Pavan Chaurasiya

1.
INTRODUCTION
India has a wide range of climatic zones which makes it suitable for a
diverse range of vectors and vector borne pathogens of medical and veterinary
importance. Transmission and geographical distribution of these vectors and
pathogens are closely linked to regional temperature, rainfall and humidity (Patz
et al., 2005). Amongst the canine vector-borne diseases, canine babesiosis has
been reported throughout world in the tropical and subtropical regions including
India (Kjemtrup and Conrad, 2006). It is an important life hazard
haemoprotozoan disease with significant impact on pet animals and has zoonotic
importance (Kumar et al., 2009).
The disease is caused by intra-erythrocytic protozoan parasites of the
genus Babesia. Babesia canis and Babesia gibsoni are the two predominant
species of the organism found worldwide that cause canine babesiosis. Their
appearance in dogs depends upon distribution of their vector species
geographically. Babesia species usually appears as a single pear-shaped
piroplasm or singnet ring shaped or in pairs of merozoites divided by binary
fission within the erythrocyte.
The infection is transmitted through ticks such as Dermacentor reticulatus,
Rhipicephalus sanguineus and Haemaphysalis leachi. These ticks are usually
specific to each species of Babesia. The rate of incidence is very high in India
(Chaudhuri, 2006; Varshney and Dey, 1998). Dogs between the age group of six
months to one year (puppies), male animal (Mahalingaiah et al., 2017) and
Rottweiler breeds are more prone to infection and are at greatest risk of serious
illness and death due to B. canis. Clinical manifestations vary with the species of
the infectious agent, age, immune status and concurrent infections of the
affected dog.
The incubation period of canine babesiosis varies from 10-21 days for
Babesia canis and 14-28 days for Babesia gibsoni. The clinical presentation of
babesiosis ranges widely from peracute, chronic or even subclinical form.
Pathogenesis varies from a peracute, shock-associated, hemolytic crisis to an
inapparent subclinical infection. Clinical signs show marked variability like
anorexia, anaemia, jaundice, vomiting, lethargy, and decreased body weight
1
(Vial and Gorenflot, 2006). Hemolytic anaemia is the result of direct injury to
erythrocytes caused by the parasites and also by immune-mediated
mechanisms. In addition, most dogs with babesiosis have thrombocytopenia.
Low blood oxygen (hypoxaemia) as a result of anaemia contributes to morbidity
and the most pathogenic strains cause Multi Organ Dysfunction Syndrome
(MODS) and Systemic Inflammatory Respiratory Disease (SIRD). Clinico-
pathological abnormalities like ascites, hemoglobinuria, hypoglycaemia, acid-
base disorders, azotemia and increased liver enzymes also occurs (Irwin, 2010).
Traditionally the disease is diagnosed by demonstration of the intra-
cytoplasmic piroplasms in peripheral blood smears. As Babesia spp. organisms
prefer to parasitize reticulocytes over mature red blood cells, a buffy coat smear
can also be useful in diagnosis (Bohm et al., 2006). Serological methods are
considered to be highly sensitive but only moderately specific because of
antigenic cross-reactions of babesia organism and normal dog erythrocytes. In
this regard, recent advances in molecular biology techniques like polymerase
chain reaction (PCR) have made it possible to detect and identify piroplasms with
greater sensitivity and specificity.
Experiments on treatment of babesiosis with various medications have
been done to overcome the infection. However, relapses after administering
some combinations of anti-babesial drugs and the presence of drug-resistance
still pose significant challenge to veterinarians. Alternative therapy such as
homeopathy have been tried by some veterinarians and found it to be effective,
less toxic and economical (Chaudhuri and Varshney, 2007). Keeping in view the
importance of the disease in the dog, the present study was designed with the
following objectives:
OBJECTIVES:
1. To study the prevalence of canines babesiosis in and around Rewa city.
2. To evaluate the haematological and biochemical parameters in infected dogs.
3. To study the comparative efficacy of allopathic and homeopathic anti- babesiosis
drugs in affected animals.
2. REVIEW OF LITERATURE
2.1 Epidemiology:
Cardoso and Serra-Freire (2001) conducted an epidemiological survey

of B.canis and reported 20.75% and 24.70% prevalence in Teresopolis and
Silva Jardim (Brazil), respectively.
Bastos et al. (2004) reported a prevalence of 42% in a retrospective

study of clinical cases of babesiosis in dogs.
Sundar et al. (2004) recorded incidence of Babasia gibsoni for a period

of one year and reported a prevalence of 0.087%. The age of infected dog
ranged from 3 months to 6 year.
Samradhni et al. (2005) recorded 64.28 % prevalence of babesiosis

from suspected 377 dogs for haemoprotista infections.
Gadahi et al. (2008) reported the prevalence of 5% of B. canis in

Hyderabad, India. They reported higher prevalence in stray dogs (13.00%)
than pet dogs (9.00%), month wise highest percentage of infection in July
(13.30%) and the lowest in May (10%). The adult dog (14.70%) had a more
common impact than the puppies (7.69%) and the percentage of infection in
females (18.6%) was more than male dogs (9.33%).
Kumar et al. (2009) reported that B. gibsoni was identified in 84.90% of

dogs which were infected with hemoprotozoa in Chennai. Higher prevalence
was found in summer and winter. The highest infection was in adults
(63.10%) but the infection spread evenly among both sexes in all breeds of
dogs.
3
Singh et al. (2012) conducted study on 460 dogs at Ludhiana (Punjab)
during the year 2010 and reported that examination of Giemsa stained
peripheral blood smears exhibited 10.21 per cent hemoprotozoan comprising
of B. gibsoni (8.26 per cent) and B. canis(0.65 per cent). B. gibsoni infection
was significantly higher (p<0.05) in male dogs.
Singh et al. (2012) recorded prevalence of babesiosis was

comparatively higher in females (6.22%) as compared to males (5.57%).
Das and Konar (2013) observed Giemsa stained peripheral blood

smears of dogs in Kolkata (West Bengal) and reported 8.51 per cent
prevalence of babesiosis.
Rene-Martellet et al. (2013) analysed the risk of infection of babesiosis

according to age classes and reported significantly higher risk in dogs of less
than 5 years age compared to dogs more than 5 years old. Males were more
affected (62%) than females and (38%).
Shrivastava et al. (2014) studies the epidemiology of haemoprotozoan

diaseases in and around Jabalpur, M.P. and reported prevalence of Babesia
specie as 10.48%, highest prevalence (18.18%) in August month (18.18%),
age wise highest in 1-3 year of age group (13.27%) followed by 5-7 year of
age group (12.94%) and 7-9 year of age group (12.92%). They recorded
highest prevalence in females (14.77%) as compared to males (7.38%).
Breed wise highest prevalence was reported in German shepherd (15.47%).
Shrivastava et al. (2014) noticed the prevalence of Babesia specie as

10.48%, month wise, age wise and sex wise prevalence of Babesia specie
was also studied. Lowest prevalence was seen in March where as August
recorded highest prevalence (18.18%) followed by July (16.67%). Highest
prevalence of the disease was recorded in 1-3 year of age group (13.27%)
followed by 5-7 year of age group (12.94%) and 7-9 year of age group
(12.92%). They recorded highest prevalence in females (14.77%) as
compared to males(7.38%). Breed wise highest prevalence was noticed in
German shepherd (15.47%) followed by Samoyed (15.25%), Pug (12.25) and
non-descript (10.94%).
Adebayo et al. (2016) studied the disease pattern in 14 dog breeds.

They found highest prevalence of babesiosis in Alsatian/ German Shephard
(62.2%) followed by Rottweiler (55.0%) and Boerboel (64.3%), out of the 14
breeds present. Among sexes, prevalence was higher in male (66.5%) than
for female (56.2%). Young pups of less than 9 month of age recorded
prevalence of 64.7%. They observed tick infestation, fever, and anorexia in
86.6%, 57.2%, and 49% cases respectively in positive cases.
Ravi et al. (2016) reported a prevalence of 4.12% for B. gibsoni and

0.0042% for B. canis. Age wise incidence of babesiosis showed that dogs
less than 1 year of age and above 6 years were more prone to infection.
Mahalingaiah et al. (2017) reported higher prevalence in male’s

animals and in the age group less than one year of age.
2.2 Diagnosis: Blood smear versus PCR

Laha et al. (2014) investigated Bobesia infections in pet dogs of a
north eastern state of India. They compared the diagnostic efficacy of
Babesia infection by polymerase chain reaction (PCR) technique with
conventional microscopy examination. A total of 44 (39.63 %) dogs were
diagnosed as positive for Babesia infections after microscopic examination.
Among these, Babesia canis infection was diagnosed in 5 dogs (4.50 %) and
B. gibsoni infection in 39 (35.13 %) dogs microscopically in Giemsa stained
blood smears. Molecular diagnosis using PCR detected 63 (56.75 %) dogs
positive for Babesia infection. Single infection with B. canis was found in 9
5
(8.10 %) dogs while B.gibsoni alone was detected in 3 (2.70 %) dogs. Mixed
infections by both these species were detected in 51 (45.94 %) dogs. Overall,
PCR detected 54 (48.64 %) dogs as B.gibsoni and 60 (54.05 %) dogs as B.
canis positive.
Davitkov et al. (2015) screened 60 dogs with clinical findings

compatible with babesiosis in Serbia. Infection was diagnosed by microscopic
examination and confirmed by PCR. The main clinical signs were apathy,
anorexia, fever, brown/red discoloration of urine, pale mucous membranes,
icterus, splenomegaly and vomiting.
Jain et al. (2017) examined a total of 150 dogs for blood parasites
through light microscopy, as well as by PCR focusing on the 18S rRNA gene
of B. gibsoni. Out of the 150 dogs examined, molecular evidence of B.
gibsoni was recorded in 47.3% of animals, and the detection of light
microscopy of infection in 26.67% cases. Haematological abnormalities in
affected dogs included decreased RBC, Hb and HCT indicating anemia with
severe thrombocytopenia.
Rucksaken, et al. (2019) studies the Comparison of conventional

polymerase chain reaction and routine blood smear for the detection of
Babesia canis, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in
Buriram Province, Thailand and reported that PCR techniques is more
sensitive PCR is an effective method for definitive diagnosis of dog blood
parasites infection, particularly in animal hospitals, blood banks and for an
epidemiological study.
2.3 Clinical Symptoms:
Matjila et al. (2005) confirmed the twenty-three cases of

autochthonous babesiosis in the Netherlands during the spring and autumn in
2004 and reported that the typical symptoms of these fatal cases were
lethargy, anorexia, fever, hemoglobin uria, and vomiting. They also reported a
wide variety of clinical signs like anorexia, lethargy, jaundice, hemolytic
anemia, vomition and marked loss of body condition.
Mathe et al. (2006) studied the clinical signs of Babesia canis and
reported the most common clinical observations were fever, lethargy, pallor,
icterus, hemoglobinuria, and spleenomegaly and tick infestation.
De Gopegui et al. (2007) reported that dogs suffering from babesiosis

showed clinical signs of lethargy (40/45), fever (27/45), pale mucous
membranes (27/45) and hemoglobinuria (15/45).
Andoni et al. (2013) studied the clinicopathological findings in dogs

naturally infected with Babesiacanis and recorded that the main clinical signs
were dehydration (89.65%), apathy (58.62%), fever (55.1%), icterus (27.5%),
petechiae (10.3%), abdominal pain (41%), anaemia in (79%) and anorexia or
decreased appetite (70%). Biochemical abnormalities included elevated ALT,
AST, bilirubin, BUN with normal creatinine.
Rene-Martellet et al. (2013) reported that the main clinical signs were
lethargy(98%), anorexia (98%) and hyperthermia 39ºC (80%) pale mucous
membranes were observed in 54% of the cases, modification of the
appearance of the urine in 45% and spleenomegaly in 33%. Hemoglobinuria
was recorded in 66% of cases followed byproteinuria (63%) and bilirubinuria
in 78%. Other clinical signs described included joint pain (15%), vomiting
(12%), modified stools (9%), polypnea (7%) and loss of balance (4%).
7
2.4 Haemato-Biochemical studies:
Makinde and Bobade (1994) measured osmotic fragility of the

erythrocytes in blood samples collected from babesia infected dogs. The
erythrocytes from dogs with Babesia canis had an increased osmotic fragility.
Onishi and Suzuki (1994) analysed the hemolytic activity in Babesia

gibsoni infected dogs. They reported that the decrease in the activity is
parallel with the increase in the number of reticulocytes.
Vercammen et al. (1997) studied the hematological and biochemical

parameters of dogs experimentally infected with B. canis. They reported
development of a normocytic, normochromic anemia a few days after the
infection and in the later stage slightly hypochromic and macrocytic and
regenerative anaemia, thrombocytopenia throughout the observation period
of 12 week. Leukopenia was irregularly considered due to neutropenia,
lymphocytopenia and monocytopenia; moderate and temporary increases of
bilirubin, aspartate transaminase and alanine transaminase and
hypoalbuminaemia during the first parasitaemic phase were observed.
Meinkoth et al. (2002) studied the hematological alterations in dogs

experimentally infected with B. gibsoni and reported that all dogs developed
marked regenerative anemia and thrombocytopenia with transient
neutropenia in some dogs.
Hossain et al. (2003) studied hematological changes due to

experimentally induced chronic babesiosis in adult splenectomized dogs and
reported polychromasia with macrocytic normochromic anemia, anisocytosis
and an increase in nucleated erythrocytes. Biochemical alterations included a
significant increase in mean total serum protein (8.27+2.37g/dl) and serum
bilirubin (1.02+0.11 mg/dl).
Camacho et al. (2005) conducted a study on 58 dogs with babesiosis
and reported that the affected dogs had significant elevation of total proteins
and globulin and significantly lower levels of albumin. Infected dogs
significantly lower concentrations of proteins, albumin and globulins at those
present at azotaemia.
Furlanello et al. (2005) studied clinic-pathological findings in

spontaneous canine babesiosis that showed anemia in 74% of dogs and
classified it as light (35%), moderate (59%) and severe (6%). In each case,
there was normocytic and normochromic anemia. Total 70% of dogs had
hemolytic anemia and non-hemolytic anemia was seen in 30%. Leukopenia
and neutropenia were observed in 69 and 74% of dogs, respectively.
Leukocytosis was due to mature neutrophilia and lymphocytosis which was
present in one dog but thrombocytopenia was present in all dogs. In most of
cases, mild elevation of aspartate transaminase (AST), alanine transaminase
(ALT), alkaline phosphatase (ALP), creatinekinase (CK) and total bilirubin
were recorded.
De Gopegui et al. (2007) conducted a retrospective study of the

babesiosis in the dog and reported thrombocytopenia, moderate, normocytic,
normochromic anemia. Abnormal leukocyte included leukopeni or
leukocytosis, neutropenia and monocytosis. Biochemical abnormalities
included increase in BUN, and moderate hyperglycemia.
Zygner et al. (2007) assessed the hemato biochemical changes in

Babesiacanis infection in dogs and reported lower hematocrit and
thrombocytopenia (99.5%) as the common finding in the affected dogs
neutropenia and shift to left (21.8%), lymphocytosis (14.9%) while 7.2% had
the lymphopenia. The biochemical abnormalities included elevated activity of
ALT, AST, ALP, creatinine and BUN concentration and decreased TP,
9
albumin and glucose. These abnormalities resulted from hepatopathy, renal
failure and fasting.
Matijatko et al. (2009) reported the hematological alterations in dogs

suffering from babesiosis and reported anaemia, leukopaenia and
thrombocytopenia. Blood biochemical abnormalities included hypoglycaemia
and bilirubinaemia.
Fabisiak et al. (2010) studied the hematological abnormalities in

babesiosis affected dogs. The most significant hematological abnormality
reported was thrombocytopenia, less severe abnormalities included anemia
and leukopenias (both neutropenia and lymphopenia), with significant
differences in PCV values and TLC values.
Crnogaj et al. (2010) examined dogs infected with B. canis and

clinically classified them into two groups, complicated (7 dogs) and
uncomplicated (28 dogs). They noted complications were renal dysfunction,
liver dysfunction, muscular involvement and acute respiratory distress
syndrome.
Irwin (2010) reported the variable clinic-pathologic abnormalities

including ascites, acid-base disturbances, hemoglobinuria, hypoglycemia,
azotemia and elevated liver enzymes in canine babesiosis.
Shah et al. (2011) studied four dogs infected with Babesia presented
to Department of Veterinary clinical services complex, GADVASU, Ludhiana
for haematological changes and recorded normocytic normochromic anaemia
and thrombocytopenia. The total and differential leukocyte counts were not
specific.
Andoni et al. (2012) reported hypocytic Hypochromicanaemia,
decreased PCV, thrombocytopenia as haematological changes in dogs
positive for B. canison blood smear examination.
Reddy et al. (2014) reported clinic haematological and urinalysis

findings in dogs with large Babesia infection. Clinical examination revealed
presence of ticks over the body, dullness, variations in the appetite, rise in
rectal temperature, tachycardia in all the dogs while tachypnoea dyspnoea
,congested mucus membranes with sunken eye balls, lymphadenopathy was
seen in 90% cases, 40-50% cases showed pallor, haemoglobinuria, tensed
abdomen, yellowish mucus membranes, yellowish discoloration of abdomen,
vomitions, diarrhea. Oedema at the legs and constipation were reported in
20% cases. Haematological findings included significant reduction in RBC,
Hb concentration, PCV percentage and platelet count with significant
decrease in WBC count and neutropenia along with lymphocytosis and
monocytosis. Urinalysis findings included haemoglobinuria, proteinuria,
bilirubinuria, and increased amount of urobilinogen in the urine. Microscopic
evaluation of the sediment revealed red blood cells as well as white blood
cells, tubular epithelial cells and crystal formation.
Nalubamba et al. (2015) reported anaemia (96.4%) with nucleated

erythrocytes (42.2%), and hypochromasia in Babesiainfection in dogs.
Gonde et al. (2016) studied the hemato-biochemical alterations in

babesiosis in dogs and reported neutrophilic Leukocytosis, hypoglycaemia
and increase in bilirubin, alanine aminotransferase (ALT), alkaline
phosphatase (ALKP)
Bilwal et al. (2017) studied the hematological parameters and noticed

that the average values of hemoglobin and total erythrocytes number in
babesiosis dogs were significantly reduced as compared to healthy dogs.
11
Among differential leukocyte count, mean values of neutrophils and
eosinophils increased while lymphocytes decreased in dogs with babesiosis
as compared to healthy dogs. The serum biochemistry showed an increase in
the value of alkaline phosphatase, alanine aminotransferase, aspartate
aminotransferase, and globulin with reduction in albumin levels in babesiosis
cases as compared to healthy dogs. The characteristic hematological pattern
associated with babesiosis in dogs showed that there were decreased levels
of Hb, TEC, and PCV as well as higher level of neutrophils while serum
biochemical pattern included increased level of ALP, ALT, AST, total bilirubin
and globulin.
Yogeshpriya et al. (2018) noticed significant reduction in RBC, Hb

concentration, PCV percentage and platelet count among babesiosis infected
dogs. Serum biochemical parameters revealed increased BUN, creatinine,
ALT and ALP levels.
2.5 Treatment
Wulansari et al. (2003) reported the effectiveness of clindamycin for
the treatment of babesiosis in dogs experimentally infected with B. gibsoni as
the drug reduced parasitemia levels and induced morphological changes that
indicated degeneration of parasites (e.g., segmentation; size reduction;
localization in the cell limbic and/or torn state of the nucleus; and swelling,
decrease, or disappearance of the cytoplasm) in the majority of dogs.
Chaudhary and Varshney (2007) studied the comparative clinical

efficacy of diminazine aceturate and homeopathic medicine Crotalus horridus
200C in the treatment of canine babesiosis and reported that the clinical
efficacy of Crotalus horridus is comparable with modern allopathic drug
diminazine aceturate.
Suzuki et al. (2007), used Clindamycin @25 mg/Kg bwt, PO
+Doxycycline@ 5mg/Kg bwt. PO +Metronidazole @15 mg/Kg bwt.PO. They
reported successful treatment of babesia infection in dog as shown by
marked increase in PCV percent and thrombocyte count and a significant
decrease in C-reactive protein in babesia infected cases.
Matsuu et al. (2008) evaluated that inhibitory activities in vitro growth

of various drugs against B. gibsoni, after the establishing of a continuous
culture isolate. They reported that no growth inhibition effect was confirmed
indeed at the maximum concentration of metronidazole, while doxycycline
and clindamycin were seen to be potent growth inhibitor.
Lin and Huang (2010) evaluated the effectiveness of oral

administration of doxycycline-enrofloxacin-metronidazole combination on
even without injections of diminazene diaceturate in the treatment of canine
babesiosis of natural origin caused by B. gibsoni. Overall efficacy of this
doxycycline-enrofloxacin-metronidazole combination together with and
without administration of diminazene diaceturate was found 85.7% and
83.3%, respectively; with an average recovery time of 24.2 and 23.5 days,
respectively.
Talukder et al. (2013) evaluated sensitivity of doxycycline against in

vitro cultured B. gibsoni by real-time PCR and reported that doxycycline
effectively inhibited the growth of B. gibsoni in vitro.
Shrivastava et al. (2014) evaluated efficacy of newer combination of

drugs (Doxycycline, enrofloxacin/ norfloxacin and metronidazole) against
canine babesiosis and reported that Doxycycline-enrofloxacin-metronidazole
combination was found to be superior, as more number of animals were
recovered 15 days after treatment.
13
3. MATERIALS AND METHODS
3.1 Location and Place of work
The cases of babesiosis for the study were screened from those
presented to Medicine Out Patient Department (OPD) at Teaching Veterinary
Clinical Complex (T.V.C.C.) of the College of Veterinary Science and A.H.,
Rewa and from private clinics in and around Rewa (M.P.).
3.2 Duration of work: 6 months.
3.3 Materials and Methods:
The present study was carried out in two phases:
3.3.1 Phases I: Study of prevalence of Babesiosis in dogs-
3.3.1.1 Animal screening:
Study for the prevalence of babesiosis in dogs was conducted at

T.V.C.C. Rewa and nearby places of Rewa. For this, a total of 200 dogs with
a history of anorexia and showing clinical signs of pale mucous membranes
were selected. Out of these 200 animals, dogs with a history of recent tick
infestation were screened for presence Babesia organism on the basis of
blood smear examination and PCR assay to know the prevalence rate.
Dogs irrespective of age, sex and breed were included in the study.
Thin blood smears were prepared after puncturing the ear tips with 24 gauge
needle, fixed in methanol and stained with Giemsa and Leishman’s stains
following standard procedures (Benjamin, 1982). Smears were observed
under microscope for presence of Babesia organism. The parasites were
identified on the basis of characteristic morphology (Soulsby 1982). One ml
blood samples were also obtained in Sodium EDTA vaccutainers from
suspected dogs from cephalic/saphanous vein for isolation of DNA for PCR.
3.3.1.2 Detection of Babesiosis by Polymerase chain reaction:
DNA Extraction:
The blood samples were collected in vaccutainers containing sodium

EDTA as anticoagulant. DNA was extracted by following method:
1. Four hundred microliters of the samples were taken and centrifuged at

4,000 rpm for 3 min.
2. The cell pellets were resuspended in one ml of erythrocyte lysis
solution, mixed and centrifuged as described below:
Erythrocyte lysis solution :
a. 155 mM NH4Cl,
b. 10 mM NaHCO3,
c. 100 mM disodium EDTA [pH 7.4]
3. Treatment with erythrocyte lysis solution was repeated until the
leukocyte pellets lost all its reddish coloration. Template DNA was
obtained as follows:
a. Four hundred microliters of WBC lysis solution (2% Triton X-
100, 1% sodium dodecyl sulfate, 100 mM NaCl, 10 mM Tris-HCl
[pH 8.0]) and 10 µl of proteinase K (10 mg/ml) were added to
the samples, and the contents were mixed thoroughly and
incubated for 30 min at 500C.(Plate:01,02)
b. Then, four hundred microliters of saturated phenol was added,
and the contents were mixed thoroughly and centrifuged at
10000 rpm for 10 min.
c. The aqueous layer was transferred to a fresh tube, and an
equal volume of chloroform-isoamyl alcohol (24:1) was added;
the contents of the tubes were mixed thoroughly and
centrifuged at 10,000 rpm for 10 min.
d. The upper layer was again transferred to a fresh tube, and 200
µl of 7.5 M ammonium acetate was added and mixed
thoroughly. Two volumes of absolute ethanol were added, the
15
contents were mixed, and the tubes were stored at -20 0C for 2-3
hrs or overnight.
e. DNA was recovered by centrifuging the samples at 10,000 rpm
for 10 min.
f. The pellets were rinsed with 1 ml of 70% ethanol, dried and
resuspended in 20 µl of TE buffer (10 mM Tris-HCl [pH 8.0], 1
mM disodium EDTA) and stored at -20 0C until they were
processed.
Polymerase Chain Reaction:
The genomic DNA of presumptively suspected dogs was employed for

detection of Babesia spp. by targeting 18S rRNA gene using PCR( Plate:03) .
The PCR was performed in thermal cycler (Veriti, ABS) with heated lid at
1050C. The oligonucleotide sequence is mentioned in Table 1. The cyclic
condition for PCR was as follows:
a. Initial denaturation at 95 0C for 5 min, 35 cycles of denaturation at 95 0C

for 45 sec, annealing at 580C for 45 sec, extension at 72 0C for 45 sec
and followed by final extension at 72 0C for 5 min and hold at 100C.
After amplification, the amplified DNA product was electrophoresed in
2% agarose gel in 0.5x Tris-Borate-EDTA (TBE) buffer containing
ethidium bromide at final concentration of 0.5µg/ml (Plate 04). The gel
was visualized by gel documentation system E-gel imager (Invitrogen,
USA) (Plate05, 06).
Table 1: Babesia spp. oligonucleotide sequence
Sr. Target Primer Oligonucleotide sequence Amplicon Reference

No gene Size
1 18S PIRO- AATACCCAATCCTGACACAGGG 400 bp Maia et al.,
rRNA A 2014
PIRO- TTAAATACGAATGCCCCCAAC
B
3.3.2 Phases II: Therapeutic evaluation of allopathy and
homeopathy formulation on Babesiaosis-
3.3.2.1 Therapeutic trial:
Out of the total 54 babesia positive dogs (based on blood smear and
PCR) a total of eighteen were included in the study and were randomly
divided into three groups (n=6) for the therapeutic trial. In addition, six healthy
animals were included in control group for comparative studies of therapeutic
trial (Table 2 and Table 3).
3.3.2.2 Group wise treatment protocol
Table 2: Group wise treatment protocol

Groups Treatment protocol
I Allopathy (Doxycycline+Clindamycin+Metronidazole)
II Homeopathy (Crotalus horridus 200C)
III Allopathy +Homeopathy
HC Healthy Control group
Table 3: Dose rate of treatment protocal
Drugs Dose rate Route Day of medications

Doxycycline @10 mg /kgBwt. PO OD daily 14 days
Metronidazole @25mg/kgBwt. PO OD daily 14 days
Clindamycin @11 mg/kg Bwt. PO OD daily 14 days
Homeopathy Crotalus @4 pills qid PO QID daily 14 days
horridus 200C
3.3.2.2 Ancillary and Supportive treatment:
All the dogs were given ancillary treatment with NSAIDS (Meloxicam)
@ 0.2mg/kg B. wt., and antacid (pantoprozole@ 1mg/kg b.wt) and supportive
treatment with haematinics, liver tonics and multivitamins. Antiemetic
(Metochlorpramide@ 0.2-0.5mg/kg b. wt.) and fluid therapy were given as per
requirement and according to symptoms produced.
 Doxycycline ( Doxy Must 100 )
17
 Metronidazole ( Flagyl 200 )
 Clindamycin ( Clincin 300 )
 Meloxicam ( Melonex)
 Pantoprozole (Pantanak -40)
 Haematinics (aRBC Rakkt)
3.3.2.3 Blood collection
Blood samples were collected aseptically from all the eighteen animals
in the study group including the animals in healthy group. The samples were
taken from cephalic/saphanus vein on day 0 (pre-treatment), 3 rd, 7th and 14th
day (post-treatment). About 5 ml of venous blood sample was collected from
each animal using dry disposable syringe. Immediately after collection, about
one ml blood was transferred to vaccutainers containing sodium EDTA (@1.5
mg/ml) for complete blood count (CBC). CBC was carried out within four
hours of collection.
The remaining four ml of blood was transferred into a clean and dry
test tube without any anticoagulant and allowed to clot in slanting position for
about one hour and then serum was harvested gently after centrifugation for
10 minutes at 2,000 to 3,000 rpm. The supernatant serum was collected
carefully in a dry eppendorf tubes with the help of micropipette and finally well
labeled sera samples were preserved at -20 0C in a deep freeze for further
biochemical estimation.
3.3.2.3 Monitoring of animal for treatment response:
Monitoring of treatment response in babesiosis in dogs was done on

the basis following parameters:
3.3.2.3.1. Blood smear examination (post-treatment):

Thin blood smear were prepared and stained with standard stains
(Giemsa and Leishman’s stains) and examined under microscope again on
3rd, 7th and 14th day (post-treatment) for presence babesia organisms.
Reduction in the number of infected RBCs and positive changes in DLC were
used as criteria to monitor the efficacy of treatment.
3.3.2.3.2: Haematological studies:
Haematological parameters like Hb, TEC, TLC, DLC, PCV and

thrombocytes were studied as per standard laboratory procedures described
by Jain (1986). Haematological studies were conducted to record the effect of
babesia infection on blood cellular profiles and also for comparing the
therapeutic efficacy of the different treatment.
3.3.2.3.2.1. Haemoglobin (Hb)
Haemoglobin concentrations were estimated by Sahli’s

haemoglobinometer with acid hematin method (Oser, 1976) and results were
expressed in g/dl of blood.
3.3.2.3.2.2. Total Erythrocytic Count (TEC)
Total erythrocytes count was estimated with the help of

haemocytometer (Jain, 1986) using Haeym’s diluting fluid (sodium chloride-
0.5 g, sodium sulphate- 2.5 g, mercuric chloride-0.25 g, distilled water- 100
ml) and results expressed in million per microliter.
3.3.2.3.2.3. Total Leukocytic Count (TLC)
Total leukocytes count were estimated with the help of

haemocytometer (Jain, 1986) using Thomas diluting fluid (glacial acetic acid-
2 ml, gentian violet- 1% aqueous solution) and results expressed in
thousands per microliter.
3.3.2.3.2.4. Differential Leukocytic Count (DLC)
Thin blood smear were made using a drop of fresh blood. The smears
were air-dried, fixed in methanol and stained with Geimsa and Leishman’s
stain (0.2 g Leishman’s powder in 100 ml of acetone free alcohol) and
observed under microscope under oil emersion field (100X). The different
leukocytes were counted by battlefield method and count expressed in
percentage.
19
3.3.2.3.2.5. Packed Cell Volume (PCV)
Packed cell volume was estimated by Wintrobe tube method (Jain,

1986) and result expressed in percentage.
3.3.2.3.2.6. Thrombocytes
Thrombocyte count was estimated with the help of haemocytometer

(Jain, 1986) using platelet diluting fluid and results expressed in ten
thousands per microliter.
3.3.2.3.3: Biochemical parameters
Following biochemical parameters were determined using the serum

obtained from the blood samples:
3.3.2.3.3.1. Alaninie Amino Transferase (ALT)
Serum ALT concentration was determined by 2, 4-DNPH method of

Reitman and Frankel (1957), using a kit from Erba diagnostics. Concentration
of ALT is expressed in IU/l.
3.3.2.3.3.2. Aspartate Amino Transferase (AST)
Serum AST concentration was determined by a modified Reitman

Frankel’s method described by Reitman and Frankel (1957), using the Erba
diagnostics kit. Concentration of AST is expressed in IU/l.
3.3.2.3.3.3. Total Protein
Total protein was estimated by the modified Biuret method as

described by Young (1997), using Erba diagnostics kit and the values are
expressed as gram per decilitre (g/dl).
3.3.2.3.3.4. Serum Albumin

Albumin was estimated according to the method described by Young
(1997), using Erba diagnostics kit and the results are expressed in gram per
decilitre (g/dl).
3.3.2.3.3.5. Serum Globulin
For this purpose the total serum albumin value was subtracted from
the value of total serum protein to get serum globulin in g/dl.
Serum Globulin= Serum Total Protein -Serum albumin
3.3.2.3.3.6. Blood Urea Nitrogen (BUN)
The BUN was estimated by using method described by (Patton and

Crouch, 1977) using reagent kit from Erba diagnostics and the results are
expressed in milligram per decilitre (mg/dl).
3.3.2.3.3.7. Serum Creatinine
Creatinine estimation was done by the method of Bowers (1980) using

a reagent kit obtained from Erba diagnostics and the results are expressed in
milligram per decilitre (mg/dl).
3.4. Statistical analysis:
The data was analysed as per standard method as described by

Snedecor and Cochran (1994).
Table 4: Collaboration with other departments

S.No. Name of Department
1. Veterinary Public Health, College of Veterinary Science and A.H.,
Rewa
2. Veterinary of Microbiology, College of Veterinary Science and A.H.,
Rewa
3. Veterinary Physiology and Biochemistry, College of Veterinary
Science and A.H., Rewa
21
4. RESULTS AND DISCUSSION
Babesiosis is one of the most important tick-transmitted apicomplexan

haemoprotozoan disease that infects a wide range of vertebrate hosts
including wild and domesticated animals and cause severe diseases (Kultler
and Ristic, 1988). In dogs, babesiosis is reported worldwide (Garcia, 2006;
Bastos et al., 2004; Ishibashi et al., 1995) including various parts of India
(Singla et al., 2016; Gonde et al., 2016; Eljadar, 2010; Kumar et al., 2006 and
Harikrishnan et al., 2005).
Examination of symptomatic dogs is of great importance, but
asymptomatic dogs should also be examined. Quick and precise diagnosis
allows prompt and adequate therapy to prevent possible complications. The
present study was undertaken in dogs in and around Rewa district of M.P. to
study the epidemiology, clinic-pathological alterations, comparative sensitivity
of various diagnostic tools in infected dogs along with comparative
therapeutic efficacy of different drugs against canine babesiosis.
4.1 Prevalence of Canine Babesiosis:
Prevalence study was undertaken for six months (From November

2019 to February 2020 and from December 2020 to January 2021). During
the study period, a total of 200 dogs with a history of anorexia and with
symptoms of pyrexia and pale mucous membrane were selected. Dogs with a
history of recent tick infestation were screened for the presence of babesia
parasite on the basis of blood smear examination and PCR assay.
4.1.1 Overall Prevalence:-

The overall prevalence of canine babesiosis is shown in the Table 5
Fig.1.
Table 5: Overall prevalence of canine babesiosis
Time period Dog surveyed Positive dogs Prevalence (%)
Six months 200 54 27%
Out of 200 dogs, 54 dogs were found positive for babesiosis showing
an overall prevalence of 27%. Our findings are in agreement with those of
Cardoso and Serra-Freire (2001) who reported an overall prevalence ranging
from 24%-27%.
Shrivastava et al. (2014), Das and Konar (2013) all reported a lower
prevalence ranging from 4.25 -10.48% while (Samradhni et al., 2005 and
Bastos et al., 2004) reported a higher prevalence of Babesia infection ranging
from 42%-64%.
4.1.2 Prevalence on the basis of blood smear examination and PCR

Assay:
Direct microscopic examination of the stained blood smear is the most
commonly used method as it is conclusive, feasible, and cost effective
diagnostic method for diagnosis of canine babesiosis but the true picture of
prevalence will be clear only by modern diagnostics procedures like PCR.
In the present study, microscopic examination of thin blood smears
stained with Geimsa’s stain revealed lower prevalence of babesiosis as
compared to PCR method (Table 6 and Fig. 2) (Plate:07,08,09).
Table 6: Prevalence on the basis of blood smear examination and PCR

Assay
Dogs with recent tick infestation Total Prevalance(%)
89 tick
infested
dogs
Dogs Positive for Babesia species on blood smear 15 16.85%
Dogs negative forBabesia specieson blood smear but 39 38.46%
positive on PCR
23
Out of the 200 dogs screened for babesiosis, 15 dogs were found
positive by blood smear method (27.77%) and 39 found positive by PCR
method (72.22%).
Our findings corroborate with those of other authors who reported a
low prevalence rate on blood smear as compared to PCR (Rucksaken et al.,
2019; Laha et al., 2014; Irwin et al., 2009 and Bourdoiseau et al., 2006).
Higher prevalence of canine babesiosis as detected by PCR based assays as
compared to microscopy indicates the higher sensitivity levels of PCR.
4.1.3 Area wise prevalence

During the present study, higher prevalence was noticed in dogs of
urban area (37%) than in dogs of rural area (17%) (Table 7 and Fig. 3).
Table 7: Area wise prevalence of canine babesiosis

Total
Dogs found
Area no. of Prevalence (%)
positive
dogs
Rural 17 100 17%
Urban 37 100 37%
TOTAL 54 200 27%
The reason for higher prevalence in urban area may be because the
study area was mostly urban.
4.1.4 Age wise prevalence:

Age wise prevalence of canine babesiosis is shown in Table 8 and Fig.
4. In the present study, maximum prevalence was observed in the age group
of 1-3 years (45.16%) followed by 6-9 years and less than one year (20.75%),
3-6 years (30%). Lowest age wise prevalence was reported in dogs of more
than 9 years of dogs (17.64%).
Table 8: Age wise prevalence of canine babesiosis
No. of
Age group Positive dogs Prevalence (%)
dogs
Less than 1 year 42 11 26.19%
1-3 years 31 14 45.16%
3-6 years 40 12 30%
6-9 years 53 11 20.75%
More than 9 years 34 6 17.64%
Total 200 54 27%
Our findings in the present study are in agreement with those of

several other authors who observed higher prevalence of the disease in
young and middle-aged dogs (Mahalingaiah et al., 2017; Singh et al., 2014;
Rene-Martellet et al., 2013 and Bourdoiseau et al., 2006).
High erythropoetic activity with high erythrocyte count in young age
gives an opportunity for the organism to parasitize more erythrocytes and
multiply rapidly. The immune system in young animals is also in the
developmental stage. Many animals in this age group are exposed to the
infection for the first time and their immune system is unable to recognize and
react against this foreign particle. All these factors may be responsible for
higher incidence of the infection in young age group.
However, many authors reported babesiosis in different age group of
dogs. Therefore it can be opined that the age is not the criteria, but the
infection depends more on the its vector and also on the immune status of the
host.
4.1.5 Breed wise prevalence:

Breeds wise prevalence of canine babesiosis is shown in Table 9 and
Fig. 5. Breeds wise prevalence revealed maximum prevalence in Non-
descript dog (46.80%), followed by German shepherd breed (33.33%),
Labrador breed (21.56%) and Rottweiler breed (12.5%) while, lowest
prevalence was noticed in Shihtzu breed (8.33%).
25
Table 9: Breed wise prevalence of canine babesiosis
No. of
Breed of dogs dogs Positive dogs Prevalence (%)
Labrador 51 11 21.56%
German shepherd 42 14 33.33%
Rottweiler 48 6 12.5%
Shih tzu 12 1 8.33%
Non-descript 47 22 46.80%
TOTAL 200 54 27%
Our results in the present study corroborate with the findings of

Adebayo et al., 2016 and Shrivastava et al., 2014 who reported higher
prevalence in German Shepherd dogs. Ravi et al. (2016), Davitkov et al.
(2015) and Sundar et al. (2004) reported that the disease was more often
diagnosed in purebred dogs while Bourdoiseau (2006) reported no breed
predilection for the infection.
Therefore it can be opined that the disease is not associated with any
particular breed but rather depends on the presence of a particular breed in a
particular area or region.
4.1.6 Sex wise prevalence
Sex wise prevalence of canine babesiosis is presented in Table 10 and
Fig. 6. The present study revealed higher prevalence in females (57%) as
compared to males (43%).
Table 10: Sex wise prevalence of canine babesiosis:
No. of Dogs
Sex Positive dogs Prevalence (%)
Examined
Male 86 24 27.90%
Female 114 30 26.31%
Our results are incongruous with those reported by Shrivastava et al.,
2014; Gonde et al., 2016 and Gadahi et al., 2008 who reported higher
prevalence in males as compared to females while Adebayo et al., 2016;
Singh et al., 2014 and Kumar et al., 2009 reported that both the sexes are
equally affected.
No sex wise predilection for the disease seems to be present as, it
depends purely on the preference of the owners for keeping pets.
4.8: Clinical signs in canine babesiosis
The physical examination of the dogs suffering from babesiosis revealed an
increased rectal temperature (>102 0F) in 88.88% of the cases. An increase in
respiration rate (>10-35/min) was found in 61.11% of the cases. An increase in pulse
rate (>120/min) was found in 72.22% of the cases.
In the present study history and clinical examination of the canine babesiosis
revealed anorexia (66.66%), dehydration (61.11%), lethargy (50.00%), tick
infestation (83.33%), haemoglobinuria (11.11%), vomiting (50.00%), jaundice
(16.66%),mucus membrane discolourationsuch as pale (38.38%), congested
(11.11%), icterus (16.66) were observed in infected dogs as shown in Table
11(Plate:10,11)
Table 11: Clinical symptoms in dogs with Babesia infection
S. No. Parameters No. of animals Positive Percent
animal (n=18) (%)
1 Rectal Temperature (above 1020F) 16 88.88%
2 Respiration( above 10-35 rate/min ) 11 61.11%
3 Pulse ( above 80-120 rate/min) 13 72.22%
4 Anorexia 12 66.66%
5 Dehydration 11 61.11%
6 lethargy 9 50%
7 Presence of ticks 15 83.33%
8 Haemoglobinuria 2 11.11%
9 Vomit 9 50%
10 Jaundice 3 16.66%
11 Mucus membrane discolouration
11.a Light Pink 2 11.11%
11.b Pale 11 61.11%
11.c Congested 2 11.11%
11.d Icterus 3 16.66%
Vial and Gorenflot (2006) and Ettinger and Feldman (2005) reported
most of the above clinical signs in dogs affected with babesiosis. The clinical
findings in the present study agree with those observed by several other
workers who reported elevated temperature, tachycardia and polypnoea,
icterus, lethargy, pale mucous membranes and hemoglobinuria (Roopali et
27
al., 2018; Gonde et al., 2016; Wadhwa et al., 2011; De Gopegui et al., 2007
and Mathe et al.,2006).
In the present study haemoglobinuria was seen only in 02 cases
(11.11%) which corroborates with the finding of Varshney et al. (2008).
Haemoglobinuria is not a prominent finding in babesiosis in canines as is
frequently seen in bovine babesiosis.
The clinical signs observed may be the result of inflammation which
causes marked release of cytokine resulting in pyrexia and associated
symptoms (Lobetti, 2006). Immunological responses play an important role in
the pathogenesis of babesia (Singla et al. 2016). Severe antibody mediated
cytotoxic destruction of erythrocytes together with autoantibodies directed
against components of the cell membranes of infected and uninfected
erythrocytes causes erythrolysis (Aysul et al., 2013) resulting in anaemia,
hypoxia, pale mucous membrane, icterus and haemoglobinuria.
4.2 Therapeutic Trial

Out of the 54 cases of babesia positive of dogs, eighteen dogs were
randomly selected for the therapeutic trial and divided in three treatment
groups (I, II and III). The response to therapy was evaluated on the basis of
improvement in haemato-biochemical parameters and resolution of the
symptoms and was compared with healthy control group dogs.
4.3 Haematological parameters:

4.3.1 Haemoglobin:
The haemoglobin (g/dl) values of different groups are presented in
Table 12 and fig. 7.
The mean haemoglobin value in groups I, II, III and healthy control on
day 0 were 7.98±0.14, 8.43±0.24,8.5±0.35 and 12.65±0.21 g/dl, respectively.
The mean haemoglobin values on day 3 post treatments were 9.75±0.42,
9.97±0.21, 9.72±0.52and 12.92±0.21 g/dl, respectively. The mean
haemoglobin values on 7th day were 10.58±0.38, 10.74±0.12, 10.85±0.49
and 12.77±0.20, respectively. The mean haemoglobin values on 14 thday were
11.98±0.14, 12.02±0.11, 12.22±0.16 and 12.83±0.25, respectively. The mean
haemoglobin values were significantly higher in healthy control group for
whole observation period.
Table 12: Haemoglobin concentrations (g/dl) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 7.98aA±0.14 9.75aB±0.42 10.58aB±0.38 11.98aC±0.14
II 8.43aA±0.24 9.97aB±0.21 10.74aC±0.12 12.02aD±0.11
III 8.5aA±0.35 9.72aB±0.52 10.85aB±0.49 12.22aC±0.16
HC 12.65b±0.21 12.92b±0.21 12.77b±0.20 12.83b±0.25
Means bearing different superscript in each row denoted by capital alphabets and in each column by
small alphabets differ significantly (p<0.05)
In treatment groups I, II and III, the mean haemoglobin values on 0 day

were significantly lowest and increased with time on 3 rd and 7thday. It was
highest on 14thday in all the treatment groups as compared to day 0 but
significant increase in mean haemoglobin values were observed in group II
and IIIas compared to day 3. The values were still statistically significantly low
in all the treatment groups as compared to those of healthy control group on
14thday.
Decrease in Hb levels at 0 day in group I, II and III as compare to
healthy control group and further increase at 3 rd, 7th and 14thday were in
agreement with reports of Yogeshpriya et al., 2018; Gonde et al., 2016;
Nalubamba et al., 2015; Andoni et al., 2013 and Zygner et al., 2007.
4.3.2 Packed Cell Volume (PCV)
The PCV (%) values of different groups are presented in Table 13 and
fig. 8.
The mean PCV value in groups I, II, III and healthy control on day 0
were 34.22±0.88, 34.42±1.06, 35.25±1.25 and 44.50±0.76%, respectively.
The mean PCV values on day 3 post treatment were 37.65±0.51, 38.48±0.77,
38.55±0.44 and 44.50±0.72%, respectively. The mean PCV values on 7 th day
were 40.47±0.43, 40.88±0.52, 41.01±0.43 and 44.83±0.48%, respectively.
The mean PCV values on 14 thday were 43.63±0.57, 43.95±0.26,
29
44.41±0.28and 44.92±0.75%, respectively. The mean PCV value was
significantly higher in healthy control group throughout the experimental
period (14 days).
Table 13: Packed Cell Volume (%) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 34.22aA±0.88 37.65aB±0.51 40.47aC±0.43 43.63D±0.57
II 34.42aA±1.06 38.48aB±0.77 40.88aC±0.52 43.95D±0.26
III 35.25aA±1.25 38.55aB±0.44 41.01aC±0.43 44.41D±0.28
HC 44.50b±0.76 44.50b±0.72 44.83b±0.48 44.92±0.75
In group I the mean PCV value was significantly lowest on 0 day and
significantly increased with time on 3 and 7 th day. It was highest on 14th day.
Similar pattern was observed in group II and III from day 0 to 14 th day. On day
14th,the values in all treatment groups were at par with health control group
and there was no significant difference observed from those of healthy
control group.
Decrease in PCV levels on day 0 (pretreatment) were in agreement
with reports of (Roopali et al., 2018; Jain et al., 2017; Nalubamba et al., 2015;
Reddy et al., 2014; and Fabisiak et al., 2010)
4.3.3 Total erythrocyte count (TEC)
The total erythrocyte count (million/μl) of different groups are
presented in Table 14 and fig. 9 The mean TEC value in groups I, II, III and
healthy control on day 0 were 3.48±0.12, 3.54±0.06, 3.41±0.22 and
5.07±0.11 million/μl, respectively. The mean TEC values on day 3 post
treatment were 3.84±0.07, 3.93±0.05, 4.01±0.19 and 5.07±0.16 million/μl,
respectively. The mean TEC values on 7 th day were 4.50±0.14, 4.61±0.09,
4.67±0.16 and 5.00±0.11 million/μl, respectively. The mean TEC values on
14thday were 5.17±0.07, 5.35±0.12, 5.56±0.16 and 5.07±0.22 million/μl,
respectively. The TEC value was significantly higher in healthy control, for the
whole observation period i.e. from day 0, 3rd and 7th day and 14th day.
Table 14: Total erythrocyte count (million/μl) in different groups
(Mean±SE)
Days
Group
0 3 7 14
I 3.48aA±0.12 3.84aB±0.07 4.50aC±0.14 5.17D±0.07
II 3.54aA±0.06 3.93aB±0.05 4.61abC±0.09 5.35D±0.12
III 3.41aA±0.22 4.01aB±0.19 4.67abC±0.16 5.56D±0.16
HC 5.07b±0.11 5.07b±0.16 5.00b±0.11 5.07±0.22
The TEC value was following the similar pattern as haemoglobin and
PCV and on 14th day, there was no significant difference from healthy control
group. In all treatment groups (l, II, III), the mean TEC value was significantly
lowest on 0 day and the values significantly increased with time on 3 and 7 th
day. It was highest on 14th day post treatment and values were non-significant
when compared to healthy control group.
The results indicated good therapeutic response in group II and III as
the mean TEC concentration were higher as compared to group I on day 7.
Decreased TEC levels were also reported by (Yogeshpriya et al.,
2018; Nalubamba et al., 2015; Reddy et al., 2014; Andoni et al., 2013; Zygner
et al., 2007 and Furlanello et al., 2005)
Decreased haemoglobin, packed cell volume and TEC indicate severe
anaemia. Babesia organism parasitizes erythrocytes which results in
increased erythrophagocytic activity by macrophages. Additionally, oxidative
stress in babesiosis may cause damage to the erythrocyte which results in
their increased susceptibility to phagocytosis.
Parasitaemia results in osmostic fragility (Makinde and Bobade, 1994)
and serum haemolytic factors (Onishi and Suzuki, 1994) which leads to
haemolysis resulting in typical clinical sign of haemolytic anaemia (Jacobson
and Clark, 1994). Immune mediated or non immune mediated destruction of
red blood cells, direct mechanical disruption caused by the parasite as it
31
leaves the red blood cells, along with intravascular hemolysis, all cause
anaemia.
4.3.4 Thrombocyte count (105/µl)
The total thrombocyte count (105/µl) values of different groups are presented
in Table 15 and fig. 10. The mean thrombocyte count value in groups I, II, III and
healthy control on day 0 were 0.58±0.05, 0.61.00±0.04, 0.63±0.03 and 2.23±0.08
(105/µl), respectively. The mean thrombocyte count values on day 3 post treatments
were 0.83±0.07, 0.86±0.02, 0.87±0.05 and 2.23±0.12105/µl, respectively. The mean
thrombocyte count values on 7th day were 1.03±0.07, 1.03±0.04, 1.21±0.16 and
2.13±0.08105/µl, respectively. The mean thrombocyte count values on 14th day were
1.18±0.06, 1.27±0.06, 1.73±0.13 and 2.25±0.08 105/µl, respectively.
Table 15: Thrombocyte count (105/µl) in different groups (Mean±SE)
Days
Group
0 3 7 14
I 0.58aA±0.05 0.83aB±0.07 1.03aC±0.07 1.18aC±0.06
II 0.61.00aA±0.04 0.86aB±0.02 1.03aC±0.04 1.27aD±0.06
III 0.63aA±0.03 0.87aA±0.05 1.21aB±0.16 1.73bC±0.13
HC 2.23b±0.08 2.23b±0.12 2.13b±0.08 2.25c±0.08
Thrombocyte count increased from day 0 to day 14 in all treatment

groups. Significant increase (p<0.05) was observed on day 3 in group I and II
but in group III no significant change was seen. On day 7 th, there was a
significant increase in the values in all treatment groups which continued till
14th day. No significant change was observed in group I as compared to day
7th. Highest rise in thrombocyte count were observed in group III on day 14 as
compared to group I and II, but the value were significantly low as compared
to healthy control group. The findings revealed good therapeutic response in
group III as the mean thrombocyte concentration elevated sooner as
compared to other treatments groups.
Decreased platelet counts in babesiosis were in agreement with (Jain
et al., 2017; Gonde et al., 2016; Matijatko et al., 2009; Zygner et al., 2007 and
Furlanello et al., 2005)
Thrombocytopenia is common, especially in dogs infected with B.
gibsoni. Taboada and Lobetti, 2006 opined that elevated body temperature
could have contributory effect on thrombocytopenia.
During the infection, thrombocytopenia results due to platelet
sequestration in the spleen or immune mediated platelet destruction or
coagulatory consumption of platelets from hemolytic or vascular injury which
results in development of disseminated intravascular coagulation (Boozer and
Macintire, 2003).
4.3.5 Total Leucocyte count (Thousand/μl)
The total leucocyte count (Thousand/μl) values of different groups are
presented in Table 16 and fig. 11.
The mean total leucocyte count value in groups I, II, III and healthy
control on day 0 were 8.74±0.38, 8.73±0.44, 8.33±0.13 and 4.82±0.10
Thousand/μl, respectively. The mean total leucocyte count values on day 3
post treatment were 7.88±0.63, 7.38±0.42, 6.87±0.27 and 4.76±0.04
Thousand/μl, respectively. The mean total leucocyte count values on 7 th day
were 7.43±0.65, 5.65±0.29, 5.53±0.16 and 4.83±0.10
Thousand/μl,respectively. The mean total leucocyte count values on 14 thday
were 6.00±0.47, 4.48±0.14, 4.13±0.18and 4.82±0.12 Thousand/μl,
respectively. The mean leucocyte count was significantly lower (p<0.05) in
healthy control, for 0, 3rd and 7thand 14thday.
Table 16: Total Leucocyte count (Thousand/μl ) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 8.74bB±0.38 7.88bB±0.63 7.43bAB±0.65 6.00bA±0.47
II 8.73bD±0.44 7.38bC±0.42 5.65aB±0.29 4.48aA±0.14
III 8.33bD±0.13 6.87bC±0.27 5.53aB±0.16 4.13aA±0.18
HC 4.82a±0.10 4.76a±0.04 4.83a±0.10 4.82a±0.12
33
Within treatment groups, the mean leucocyte count values in group
Iwere higher on day 0 with statistically non-significant values till day 7 after
which there was significant decrease on day 14.In group II and III, the values
were highest on day 0 which continued to decrease till day 14.
Between the groups, the values on day 0 and 3 rdday were statistically
non-significant among group I, II and III but significant difference was seen
when compared to healthy control group. On day 7 th, the values in group II
and III were lower and statistically non-significant when compared to healthy
control group, however in group I the values were significantly high. Better
therapeutic response was reported in group III as the mean leucocyte
concentration decreased sooner compared to other treatments groups.
Similar findings of significant leukocytosis in dogs with babesiosis were
reported by (Reddy et al., 2014 and Wadhwa et al., 2011). However, Bilwal et
al. (2017) reported non-significant changes in leukocyte count in dogs
suffering with babesiosis.
4.3.6 Neutrophils count

The Neutrophils count (%) values of different groups are presented in
Table 17 and fig. 12 The mean neutrophils value in groups I, II, III and healthy
control on day 0 were 58.67±1.05, 59.83±1.08, 60.83±0.48 and 69.67±0.49%,
respectively. The mean neutrophils value on day 3 post treatment was
61.17±0.95, 64.83±0.83, 65.17±0.60 and 69.83±0.48%, respectively. The
mean neutrophils value on 7th day was 64.67±0.92, 66.33±0.95, 68.17±0.98
and 70.00±0.58%, respectively. The mean neutrophils value on 14 thday was
67.33±0.76, 68.50±0.43, 69.67±0.61 and 70.00±0.37%, respectively. The
mean neutrophils count was significantly higher (p<0.05) in healthy control
throughout the study period.
Table 17: Neutrophils (%) in different groups (Mean±SE)
Days
Group
0 3 7 14
I 58.67aA±1.05 61.17aA±0.95 64.67aB±0.92 67.33aB±0.76
II 59.83aA±1.08 64.83bB±0.83 66.33abBC±0.95 68.50abC±0.43
III 60.83aA±0.48 65.17bB±0.60 68.17bcC±0.98 69.67bC±0.61
HC 69.67b±0.49 69.83c±0.48 70.00c±0.58 70.00b±0.37
Among treatment groups, lowest neutrophil count was observed in all

groups on day 0. The values on 3 rdday increased significantly (p<0.05)in
group II and III compared to days 0 but in group I no significant change was
observed. On 7th day the mean neutrophil count was significantly higher in all
the treatment groups. On day 14th significant increase in group II was
observed but no significant change was observed in group I and III. The
values in group II and III were significantly higher as compared to those in
group I on day 14.
When compared between treatments, the mean neutrophil count was
significantly higher in group II and III as compared to group I on day 3. On
day 7 the mean neutrophil count show significant increases in group III
followed by group II and then I. On day 14 the values in group III were
significant higher but at par with healthy control. The values in group II were
less than those in group III but higher than those in group I. Good therapeutic
response in group III as compared to other groups is evident from the results,
as mean neutrophil count returned to normal levels in this group.
Neutropenia in canine babesiosis is in agreement with (Vishnurahav et
al.,2014; Fabisiak et al., 2010; Zygner et al., 2007; Furlanello et al., 2005 and
Meinkoth et al., 2002). However, Bilwal et al. (2017) and Gonde et al. (2016)
reported significant neutrophilia in dogs with babesiosis than healthy dogs.
4.3.7 Lymphocyte count
The Lymphocyte count (%) values of different groups are presented in
Table 18 and fig. 13. The mean lymphocyte value in groups I, II, III and
26.67±0.56%, respectively. The mean lymphocyte values on day 3 post
treatment were 31.67±1.02, 29.33±0.80, 29.33±0.49 and 26.33±0.33%,
respectively. The mean lymphocyte values on 7 th day were 30.33±1.09,
35
29.50±0.96, 28.00±0.82 and 26.50±0.43%, respectively. The mean
lymphocyte values on 14thday were 28.67±0.99, 28.33±0.71, 26.33±0.61 and
26.17±0.31%, respectively. The mean lymphocyte count was significantly low
(p<0.05) in healthy control for 0, 3rd, 7thand 14thday.
Table 18: Lymphocyte (%) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 33.06bB±1.46 31.67cAB±1.02 30.33bAB±1.09 28.67bA±0.99
II 32.00bB±1.13 29.33bAB±0.80 29.50bAB±0.96 28.33abA±0.71
III 31.33bC±0.42 29.33bB±0.49 28.00abAB±0.82 26.33aA±0.61
HC 26.67a±0.56 26.33a±0.33 26.50a±0.43 26.17a±0.31
Within treatment groups, in group I and II, the values were higher on
day 0 which did not show any significant change till day 7 but showed
significant decrease on day 14. In group III, the values were higher on day 0
which decreased on day3 but showed no significant change on day 7 th and
later decreased on day 14th.
Between the groups, the values were statistically non-significant on 0
day in group I, II and III but significantly higher than health control group. On
day 3 the values in group I were significantly higher as compared to those of
group II and III. On day 7, the values were significantly lower in group III as
compared to those of group I and II. On day 14 th the values in group III were
significantly lowest as compared to group II and III and non-significant with
health control group.
The statistical data revealed good therapeutic response in group III as
the mean lymphocyte concentration decreased sooner as compared to other
treatments groups. Our findings of lymphocytosis in canine babesiosis were
in agreement with Reddy et al., 2014 and Andoni et al., 2013).
4.3.8 Monocyte count

The mean monocyte count (%) values of different groups are
presented in Table 19 and fig. 14 The mean Monocyte value in groups I, II, III
and healthy control on day 0 were 3.28±0.47, 3.00±0.37, 2.50±0.22 and
1.83±0.31%, respectively. The mean Monocyte values on day 3 post
respectively. The mean Monocyte values on 7th day were 1.83±0.17,
1.83±0.17, 1.67±0.21 and 2.00±0.26%, respectively. The mean Monocyte
values on 14thday were 1.67±0.21, 1.67±0.21, 2.00±0.00 and 1.83±0.31%,
respectively. The mean monocyte count was significantly lower (p<0.05) in
healthy control group throughout the observation period.
37
Table 19: Monocyte (%) in different groups (Mean±SE)
Days
Group
0 3 7 14
I 5.00bB±0.37 4.50cB±0.22 3.17bA±0.31 2.33bA±0.21
II 5.17bD±0.17 3.33bC±0.21 2.33bB±0.33 1.50aA±0.22
III 5.33bC±0.21 3.50bB±0.22 2.17bA±0.17 2.00bA±0.00
HC 1.83a±0.17 1.83a±0.17 1.67a±0.21 2.00b±0.00
Within treatment groups, significantly higher mean monocyte count

was observed in group I on day 0 and 3 rd day but the values decreased on 7 th
and 14th day. The mean monocyte count in group II was highest on day0 and
continuously decreased from 3rdday onwards till 14th day. In group III, mean
monocyte count was highest on day 0and continuously decreased till day
7thbut no significant change was observed thereafter till 14 thday.
Between the treatment groups, the values were higher in all the groups
as compared to healthy control group on day 0. On day 3, the values in group
I was significantly high in group I followed by group II and III which were at
par but still higher as compared to healthy control group. On day 7, the values
in all thegroupswere comparable but significantly higher than healthy control
group. On day 14, there was no significant difference among healthy control
and group I and III, however the values in group II showed significant lower
values. The results revealed good therapeutic response in group III as the
mean monocyte count decreased sooner as compared to other treatments
groups.
In conformity with our results, (Reddy et al., 2014) also reported
significant monocytes changes in dogs with babesiosis.
4.3.9 Eosinophils count

The mean eosinophil count (%)of different groups are presented in
Table 20 and fig. 15. The mean eosinophil values in groups I, II, III and
1.83±0.31%, respectively. The mean eosinophil values on day 3 post
respectively. The mean eosinophil values on 7 th day were 1.83±0.17,
1.83±0.17, 1.67±0.21 and 2.00±0.26%, respectively. The mean eosinophil
values on 14thday were 1.67±0.21, 1.67±0.21, 2.00±0.00 and 1.83±0.31%,
respectively. The mean eosinophil count was significantly lower (p<0.05) in
healthy control group throughout the study period.
Table 20: Eosinophils (%) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 3.28bC±0.47 2.67BC±0.33 1.83AB±0.17 1.67A±0.21
II 3.00bB±0.37 2.50AB±0.34 1.83A±0.17 1.67A±0.21
III 2.50abB±0.22 2.00AB±0.26 1.67A±0.21 2.00AB±0.00
HC 1.83a±0.31 2.00±0.26 2.00±0.26 1.83±0.31
Means bearing different superscript in each row denoted by capital alphabets and in each
column by small alphabets differ significantly (p<0.05)
Among the treatment groups, the mean eosinophil count on day 0 was
significantly higher (p<0.05)in group I as compared to group II and III. The
trend continued till day 3 in all the treatment groups. On day 7, there was
significant reduction in the values in all the treatment groups but the values in
group I were still higher than those in group II and III. On day 14 th, the mean
values in group I decreased significantly but increased in group III. However
in group II there was no significant change observed.
Between the treatment groups, the values were significantly higher on
day 0 in all the groups with highest values in group II and III as compared to
group I. There were no significant changes between treatment groups on day
3, 7 and 14 but the values decreased steadily till day 14 indicating steady
improvement in all the groups. Though the eosinophil count was higher in all
the groups but was within the normal range.
39
4.4 Biochemical parameters:
4.4.1 Aspartate Aminotransferase (AST)
The AST (U/l) values of different groups are presented in Table 21 and
fig. 16. The mean AST value in groups I, II, III and healthy control on day 0
were 56.87±3.14, 51.64±2.03, 54.50±1.74 and 29.23±1.24 U/l, respectively.
The mean AST values on day 3 post treatment were 47.15±1.84, 46.44±1.94,
39.87±1.72 and 27.36±1.13 U/l, respectively. The mean AST values on 7 th
day were 45.16±1.39, 41.95±2.26, 32.10±1.12 and 28.13±1.32 U/l,
respectively. The mean AST values on 14 thday were 34.31±1.40, 28.21±1.87,
21.72±0.48 and 28.82±1.20 U/l, respectively. The mean AST value was
significantly low (p<0.05)in healthy control, for 0, 3rd and 7th and 14th day.
Table 21: AST (U/l) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 56.87bC±3.14 47.15cB±1.84 45.16bB±1.39 34.31cA±1.40
II 51.64bC±2.03 46.44cBC±1.94 41.95bB±2.26 28.21bA±1.87
III 54.50bD±1.74 39.87bC±1.72 32.10aB±1.12 21.72aA±0.48
HC 29.23a±1.24 27.36a±1.13 28.13a±1.32 28.82b±1.20
Within groups, the values in group I was significantly high on day 0,

which decreased on day 3 but there was no significant difference on day 7.
However, the values reduced significantly on day 14. In group II, the value
was significantly high on day 0 and statistically no change was observed on
day 3 but significant reduction in values were observed from day 7 till day 14.
In group III, the value was significantly high on day 0, which continued to
decrease significantly till day 14.
Between groups, the values were high and statistically non-significant
difference was observed among group I, II and III but when compared to
healthy control group, the values were significantly high. On day 3, the values
were significantly high in group I and II as compared to group III, but the
values in all the groups were significantly high as compared to healthy control
group. On day 7, the values in group I and II were significantly higher than
group III which was statistically on significant with healthy control group. At
14thday the mean AST value was significantly lowest in group III than healthy
control and group II values which were statistically similar and highest value
being recorded in group I.
The statistical data revealed good therapeutic response in III group as
the mean AST concentration decreased sooner as compared to other
treatments groups.
4.4.2 Alanine Aminotransferase (ALT)

The ALT (U/l) values of different groups are presented in Table 22 and
fig. 17. The mean ALT value in groups I, II, III and healthy control on day 0
were 75.94±4.00, 75.12±3.88, 74.05±1.62 and 30.39±0.19 U/l, respectively.
The mean ALT values on day 3 post treatment were 73.95±3.55, 73.78±3.84,
63.11±1.81 and 30.32±0.17 U/l, respectively. The mean ALT values on 7 th
day were 68.36±2.78, 64.07±3.34, 53.82±1.54 and 30.25±0.19 U/l,
respectively. The mean ALT values on 14 thday were 35.87±2.79, 32.28±2.28,
30.62±1.53, 30.05±0.07 U/l, respectively. The mean ALT value was
significantly low (p<0.05)in healthy control, for 0, 3rd and 7th and 14th day.
41
Table 22: ALT(U/l) in different groups (Mean±SE)
Days
Group
0 3 7 14
I 75.94bB±4.00 73.95cB±3.55 68.36cB±2.78 35.87A±2.79
II 75.12bC±3.88 73.78cBC±3.84 64.07cB±3.34 32.28A±2.28
III 74.05bD±1.62 63.11bC±1.81 53.82bB±1.54 30.62A±1.53
HC 30.39a±0.19 30.32a±0.17 30.25a±0.19 30.05±0.07
Within groups, mean ALT value was high on day 0 which did not
change significantly till day 7 after which there was significant reduction in the
values seen. In group II, the values were high on day 0 however the values
decreased on day 3 and 7 were comparable but on day 14 there was
significant reduction in the mean ALT value. In group III, the values showed a
significantly decreasing trend from day 0 till day 14.
Between groups, the values were significantly higher in all the groups
as compared to healthy controlgroup. On day 3 and 7, the values were
significantly higher ingroup I and II as compared to group III but the values in
all the groups were significantly high as compared to healthy controlgroup.
On day 14 there was a non-significant difference observed in all the treatment
groups including healthy controlgroup.The statistical data revealed good
therapeutic response in III group as the mean ALT concentration decreased
sooner as compared to other treatments groups.
The levels of aspartate aminotransferase and alanine transaminase
were significantly higher in the affected animals which are in accordance with
the observations of (Crnogaj et al., 2010; Rafaj et al., 2007 and Vercammen
et al., 1997).
This change may be attributed to the hemolysis and cellular damage to
the hepatic cells. Increased activities of AST and ALT were due to escape of
these enzymes from the damaged hepatic parenchymal cells with necrosis or
altered membrane permeability indicating hepatic dysfunction.
4.4.3 Total Bilirubin (mg/dl)
The Total Bilirubin (mg/dl) values of different groups are presented in
table 23 and fig. 18. The mean Total Bilirubin value in groups I, II, III and
0.53±0.03mg/dl, respectively. The mean Total Bilirubin values on day 3 post
treatment were 1.13±0.01, 1.01±0.02, 0.99±0.03 and 0.52±0.01mg/dl,
respectively. The mean Total Bilirubin values on 7 th day were 0.83±0.03,
0.74±0.02, 0.73±0.03 and 0.52±0.01 mg/dl, respectively. The mean Total
Bilirubin values on 14thday were 0.53±0.01, 0.49±0.02, 0.45±0.02 and
0.51±0.01mg/dl, respectively. The mean total bilirubin value was significantly
lower (p<0.05)in healthy control, for 0, 3rd and 7th and 14th day.
Table 23: Total Bilirubin (mg/dl)in different groups (Mean±SE)
Days
Group
0 3 7 14
I 1.27bD±0.02 1.13cC±0.01 0.83cB±0.03 0.53bA±0.01
II 1.27bD±0.02 1.01bC±0.02 0.74bB±0.02 0.49abA±0.02
III 1.29bD±0.03 0.99bC±0.03 0.73bB±0.03 0.45aA±0.02
HC 0.53a±0.03 0.52a±0.01 0.52a±0.01 0.51b±0.01
Within groups, significantly higher values were observed statistically

from day 0 and the values showed a decreasing trend in all the treatment
groups till day 14.
Between groups, there was non-significant difference observed
between group I, II and III on day 0, however there was significant difference
when compared with the healthy control group. On day 3, and 7 there was
significant difference seen between group I with higher values as compared
to group II and III where the values were statistically non-significant; however
statistically significant difference was observed among all the treatment
groups when compared to healthy control group. On day 14 th, the values in
43
group I and healthy control showed non-significant variation as compared to
group II and III where the values were comparable and lower.
Crnogaj et al. (2010), Matijatko et al. (2009), Rafaj et al. (2007) and
Furlanello et al. (2005), and also recorded similar findings of increased total
bilirubin values.
4.4.4 Bilirubin Direct (mg/dl)

The bilirubin (direct) (mg/dl) values of different groups are presented in
table 24 and fig. 19. The mean bilirubin (direct) value in groups I, II, III and
0.29±0.01mg/dl, respectively. The mean bilirubin (direct) values on day 3
post-treatment were 0.58±0.02, 0.48±0.06, 0.50±0.02 and 0.29±0.01mg/dl,
respectively. The mean bilirubin (direct) values on 7 th day were 0.44±0.02,
0.37±0.04, 0.37±0.02 and 0.27±0.01 mg/dl, respectively. The mean bilirubin
(direct) values on 14thday were 0.28±0.02, 0.25±0.04, 0.24±0.02 and
0.27±0.00mg/dl, respectively.
Table 24: Bilirubin Direct (mg/dl)in different groups (Mean±SE)

Days
Group
0 3 7 14
I 0.66bD±0.03 0.58bC±0.02 0.44bB±0.02 0.28A±0.02
II 0.65bC±0.02 0.48bB±0.06 0.37bAB±0.04 0.25A±0.04
III 0.67bD±0.03 0.50bC±0.02 0.37bB±0.02 0.24A±0.02
HC 0.29a±0.01 0.29a±0.01 0.27a±0.01 0.27±0.00
The mean bilirubin (direct) value was significantly lower (p<0.05) in
healthy control, for 0, 3rd and 7th day as compare to group I, II and III.
Within treatment groups, in group I and II, there were significantly
higher mean values (p<0.05) of bilirubin (direct) observed on day 0 and the
values continued to decrease till day 14. In group III, the values showed a
continues decreasing trend from day 0 to day 14.
Between groups, there was no significant difference in group I, II and
III on day 0, 3 and 7 however, the values were significantly higher when
compared to healthy control group on these days. On day 14 th, there was no
statistically significant difference observed among groups including healthy
control group.
4.4.5 Bilirubin indirect (mg/dl)
The bilirubin indirect (mg/dl) values of different groups are presented in
Table 25 and fig. 20. The mean bilirubin indirect value in groups I, II, III and
0.24±0.01mg/dl, respectively. The mean bilirubin indirect values on day 3
post treatment were 0.55±0.01, 0.53±0.05, 0.49±0.02 and 0.23±0.01mg/dl,
respectively. The mean bilirubin indirect values on 7 th day were 0.39±0.02,
0.37±0.04, 0.36±0.02 and 0.24±0.01 mg/dl, respectively. The mean bilirubin
indirect values on 14thday were 0.25±0.01, 0.25±0.02, 0.21±0.02 and
0.24±0.01 mg/dl, respectively. The mean bilirubin indirect value was
significantly lower (p<0.05) in healthy control, for 0, 3rd and 7thand 14thday.
Table 25: Bilirubin indirect (mg/dl)in different groups (Mean±SE)
Days
Group
0 3 7 14
I 0.61bD±0.02 0.55bC±0.01 0.39bB±0.02 0.25A±0.01
II 0.61bC±0.03 0.53bC±0.05 0.37bB±0.04 0.25A±0.02
III 0.62bD±0.04 0.49bC±0.02 0.36bB±0.02 0.21A±0.02
HC 0.24a±0.01 0.23a±0.01 0.24a±0.01 0.24±0.01
Within groups, the values in all groups were significantly high on day 0.
The values in group I and IIIcontinued to decrease till day 14. In group II there
was no significant change seen till day 3 after which there was significant
reduction in the mean values till day 14th.
Between treatment groups, there was no statistically significant change
observed among treatment groups on day 0, 3 and 7, however there was
statistically significant increase seen when compared to healthy control
45
group. On day 14th, there was non-significant difference between treatment
group and healthy control group.
Crnogaj et al. (2010), Matijatko et al. (2009), Rafaj et al. (2007)
Furlanello et al. (2005) and Hossain et al. ( 2003) also recorded similar
findings of hyperbilirubinaemia.
Hyperbilirubinaemia in canine babesiosis resulted from both
intravascular and extravascular haemolysis.Increase in total bilirubin may be
due to disruption of erythrocytes and damage to hepatic and spleenic cells.
4.4.6 Total Protein (g/dl)
The Total Protein (g/dl) values of different groups are presented in
table 26 and fig. 21. The mean Total Protein value in groups I, II, III and
6.78±0.22g/dl, respectively. The mean Total Protein values on day 3 post
treatment were 5.98±0.05, 5.99±0.13, 6.02±0.02 and 6.75±0.18g/dl,
respectively. The mean Total Protein values on 7 th day were 6.01±0.05,
6.18±0.05, 6.27±0.03 and 6.70±0.24 g/dl, respectively. The mean Total
Protein values on 14thday were 6.16±0.04, 6.24±0.04, 6.37±0.02 and
6.90±0.22 g/dl, respectively. The mean Total Protein value was significantly
high(p<0.05)in healthy control, for 0, 3rd and 7th and 14th day.
Table 26: Total Protein (g/dl) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 5.84aA±0.05 5.98aAB±0.05 6.01aB±0.05 6.16aC±0.04
II 5.75aA±0.04 5.99aB±0.13 6.18aBC±0.05 6.24aC±0.04
III 5.78aA±0.03 6.02aB±0.02 6.27aC±0.03 6.37aD±0.02
HC 6.78b±0.22 6.75b±0.18 6.70b±0.24 6.90b±0.22
Within groups, the mean total protein value was significantly low on
day 0 n the values with only mild increase on day 3 were comparable to those
on day 0. The values showed an increasing trend from day 7 onwards till day
14. In groupII, the values increased from day 0 to day 3. The values on day 7
were comparable to those on day 3 however the values increased till day 14.
In group III, the values showed a gradual increasing trend from day 0 to day
14.
Between groups, non-significant change was seen among group I, II
and III throughout the experimental period, however significant variation was
seen when compared to healthy control group where the values were high.
The statistical data revealed good therapeutic response in III group as
the mean total protein concentration elevated sooner as compared to other
treatments groups.
4.4.7 Albumin (g/dl)
The Albumin (g/dl) values of different groups are presented in Table 27
and fig. 22. The mean albumin value in groups I, II, III and healthy control on
day 0 were 2.02±0.01, 1.76±0.01, 2.44±0.03 and 4.83±0.07g/dl, respectively.
The mean albumin values on day 3 post-treatment were 2.40±0.05,
2.60±0.04, 3.23±0.02 and 4.90±0.06g/dl, respectively. The mean albumin
values on 7th day were 4.10±0.04, 4.03±0.03, 4.55±0.04 and 4.72±0.05g/dl
respectively. The mean albumin values on 14 thday were 4.46±0.04,
4.81±0.03, 4.85±0.03 and 4.92±0.04 g/dl, respectively. The mean albumin
value was significantly higher (p<0.05)in healthy control, for 0, 3rd and 7th and
14th day.
Table 27: Albumin (g/dl) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 2.02bA±0.01 2.40aB±0.05 4.10aC±0.04 4.46aD±0.04
II 1.76aA±0.01 2.60bB±0.04 4.03aC±0.03 4.81bD±0.03
III 2.44cA±0.03 3.23cB±0.02 4.55bC±0.04 4.85bD±0.03
HC 4.83dAB±0.07 4.90dB±0.06 4.72cA±0.05 4.92bB±0.04
47
Within treatments, in group I, II and III the mean albumin values were
significantly low on day 0 which continued to increase gradually till day 14.
Between treatments groups, on 0 day, the value in group II was significantly
lowest followed by the values in group I and then group III when compared with the
values in healthy control group which had highest value on day 0. On day 3
significantly lowest value was recorded in group I followed by group II and then
group III which had highest value on day 3. On day 7, the values in group I and II
showed non-significant change as compared to group III; however the values in
healthy control group were significantly highest on day 7. On day 14, the values in
group II and III were significantly non-significant when compared to healthy control
group but in group one the values were significantly low.
The statistical data revealed good therapeutic response in III group as the
mean albumin concentration elevated sooner as compared to other treatments
groups.
4.4.8 Globulin (g/dl)
The globulin (g/dl) values of different groups are presented in Table 28 and
fig. 23. The mean globulin value in groups I, II, III and healthy control on day 0 were
3.82±0.04, 3.99±0.04, 3.34±0.05 and 1.95±0.16g/dl, respectively. The mean globulin
values on day 3 post-treatment were 3.58±0.04, 3.39±0.13, 2.79±0.03 and
1.85±0.16g/dl, respectively. The mean globulin values on 7th day were 1.91±0.08,
2.15±0.07, 1.72±0.05 and 1.98±0.24 g/dl, respectively. The mean globulin values on
14thday were 1.70±0.04, 1.43±0.05, 1.52±0.05 and 1.98±0.25 g/dl, respectively. The
mean globulin value was significantly low (p<0.05) in healthy control, for 0, 3rd and 7th
and 14th day.
Table 28: Globulin (g/dl) in different groups (Mean±SE)

Days
Group
0 3 7 14
I 3.82cD±0.04 3.58cC±0.04 1.91aB±0.08 1.70abA±0.04
II 3.99cD±0.04 3.39cC±0.13 2.15aB±0.07 1.43aA±0.05
III 3.34bD±0.05 2.79bC±0.03 1.72aB±0.05 1.52aA±0.05
HC 1.95a±0.16 1.85a±0.16 1.98 a±0.24 1.98b±0.25
Within groups, globulin value in group I, II and III there was
significantly high on day 0 which showed significant decrease gradually till
day 14.
Between treatment on day 0 and 3, the values were significantly high
in group I and II as compared to group III and healthy control the values in
healthy control group being significantly lowest. On day 7, the values in all the
groups were statistically non-significant including healthy control group
however on day 14 the healthy control group showed significantly higher
values as compared to treatment groups I,II and III.
Our finding are in accordance with Konto et al. (2014), who reported
decreased levels of total protein associated with anorexia, mal absorption,
hepatopathy and blood loss. However, Camacho et al., 2005 and Hossain et
al., 2003 reported increased levels of total plasma protein in babesiosis.
The decrease in the concentration of total protein and albumin in the
affected animals is the result of an increased intravascular hemolysis of red
blood cells. This decreases the onchotic pressure and fluid starts to
accumulating in the tissue spaces. On the other hand, the liver cannot
synthesize these plasma proteins without certain amino acids which can only
be achieved by dietary intake. With anorexia and mal-absorption, there is
insufficient intake of these amino acids resulting to malnutrition. Parasites
may also create malnutrition in canines resulting to emaciation.
On the other hand, an increase in globulin concentration suggests
imflammation and hepatic affection. Increase in globulin also suggests an
immune response to the parasite and also development of antibodies.
4.4.9 Blood Urea Nitrogen (BUN)
The BUN (mg/dl) values of different groups are presented in Table 29
and fig. 24. The mean BUN value in groups I, II, III and healthy control on day
0 were 45.68±1.34, 43.07±1.66, 39.62±1.54 and 15.98±0.93mg/dl,
respectively. The mean BUN values on day 3 post treatment were
20.56±0.63, 20.17±0.72, 20.00±0.71 and 15.78±0.90mg/dl, respectively. The
mean BUN values on 7th day were 19.17±0.44, 18.64±0.48, 18.43±0.46 and
49
15.66±0.93 mg/dl, respectively. The mean BUN values on 14 thday were
14.75±0.40, 13.63±0.55, 13.55±0.06 and 15.20±0.91 mg/dl, respectively. The
mean BUN value was significantly lower (p<0.05)in healthy control, for 0, 3 rd
and 7th and 14th day.
Table 29: BUN (mg/dl)in different groups (Mean±SE)
Days
Group
0 3 7 14
I 45.68cC±1.34 20.56bB±0.63 19.17bB±0.44 14.75A±0.40
II 43.07bcC±1.66 20.17bB±0.72 18.64bB±0.48 13.63A±0.55
III 39.62bC±1.54 20.00bB±0.71 18.43bB±0.46 13.55A±0.06
HC 15.98a±0.93 15.78a±0.90 15.66a±0.93 15.20±0.91
Within treatment groups, the values in group I, II and III decreased

significantly from day 0 to day 3 but no significant change was seen till day 7
after which the values reduced significantly till day 14.
Between groups, significantly higher values were seen on day 0 in
group I as compared to those in group II and III where the values were
comparable; however the values in all treatment groups were significantly
higher than healthy control group on day 0. On day 3 and 7, the values
between treatment groups I,II and III were statistically non significant but
statistically significant as compared to healthy control group. On day 14 there
was statistically non-significant variation seen among all the treatment groups
including healthy control group.
4.4.10 Creatinine (mg/dl)

The creatinine (mg/dl) values of different groups are presented in
Table 30 and fig. 25. The mean creatinine value in groups I, II, III and healthy
control on day 0 were 3.17±0.29, 3.12±0.15, 2.97±0.24 and 0.44±0.02mg/dl,
respectively. The mean creatinine values on day 3 post treatments were
mean creatinine values on 7th day were 1.03±0.14, 0.55±0.02, 0.52±0.01 and
0.45±0.02 mg/dl, respectively. The mean creatinine values on 14 thday were
mean creatinine value was significantly lower (p<0.05)in healthy control, for 0,
3rd and 7th and 14th day.
Table 30: Creatinine (mg/dl)in different groups (Mean±SE)

Days
Group
0 3 7 14
I 3.17bC±0.29 1.88cB±0.23 1.03bA±0.14 0.79bA±0.10
II 3.12bC±0.15 0.94bB±0.01 0.55aA±0.02 0.42aA±0.01
III 2.97bC±0.24 0.92bB±0.01 0.52aA±0.01 0.40aA±0.01
HC 0.44a±0.02 0.44a±0.02 0.45a±0.02 0.43a±0.01
Within groups, the mean creatinine value in group I was significantly

higher on day 0 which continued to decrease till day 7 after which no
significant change was observed. Similar trend was seen in group II and III.
Between treatment groups, non-significant difference was observed on
day 0 among group I, II and III but the values were significantly high as
compared to healthy control group. On day 3 the values in group I were
significantly high as compared to group II and III which showed non-
significant difference; however the values in all the treatment groups were
significantly high as compared to healthy control group. On day 7 the values
in group I were significantly high as compared to group II and III where the
values were significantly non significant when compared to healthy control
group.
There was a significant increase in the blood urea nitrogen and
creatinine in the affected animals. Crnogaj et al. (2010), also reported
elevated blood urea nitrogen and creatinine level in the affected animals. An
elevated serum urea and creatinine is an reliable indicator of renal
insufficiency in animals with babesiosis related to catabolism of lysed
erythrocytes
51
Increased BUN concentration in the present study corroborates with
findings of (Reddy et al., 2014). The increased BUN level in canine
babesiosis may be due to reduced glomerular filteration rate (Centos, 1994).
Increased protein catabolism and urea production, resulting from
gastrointestinal hemorrhage or protein catabolism due to febrile inflammatory
illness may be the reason (Lobetti and Jacobson, 2001). De Scally et al.
(2006) found that urea concentration in canine babesiosis is as double as the
normal value. The increase in urea resulted from ammonia loading which
occurs in canine babesiosis as a result of hemolysis and gastrointestinal
hemorrhage which can lead to non-related increase in urea level (Reyers,
1992).
4.5 Evaluation of comparative therapeutic efficacy of different anti-

babesial drugs in babesiosis in dogs:
Efficacy of the therapeutic agent was evaluated on the basis of time
duration of recovery period, percentage of reduction in the clinical symptoms
and improvement in the haemogram values. Based on these parameters a
rough score card for evaluation was prepared as follows:
Negative ( - ) = No change
Positive (+) = Fair Improvement
Positive (++)=Mild Improvement
Positive (+++)= Moderate Improvement
Positive (++++) = Good Improvement
Group I- Allopathy (Doxycycline+Clindamycin+Metronidazole) (n=6)

In this group, all the affected dogs were treated for 14 day once daily
with a combination of clindamycin@ 25 mg/Kg bwt, PO +Doxycycline @
10mg/Kg bwt PO +Metronidazole @11 mg/Kg bwt. PO for 14 day The
combination of these three drugs was used for their synergistic effect as they
could be less toxic and economical (Table 31). The combination proved
effective in resolution of the clinical symptoms and there was a marked
increase in the haemogram and thrombocyte count and decrease in the
parasitaemia.
Table 31: Degree of improvement in clinical parameters in animal at
different intervals in Group I
NO. Day 0 Day 3 Day 7 Day 14
1 - ---- +- - - ++-- +++-
2 - --- - --- +--- ++--
3 - --- ++-- +++- + +++
4 - --- - --- ++ -- +++-
5 - --- - ++- +++ - +++-
6 - --- +- - - ++-- ++++
Clinical improvement was noticed on 7 day post-treatment and on 14

day post-treatment all dogs showed complete clinical recovery. Hematological
parameter showed gradual increase in Hb, TEC, PCV, and platelets count
post treatment and on day 14 post treatment, all the parameters returned to
the normal range but towards the lower limit in the reference range as
compared to healthy control.
Suzuki et al. (2007), used Clindamycin@25 mg/Kg bwt, PO

+Doxycycline@ 5mg/Kg bwt. PO +Metronidazole @15 mg/Kg bwt.PO. They
reported successful treatment of babesia infection in dog as shown by
marked increase in PCV percent and thrombocyte count and a significant
decrease in C-reactive protein in babesia infected cases.
Many researchers have evaluated the efficacy of Clindamycin in the

treatment of babesiosis (Wulansari et al., 2003 however they also suggested
that treatment with Clindamycin alone is not sufficient to eliminate babesiosis
infection from blood. Matsuu et al. (2008) and Fowler et al. (1972), reported
efficacy of metronidazole in treatment of babesia. Several researchers have
shown Doxycycline to be effective in treatment of babseiosis (Talukder et al.,
2013; Lin and Huang, 2010).
Group II- Homeopathy (Crotalus horridus 200C) (n=6)
53
In this group, dogs were treated for 14 day withhomeopathic drug
Crotalus horridus in the dilution of 200C@ 4 pills QD. Clinical improvement
was noticed on 9 day post treatment and on 14 day post treatment all dogs
showed complete clinical recovery (Table 32). Hematological parameter
showed gradual increase in Hb, TEC, PCV, and platelets count post
treatment and on day 14 post treatment, all the parameters returned to the
normal range but towards the lower limit in the reference range as compared
with healthy control. Similar reports in canine babesiosis have been reported
by (Chaudhuri and Varshney, 2007).

different intervals in Group II
S NO. Day 0 Day 3 Day 7 Day 14
1 - --- ++ - - ++ - ++++
2 - --- +--- ++-- +++-
3 - --- ++-- +++- + ++-
4 - --- +--- ++ -- ++++

5 - --- ++-- +++ - ++++
6 - --- +- - - + +-- +++-
Group III- Allopathy +Homeopathy (n=6)
In this group, dogs were treated for 14 day with a combination of

allopathic drug (combination Doxycycline+Clindamycin+Metronidazole) and
Homeopathy (Crotalus horridus 200C).
Clinical improvement was noticed on 3 rd day post-treatment and on 14
day post treatment all dogs showed complete clinical recovery (Table 33).
Hematological parameter showed gradual increase in Hb, TEC, PCV, and
platelets count post treatment and on day 14 post treatment, all the
parameters returned to the normal range but towards the lower limit in the
reference range as compared with healthy control.

different intervals in Group III
S NO. Day 0 Day 3 Day 7 Day 14
1 - +- - - ++ +- ++++
2 - +--- ++-- +++-
3 - ++-- +++- + +++
4 - ++-- +++- ++++

5 - +++- ++ -- ++++
6 - ++- - +++- ++++
Combination therapy proved to give better treatment response as the

clinical symptoms resolved earlier and the improvement in the haemogram
was better as compared to other treatment groups.
Combination of allopathy and homeopathy is likely to synergize the
effect due to interaction of several drugs acting on parasite at different targets
and thus is beneficial in suppressing parasite growth and activity. Also a
homeopathic drug works at nano levels and they might also play an active
role in improving the immunity of the animal thereby mitigating the infection at
a faster rate when given in combination with allopathic medicines.
55
SUMMARY, CONCLUSION AND SUGGESTION FOR FURTHER WORK
5.1 SUMMARY
Canine babesiosis is one of the most important tick-transmitted
apicomplexan haemoprotozoan disease which cause severe disease in dogs.
The disease is caused by intra-erythrocytic protozoan parasites of the genus
Babesia. Babesia canis and Babesia gibsoni are the two predominant species
of the organism. The clinical presentation of babesiosis ranges widely from
peracute, chronic or even subclinical. Examination of symptomatic dogs is of
great importance, but asymptomatic dogs should also be examined. Quick
and precise diagnosis allows prompt and adequate therapy to prevent
possible complications.
The present study was undertaken to study the epidemiology, clinic-
pathological alterations, and comparative sensitivity of various diagnostic
tools with comparative therapeutic efficacy of different drugs against canine
babesiosis. Prevalence of the disease in respect to different age group, breed
and sex of dogs in around Rewa district of M.P. was studied. A retrospective
study was conducted from November 2019 to February 2020 and from
December 2020 to January 2021 on a total of 200 dogs with the history of tick
infestation, pyrexia, anorexia haematuria. Age, sex, breed and area wise
prevalence in dogs were recorded. Clinico-pathological and therapeutic study
were conducted in eighteen dogs after confirmation of Babesia sp. infection
by microscopic examination of stained blood smear with Giemsa stain and on
the basis of PCR assay. Five ml blood was collected from cephalic or
recurrent tarsal vein. For the therapeutic studies blood samples were
collected on day 0, day 3, day 7 and subsequently on day 14 post treatment.
Estimation of the hematological parameters including hemoglobin
(g/dl), total erythrocyte count (million/μl), packed cell volume (%), platelet
count (thousands/μl), differential leukocyte count (%) and total leukocytecount
(thousands/μl) were done following standard procedures. Biochemical
parameters including alanine amino transaminase (U/L), asparte
aminotransminase (U/L), bilirubin–total mg/dl), total protein(g/dl) and albumin
(g/dl), globulin (g/dl), creatinine (mg/dl) and blood urea nitrogen(mg/dl) were
determined in serum of animals.
To assess the therapeutic efficacy of drugs, 18 dogs were divided in 3
groups (I-III). Each treatment group comprised of 6 dogs. Group I was treated
with Doxycycline@10 mg kgBwt, Metronidazole @25mg/kgBwt,
Clindamycin@11 mg/kg BwtGroup II with (Homeopathy Crotalus horridus
200C@4 pills qid) and group III (Allopathy +Homeopathy). Six apparently
healthy dogs were grouped in group IV as healthy control.
In the present study, an overall prevalence of 27% (54/200) of canine
babesiosis was found from November 2019 to February 2020 and from
December 2020 to January 2021. Higher prevalence was observed in urban
area. Epidemiological study revealed higher prevalence in in German
shepherd (33.33%) followed by Labrador (21.56%), non-descriptive (46.80%)
Rottweiler (12.5%), Shih tzu (8.33%). The age wise prevalence of canine
babesiosis revealed highest prevalence in 1-3 years age group, followed by in
dogs of followed by 3-6 years, then 6-9years and < 1 year age, and lowest in
>9 years group. The sex wise prevalence more cases in males (27.90%) as
compared to (26.31%) in females.
Hematological study revealed significant decrease in Hb, TEC, PCV,
platelets and neutrophil count and significant increase in lymphocyte and
monocyte count. Biochemical studies revealed significant increase in ALT,
AST, BUN, Creatinine, Total bilirubin and globulin while significant decrease
in the total protein and albumin was noticed. The therapeutic study revealed
that all the drugs used in study trial could cure the Babesia spp. infections
from the affected dogs. However, based on the earlier resolution of clinical
symptoms and reduction in the degree of parasitemia, group III (Allopathy
+Homeopathy) was considered as the most efficient treatment regimen
against babesiosis followed by group I (allopathy) and group II (homeopathy).
57
5.2 Conclusion
 The study revealed an overall prevalence of canine babesiosis in

Rewa district of Madhya Pradesh as 27%.
 The most prominent clinical presentation was pyrexia and anorexia.
 The most prominent haematological finding was reduced haemogram
and thrombocytopenia.
 The most prominent biochemical finding was increased BUN and
creatinine values.
 The order of drug efficacy against babesiosis in dogs on the basis to
recovery from parasitemia and clinical improvement is
Combination>Allopathy>Homeopathy.
5.3 Suggestions for further work

1. An extensive epidemiological study in the larger part of the state is
required to find out the prevalence of canine babesiosis.
2. Study of the effect of homeopathic anti-babesial drugs on different
organs and immune system in dogs infected with babesiosis is further
needed.
3. Study on comparative therapeutic efficacy of different concentrations
of homeopathic anti-babesialdrugs in dogs infected with babesiosis is
further needed.
4. Study on comparative efficacy of different combinations of
homeopathic anti-babesial drugs in dogs infected with babesiosis is
further needed.
5. Study on efficacy of preventive homeopathic anti-babesial drugs in
dogs infected with babesiosis is further needed.
6. REFERENCES
Adebayo, O.O., Ajadi, R.A., Omobowale, T.O., Omotainse, S.O., Dipeolu,

M.A., Nottidge, H.O. and Otesile, E.B. (2016).Reliability of clinical
monitoring forthe diagnosis of babesiosis in dogs in Nigeria. Veterinary
Medicine: Research and Reports, 7: 85-90.
Amritpal, S., Harkirat, S., Singh, N.K., Singh, N.D. and Rath, S.S. (2014).
Canine Babesiosis in Northwestern India: Molecular Detection and
Assessment of Risk Factors. BioMed Research International, 2014: 1-5.
Andoni, E., Rapti, D., Postoli, R., Dimco, E. and Abeshi, J. (2013).
Clinicopathological findings in dogs naturally infected with Babesia spp.
Albanian Journal of Agricultural Sciences, 12 (2):185-189.
Aysul N., Ural K., Ulutas B., Eren H. and Karagenc T. (2013).First detection
and molecular identification of Babesia gibsoni in two dogs from the
Aydın Province of Turkey.Turkish Journal of Veterinary and Animal
Sciences, 37: 226-229.
Bastos, C.D.V.E., Moreira S.M. and Passos L.M.F. (2004).Retrospective
study (1998-2001) on canine babesiosis in Belo Horizonte, Minas
Gerais, Brazil.Annals of the New York Academy of Sciences, 1026: 158-
160.
Benjamin, M.M. (1982). Outline of Veterinary Clinical pathology. 3rd Edn.
Kalyani publishers, New Delhi. Pp. 26-37.
Bilwal, A.K., Mandali, G.C. and Tandel, F.B. (2017).Clinicopathological
alterations in naturally occurring Babesia gibsoni infection in dogs of
Middle-South Gujarat, India.Veterinary world, 10(10): 1227-1236.
Bohm, M., Leisewitz, A. L., Thompson, P. N. and Schoeman, J. P.
(2006).Capillary and venous Babesia canis rossi parasitaemias and
their association with outcome of infection and circulatory
compromise.Veterinary Parasitology, 141(1-2): 18-29.
Boozer, A.L. and Macintire, D.K. (2003). Canine babesiosis. The Veterinary
Clinics of North America. Small Animal Practice, 33(4): 885-904.
Bourdoiseau, G. (2006): Canine babesiosis in France. Veterinary
Parasitology 138: 118–125.
Bowers, L.D. (1980). Clinical Chemistry. pp. 551.
Camacho, A.T., Guitian, F.J., Pallas, E., Gestal, J. J., Olmeda, S., Goethert,
H., Telford, S. and Spielman, A. (2005). Serum protein response and
100 renal failure in canine Babesia annae infection. Veterinary
Research, 36(5-6): 713-22.
Cardoso, V.D.S. and Serra-Freire, N.M. (2001). Prevalence of Babesia canis
infection from Silva Jardim and Teresopolis, Rio de Janeiro, Brazil:
evaluation by blood smear. Entomology and Vector, 8(3): 359-364.
59
Centos, S.E.T. (1994).Pathophysiology and laboratory diagnosis of
hepatobiliary disorder.A testbook of veterinary Internal Medicine.4
Eddition. Ettinger, S.J.W.B Saunder co. Philadelphia, pp. 1262-1310.
Chaudhuri, S. (2006) Studies on clinico-therapeutic aspects of babesiosis in
dogs. MVSc Thesis. Indian Veterinary Research Institute.
Chaudhuri, S., and Varshney, J. P.(2007). Clinical management of babesiosis
in dogs with homeopathic Crotalus horridus 200C.Homeopathy, 96(2):
90–94.
Crnogaj, M., Petlevski, R., Mrljak, V., Kis, I., Torti, M., Kucer, N., Matijatko, V.,
Sacer, I. and Stokovic, I. (2010). Malondialdehyde levels in serum of
dogs infected with Babesia canis. Veterinary Medicine, 55: 163-171.
Das, M. and Konar, S. (2013).Clinical and hematological study of canine
Ehrlichiosis with other hemoprotozoan parasites in Kolkata, West
Bengal, India. Asian Pacific Journal of Tropical Biomedicine, 3(11): 913–
915.
Davitkov, D., Vucicevic, M., Stevanovic, J., Krstic, V., Tomanovic, S.,
Glavinic, U., & Stanimirovic, Z. (2015). Clinical babesiosis and molecular
identification of Babesia canis and Babesia gibsoni infections in dogs
from Serbia. Acta Veterinaria Hungarica, 63(2): 199-208.
De Gopegui, R.R., Penalba, B., Goicoa, A., Espada, Y., Fidalgo, L.E. and
Espino, L. (2007).Clinico-pathological findings and coagulation disorders
in 45 cases of canine babesiosis in Spain Veterinary Journal, 174(1):
129-132.
De Scally, M.P., Leisewitz, A.L., Lobetti, R.G. and Thompson, P.N. (2006).
The elevated serum urea: creatinine ratio in canine babesiosis in south
Africa is not renal origin. Journal of the South African Veterinary
Association, 77: 175-178.
Eljadar M.S.M. (2010). Clinico-diagnostic studies on vector transmitted
haemoprotozoan diseases in dogs. M.V. Sc Thesis, Guru Angad Dev
Veterinary and Animal Sciences University, Ludhiana (Punjab).
Ettinger, S.J. and Feldman, E.C. (2005).Text Book of Veterinary Internal
Medicine.6th edition. Pp. 643- 644.W.B.
Fabisiak, M., Sapierzynski, R. and Klucinski, W. (2010). Analysis of
haematological abnormalities observed in dogs infected by a large
Babesia. Bull. Veterinary Institute in Pulawy, 54(2): 167-170.
Farwell G.E., Le Grand E.K. and Cobb C.C. (1982). Clinical observations on
Babesia gibsoni and Babesia canis infections in dogs. Journal of the
American Veterinary Medical Association, 180(5): 507-511.
Fowler, J.L., Ruff, M.D., Fernau, R.C. and Furusho, Y. (1972). Babesia
gibsoni: chemotherapy in dogs. American Journal of Veterinary
Research, 33(6): 1109-1114.
Furlanello, T., Fiorio, F., Caldin, M., Lubas, G. and Solano-Gallego, L.
(2005).Clinico-pathological findings in naturally occurring cases of
babesiosis caused by large form Babesia from dogs of northeastern
Italy.Veterinary Parasitology,134(1-2): 77-85.
Gadahi, J.A., Arijo, A.G., Abubakar, M., Javaid, S.B. and Arshed, M.J. (2008).
Prevalence of blood parasites in stray and pet dogs in Hyderabad area:
comparative sensitivity of different diagnostic techniques for the
detection of microfilaria. Veterinary World, 1(8): 229-232.
García A.T. (2006). Piroplasma infection in dogs in northern Spain.Veterinary
Parasitology, 138: 97-102.
Gonde, S., Chhabra, S., Uppal, S.K., Singla, L.D. and Randhawa, S.S.
(2016). A unique case of Babesia gibsoni infected dog with paraplegia.
Journal of Parasitic Disease, 40(4): 1605-1608.
Harikrishnan T.J., Pazhanivel N. and Chellappa J.D. (2005).Concomitant
Babesia gibsoni and Ehrlichia canis infection in a dog.Veterinarski Arhiv,
75: 513-520.
Hossain, M.A., Yamato, O., Yamasaki, M. and Maede, Y. (2003). Clinical and
haematobiochemical studies on experimentally induced chronic
babesiosis in splenectomized adult dogs. Bangl Journal of Veterinary
Medicine, 1(1): 53-56.
Irwin, P. J. (2009). Canine babesiosis: from molecular taxonomy to control.
Parasites and vectors, 2(1): 1-9.
Irwin, P. J. (2010). Canine Babesiosis. Veterinary Clinics of North America:
Small Animal Practice, 40(6): 1141–1156.
Ishibashi T. Sunaga F., Namikawa K., Jongejan F. and Kanno Y. (1995).
Subspecies of Babesia canis isolated from dogs in Okinawa Island,
Japan. Journal of the Japan Veterinary Medical Association, 48: 35-37.
Jacobson L.S. and Clark I. A. (1994). The pathophysiology of canine
babesiosis: New approaches to an old puzzle. Journal of South African
Veterinary Associations, 65: 134-145.
Jain, K.J., Lakshmanan, B., Syamala, K., Praveena, J.E. and Aravindakshan,
T. (2017). High prevalence of small Babesia species in canines of
Kerala, South India, Veterinary World, 10(11): 1319-1323.
Jain, N.C. (1986).Schalm’s Veterinary Haematology, 4th ed. Lea and
Febiger, Philadelphia. pp: 103-110.
Kjemtrup, A.M. and Conrad, P.A. (2006). A review of the small canine
piroplasms from California: Babesia conradae in the literature.
Veterinary Parasitology,138(1-2): 112-117.
Konto, M., Biu, A.A., Ahmed, M.I. and Charles, S. (2014). Prevalence and
seasonal abundance of ticks on dogs and the role of Rhipicephalus
61
sanguineus in transmitting Babesia species in Maidugiri, North-Eastern
Nigeria.Veterinary World, 7(3): 119-124.
Kultler K.L. and Ristic M. (1988).Chemotherapy of babesiosis. In: Babesiosis
of domestic animals and man, CRC Press, Florida, USA.
Kumar A., Varshney J.P. and Patra R.C. (2006). A comparative study on
oxidative stress in dogs infected with Ehrlichia canis with or without
concurrent infection with Babesia gibsoni. Veterinary Research
Communication, 30: 917-920.
Kumar, K.S., Vairamuthu, S. and Kathiresanl, D. (2009). Prevalence of
haemoprotozoans in canines in Chennai City.Tamilnadu Journal of
Veterinary and Animal Science, 5(3):104-108.
Laha, R., Bhattacharjee, K., Sarmah, P. C., Das, M., Goswami, A., Sarma, D.
and Sen, A. (2014). Babesia infection in naturally exposed pet dogs
from a north-eastern state (Assam) of India: detection by microscopy
and polymerase chain reaction. Journal of Parasitic diseases, 38(4):
389-393.
Lin, M.Y. and Huang, H.P. (2010). Use of doxycycline-enrofloxacin-
metronidazole combination with/without diminazine diaceturate to treat
naturally occurring canine babesiosis caused by Babesia gibsoni. Acta
Veterinaria Scandinavica, 52: 27-35.
Lobetti, R. G. and Jacobson, L. S. (2001). Renal involvement in dogs with
babesiosis. Journal of the South African Veterinary Association, 72: 23-
28.
Macleod G. (2012). The Treatment of Cattle by Homeopathy. Random
House, 2012. Saffron Walden, England: The C. W. Daniel Company Ltd;
1981.
Mahalingaiah, M.K.C., Asoor, M., Thimmaiah, R.P., Narayanaswamy, H.D.,
Mukartal, S. Y., Elattuvalappil, A.M. and Singh, S. (2017).Prevalence of
canine babesiosis in different breeds of dogs in and around
bengaluru.Advances Animal Veterinary Science, 5(3): 140-144.
Makinde M.O. and Bobade P.A. (1994).Osmotic fragility of erythrocytes in
clinically normal dogs and dogs with parasites. Research in Veterinary
Science, 57: 543-548.
Maiav J, Harris DJ , Carranza S, Gómez-Díaz E. 2014. A comparison of
multiple methods for estimating parasitemia of hemogregarine hemoparasites
(Apicomplexa: Adeleorina) and its application for studying infection in natural
populations. PLoS One 9:e95010.
Mathe, A., Voros, K., Papp, L. and Reiczigel, J. (2006).Clinical manifestations

of canine babesiosis in Hungary (63 cases). Acta Veterinaria Hungarica,
54(3): 367-385.
Matijatko, V., Kis, I., Tortia, M., Brkljacica, M., Kucera, N., Rafajb, R.B.,
Grdena, D., Zivicnjakc T. and Mrljaka, V. (2009).Septic shock in canine
babesiosis.Veterinary Parasitology, 162(3-4): 263-270.
Matjila, T.P., Nijhof, A.M., Taoufik, A., Houwers, D., Teske, E., Penzhorn, B.L.
and Jongejan, F. (2005). Autochthonous canine babesiosis in The
Netherlands. Veterinary Parasitol, 131(1): 23-29.
Matsuu, A., Yamasaki, M., Xuan, X., kadai, H.I and Hikasa, Y. (2008). In vitro
evaluation of the growth inhibitory activities of 15 drugs against Babesia
gibsoni (Aomori strain). Veterinary Parasitology, 157:1–8.
Meinkoth, J.H., Kocan, A.A., Loud, S.D. and Lorenz, M.D. (2002). Clinical and
hematologic effects of experimental infection of dogs with recently
identified Babesia gibsoni-like isolates from Oklahoma. Journal of the
American Veterinary Medical Association. 220(2): 185-189.
Murphy R. Lotus Materia Medica. Indian edn New Delhi: B. Jain Publishers
Pvt. Ltd.; 2002.
Nalubamba, K.S., Mudenda, N.B., Namwila, M.M., Mulenga, C.S., Bwalya,
E.C., Kandawire, E.M., Saasa, N., Hancanga, C., Oparaocha, E. and
Simuunza, M. (2015). A study of naturally acquired canine babesiosis
caused by single and mixed Babesia species in
Zambia:Clinicopathological findings and case management. Journal of
Parasitology Research 9: 236–249.
Onishi T. and Suzuki S. (1994).Changes in serum haemolytic activity and the
number of reticulocytes in canine Babesia gibsoni infection. Journal of
Veterinary Medical Science, 56: 611-612.
Oser, B.L. (1976). Hawk’s Physiological Chemistry. 14 th edn. New Delhi, The
Blactston Division, Mc Graw Hill Publishing Co Ltd.
Patton, C.J. and Crounch, S.R. (1977). Veterinary clinical diagnosis.
Analytical chemistry, 49: 464-469.
Patz, J.A., Sari Kovats, R. (2005). Hotspots in climate change and human
health.British Medical Journal, 325: 1094–1098.
Rafaj, R.B., Mrljak, V., Kucer, N., Brkljacic, M. and Matijatko, V.
(2007).Protein C activity in babesiosis of dogs.Veterinarski arhiv, 77: 1-
8.
Ravi, L. B., Bhoopathy, D. and Subbiah, V. (2016).Escalations in the
incidence of canine babesiosis over a period of 8 years (2006–2013) in
Chennai, Tamil Nadu, India. Journal Parasitic Diseases, 40(4): 1239-
1242.
Reddy, B.S., Sivajothi, S., Reddy, L.S.S. and Raju, K.G.S. (2014).Clinical and
laboratory findings of Babesia infection in dogs.Journal
of Parasitic Disease, 92: 268–272.
63
Reitman, S. and Frankel, S. (1957). Colorimetric method for the determination
of serum glutamic oxaloacetic and gutamic transaminases. American
Journal of Clinical Pathology, 28: 56- 63.
Rene-Martellet, M., Chene, J., Chabanne, L., Chalvet-Monfray, K. and
Bourdoiseau, G. (2013). Clinical signs, seasonal occurrence and
causativeagents of canine babesiosis in France: Results of a
multiregional study. Veterinary Parasitology.197(1): 50-58.
Reyers, F. (1992). Is azotemia in canine babesiosis and indication of renal
disease? Proceeding of 9th faculty day, University of Pretoria, Faculti of
Veterinary Medicine.
Roopali, B., M. Roy and Roy, S. 2018. Clinico, Haemato-Biochemical
Changes and Therapeutic Management of Canine
Babesiosis.International Journal of Current Microbiology and Applied
Science, 7(8): 1384-1388.
Rucksaken, R., Maneeruttanarungroj, C., Maswanna, T., Sussadee, M. and
Kanbutra, P. (2019). Comparison of conventional polymerase chain
reaction and routine blood smear for the detection of Babesia canis,
Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in Buriram
Province, Thailand. Veterinary world, 12(5): 700-712.
Samradhni, D., Maske. D.K. Shobha, R. and Shinde, P.N. (2005).Bionomics
and haemodynamics in blood protozoal infections in dogs from Nagpur.
Maharastra. Indian Journal of Animal Health. 44: 57-66.
Shah S.A, Sood N. and Tumati S.R. (2011). Haemato-biochemical changes in
natural cases of canine babesiosis. Asian Journal of Animal Sciences,
5(6): 387–392.
Shrivastava, S., Shukla, P.C. and Rao, M.L. (2014). An epidemiological study
on canine hemoprotozoa in Jabalpur (Madhya Pradesh).International
Journal of Agricultural Sciences and Veterinary Medicine, 2: 4-10.
Singh, H., Haque, M., Singh, N. K. and Rath, S. S. (2012). Occurrence of
parasitic infections in dogs in and around Ludhiana, Punjab (India).
Applied Biological Research, 14(1): 108-110.
Singla L.D., Sumbria D., Mandhotra A., Bal M.S. and Kaur P. (2016). Critical
analysis of vector-borne infections in dogs: Babesia vogeli, Babesia
gibsoni, Ehrlichia canis and Hepatozoon canis in Punjab, India. Acta
Parasitologica, 61(4): 697-706.
Soulsby, E.J.L. (1982). Helminths, Arthropods and Protozoa of domesticated
animals.7th Edn. Se. Asian Journal of Tropical Medicine, 36 (4):149-
151.
Sundar, N., Balachandran, C., and Senthilvelan, A. (2004). Incidence of
Babesia gibsoni infection in dogs in Tamil Nadu. Journal Veterinary
Parasitology,18: 79-80.
Suzuki, K., Wakabayashi, H., Takahashi, M., Fukushima, K., Yabuki, A. and
Endo, Y. (2007). A Possible treatment strategy and clinical factors to
estimate the treatment response in Bebesia gibsoni infection. Journal of
Veterinary Medical Science, 69(5): 563-568.
Taboada, J. and Lobetti, R. (2006).Babesiosis. In: Greene, C.E. (ed.).
Infectious Diseases of the Dog and Cat, 3rd Edn., Elsevier Publishers,
Missour, 1387p.
Talukder, M.H., Matsuu, A. and Hikasa, Y. (2013). Evaluation of doxycycline
sensitivity in vitro against Babesia gibsoni by Real Time-PCR. Journal of
Bangladesh Agricultural University, 11(1): 97–102.
Varshney J.P., Deshmukh V.V. and Chaudhary P.S. (2008).Multisystemic
effects of canine babesiosis and management of critical cases. Intas
polivet, 9, 281-287.
Varshney, J.P. and Dey, S. (1998). A clinical study on haemoprotozoan
infections in referral canines Journal of Remount Veterinary Corps, 37:
83-89.
Vercammen, F., Deken, R., Antwerpen D. and Maes, L. (1997).
Haematological and biochemical profile in experimental canine
babesiosis (Babesia canis). Vlaams Diergeneeskunding Tijdschrift,
66(4): 174-178.
Vial, H.J. and Gorenflot, A. (2006).Chemotherapy against
babesiosis.Veterinary Parasitology.138(1): 147-160.
Vishnurahav, R.B., Pillai, U.N., Alex, P.C., Ajitkumar, S. and Lusy sabu
(2014). Haematobiochemicalchanges in canine babesiosis. Indian
Journal of Canine Practice, 6: 2-8.
Wadhwa, D.R., Pal, B., Mandial, R.K., Kumar, A. and Agnihotri, R.K.
(2011).Clinical, haemato-biochemical and therapeutic studies of canine
Babesiosis in Kangra valley of Himachal Pradesh. Journal Veterinary
Parasitology. 25(1): 39-41.
Wulansari R., Wijaya, A., Ano, H., Horii, Y., Nasu, T., Yamane, S. and
Makimura, S. (2003). Clindamycinemin the treatment of Babesia gibsoni
infections in dogs. Journal of the American Animal Hospital Association,
39(6): 558-562.
Yogeshpriya, S., Sivakumar, M., Saravanan, M., Venkatesan, M.,
Veeraselvam, M., Jayalakshmi, K. and Selvaraj, P. (2018).Clinical,
haemato-biochemical and ultrasonographical studies on naturally
occurring Babesia gibsoni infection in dogs.Journal of the Entomological
Research, 6(1): 1334-1337.
Young, D. (1997). In effect of preanalytical variable on clinical laboratory
tests, 2nd edn., AACC press, Washington, pp.502.
65
Zygner, W., Gojska, O., Rapacka, G., Jaros, D. and Wedrychowicz, H.
(2007). Hematological changes during the course of canine babesiosis
caused by large Babesia in domestic dogs in Warsaw (Poland).
Veterinary Parasitology, 145(1-2): 146-151.
ABSTRACT
Amongst the canine vector-borne diseases, canine babesiosis

transmitted by Dermacentor reticulatus, Rhipicephalus sanguineusis an
important life hazard disease worldwide and has zoonotic importance (Kumar
et al., 2009).The disease is caused by intra-erythrocytic protozoan parasites
of the genus Babesia which usually appears as a single pear-shaped
piroplasm or singnet ring shaped or in pairs within the erythrocyte. The rate of
incidence is very high in India (Varshney and Dey, 1998 and Chaudhuri,
2007). Clinical signs included pyrexia, anorexia, anaemia, jaundice and
hemoglobinuria, Different treatment regimens have been tried with various
success rate. Alternative therapy such as homeopathy have been tried and
found to be effective, less toxic and cost effective. Epidemiological studies in
canine babesiosis have not been conducted in Rewa district of M.P.
Therefore, the present study was undertaken to study the prevalence of
caninesbabesiosis in and around Rewa city and to evaluate the haemato-
biochemical parameters and comparative efficacy of allopathic and
homeopathic anti- babesiosis drugs in affected animals.
The present study was carried out in the Department of Veterinary
Medicine, COVS & AH, Rewa, The epidemiological survey carried out in and
around Rewa revealed an overall prevalence of 27% with maximum
prevalence in age group of 1-3 years (25.92%), Non-descript dog (40.74%),
females (55.56%). Prominent clinical symptoms included pyrexia,
dehydration, haemoglobinuria and jaundice (16.66%). PCR assay proved to
be a sensitive diagnostic tool.Haematobiochemical findings included reduced
haemogram and leucogram elevated, renal and hepatic enzymes with
hypoalbuminaemia and hyperglobulinaemia. Therapeutic trial included three
treatment groups with group II comprising of Allopathy
(Doxycycline+Clindamycin+Metronidazole). Group III comprising of
Homeopathy drug (Crotalushorridus 200C), and group IV comprising of
Combination therapy with Allopathy +Homeopathy. Group I included six
healthy animals as control group. The resolution of symptoms in dogs along
with time duration for hemato-biochemical parameters to return to normal
values, were used as criteria for deciding therapeutic efficacy of different
drugs. Present study revealed that combination therapy (group IV-Allopathy
and homeopathy) is better as compared to group II (Allopathy) or group III
(Homeopathy) as the values of haemogram and thrombocyte count increased
and liver and kidney enzyme values returned to normal at a faster rate in
comparison to other groups.
67
lkjka'k
dSukbu osDVj&tfur jksxksa ds chp] MsjsesUVksj jsfVdqyVl]

fjihiS¶yl lkaxqbU;wfll }kjk çlkfjr dSukbu csfc;ksfll ,d egRoiw.kZ thou
ds fy, nqfu;k Hkj esa [krjukd chekjh gS vkSj bldk twuksfVd egRo gSA ;g
jksx thul cscsfl;k ds baVªk&,fjFkzkslkbfVd çksVkstksvk ijthoh ds dkj.k
gksrk gS] tks vkerkSj ij ,d ,dy ds :i esa çdV gksrk gSA ,fjFkzkslkbV ds
Hkhrj fijksIykTe ;k flaxusV fjax ds vkdkj dk ;k tksM+s esaA Hkkjr esa ?
kVukvksa dh nj cgqr vf/kd gSA uSnkfud ladsrksa esa ikbjsfDl;k]
,uksjsfDl;k] ,uhfe;k] ihfy;k vkSj gheksXyksfcuqfj;k 'kkfey gSa] fofHkUu
mipkj jsthesaUl dks fofHkUu lQyrk nj ds lkFk vktek;k x;k gSA
gksE;ksiSFkh tSlh oSdfYid fpfdRlk dks çHkkoh vkSj de fo"kkä vkSj
ykxr çHkkoh cukus dh dksf'k'k dh xbZ gSA dSukbu csfc;ksfll esa
egkekjh foKku ds v/;;u jhok ftys esa e-çA blfy,] jhok 'kgj esa vkSj mlds
vklikl dSusckfl;ksfll ds çpyu dk v/;;u djus vkSj çHkkfor i'kqvksa esa
gseVks&ck;ksdSfed ekinaMksa vkSj ,yksiSfFkd vkSj gksE;ksiSfFkd
,aVh&csfc;ksfll nokvksa dh rqyukRed çHkkodkfjrk dk ewY;kadu djus ds
fy, orZeku v/;;u fd;k x;k FkkA
orZeku v/;;u i'kq fpfdRlk foHkkx] lhvksoh,l vkSj ,,p] jhok esa fd;k x;k
Fkk] jhok esa vkSj mlds vklikl fd, x, egkekjh foKku losZ{k.k us 1&3 lky
dh vk;q ds vf/kdre çlkj ds lkFk 27% dh lexz O;kidrk dk [kqyklk fd;k ¼ 25-
92%½] xSj&foojf.kr dqÙkk ¼40-74%½] efgyk,a ¼55-56%½A çeq[k uSnkfud
y{k.kksa esa ikbjsfDl;k] futZyhdj.k] gseksXyksfcU;wfj;k vkSj ihfy;k
¼16-66%½ 'kkfey FksA ihlhvkj ij[k ,d laosnu'khy uSnkfud Hkh lkfcr
gqvkA gsesVksck;ksdsfedy fu"d"kksaZ esa de gheksxzke vkSj
Y;wdksksxzke dks Åapk djuk] gkbiksysC;wfefufe;k vkSj
gkbijXykscqfyfufe;k ds lkFk xqnsZ vkSj ;—r ,atkbe 'kkfey gSaA
fpfdRlh; ijh{k.k esa ,yksiSFkh ¼M‚DlhlkbfDyu + fDyaMkekbflu +
esVªksfuMktksy½ ds lewg II ds lkFk rhu mipkj lewg 'kkfey FksA lewg
III esa gksE;ksiSFkh nok ¼Crotalushorridus200C½] vkSj lewg IV esa
,yksiSFkh + gksE;ksiSFkh ds lkFk la;kstu fpfdRlk 'kkfey gSA lewg I esa
fu;a=.k lewg ds :i esa Ng LoLFk tkuoj 'kkfey FksA lkekU; ewY;ksa ij
ykSVus ds fy, gsesVks&ck;ksdsfedy ekinaMksa ds fy, dqÙkksa esa le;
dh vof/k ds lkFk y{k.kksa dk lek/kku] fofHkUu nokvksa dh fpfdRlh;
çHkkodkfjrk r; djus ds fy, ekunaM ds :i esa mi;ksx fd;k x;k FkkA orZeku
v/;;u ls irk pyk fd la;kstu fpfdRlk ¼lewg IV&,yksiSFkh vkSj
gksE;ksiSFkh½ lewg II ¼,yksiSFkh½ ;k lewg III ¼gksE;ksiSFkh½ dh
rqyuk esa csgrj gS D;ksafd gseksxzke vkSj FkzksEckslkbV fxurh ds
ewY;ksa esa o`f) gqbZ gS vkSj ;—r vkSj xqnsZ ds ,atkbe dk eku
lkekU; :i ls okil vk x;k gSA
69
VITA
The author of the thesis Dr. Pavan kumar

Chaurasiya S/o Shri. Sabhapati Chaurasiya and
Smt. Chanda Chaurasiya was born on 4th March,
1989 at Satna (M.P.).
He persued his high school education from

Government Boys Higher Secondary, School,
Amarpatan, Satna (M.P. Board) in 2005 and
completed Higher Secondary School Education in
2008 from the same school.
He was admitted to B.V.Sc & A.H. degree in the year 2012 at College of
Veterinary Science and Animal Husbandary, Rewa, Nanaji Deshmukh
Veterinary Science University and successfully completed his degree in 2018
with 6.7/10 OGPA. He joined M.V.Sc in the Department of Veterinary
Medicine, College of Veterinary Science and Animal Husbandary, Rewa,
NDVSU in the same year.
For the partial fulfillment of the degree, he is submitting his thesis

entitled “Studies on comparative therapeutic efficacies of allopathic and
homeopathic drugs in canine babesiosis”.
Permanent address:
Dr. Pavan Kumar Chaurasiya
S/o Shri. Sabhapati Chaurasiya
Rewa (M.P.)
Pin code: 486001
E-Mail: pavanamit50@gmail.com
Title of thesis : STUDIES ON COMPRATIVE THERAPEUTIC
EFFICACIES OF ALLOPATHIC AND
HOMEOPATHIC DRUGS IN CANINE
BABESIOSIS
Student : Pavan Kumar Chaurasiya
Name (Full) :
Postal address Permanent : Sharda Nagar Godhahar, Rewa (M.P.)
PIN- 486001
Major advisor : Dr. Kanchan K. Walwadkar
Address : Assistant Professor
Department of Veterinary Medicine,
College of Veterinary Science & A.H.,
Kuthulia, Rewa 486001
Degree Awarded : M.V.Sc.
Year of award of degree : 2021
Major Subject : Veterinary Medicine
Number of Pages in thesis : 65
Number of words in Abstract : 328
Dr. Kanchan K. Walwadkar Dr. K.K. Mishra Pavan Kumar Chaurasiya

Major Advisor Professor & Incharge Student
Head
71

Pavan Chaurasiya

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Pavan Chaurasiya

Uploaded by

Copyright:

Available Formats

1.

Cardoso and Serra-Freire (2001) conducted an epidemiological survey

Bastos et al. (2004) reported a prevalence of 42% in a retrospective

Sundar et al. (2004) recorded incidence of Babasia gibsoni for a period

Samradhni et al. (2005) recorded 64.28 % prevalence of babesiosis

Gadahi et al. (2008) reported the prevalence of 5% of B. canis in

Kumar et al. (2009) reported that B. gibsoni was identified in 84.90% of

Singh et al. (2012) recorded prevalence of babesiosis was

Das and Konar (2013) observed Giemsa stained peripheral blood

Rene-Martellet et al. (2013) analysed the risk of infection of babesiosis

Shrivastava et al. (2014) studies the epidemiology of haemoprotozoan

Shrivastava et al. (2014) noticed the prevalence of Babesia specie as

Adebayo et al. (2016) studied the disease pattern in 14 dog breeds.

Ravi et al. (2016) reported a prevalence of 4.12% for B. gibsoni and

Mahalingaiah et al. (2017) reported higher prevalence in male’s

2.2 Diagnosis: Blood smear versus PCR

Davitkov et al. (2015) screened 60 dogs with clinical findings

Rucksaken, et al. (2019) studies the Comparison of conventional

2.3 Clinical Symptoms:

Matjila et al. (2005) confirmed the twenty-three cases of

De Gopegui et al. (2007) reported that dogs suffering from babesiosis

Andoni et al. (2013) studied the clinicopathological findings in dogs

Makinde and Bobade (1994) measured osmotic fragility of the

Onishi and Suzuki (1994) analysed the hemolytic activity in Babesia

Vercammen et al. (1997) studied the hematological and biochemical

Meinkoth et al. (2002) studied the hematological alterations in dogs

Hossain et al. (2003) studied hematological changes due to

Furlanello et al. (2005) studied clinic-pathological findings in

De Gopegui et al. (2007) conducted a retrospective study of the

Zygner et al. (2007) assessed the hemato biochemical changes in

Matijatko et al. (2009) reported the hematological alterations in dogs

Fabisiak et al. (2010) studied the hematological abnormalities in

Crnogaj et al. (2010) examined dogs infected with B. canis and

Irwin (2010) reported the variable clinic-pathologic abnormalities

Reddy et al. (2014) reported clinic haematological and urinalysis

Nalubamba et al. (2015) reported anaemia (96.4%) with nucleated

Gonde et al. (2016) studied the hemato-biochemical alterations in

Bilwal et al. (2017) studied the hematological parameters and noticed

Yogeshpriya et al. (2018) noticed significant reduction in RBC, Hb

Chaudhary and Varshney (2007) studied the comparative clinical

Matsuu et al. (2008) evaluated that inhibitory activities in vitro growth

Lin and Huang (2010) evaluated the effectiveness of oral

Talukder et al. (2013) evaluated sensitivity of doxycycline against in

Shrivastava et al. (2014) evaluated efficacy of newer combination of

3.1 Location and Place of work

3.2 Duration of work: 6 months.

3.3 Materials and Methods:

The present study was carried out in two phases:

3.3.1 Phases I: Study of prevalence of Babesiosis in dogs-

3.3.1.1 Animal screening:

Study for the prevalence of babesiosis in dogs was conducted at

The blood samples were collected in vaccutainers containing sodium

1. Four hundred microliters of the samples were taken and centrifuged at

Polymerase Chain Reaction:

The genomic DNA of presumptively suspected dogs was employed for

a. Initial denaturation at 95 0C for 5 min, 35 cycles of denaturation at 95 0C

Table 1: Babesia spp. oligonucleotide sequence

Sr. Target Primer Oligonucleotide sequence Amplicon Reference

3.3.2.1 Therapeutic trial:

3.3.2.2 Group wise treatment protocol

Table 2: Group wise treatment protocol

Table 3: Dose rate of treatment protocal

Drugs Dose rate Route Day of medications