway contributing to the decrease of Rt.
Paracellular permeability is regulated by the tight
junction network between epithelial cells. To study the
effect of IL-13 on this network, we quantified the ex-
pression of tight junction proteins under the influence of
IL-13. These include occludin and several claudins, prod-
ucts of a multigene family.36,37 The exact physiologic
role of these integral membrane proteins is far from clear.
In the family of claudin proteins, a barrier role of clau-
din-138 and claudin-439 was suggested by transfection
experiments in MDCK cells. In contrast, a permeabiliz-
ing or “pore-forming” property was identified for clau-
din-2, because transfection resulted in the conversion of
MDCK cells from a high-resistance toward a low-resis-
tance, cation-permeable phenotype.40 It has been shown
that cleavage of occludin can induce a barrier breakdown
in airway epithelial cells,41 although other studies seem
to indicate that occludin is not a condition sine qua non
for barrier formation.37 Hence, intestinal barrier function
was not affected in occludin-deficient mice,42 a finding
that can be explained by functional redundancy of occlu-
din among many other tight junction strand–forming
proteins. Thus, tight junction strands are composed as
heteropolymers of different tight junction proteins that
can in part functionally substitute each other. Therefore,
we included occludin, claudin-1, and claudin-4 into our
analysis as well as claudin-2. IL-13 caused a 3-fold higher
expression of claudin-2 in HT-29/B6 cell monolayers,
while the expression of the other tight junction proteins
remained unchanged. To show a similar change in tight
junction protein expression in UC, these proteins were
quantified in biopsy specimens from inflamed mucosa of
August 2005
patients with UC. Indeed, we found a dramatic increase
in claudin-2 expression in the tight junction network in
UC. As alluded to previously, the increased expression of
claudin-2 can lead a tight junction network to become
leaky for small cations.40 Because NKT cells in inflamed
mucosa produce IL-13, the increased expression of clau-
din-2 is most likely induced by IL-13 and contributes
significantly to the diarrhea in UC.
In inflamed mucosa, the absolute number of epithelial
cells is decreased due to the rarefication of crypts in UC.
Consequently, tight junctional area per serosal area is
decreased. This leads to an underestimation of tight
junction protein detection in Western blots on UC mu-
cosa, a phenomenon that is even intensified by the pro-
tein pool expansion resulting from the subepithelial in-
flammatory process. This, however, makes absolute
quantification of mucosal proteins very difficult. In a
recent study from our laboratory performed on UC spec-
imens at a similar stage of inflammation (Truelove I-II),
this dilution artifact was calculated to be 1.63 (obtained
from a 1.29-fold decrease in mucosal surface area and a
1.26 increase in submucosal protein pool in UC).43
Therefore, this dilution artifact may be responsible for
the reduction in occludin, claudin-1, and claudin-4 ex-
pression observed in UC samples, although an additional
effect as, for example, a regulatory influence of TNF-␣ is
possible. However, the dramatic increase of claudin-2
expression in these samples has to be assumed to result
from a specific up-regulation of expression. In this re-
gard, tight junction protein expression in UC resembles
that observed in HT-29/B6 cells exposed to IL-13.
In addition to the effect of IL-13 on apoptosis and
tight junctions, IL-13 inhibits spreading and migration
of epithelial cells after setting standardized lesions in the
epithelium. The reduced velocity of restitution can play
an important role in the response of an epithelial layer to
naturally occurring or pathogen-induced small lesions.
While normal epithelial cells can rapidly close such gaps
by restitution, this ability is greatly diminished in cells
under the influence of IL-13 and could explain the ulcer-
type lesions found in active UC.
Our data indicate that T cells from patients with UC
produce large amounts of IL-13, which can induce epi-
thelial apoptosis and facilitate development of erosions
and ulcer-type lesions by epithelial restitution arrest.
Furthermore, tight junction strands can become more
leaky as the result of a claudin-2 up-regulation. A sig-
nificant barrier dysfunction has indeed been documented
during intestinal inflammation in UC.5 As a consequence
of this, barrier disturbance invasion of small antigens or
noxious agents is increased and loss of ions and water into
the intestinal lumen leads to diarrhea (leak flux diarrhea).
IL-13 IN ULCERATIVE COLITIS 563
Although the role of Th1 cytokines (eg, TNF-␣) in
respect to intestinal barrier function is well established,
the present report is the first to yield direct evidence for
such an effector role for the Th2-cytokine IL-13. Because
the facilitated antigen uptake in response to IL-13 can
provoke additional stimulation of lamina propria cells
with the release of more IL-13, a perpetuation of inflam-
mation could be induced. Therefore, neutralization of
IL-13 (eg, with therapeutic antibodies) is a potential
treatment for patients with active UC that could inter-
rupt tissue destruction by activated immune cells.
References
1. Sartor RB. Current concepts of the etiology and pathogenesis of
ulcerative colitis and Crohn’s disease. Gastroenterol Clin North
Am 1995;24:475–507.
2. Fuss IJ, Neurath M, Boirivant M, Klein JS, de la Motte C, Strong
SA, Fiocchi C, Strober W. Disparate CD4⫹ lamina propria (LP)
lymphokine secretion profiles in inflammatory bowel disease.
Crohn’s disease LP cells manifest increased secretion of IFN-
gamma, whereas ulcerative colitis LP cells manifest increased
secretion of IL-5. J Immunol 1996;157:1261–1270.
3. West GA, Matsuura T, Levine AD, Klein JS, Fiocchi C. Interleukin
4 in inflammatory bowel disease and mucosal immune reactivity.
Gastroenterology 1996;110:1683–1695.
4. Fuss IJ, Heller F, Boirivant M, Leon F, Yoshida M, Fichtner-Feigl S,
Yang Z, Exley M, Kitani A, Blumberg RS, Mannon P, Strober W.
Nonclassical CD1d-restricted NK T cells that produce IL-13 char-
acterize an atypical Th2 response in ulcerative colitis. J Clin
Invest 2004;113:1490 –1497.
5. Schmitz H, Barmeyer C, Fromm M, Runkel N, Foss HD, Bentzel
CJ, Riecken EO, Schulzke JD. Altered tight junction structure
contributes to the impaired epithelial barrier function in ulcerative
colitis. Gastroenterology 1999;116:301–309.
6. Gitter AH, Wullstein F, Fromm M, Schulzke JD. Epithelial barrier
defects in ulcerative colitis: characterization and quantification by
electrophysiological imaging. Gastroenterology 2001;121:
1320 –1328.
7. Kreusel KM, Fromm M, Schulzke JD, Hegel U. Cl-secretion in
epithelial monolayers of mucus-forming human colon cells (HT-
29/B6). Am J Physiol 1991;261:C574 –C582.
8. Bojarski C, Gitter AH, Bendfeldt K, Mankertz J, Schmitz H, Wagner
S, Fromm M, Schulzke JD. Permeability of human HT-29/B6
colonic epithelium as a function of apoptosis. J Physiol 2001;
535:541–552.
9. Gitter AH, Bertog M, Schulzke J, Fromm M. Measurement of
paracellular epithelial conductivity by conductance scanning.
Pflugers Arch 1997;434:830 – 840.
10. Bürgel N, Bojarski C, Mankertz J, Zeitz M, Fromm M, Schulzke JD.
Mechanisms of diarrhea in collagenous colitis. Gastroenterology
2002;123:433– 443.
11. Blanchard C, Durual S, Estienne M, Bouzakri K, Heim MH, Blin N,
Cuber JC. IL-4 and IL-13 up-regulate intestinal trefoil factor ex-
pression: requirement for STAT6 and de novo protein synthesis.
J Immunol 2004;172:3775–3783.
12. Dignass AU, Podolsky DK. Cytokine modulation of intestinal ep-
ithelial cell restitution: central role of transforming growth factor
beta. Gastroenterology 1993;105:1323–1332.
13. Sandle GI, Higgs N, Crowe P, Marsh MN, Venkatesan S, Peters
TJ. Cellular basis for defective electrolyte transport in inflamed
human colon. Gastroenterology 1990;99:97–105.
14. Fasano A, Baudry B, Pumplin DW, Wasserman SS, Tall BD, Ketley
JM, Kaper JB. Vibrio cholerae produces a second enterotoxin,
564 HELLER ET AL
which affects intestinal tight junctions. Proc Natl Acad Sci U S A
1991;88:5242–5246.
15. Braegger CP, MacDonald TT. Immune mechanisms in chronic
inflammatory bowel disease. Ann Allergy 1994;72:135–141.
16. Heller F, Fuss IJ, Nieuwenhuis EE, Blumberg RS, Strober W.
Oxazolone colitis, a Th2 colitis model resembling ulcerative coli-
tis, is mediated by IL-13-producing NK-T cells. Immunity 2002;
17:629 – 638.
17. Blumberg RS, Terhorst C, Bleicher P, McDermott FV, Allan CH,
Landau SB, Trier JS, Balk SP. Expression of a nonpolymorphic
MHC class I-like molecule, CD1D, by human intestinal epithelial
cells. J Immunol 1991;147:2518 –2524.
18. Canchis PW, Bhan AK, Landau SB, Yang L, Balk SP, Blumberg
RS. Tissue distribution of the non-polymorphic major histocom-
patibility complex class I-like molecule, CD1d. Immunology 1993;
80:561–565.
19. Grunig G, Warnock M, Wakil AE, Venkayya R, Brombacher F,
Rennick DM, Sheppard D, Mohrs M, Donaldson DD, Locksley RM,
Corry DB. Requirement for IL-13 independently of IL-4 in experi-
mental asthma. Science 1998;282:2261–2263.
20. Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL,
Donaldson DD. Interleukin-13: central mediator of allergic
asthma. Science 1998;282:2258 –2261.
21. Kuperman DA, Huang X, Koth LL, Chang GH, Dolganov GM, Zhu Z,
Elias JA, Sheppard D, Erle DJ. Direct effects of interleukin-13 on
epithelial cells cause airway hyperreactivity and mucus overpro-
duction in asthma. Nat Med 2002;8:885– 889.
22. Kopf M, Le Gros G, Bachmann M, Lamers MC, Bluethmann H,
Kohler G. Disruption of the murine IL-4 gene blocks Th2 cytokine
responses. Nature 1993;362:245–248.
23. Punnonen J, Aversa G, Cocks BG, McKenzie AN, Menon S, Zurawski
G, de Waal Malefyt R, de Vries JE. Interleukin 13 induces interleukin
4-independent IgG4 and IgE synthesis and CD23 expression by
human B cells. Proc Natl Acad Sci U S A 1993;90:3730 –3734.
24. Zurawski SM, Vega F Jr, Huyghe B, Zurawski G. Receptors for
interleukin-13 and interleukin-4 are complex and share a novel
component that functions in signal transduction. EMBO J 1993;
12:2663–2670.
25. Zurawski G, de Vries JE. Interleukin 13, an interleukin 4-like
cytokine that acts on monocytes and B cells, but not on T cells.
Immunol Today 1994;15:19 –26.
26. Aman MJ, Tayebi N, Obiri NI, Puri RK, Modi WS, Leonard WJ.
cDNA cloning and characterization of the human interleukin 13
receptor alpha chain. J Biol Chem 1996;271:29265–29270.
27. Murata T, Noguchi PD, Puri RK. IL-13 induces phosphorylation
and activation of JAK2 Janus kinase in human colon carcinoma
cell lines: similarities between IL-4 and IL-13 signaling. J Immu-
nol 1996;156:2972–2978.
28. Lugli SM, Feng N, Heim MH, Adam M, Schnyder B, Etter H,
Yamage M, Eugster HP, Lutz RA, Zurawski G, Moser R. Tumor
necrosis factor alpha enhances the expression of the interleukin
(IL)-4 receptor alpha-chain on endothelial cells increasing IL-4 or
IL-13-induced Stat6 activation. J Biol Chem 1997;272:5487–
5494.
29. Aggarwal BB, Eessalu TE. Induction of receptors for tumor necro-
sis factor-alpha by interferons is not a major mechanism for their
synergistic cytotoxic response. J Biol Chem 1987;262:10000 –
10007.
30. Gornet JM, Couve S, Hassani Z, Delchier JC, Marteau P, Cosnes
J, Bouhnik Y, Dupas JL, Modigliani R, Taillard F, Lemann M.
Infliximab for refractory ulcerative colitis or indeterminate colitis:
an open-label multicentre study. Aliment Pharmacol Ther 2003;
18:175–181.
GASTROENTEROLOGY Vol. 129, No. 2
31. Kohn A, Prantera C, Pera A, Cosintino R, Sostegni R, Daperno M.
Anti-tumour necrosis factor alpha (infliximab) in the treatment of
severe ulcerative colitis: result of an open study on 13 patients.
Dig Liver Dis 2002;34:626 – 630.
32. Sträter J, Wellisch I, Riedl S, Walczak H, Koretz K, Tandara A,
Krammer PH, Möller P. CD95 (APO-1/Fas)-mediated apoptosis in
colon epithelial cells: a possible role in ulcerative colitis. Gastro-
enterology 1997;113:160 –167.
33. Jones BA, Gores GJ. Physiology and pathophysiology of apoptosis
in epithelial cells of the liver, pancreas, and intestine. Am J
Physiol 1997;273:G1174 –G1188.
34. Gitter AH, Bendfeldt K, Schmitz H, Schulzke JD, Bentzel CJ,
Fromm M. Epithelial barrier defects in HT-29/B6 colonic cell
monolayers induced by tumor necrosis factor-alpha. Ann N Y
Acad Sci 2000;915:193–203.
35. Bruewer M, Luegering A, Kucharzik T, Parkos CA, Madara JL,
Hopkins AM, Nusrat A. Proinflammatory cytokines disrupt epithe-
lial barrier function by apoptosis-independent mechanisms. J Im-
munol 2003;171:6164 – 6172.
36. Furuse M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, Tsukita S.
Occludin: a novel integral membrane protein localizing at tight
junctions. J Cell Biol 1993;123:1777–1788.
37. Furuse M, Fujita K, Hiiragi T, Fujimoto K, Tsukita S. Claudin-1 and
-2: novel integral membrane proteins localizing at tight junctions
with no sequence similarity to occludin. J Cell Biol 1998;141:
1539 –1550.
38. Inai T, Kobayashi J, Shibata Y. Claudin-1 contributes to the
epithelial barrier function in MDCK cells. Eur J Cell Biol 1999;
78:849 – 855.
39. Van Itallie C, Rahner C, Anderson JM. Regulated expression of
claudin-4 decreases paracellular conductance through a selec-
tive decrease in sodium permeability. J Clin Invest 2001;107:
1319 –1327.
40. Amasheh S, Meiri N, Gitter AH, Schoneberg T, Mankertz J, Schulzke
JD, Fromm M. Claudin-2 expression induces cation-selective chan-
nels in tight junctions of epithelial cells. J Cell Sci 2002;115:4969 –
4976.
41. Wan H, Winton HL, Soeller C, Tovey ER, Gruenert DC, Thompson
PJ, Stewart GA, Taylor GW, Garrod DR, Cannell MB, Robinson C.
Der p 1 facilitates transepithelial allergen delivery by disruption
of tight junctions. J Clin Invest 1999;104:123–133.
42. Saitou M, Furuse M, Sasaki H, Schulzke JD, Fromm M, Takano H,
Noda T, Tsukita S. Complex phenotype of mice lacking occludin,
a component of tight junction strands. Mol Biol Cell 2000;11:
4131– 4142.
43. Amasheh S, Barmeyer C, Koch CS, Tavalali S, Mankertz J, Epple
HJ, Gehring MM, Florian P, Kroesen AJ, Zeitz M, Fromm M,
Schulzke JD. Cytokine-dependent transcriptional down-regulation
of epithelial sodium channel in ulcerative colitis. Gastroenterol-
ogy 2004;126:1711–1720.
Received August 2, 2004. Accepted April 13, 2005.
Address requests for reprints to: Jörg-Dieter Schulzke, MD, Charité,
Campus Benjamin Franklin, Med. Klinik I - Gastroenterologie, Infekti-
ologie & Rheumatologie, 12200 Berlin, Germany. e-mail:
joerg.schulzke@charite.de; fax: (49) 30-8445-4239.
Supported by grants from Deutsche Forschungsgemeinschaft (DFG
Schu 559/7-3 and Fr 652/4-2) and the Else Kröner-Fresenius-Stiftung.
The authors thank Dr Jörg Weiske for advice on immunohistochem-
istry techniques; Anja Fromm, Sieglinde Lüderitz, and Susanna Schön
for excellent assistance; and Detlef Sorgenfrei for support.