Full-Process Radiosensitization Based on Nanoscale

Metal-Organic Frameworks

∥ ⊥ ⊥

∥ ∥

† Shanghai Key Laboratory of Green Chemistry and Chemical Processes, School of Chemistry

and Molecular Engineering, East China Normal University, Shanghai 200062, China

∥
Department of Radiation Oncology, Shanghai Huadong Hospital, Fudan University, Shanghai

200040, China

§State Key Laboratory of High-Performance Ceramics and Superfine Microstructure, Shanghai

Institute of Ceramics, Chinese Academy of Science, Shanghai, 200050, China

⊥
Tongji University Cancer Center, Shanghai Tenth People’s Hospital, Tongji University School

of Medicine, Shanghai 200072, China

1
Section 1: Methods

UV-Vis spectroscopy. The spectra were determined using SHIMADZU UV-2700 spectrometer.

Solid-state spectroscopy was conducted using a diffuse reflectance (DR) attachment including

ISR-2600 integrating sphere, with BaSO 4 as the reference (100% reflectance). The sample

powder was spread as a thin uniform layer on a layer of BaSO 4 powder. The spectra were given

in the form of effective absorbance. The energy gaps for CT transitions were estimated from the

Tauc plots of (F(R)hν)1/2 against hν, where F(R) is the Kubelka-Munk Function [F(R) = (1-

R)2/2R] and R is the diffuse reflectance relative to BaSO 4 (Figure S18b).1, 2

Electrochemical measurements. Cyclic voltammetry (CV) was conducted with CHI 604E

workstation (CH instruments, China) with a conventional three-electrode system, a MOF-

modified glassy carbon electrode (GCE) as the working electrode, a platinum wire as the counter

electrode, and an Ag/AgCl electrode as the reference electrode. The supporting electrolyte was

0.1 M KCl aqueous solution, and the scan rate was set as 100 mV s-1. The modified GCE was

fabricated as follows: 1 mg of a ground nMOF sample was dispersed in 0.5 mL of ethanol and 40

μL of Nafion solution (5 wt. % in lower aliphatic alcohols and water, contains 15-20% water) by

sonication for 20 min. A pre-cleaned GCE was drop-cast with a 10 μL portion of the dispersion

and then dried in air.

2
Section 2: Biological characterization

Cells and animals. HeLa, A549 and RM-1 cells were purchased from Shanghai Institute of cells,

Chinese Academy of Sciences. Culture medium was composed of high-glucose Dulbecco’s

modified Eagle’s medium (DMEM), 10% fetal bovine serum (FBS), 1% penicillin (100 U/mL),

and streptomycin (100 mg/mL). Kunming mice and Balb/c nude mice were purchased from

Shanghai SLAC Laboratory Animal Co. Ltd. These mice were raised in Laboratory Animal

Center of East China Normal University (ECNU), for more than 8 weeks after birth. All the

experiments conformed to animal ethics.

MTT assay. The Hela cells were seeded in 96-well plates and incubated with a series of

concentrations of Hf-BPY or Hf-BPY-Fe for 24h. There were 6 wells in each group. 3-(4, 5-

dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) cell survival assay was

applied to measure the survival rate of cells in each group.

The cytotoxicity of H 2O 2 with nMOFs (5 ppm based Hf4+ ion) or without nMOFs to Hela cells

in 24 h after incubation with the concentration of 0, 12.5, 25, 50, 100 μM was measured by MTT

assay. Based on this, the safe concentration of H 2O 2 used in subsequent cell experiments is 50

μM.

Cytotoxicity of chemodynamic therapy (CDT) combined with RT was also based on MTT

method. Briefly, Hela cells and 50 μM H 2O 2 were incubated with a series of concentrations of

nMOFs (0, 5, 20, 40, 80 ppm based Hf4+ ion) for 24 h. Then, the cells were irradiated with 0 Gy

and 4 Gy of X-rays. After irradiation, cells continued to incubate for 24 h without changing

culture medium. MTT cell survival assay was applied to measure the survival rate of cells in

each group.

3
Cellar uptake. FITC and nMOFs were mixed in ethanol and stirred for 6 h to get the FITC@

nMOFs. 1 × 104 Hela cells were seeded in 35 mm culture dishes and incubated with FITC@

nMOFs for 4 h. After removing culture solution, the cells were washed for 3 times by phosphate

buffer saline (PBS) was used to wash. The cells were fixed with 4% formaldehyde, labeled with

DAPI, and then imaged by a confocal fluorescence microscope.

Cell cycle analysis. 1 ml culture medium contained 1 × 105 HeLa cells and 50 μM H 2O 2 with 5

ppm (based Hf4+ ion) Hf-BPY, 5 ppm (based Hf4+ ion) Hf-BPY-Fe or PBS were seeded in 6-

well plates and incubated for 24 h. After incubation, those cells were collected by centrifugation

(1000 rpm, 3 min), washed twice with PBS, and then fixed with 70% precooled ethanol at 4 °C

for 12 h. Then the cells were incubated with RNase A (100 μg / mL) and propidium iodide (PI,

50 µg / mL) for 30 min at 37 °C in the dark. The flow cytometry assay was employed for cell

cycle analysis, and Modfit software was used for fitting analysis.

PCR Analysis. 5 × 104 HeLa cells were seeded in several 35 mm culture dishes and incubated

for 24 h. These cells were irradiated with 6 Gy of X-rays. Then, the survival cells were replanted

in new culture medium (containing 50 μM H 2O 2) and co-cultured with 5 ppm (based Hf4+ ion)

Hf-BPY, Hf-BPY-Fe or PBS for different times (1 h, 6 h, 12 h and 24h), respectively. The ABI

7300 real-time PCR system was used for quantitative PCR measurement. The primer for the

target genes were as follows:

Gen Primer sequences(5’-3’）

H-GAPDH-S GGAAGCTTGTCATCAATGGAAATC
H-GAPDH-A TGATGACCCTTTTGGCTCCC
H-53BP1-S ACGAGGAGACGGTAATAGTGGG
H-53BP1-A TGCTTGTCCTGTTTGGCTGA
H-XRCC1-S TGAACCAAGAAGAAAAGAAGACCC
H-XRCC1-A GGAAGCCACTCAGCACCACTA
H-RAD51-S ACCCATTTCACGGTTAGAGCA
H-RAD51-A CTTCTTTGGCGCATAGGCAAC

4
Colony formation assay. 2 ml culture medium contained 50 μM H 2O 2 and 200, 400, or 800

HeLa cells with 5 ppm (based Hf4+ ion) Hf-BPY, Hf-BPY-Fe, or PBS were seeded in 6-well

plates. After incubation for 24 h, 200 cells wells were irradiated with 0 Gy or 2 Gy of X-rays,

400 cells were irradiated with 4 Gy of X-rays, and 800 cells were irradiated with 6 Gy of X-rays.

Three parallel experiments were conducted in each group. After irradiation, all the plates were

cultivated for 14 days. At last all cells were stained with giemsa stain. A cell colony should

contain at least 50 cells. The sensitive enhancement ratio (SER) was evaluated by the multi-

target and single-hit model,3

y = 1 − (1 − e−kx )N

in which x is the dosage of each group, and y is colony formation rate. Then y value of the group

treated with 4 Gy and saline was substituted into the equation for the other groups to calculate x.

SER = 4 Gy / x for each group. Clonogenic assays of A549 and RM-1 cells were performed

using the same procedure.

Comet assay. 1 ml culture medium contained 1 × 105 HeLa cells and 50 μM H 2O 2 with 5 ppm

(based Hf4+ ion) Hf-BPY, Hf-BPY-Fe, or PBS were seeded in 6-well plates and incubated for 24

h. Then these cells were irradiated with 0 Gy, or 4 Gy of X-rays. After incubation for 24 h, the

cells were centrifuged and washed twice with PBS. Finally, cells were digested and harvested,

and the standard single cell gel electrophoresis procedure was employed to observe the DNA

damage.

Apoptosis assay. 1 ml culture medium contained 1 × 105 HeLa cells and 50 μM H 2O 2 with 5

ppm (based Hf4+ ion) Hf-BPY, Hf-BPY-Fe, or PBS were seeded in 6-well plates and incubated

for 24 h. Then these cells were irradiated with 0 Gy, or 4 Gy of X-rays. After incubation for 24 h,

the cells were centrifuged and washed twice with PBS. The suspended cells were added with 500

5
μL binding buffer solution, and Annexin V-FITC was added for 15 min incubation in the dark.

Before test, PI was added and incubated for 5 min. At last, the flow cytometry assay was

employed, and Flowjo software was used for fitting analysis.

Western blotting for detection of protein expression. The cells were seeded and treated the

same as cell apoptosis assay. After that, the cells were centrifuged and washed twice with PBS.

Then the cells were lysed by pre-cooled RIPA buffer on ice. The protein samples were separated

by SDS-PAGE (10% gel) and transferred onto nitrocellulose membranes (PVDF). After blocking

with 5% non-fat milk, the membranes were incubated with specific primary antibodies (1:1000)

overnight at 4 C. After 3 times washing, incubations with secondary HRP-linked antibodies

were performed at room temperature for 1 h. Lastly, the membranes were detected using the

electrochemiluminescence (ECL) reagent kit (Thermo Scientific, USA) according to

manufacturer instruction.

In vivo toxicity assay. Kunming mice (7 weeks, female) were intravenous injected with Hf-

BPY-Fe (Hf, 100 mg/kg) suspended in normal saline and sacrificed at 3 or 30 days to collect

blood for hematological assay and tissues (including heart, liver, spleen, lung, and kidney) for

hematoxylin and eosin stain (H&E stain). The control group received intravenous normal saline

only and sacrificed at 3 or 30 days for the same assays.

In vivo radiation therapy. To establish the bilateral xenograft tumor model, 5 × 106 Hela cells

were suspended in 100 μl PBS and injected subcutaneously into the flanks of Balb/c nude mice

(7 weeks, female). As the tumor size reached approximately 100 mm 3, the mice were divided

randomly into 4 groups (6 mice in each group). Three groups received intratumoral objection of

PBS, Hf-BPY (Hf, 20 mg/kg), and Hf-BPY-Fe (Hf, 20 mg/kg), respectively. After 24 h, tumors

in the right flank were irradiated at a dose of 4 Gy, and tumors in the left flank were shielded

6
from irradiation as the control. The H&E stain and TdT mediated dUTP nick end labeling

(TUNEL) of tumor tissues using a commercially available kit were performed at 48 h after

irradiation, respectively. Body weight of mice and tumor volume were recorded every 3 days,

and the latter was calculated by the following equation: volume = length × (width)2 / 2. The other

three groups received intravenous administration of PBS, Hf-BPY-Fe (Hf, 20 mg/kg), and PEG-

Hf-BPY-Fe (Hf, 20 mg/kg), respectively. The tumor volume were recorded every 3 days.

7
Section 3: Supplementary figures

Figure S1. PXRD patterns of nMOFs.

Figure S2. 1H NMR spectrum of Hf-BPY. The spectrum was recorded with the solutions

obtained by digesting the solids with HF (aq.)/d 6-DMSO (1/40, v/v). 4 No other miscellaneous

peaks were found, indicating the high purity of materials.

8
Figure S3. TEM image of Hf-BPY.

Figure S4. IR spectra of Hf-BPY and Hf-BPY-Fe.

9
Figure S5. Particle size distributions of Hf-BPY and Hf-BPY-Fe.

Figure S6. (a) Photographic images showing Hf-BPY and Hf-BPY-Fe polycrystalline samples.

(b) Photographs of saline dispersion for Hf-BPY and Hf-BPY-Fe.

10
Figure S7. Zeta potentials of Hf-BPY, Hf-BPY-Fe and PEG-Hf-BPY-Fe.

Figure S8. XPS spectra of Hf-BPY and Hf-BPY-Fe.

11
Figure S9. Elemental analysis and energy dispersive X-ray elemental mapping of Hf-BPY (a, c)

and Hf-BPY-Fe (b, d).

12
Figure S10. N 2 adsorption/desorption isotherms of Hf-BPY and Hf-BPY-Fe.

Figure S11. Assessment of cellular uptake of Hf-BPY and Hf-BPY-Fe (Scale bar = 20 µm).

HeLa cells treated with FITC-labeled Hf-BPY and Hf-BPY-Fe showed remarkable intracellular

green fluorescence spots. Nuclei were stained with DAPI (blue fluorescence).

13
Figure S12. Cell viability of Hela cells after 24 h incubation with a series of concentrations

(determined by ICP-OES based on the concentration of Hf4+ ions) of Hf-BPY and Hf-BPY-Fe.

Figure S13. Cytotoxicity test in vitro of nMOFs. The Hela cells were seeded in 96-well plates

(10000 cells per well) and incubated with a series of concentrations (determined by ICP-OES

based on the concentration of Hf4+ ions) of Hf-BPY or Hf-BPY-Fe for 24h, PBS as blank

14
control group. These cells were irradiated with 0 Gy, or 4 Gy of X-rays. After that, the cells

continued to incubate for other different times, 24 h, 48h and 72 h. MTT cell survival assay was

applied to measure the survival rate of cells in each group.

Figure S14. Cell viability of Hela cells after 24 h incubation with a series of concentrations of

H 2O 2 and Hf-BPY and Hf-BPY-Fe (5 ppm based on Hf4+ ions). External H 2O 2 was used to

simulate the overexpression of H 2O 2 microenvironment in tumor area. The cell survival rate after

CDT (induced by 50 µM H 2O 2 and Hf-BPY-Fe) was still higher than 80%. Therefore, the safe

dosage of H 2O 2 for all cell experiments in this work is 50 µM.

15
Figure S15. Synergistic therapeutic effect of Hela cells that have taken up Hf-BPY-Fe (80 ppm

based on Hf4+ ions) subjected to RT, CDT, and the combined RT/CDT treatments. The projected

additive value is calculated by multiplying the cell viability of RT and CDT group.

Figure S16. The flow cytometric analysis of cell cycles of Hela cells treated with PBS, Hf-BPY,

and Hf-BPY-Fe for 24 h, respectively.

16
Figure S17. ESR spectra of different groups as indicated with/without X-ray irradiation (4 Gy).

DMPO was used as the spin trap. Both of the two nMOFs shows representative OH signals after

X-ray treatment. The OH mainly come from water dissociation induced by strong X-ray

attenuation of Hf4+ in nMOFs. After irradiation, ESR signal intensity of Hf-BPY-Fe is slightly

stronger than Hf-BPY, which is consistent with the cell growth inhibition of nMOFs with X -ray

treatment (Figure S13).

Figure S18. (a) Diffuse reflectance UV-vis spectra of Hf-BPY and Hf-BPY-Fe. (b) Fkm spectra

of nMOFs from diffuse reflectance UV-vis spectra. (c) Cyclic voltammograms of Hf-BPY and

17
Hf-BPY-Fe. According to ELUMO (LUMO = lowest unoccupied molecular orbital) estimated

from the first reduction potential and ∆CT estimated from the charge-transfer absorption in the

solid-state UV–vis spectra. 1, 5

Figure S19. Comet assays after treatment with/without X-ray radiation. Compared to other

groups, the clear comet tails in the X-ray + Hf-BPY-Fe group suggest severe DNA damage in

cells. These results are consistent with the results of the γ-H2AX staining.

18
Figure S20. Detection of double-stranded DNA damage repair (Scale bar = 20 µm). The cells

were irradiated with 6 Gy X-rays. Immunofluorescence images of γ-H2AX with different

treatments: (a) detect immediately; detect after co-cultured for 24 h with PBS (b), Hf-BPY (c),

or Hf-BPY-Fe (d).

19
Figure S21. Real time PCR results of different groups including 53BP1, XRCC1 and RAD51.

20
Figure S22. Colony formation assay of Hela cells incubated with PBS, Hf-BPY or Hf-BPY-Fe

with or without X-ray irradiation.

21
Figure S23. Colony formation assay of A549 and RM-1 cells lines.

22
Table S1. Sensitization enhancement ratio (SER) values by clonogenic assays in a panel of cell

lines upon X-ray irradiation.

SER Hela A549 RM-1

Hf-BPY 1.41 1.32 1.43

Hf-BPY-Fe 1.74 1.87 1.75

Figure S24. Temporal changes of body weight of Kunming mice after intravenous injection of

Hf-BPY-Fe (Hf, 100 mg/kg) or PBS.

23
Figure S25. Hematological parameters of Kunming mice after intravenous injection of Hf-BPY-

Fe (Hf, 100 mg/kg) or PBS.

24
Figure S26. Hematoxylin-Eosin (H&E) stained tissue sections of major organs of Kunming mice

after intravenous injection of Hf-BPY-Fe (Hf, 100 mg/kg). Scale bar = 50μm

Figure S27. Blood half-time test of Hf element. The blood terminal half-life of Hf-BPY-Fe and

PEG-Hf-BPY-Fe is 65 min and 93 min, respectively, based on the one-component

pharmacokinetic model. Three female Balb/c nude mice at 7 weeks were injected intravenously

with Hf-BPY-Fe and PEG-Hf-BPY-Fe (Hf, 100 mg/kg) saline solution, respectively. After that,

20 µL blood was collected from the tail vein in the given time points (10 min, 30 min, 1 h, 2 h, 3

h, 6 h, 12h and 24 h) and diluted to 4 ml of ultrapure water with 10 mM

25
ethylenediaminetetraacetic acid disodium salt (EDTA-2Na) as anticoagulant. Then ICP-OES was

used to determine the time-dependent concentrations of Hf in blood. 6 The prolonged circulation

time of nanoparticles in blood could be attributed to surface modification of PEG reduces uptake

in reticuloendothelial system (RES).7-8

Figure S28. Biodistribution of Hf in Balb/c nude mice. Three female Balb/c nude mice at 7

weeks were injected intravenously with Hf-BPY-Fe or PEG-Hf-BPY-Fe (Hf, 100 mg/kg) saline

solution. After 24h, the mice were sacrificed and the major organs, tumors and muscles adjacent

to tumor were collected. These tissues and organs were weighted and then digested with aqua

regia for ICP-OES analysis of Hf content. The percentage injected dose per gram (% ID g -1)

organ/tissue (D) of Hf was calculated by the following equation: 9

26
 M Hf ⁄ Morgan
𝐷= × 100%
M ID

where M Hf (µg) is the mass in the corresponding organ whose mass is M organ (g), and the constant

M ID (µg) is the injected dose of Hf.

Figure S29. Localization of tumor in the clinical radiation therapy apparatus.

Figure S30. Tumor photos at the end of the observation.

27
Figure S31. Photographs of xenograft tumors (a) and growth curves (b) after different treatments

via intravenous injection.

28
REFERENCES

1. Sippel, P.; Denysenko, D.; Loidl, A.; Lunkenheimer, P.; Sastre, G.; Volkmer, D.
Dielectric Relaxation Processes, Electronic Structure, and Band Gap Engineering of MFU-4-
Type Metal-Organic Frameworks: Towards a Rational Design of Semiconducting Microporous
Materials. Adv. Funct. Mater. 2014, 24, 3885-3896.
2. Wood, D. L.; Tauc, J. Weak Absorption Tails in Amorphous Semiconductors. Phys. Rev.
B 1972, 5, 3144-3151.
3. Ma, N.; Jiang, Y. W.; Zhang, X.; Wu, H.; Myers, J. N.; Liu, P.; Jin, H.; Gu, N.; He, N.;
Wu, F. G.; Chen, Z. Enhanced Radiosensitization of Gold Nanospikes via Hyperthermia in
Combined Cancer Radiation and Photothermal Therapy. ACS Appl. Mater. Interfaces 2016, 8,
28480-28494.
4. Yang, N. N.; Fang, J. J.; Sui, Q.; Gao, E. Q. Incorporating Electron-Deficient
Bipyridinium Chromorphores to Make Multiresponsive Metal-Organic Frameworks. ACS Appl.
Mater. Interfaces 2018, 10, 2735-2744.
5. Cardona, C. M.; Li, W.; Kaifer, A. E.; Stockdale, D.; Bazan, G. C. Electrochemical
Considerations for Determining Absolute Frontier Orbital Energy Levels of Conjugated
Polymers for Solar Cell Applications. Adv. Mater. 2011, 23, 2367-2371.
6. Zhang, C.; Bu, W.; Ni, D.; Zhang, S.; Li, Q.; Yao, Z.; Zhang, J.; Yao, H.; Wang, Z.; Shi,
J. Synthesis of Iron Nanometallic Glasses and Their Application in Cancer Therapy by a
Localized Fenton Reaction. Angew. Chem., Int. Ed. 2016, 55, 2101-2106.
7. Vert, M.; Domurado, D. Poly(Ethylene Glycol): Protein-Repulsive or Albumin-
Compatible? J. Biomater. Sci., Polym. Ed. 2000, 11, 1307-1317.
8. Blume, G.; Cevc, G.; Crommelin, M. D. J. A.; Bakker-Woudenberg, I. A. J. M.; Kluft,
C.; Storm, G. Specific Targeting with Poly(Ethylene Glycol)-Modified Liposomes: Coupling of
Homing Devices to the Ends of the Polymeric Chains Combines Effective Target Binding with
Long Circulation Times. Biochim. Biophys. Acta 1993, 1149, 180-184.
9. Zhang, C.; Bu, W.; Ni, D.; Zuo, C.; Cheng, C.; Li, Q.; Zhang, L.; Wang, Z.; Shi, J. A
Polyoxometalate Cluster Paradigm with Self-Adaptive Electronic Structure for
Acidity/Reducibility-Specific Photothermal Conversion. J. Am. Chem. Soc. 2016, 138, 8156-
8164.

29