Professional Documents
Culture Documents
A1636094 Wildcat Hybrid Scoring For Conservation Breeding Under The ScottishWildcat Conservation Action Plan
A1636094 Wildcat Hybrid Scoring For Conservation Breeding Under The ScottishWildcat Conservation Action Plan
Citation: Senn HV and Ogden R, Wildcat Hybrid Scoring For Conservation Breeding under
the Scottish Wildcat Conservation Action Plan (2015), Royal Zoological Society of Scotland,
May 2015
1
Communicating author hsenn@rzss.org.uk
2
About Scottish Wildcat Action
The Scottish wildcat is one of Europe's most elusive and endangered mammals. Often referred to as
the ‘Tiger of the Highlands’, it is one animal whose image we recognise instantly. Striking, handsome
and powerful, it is the very essence of a wild predator living by stealth and strength.
We have come to the stage where urgent action is needed to save Scotland's remaining wildcats. We
have given ourselves just six years to halt the decline. Scottish Wildcat Action is one of the most
ambitious conservation projects ever undertaken in Scotland, with over 20 organisations,
community groups and landowners coming together to tackle the decline of Scottish wildcats.
The work is a key part of delivering the national Scottish Wildcat Conservation Action Plan, and
involves both in situ and ex situ conservation activities, including targeted effort in six priority areas,
monitoring and surveying work, and a conservation breeding programme (based at RZSS Highland
Wildlife Park in Kingussie).
Project partners
3
Executive Summary
1. This document is designed to set out the genetic system for determining
hybridisation and how it should be integrated with morphological data, in putative
specimens of the wildcat (Felis silvestris) destined to be brought into a conservation
breeding programme, overseen by the Royal Zoological Society of Scotland as part of
the Scottish Wildcat Conservation Action Plan (SNH 2013).
2. Wildcats hybridise with the domestic cat and produce fertile offspring.
3. In the absence of whole genome sequencing, a sample of genetic markers are
capable of estimating the extent of hybridism in an individual with an associated
degree of confidence. Wildcat phenotype provides further assessments of wildcat
ancestry.
4. The test system devised by RZSS to select the animals for conservation breeding with
the greatest available proportion of wildcat ancestry, employs 35 nuclear SNP DNA
markers and one mitochondrial marker in combination with pelage assessments. The
genetic test is based on one of the more powerful (83 SNP) tests currently available,
developed in Switzerland, and has the advantage of generating data that can be
compared to datasets for wildcats across Europe. It produces very similar estimates
of hybridism to the Swiss test, has a slightly lower degree of confidence associated
with them, but is faster and more cost-effective to run.
5. Testing of cat samples collected from across Scotland indicates that there is a
complete genetic continuum between wild and domestic cat genetic types in the
wild/feral cat population. From the relatively limited sampling to date, the wild-living
cat population is a hybrid swarm, i.e. most individuals demonstrate some level of
hybridisation.
6. Any method of choosing “wildcats” for a conservation breeding programme needs to
decide on a cut-off between wildcat and domestic cat types.
7. We suggest that as a general principle we choose cats in which we have a 95%
confidence of them being closer than a first generation backcross to wildcat based
on their genetic scores. A first generation backcross to wildcat is a cat where one of
its four grandparents is a domestic cat and the remaining three are wildcats.
8. Based on the limited evidence currently available, there does not always appear to
be good correspondence between the genetic test and the commonly used
phenotypic test (pelage score). This is likely because hybridisation in Scotland has
been occurring for a long time and the phenotypic traits are under the control of
very few genes that do not match the areas examined in the genetics test. However,
this correspondence requires further analysis from a larger sample of individuals
with a range of phenotypes and genotypes.
9. We propose that genetic and phenotypic tests are used as separate, independent
lines of evidence, when decisions are made about cats. Only where the two lines of
evidence corroborate should we chose cats for the conservation breeding
programme.
4
Contents
About Scottish Wildcat Action ............................................................................................................ 2
Executive Summary............................................................................................................................. 4
Purpose ............................................................................................................................................... 6
History of wildcat hybrid testing ......................................................................................................... 6
Principle of hybrid testing ................................................................................................................... 7
Current test ......................................................................................................................................... 8
mtDNA marker ................................................................................................................................ 8
Nuclear markers .............................................................................................................................. 8
Background justification to the test.................................................................................................... 9
Theoretical limits to the test ........................................................................................................... 9
Reference data and choice of loci ................................................................................................. 11
The performance of statistical methods (STRUCTURE) and the empirical limits to the test........ 15
Discussion of limitations of the test.............................................................................................. 19
Decisions for hybrid cut-off criteria .................................................................................................. 25
Nuclear genetic criteria at the 35 Locus test ................................................................................ 25
Power of mtDNA test: ................................................................................................................... 28
Pelage Scores ................................................................................................................................ 30
The test decision ............................................................................................................................... 32
The Principle of the test ................................................................................................................ 32
The details ..................................................................................................................................... 32
Pelage Scoring Criteria .................................................................................................................. 32
Genetic Scoring Criteria ................................................................................................................ 32
Combined pelage and genetic scoring decision matrix: ............................................................... 33
References ........................................................................................................................................ 35
Appendices........................................................................................................................................ 38
Appendix 1: Allele frequencies at the 35 SNPs in the 82 individual test dataset ......................... 38
Appendix 2: STRUCTURE output at different values of K in the 82 individual test dataset.......... 41
Appendix 3: Test data ................................................................................................................... 41
Appendix 4: Physical validation of the test ................................................................................... 46
Appendix 5: Standard Test protocol at RZSS................................................................................. 47
Appendix 6: Nuclear SNP assay information and reorder numbers ............................................. 49
Appendix 7: SNP assay clustering ................................................................................................. 56
5
Purpose
This protocol is designed to set out the genetic system for determining hybridisation in
putative specimens of the wildcat (Felis silvestris) destined to be brought into a conservation
breeding programme overseen by the Royal Zoological Society of Scotland (RZSS) 2 as part of
the Scottish Wildcat Conservation Action Plan (SNH 2013). Wildcats hybridise with the
domestic cat (Felis catus) and produce fertile offspring. Genetic tests are capable of
determining the extent of hybridism in an individual with a degree of confidence. This
document discusses the protocol used at the Royal Zoological Society of Scotland as part of
the Conservation Breeding Strategy of the Scottish Wildcat Conservation Action Plan (SNH
2013) and gives a critical evaluation of the limitations of its power.
In line with the brief from the Scottish Wildcat Conservation Action Plan (SNH 2013)
throughout this document the working assumption is that:
1. The situation for Scottish Wildcat is so critical in terms of low numbers and high level
of genetic introgression from domestic cat, that taking some animals from the wild
into a conservation breeding programme is a conservation solution that is going to
be of net benefit to the Scottish Wildcat (as opposed to managing the situation in
the wild alone, or doing nothing).
2. The Scottish Wildcat is distinct entity with biodiversity and cultural dimensions that
is worth conserving (versus favouring conservation solutions that involve wildcats
from Central Europe). The approach is also based on the assumption that wildcats
with a high proportion of wildcat ancestry can still be found in the wild in Scotland.
3. That we are seeking to protect a distinct group of cats that look like wildcats and
contain a large proportion of wildcat genes, but may not all be genetically “pure”
wildcats.
The test presented here is an expanded version of the test developed (also from the Swiss
test, above) and run by RZSS in the SNH survey of 2013/14 (Commissioned report 768). Data
generated during the 2013/14 survey is directly comparable to data generated in this
expanded version of the test (at 12/14 original loci). The latest test will, however, give an
increased level of confidence in the estimates of hybridisation beyond that used in the SNH
survey of 2013/14.
7
is introgressed3. This means that it is much harder to understand situations where
hybridisation has been happening between the parent species for many generations.
In the Scottish Wildcat hybridisation has been occurring for hundreds if not
thousands of years – potentially since domestic cat arrived on mainland Britain
(Neaves & Hollingsworth 2013).
3. Large numbers of markers are costly and time-consuming to run and some methods
require high quality DNA.
Thus any hybrid test is a balance between the ideal (a large number of markers, ideally
whole genome data4) and the necessary practical restrictions of running the test.
Current test
The current test consists of mitochondrial and nuclear DNA markers used in tandem to infer
the hybrid ancestry of any given cat.
mtDNA marker
This current test includes a single mtDNA marker that distinguishes between wildcat and
domestic cat at the mitochondrial genome (i.e. only distinguishes maternal lineages, for
limitations of this see later). Details of this test have been published in McEwing et al.
(2011).
Nuclear markers
The current test includes a panel of 35 nuclear SNPs that appear to be highly discriminatory
between a reference dataset of wild and domestic cats. This test is an expanded version of
the 14 SNP test utilised in the SNH survey of 2013/14 (Commissioned report 768) and is
based on the markers in Table 1 published in (Nussberger et al. 2013). The 35 markers were
chosen as a compromise between an ideal requirement (to have many markers for a
hybridism test) and cost/speed consideration for running the test.
Table 1: Details of the SNP Panel
3
Once hybridisation in a population has progress to such an extent that the majority of the population is
consistent of hybrids of some kind (i.e. hybrid swarm) then this simple scenario of backcrossing to pure
animals no longer hold true however animals with distant hybrid ancestors will
4
Or lots of markers with linkage information to examine genomic blocks of introgression.
5
An additional two markers were also used for this original panel of 15 that are no longer used: SNP153 which
was dropped by the Swiss and SNP038 that did not convert to the new Taqman assay chemistry (see below).
8
SNP016 A G B1_20092839 Yes
SNP019 G A B2_11748866 Yes
SNP026 G C B3_75494376 Yes
SNP030 A G B4_45476816 Yes Yes
SNP044 A G E3_12301230 Yes
SNP045 C T F1_24323263 Yes
SNP047 G C F2_7927040 Yes
SNP048 C T A3_51056949 Yes Yes
SNP050 G A C1_223335334 Yes
SNP058 G A D1_126067118 Yes Yes
SNP060 A T D1_128802001 Yes
SNP062 G T D2_88876341 Yes
SNP084 A G D4_103411241 Yes
SNP098 G A E1_47901546 Yes
SNP101 C T B4_143164026 Yes
SNP102 C T C2_142858667 Yes Yes
SNP114 G A A2_62528310 Yes Yes
SNP115 G A A2_63544109 Yes Yes
SNP127 C T B3_132539085 Yes
SNP129 G A B4_96741303 Yes Yes
SNP133 G A C1_163375181 Yes
SNP143 C T F2_29878116 Yes Yes
SNP146 C T A1_214220499 Yes
SNP148 G A A2_120724549 Yes Yes
SNP155 A C B2_129152112 Yes Yes
SNP166 G A B3_147841323 Yes
SNP176 T C C1_112821482 Yes
SNP178 G A C1_189621758 Yes Yes
SNP187 C G D3_49022779 Yes
SNP190 C G D3_88773687 Yes
SNP195 A G E2_33320051 Yes
SNP196 T A E2_50523470 Yes
9
Table 2: Theoretical power of the 35 SNPs test used to test wildcats
Table 2 illustrates the theeoretical maximal power of the test. Roughly speaking, as a best
case scenario, this test will reliably distinguish will reliably distinguish pure wild-cats from
1st – 3rd generation back-crosses (<1% error rate).
For comparison we list here the theoretical limits of other possible panels of markers with a
given number.
Table 3: Theoretical power of tests with varying numbers of SNPs
Number of perfectly Limit of test (ancestral mixing at which there is < 5% probability
discriminatory loci of confusing this category with pure animal (actual probability
given in brackets)
14 1st Generation backcross (0.000061)
20 2nd Generation backcross (0.003171)
24 3rd Generation backcross (0.040569)
30 3rd Generation backcross (0.018207)
36 3rd Generation backcross (0.008171)
48 4th Generation backcross (0.045156)
83 4th Generation backcross (0.004716)
96 5th Generation backcross (0.047460)
10
Although the best case scenario for the 35 SNP test is to distinguishing up to 3rd generation
backcross, the true power of the test may be somewhat lower than this due to unavoidable
uncertainties surrounding the reference data used to generate the test and due to ancestral
polymorphisms in the markers.
Reference data and choice of loci
The 14 SNPs from the original SNH survey of 2013/14 (Commissioned report 768), 12 of
which are used here, were chosen based on segregation between a test panel of 10
wildcats, consisting of five high pelage scoring individuals from Scotland (NMS accession
numbers 1958.8, 1947.13(2), 1931.59, mw1947.133, mw1947.131) and five individuals from
Germany, and a test panel of 4 domestic cats of Scottish (n=3) and German (n=1) origin. The
high pelage scoring Scottish cats had scores ranging from 18-21 on the 7 Pelage Score
(Kitchener et al. 2005). See the SNH survey of 2013/14 (Commissioned report 768) for
further details.
The additional 23 SNPs were selected from a panel of 82 individuals that were run at the
Keller lab (University of Zurich, Switzerland) for 83 SNPs previously shown to be highly
diagnostic between Swiss wild and domestic cats (Nussberger et al. 2013; Nussberger,
Wandeler, & Camenisch 2014; Nussberger, Wandeler, Weber, et al. 2014). This panel of 82
individuals consisted of 6 Swiss reference cats (2x wildcat from the Swiss Jura6, 2x domestic
cat, 1x F1, 1x backcross to wild, all from Switzerland) and 76 samples collected from the wild
and captivity in Scotland. 38 samples in this dataset had previously been run for the SNH
survey of 2013/14 (Commissioned report 768) and acted as positive controls within the
Scottish dataset7 alongside the Swiss reference cats that had previously been run by the
Swiss lab.
A full list of theses samples with their locality data and pelage scores can be found in
Appendix 3.
Table 4: Summary of test data of the 82 individuals used for developing the new panel of 35 SNPs
6
The two wildcats are wild individuals (roadkills), a male WK28 from Kleinlützel (2008) and a female WK56
from Oberbuchsiten (2002), both in canton Solothurn (Beatrice Nussberger pers. com.)
7
At the 13 loci in common between the two methods
11
Swiss_dom 2
Swiss_F1 1
Swiss_wild 2
Scotland Unknown 1
England 1
Analysis of reference data; the status quo in Scotland and what follows from it
A principle component analysis (PCA) of the Swiss 83 SNP dataset (conducted in Genalex
6.5) revealed that there appears to be no distinct separation of wild cats in Scotland from
domestic cat. Although this dataset is not huge (See Table 4) it suggests that it would be
difficult to draw a dividing line between the two populations (see also Daniels et al. 2001;
Neaves & Hollingsworth 2013).
From this we make the following statements:
1: Wildcats in Scotland appear to form a hybrid swarm with domestic cats. This can be seen
in contrast to the situation of hybridisation existing between red deer and sika deer (genus
Cervus) in Scotland; where low level hybridisation has not, as yet, resulted in complete
genetic and phenotypic mixing of the two species into a “hybrid swarm” other than in
localised regions on the Kintyre Peninsula (Senn & Pemberton 2009; Senn, Barton, et al.
2010; Senn, Swanson, et al. 2010).
2: Any programme to bring “wildcats” into a conservation breeding programme will have to
set a threshold (based on judgement rather than a clear biological distinction) that balances
the wish to preserve the genetic diversity encapsulated in the apparently non-pure wildcats
from Scotland as part of a Scottish Wildcat Conservation Breeding Programme, versus the
desire not to be too inclusive of domestic cat genes (and associated traits). Set the purity
bar too high and the risk is that good wildcat genes are excluded, ‘good-ish’ cats are
excluded as hybrids, and the population accepted into captivity is so small that it will
experience a high level of inbreeding. Set the bar too low and we end up breeding
something that is only slightly better than the situation in the wild.
3: In setting such a cut-off we will also need to be aware of the uncertainty around any
estimate that the genetic data produces, given the limitation of hybridisation assays
discussed above (inherent power of any test, uncertainty surrounding reference data etc.).
12
Figure 1: A Principle Component Analysis (PCA) of 82 cats (for details see table 4 & Appendix 3). Each point represents a single cat scored at 83 SNP DNA
markers. The proximity of the cats to each other on the plot represents their genetic similarity. The percentage of variation shown by each of the
components is: PCA1 : 34.28%; PCA2:5.46 %. The Swiss reference cats fall out as expected across the cluster and can be used to bench-mark other cats, for
example WCQ0114 has high genetic similarity to the Swiss reference F1 hybrid cat.
13
Use of reference data to choose 35 markers for the test panel
The reference data matrix (82 individuals x 83 SNPs) was used to choose the additional
markers for the panel. To do this, the dataset was analysed using STRUCTURE 2.3.4
(Pritchard et al. 2000; Falush et al. 2003; Pritchard 2010). STRUCTURE is a piece of
population genetic software that can be considered the “gold standard” for population
assignment and admixture (hybridisation) analysis. It is commonly used in similar analyses
and uses a Bayesian clustering algorithm to statistically assign an individual to each of a
number of clusters based on the available genetic data. The model makes use of the
observation that true populations show two properties in their genetic data: 1: “Hardy-
Weinberg Equilibrium” and 2: “Linkage Equilibrium”, and STRUCTURE seeks to optimise the
individuals into the best genetic clusters that conform to these properties (see references
above for more details).
The following (standard) model was chosen: 500,000 burn-in, 1,000,000 MCMC reps,
Admixture model (infer alpha), Correlated allele frequencies model (Lamda =1). Null allele
frequencies were estimated simultaneously using the RECESSIVEALLELES=1 option and by
setting dummy values at each locus (see STRUCTURE manual). This was done since the
presence of null alleles has the possibility of distorting estimates of hybridisation (Senn &
Pemberton 2009a). The model was run for K=2 (since we are investigating a hybridising
scenario between two populations8). Three replicates of the analysis were run to ensure
stability of the results.
The two genetic clusters generated by STRUCTURE were assumed to represent domestic
and wild genetic populations as benchmarked against the Swiss reference samples. Pelage
data was not taken into account during this analysis.
The Q-hat scores from STRUCTURE (estimates of the posterior probability of a cat belonging
to wildcat) were examined9 and the dataset was divided into two sets using the following
criteria. Set 1, (the “domestic set”): cat with scores of Q <0.25, consisting of two Swiss
domestic cats and eight feral cats collected from across Scotland. Set 2, (the “wild” set): cats
with scores of Q >0.75, consisting of the two Swiss wildcats and 35 wild-living cats from
Scotland and captive wildcats from across the UK. This equates to approximately judging
“1st generation backcross to wild and better” against “1st generation backcross to domestic
and worse”.
Pairwise Fst, a measure of population differentiation, was calculated for all SNPs across
these datasets using Genepop 4.2. The loci were ranked according to Fst. SNPs with the
highest values of Fst were taken to show the highest level of genetic differentiation between
the two groups (i.e. had the greatest power to distinguish between the two). The loci were
then chosen according to these approximate criteria: highest ranking SNPs not on the same
chromosome of another SNP already in the panel. When the chromosome choices had been
depleted, the highest ranking loci not within 1,000,000 bp of other loci on panel were
selected. This ensured that loci showing high levels of differentiation were chosen, but that
8
A graph of LnD(P) at other values of K can be found in Appendix 2
9
The scores for individual cats can be found in Appendix 3.
14
they were also not tightly linked on the genome (discussed later). The position of each locus
on the domestic cat genome is given in Table 1.
The performance of statistical methods (STRUCTURE) and the empirical limits to the test
The performance of STRUCTURE at various numbers of loci was evaluated by running the
data set of 82 individuals through STRUCTURE according to the parameters above, using
panels of different sizes. These were:
1. The original panel of 13 SNPs 10
2. The final choice panel of 35 SNPs (which contained 12 of the original SNPs).
3. A panel of 24 and 30 SNPs (to further explore the degree of confidence with fewer
markers) based on similar choice criteria to the ones chosen for the final panel of 35
(i.e. high Fst and not closely located on chromosomes).
4. The full panel of 83 SNPs.
For each of these datasets STRUCTURE was used to allocate a hybrid score for each
individual and calculate a 90% posterior probability interval (confidence interval) around the
score.
A comparison of the extremes of the test (13 versus 83 loci) shows that hybrid categories
allocated are generally similar, although there is appreciable variation in scores between the
two tests (Figure 2):
10
14 original loci minus the locus dropped by the Swiss research group. Since this locus had been dropped it
was not possible to make any comparisons.
15
Figure 2: (above) relationship between the test at the original 13 SNPs and the entire Swiss panel of
83 individuals. The correlation is statistically significant however the variance between results of the
different test is still quite large. For example a cat (orange arrow) given a score of ~40% (~0.4)
wildcat on the 13 SNP test is given a score of >60% (>0.6) wildcat on the 83 SNP test. For the
arguments given above, we assume that the 83 SNP test has an inherently higher level of reliability
16
than the test with a lower numbers of markers. (Below) the relationship is tightened if we compare
83 against 35 markers.
We make the assumption, for the argument given above, that the value produced by the 83
SNP test is closer to the true hybrid score. In order to understand this better, it is
informative to look at the confidence intervals surrounding the hybrid scores; which
decrease with increasing number of loci:
Table 5: The average width of the 90% posterior probability (confidence) interval surrounding each
hybrid score in the test panel of 82 cats. Confidence intervals decrease with increasing numbers of
loci i.e. our confidence in the test increases with increasing numbers of loci.
%
relative
to 83
Average width of 90% posterior probability confidence panel
Panels interval around hybrid score width
Original 13 0.2892 208%
24 0.2062 148%
30 0.1835 132%
Final 35 0.1757 126%
83 0.1389 100%
It can be seen that the width of the probability interval decreases with an increasing number
of SNPs. A decrease in the number of SNPs from 83 to 35 increases the probability interval
to 126% of the 83 SNP panel width.
A plot of the data (Figure 3) reveals that the degree of uncertainty relative to the hybrid
score changes across the range of hybrid score.
Using 35 loci the average level of uncertainty around a hybrid score is 0.1757. This increases
to approximately 0.2 at hybrid scores of 0.75 (75% wildcat) and to 0.225 at a score of 0.5
(50% i.e. F1).
Using 35 loci approximately halves the level of uncertainty, in comparison to using 13 loci.
Figure 3 illustrates the confidence interval in the different datasets.
17
0.5
0.45
Uncertainty surrounding Qhat (90% posterior
0.4
0.35
probability interval)
0.3
13
0.25 24
30
0.2
83
0.15
final 35
0.1
0.05
0
0 0.2 0.4 0.6 0.8 1
"Hybrid score" Qhat (estimated probabilty of being a wildcat)
Figure 3: The uncertainly surrounding the hybrid score, against the hybrid score for each cat in the test panel of 82 cats, for each of a panel of loci
(13,24,30,35,83).
18
Discussion of limitations of the test
11
Primarily (admixture) linkage disequilibrium, implemented through STRUCTURE model.
19
Table 6: Details of the reference samples used to choose the original panel of 14 SNPs and their
scores using the new SNP test. The new test contain 35 SNPs however the original cats (below) were
only scored for 33 of these 35 SNPs because the Swiss test panel changed between the two studies
and the original panel did not contain SNP044 & SNP045). In addition the cats were also just
analysed using the new 21 Loci that did not overlap with the original panel of 14. In both cases the
resulting hybrid scores place the cats in the correct category i.e. wildcat or domestic.
12 13 11 12
RZSS_ID Other 7PS Q LBQ UBQ Q (21) LBQ UBQ Function in
Accession No (33) (33) (33) (21) (21) original test
panel
WCQ0348 0.978 0.936 1 0.956 0.884 0.998 German WC
WCQ0349 0.985 0.947 1 0.965 0.897 0.998 German WC
WCQ0350 0.977 0.936 1 0.965 0.897 1 German WC
WCQ0351 0.987 0.952 1 0.982 0.933 1 German WC
WCQ0352 0.968 0.906 1 0.922 0.814 0.998 German WC
WCQ0353 0.026 0 0.074 0.028 0 0.093 German DC
WCQ0354 0.059 0.008 0.126 0.058 0 0.157 Scottish DC
WCQ0355 0.087 0.019 0.166 0.113 0.011 0.235 Scottish DC
WCQ0356 0.125 0.052 0.212 0.167 0.043 0.301 Scottish DC
WCQ0364 1958.8 19 0.983 0.942 1 0.956 0.876 1 Scottish WC
Null alleles
Null alleles are alleles that fail to amplify at a locus due to a mutation in the primer binding
site. Homozygous individuals will appear to have a failed genotype and heterozygous
individuals will score as a homozygote. There is the potential for null alleles to interfere
with the determination of hybridism, as false homozygotes scores at SNPs with null allele
can inflate or deflate estimates (Senn & Pemberton 2009). For this reason, the STRUCTURE
analysis is used to jointly estimate null allele frequency during the assignment analysis. The
null allele frequency estimates from this analysis can be found in the Appendix 1. Estimates
range from 0.2-4.8% across both populations. The following loci had an estimate of >2% null
allele frequency in the wildcat population cluster: SNP048, SNP196, and the following for
the domestic cat cluster: SNP012, SNP058, SNP114, SNP115, SNP143, SNP190, SNP196. The
likely presence of null alleles does not, however, appear to have a large effect on the
estimations of hybridism as shown by a comparison of Q-hat hybrid scores generated in
STRUCTURE, with or without the null allele estimation model:
12
Lower boundary of the 90% confidence interval for Q (see later)
13
Upper boundary of the 90% confidence interval for Q (see later)
20
Figure 4: Performance of STRUCTURE model with and without the option to simultaneously estimate
null allele frequency on hybrid score (above) and confidence interval surrounding the hybrid score
(below). The impact of null alleles on hybrid score estimation and its confidence is negligible.
21
Physical linkage
There is a potential issue with physical linkage amongst the chosen 35 markers. One of the
assumptions of the STRUCTURE model is that the markers behave genetically as “unlinked”.
Where markers are situated on the same chromosome, this assumption is technically
violated. The more closely linked the markers are, the less likely they are to be recombined
in a given time period, and the greater the breach of this assumption. The more markers
that are used, the more likely this assumption is to be breached. Where markers are
thought to be independent and are in fact not, this has the potential to skew estimates of
hybridism. Map distances between the markers ordered along chromosomes are shown in
Table 7.
As a rough guide, within the human genome markers situated more than 100,000,000 base
pairs apart are likely to recombine each generation (rate is approx 0.01 crossing per Million
bp) and so essentially behave independently. Comparison of physically linked markers in
Table 6 shows that most are more closely situated than this.
In order to examine the possible effect of linkage on estimates of hybridisation, the linkage
model in STRUCTURE (Falush et al. 2007) was employed. The linkage model essentially
states that linked markers are more likely to come from the same population and weights
this likelihood by the distance between them. The linkage model was run using the
distances in Table 6 with the same parameters used for the other analyses (see above)
including the null allele model.
Linkage does not have any appreciable effect on the estimations of Hybrid score or its
confidence (Figure 5). The linkage model also does not appear to improve the estimates
(reduce confidence interval).
22
SNP127 B3_132539085 57,044,709
SNP166 B3_147841323 15,302,238
SNP030 B4_45476816 -1
SNP129 B4_96741303 51,264,487
SNP101 B4_143164026 46,422,723
SNP176 C1_112821482 -1
SNP133 C1_163375181 50,553,699
SNP178 C1_189621758 26,246,577
SNP050 C1_223335334 33,713,576
SNP102 C2_142858667 -1
SNP058 D1_126067118 -1
SNP060 D1_128802001 2,734,883
SNP062 D2_88876341 -1
SNP187 D3_49022779 -1
SNP190 D3_88773687 39,750,908
SNP084 D4_103411241 -1
SNP098 E1_47901546 -1
SNP195 E2_33320051 -1
SNP196 E2_50523470 17,203,419
SNP044 E3_12301230 -1
SNP045 F1_24323263 -1
SNP047 F2_7927040 -1
SNP143 F2_29878116 21,951,076
23
Figure 5: Performance of STRUCTURE model with and without the linkage model on hybrid score
(above) and confidence interval surrounding the hybrid score (below). The impact of linkage on
hybrid score estimation and its confidence is negligible.
24
Discussion of other software for estimating hybridism
New Hybrids (Anderson & Thompson 2002) has previously been used to assign hybrid
category to wild cat data (Nussberger et al. 2013; the SNH survey of 2013/14
(Commissioned report 768)). This test uses a similar (Bayesian) model to STRUCTURE to
assign the animals in the dataset to discrete categories (e.g. Wildcat, Domestic, F1, F2, Bx1
etc). Although it appears to be a conceptually more simple result to understand than the Q-
hat value provided by STRUCTURE, it is however a less appropriate test for the scenario in
Scotland. The reason for this is that it seems likely that the “hybrid swarm” pattern of
hybridisation found in Scotland is old and therefore generating complex hybrids. We can
imagine a scenario where F1 are mating with Bx2, F2 are mating with Bx5 etc. In other
words the cats do not conform to simple categories proposed by the New Hybrids model.
This means that cats can often be assigned to multiple categories with low probability and
are sensitive to “jumping” category when different reference data is used in the analysis
(data not shown here).
The simple estimation of the proportion of the genome that is introgressed that is
essentially provided by STRUCTURE14 is likely to be more accurate and is actually simpler to
interpret.
14
Formally the posterior probability of belonging to a given cluster.
25
The value of 75% (0.75) is chosen as this represents the proportion of a genome that would
be “wildcat” in a first generation backcross to wildcat, Bx1wildcat (i.e a cat with one
domestic grandparent).
The cut off used allows us to select cats in which we have approximately a 95%15
confidence of being better than first generation backcross.
Given the high degree of introgression found in the Scottish wildcat (see Figure 1), this is
considered to be the best value to balance issues surrounding stringency, leniency and
inherent uncertainty in the genetic test (see above). The threshold could be increased if
more animals with a high proportion of wildcat ancestry are found to exist.
This cut off is illustrated graphically in Figure 6.
With a differing number of loci this cut-off would have the following implications for the
wild and captive cats in the test dataset (Table 8). It can be seen from the table that
increasing the number of loci, in general, decreases the number of cats that we are
uncertain about, however an increase beyond 35 loci brings few benefits under this cut-off
system versus using the full 83 loci.
Table 8: Decision made on cats in the test dataset using the cut-off detailed above with various
datasets of different loci.
15
95% because the 90% confidence interval is two-tailed.
26
Figure 6: Hybrid scores for individual cats scored at 35loci in the test data set. Cats are ordered along the bottom of the graph. Points represent the hybrid
score at an individual cat. Lines represent the 90% confidence interval. Cats in green are “Good wildcat”, cats in red are “Certain not good wildcat”, cats in
grey are “Cat of uncertain genetic status.
27
Power of mtDNA test:
Mitochondrial tests alone are not suitable for determining hybridisation since they only
provide information regarding the female to female lineage (matriline). Essentially this test
only provides information on one of the 2n possible ancestors that an individual has n
generations back. In conjunction with nuclear markers it is useful for assaying recent
hybridisation, but becomes harder to interpret the older hybridisation events are.
Data generated as part of this report shows that the power of this test is likely to be very
low because even genetically “good” cats at nuclear loci have mitochondrial DNA
introgression (Figure 7). This suggests that either the mitochondrial haplotype is not fixed
between these two species (ancestral polymorphism) or that introgression has been
happening for a long time between wild and domestic cats in Scotland.
Therefore we state here:
1. That this test is only used to provide corroborating evidence in the event that a decision
has to be made about a “cat of uncertain genetic status” that has to go to committee (see
The test decision).
Within the conservation breeding programme, the ultimate aim is to breed this trait out. A
best strategy for doing this (i.e either in the short, or longer term) will be established
according to its impact on other genetic factors (i.e inbreeding) within the captive breeding
pool and is beyond the scope of this document.
28
Q HAT
Figure 7: Hybrid Score (at 83 loci) for wild and captive cats. Blue bar represent the hybrid score obtain from STRUCTURE. Red stars represent the domestic
mitochondrial haplotype. It can be seen that cats with a high value of Q (i.e very wildcat) have mitochondrial DNA introgression. This suggest that either the
mitochondrial haplotype is not fixed between these two species (ancestral polymorphism) or that introgression has been happening for a long time.
29
Pelage Scores
We also investigated the relationship between pelage score (7PS) and DNA hybrid score.
The cats detailed here are cats in the test dataset (Appendix 3) from the National Museum
of Scotland (NMS) and the SNH survey of 2013/14 (Commissioned report 768). The cats
were scored by Dr Andrew Kitchener and Charlotte Wagener NMS.
There a weak positive relationship between the two types of marker for the range of cats
that have been investigated at 83 loci (Figure 8). A previous survey that used 9 microsatellite
markers (SNH Commissioned report no. 356, 2010), the survey by Beaumont et al. (2001),
and the meta-analysis presented by Neaves & Hollingsworth (2013) have drawn similar
conclusions.
Figure 8: Relationship for hybrids score (at 83 loci) and pelage score (7PS) for the 47 cats for which
both types of data exists. There is a weak positive correlation between the two. A larger sample size
is required to investigate the relationship between the two scores properly, emphasising the need for
ongoing scientific research.
The explanation for this weak correspondence is likely to include the following reasons:
Phenotypic traits measured in wildcats are likely to be under the control of a small number
of genes. The genetic test surveys a number of different genes that are probably not in tight
linkage to the genes that control these phenotypic traits. In recent hybrids we would expect
the correspondence between phenotypic traits and hybrid score to be reasonable (due to
30
linkage disequilibrium), however in a situation of complex ancient hybridisation this
relationship is likely to be broken up as small chunks of domestic cat genome enter the
wildcat population carrying single genes that exert a large effect on phenotype (either as
dominants or recessives). In the case of recessives, as the gene pool shrinks they are more
likely to be presented as homozygotes.
As yet, we are not in a technical position to understand the genes that control wildcat
phenotype across the wide suit of genes for pelage, behaviour, physiology etc. that
distinguish wildcats from their domestic relative. It should be noted, that pelage scores are
only one subset of the phenotypic traits that make a wildcat a wildcat. The pelage score is
however a trait that is easy to measure, not likely to be subject to too much environmental
variation and is of importance to the general public 16.
The lack of correspondence between genetic and phenotypic pelage characteristics should
perhaps not be viewed as a problem, instead it is a logical consequence of a situation
involving hybridisation over a number of generations. It is not unlikely that single genes may
have considerable effect on phenotype; mutations to the human gene melanocortin 1
receptor (MC1R) which as a homozygote confers not only red hair colour but pale skin in
humans is a good illustration of this fact. In animals, for example, a small number of genes
has been implicated in coat colour variation in a large number of mammals, including house
mice (Mus musculus), Soay sheep (Ovis aries), dogs (Canis familiaris) and other domesticated
animals (Schmutz & Berryere 2007; Gratten et al. 2010; Cieslak et al. 2011).
Under the very reasonable assumption that pelage characteristics are indeed under genetic
control we should view them as additional independent genetic markers. Thus nuclear loci
and pelage traits should be taken as independent lines of evidence when making decisions
about whether or not a cat is a wild cat and a suitable candidate for conservation
breeding.
16
See also objectives of Scottish Wildcat Conservation Action Plan (SNH 2013).
31
The test decision
The Principle of the test
The principle of the test is that genetic and pelage traits are taken as independent lines of
evidence. They are scored blind with respect to one another.
The details
Pelage Scoring Criteria
Standardised images from each individual will be taken whilst under anaesthesia according
to the Photography Protocol (section 4.3). These will be sent to NMS for pelage scoring by
trained personnel. The individual undertaking the scoring will not be made aware of the
identity (trap location or captive collection for example) of the cat to be scored, or of any
genetic screening result. The findings will be considered in conjunction with results from the
genetic screening on an individual basis, but as a general principle cats scoring <16 will be
rejected, whilst those scoring >18 will be included in the conservation breeding programme
subject to their genetic score. Those individuals scoring from 16 to 18 will require further
consideration on their suitability (see detailed decision matrix below).
32
Combined pelage and genetic scoring decision matrix:
1. Pelage and genetic scores will be generated independently and compared against
this matrix:
MATRIX 1
FAIL UNCERTAIN PASS
(UBQ<0.75) (UBQ>0.75/LBQ <0.75) (LBQ>0.75)
<16 ✖ ✖ ✔*
Pelage Criteria (7PS)
16-18 ✖ ? Go to sub-matrix 2 ✔
>18 ✖ ✔ ✔
33
2. Cats with an intermediate matrix score (falling into the central blue square above)
will be further assessed against a refined matrix, as follows:
SUB-MATRIX 2
✖ ? go to committee
Pelage Criteria (7PS)
16
17 ✖ ✔
18 ? go to committee ✔
3. Following the results of the refined matrix assessment, any cats that are still
considered to be intermediate “?” (above) will be evaluated individually by a panel
of three assessors from the National Museum of Scotland, the Royal Zoological
Society of Scotland and Scottish Natural Heritage.
Process documentation:
The genetic and pelage scoring results and final decision on each cat will be documented in
a standardised case file for each individual.
Process review:
Test selection criteria will be reviewed after first captive season, though a review of case
files, by the Scottish Wildcat Conservation Action Plan Steering Group.
34
References
Anderson EC, Thompson EA (2002) A Model-Based Method for Identifying Species Hybrids
Using Multilocus Genetic Data. , 1229, 1217–1229.
Beaumont M, Barratt EM, Gottelli D et al. (2001) Genetic diversity and introgression in the
Scottish wildcat. Molecular ecology, 10, 319–36.
Daniels MJ, Beaumont MA, Johnson PJ et al. (2001) Ecology and genetics of wild-living cats
in the north-east of Scotland and the implications for the conservation. , 146–161.
Driscoll C, Yamaguchi N, O’Brien SJ, Macdonald DW (2011) A suite of genetic markers useful
in assessing wildcat (Felis silvestris ssp.)-domestic cat (Felis silvestris catus) admixture.
The Journal of heredity, 102 Suppl , S87–90.
Gratten J, Pilkington JG, Brown E a et al. (2010) The genetic basis of recessive self-colour
pattern in a wild sheep population. Heredity, 104, 206–14.
Kitchener AC, Yamaguchi N, Ward JM, Macdonald DW (2005) A diagnosis for the Scottish
wildcat (Felis silvestris): a tool for conservation action for a critically-endangered felid.
Animal Conservation, 8, 223–237.
Mattucci F, Oliveira R, Bizzarri L et al. (2013) Genetic STRUCTURE of wildcat ( Felis silvestris )
populations in Italy. Ecology and Evolution, 3, 2443–2458.
Neaves, L.E. & Hollingsworth, P.M. 2013. The Scottish wildcat (Felis silvestris); A review of
genetic information and its implications for management. Conservation Genetic
Knowledge Exchange, Royal Botanic Gardens, Edinburgh
35
Nussberger B, Greminger MP, Grossen C, Keller LF, Wandeler P (2013) Development of SNP
markers identifying European wildcats, domestic cats, and their admixed progeny.
Molecular ecology resources, 13, 447–60.
Pierpaoli M, Biro ZS, Herrmann M et al. (2003) Genetic distinction of wildcat (Felis silvestris)
populations in Europe, and hybridization with domestic cats in Hungary. Molecular
Ecology, 12, 2585–2598.
Randi E (2008) Detecting hybridization between wild species and their domesticated
relatives. Molecular ecology, 17, 285–93.
Le Roux JJ, Foxcroft LC, Herbst M, MacFadyen S (2014) Genetic analysis shows low levels of
hybridization between African wildcats ( Felis silvestris lybica ) and domestic cats (
F. s. catus ) in South Africa. Ecology and Evolution, n/a–n/a.
Schmutz SM, Berryere TG (2007) Genes affecting coat colour and pattern in domestic dogs:
a review. Animal genetics, 38, 539–49.
Senn H V, Swanson GM, Goodman SJ, Barton NH, Pemberton JM (2010) Phenotypic
correlates of hybridisation between red and sika deer (genus Cervus). The Journal of
animal ecology, 79, 414–25.
36
Witzenberger K a, Hochkirch A (2014) The genetic integrity of the ex situ population of the
European wildcat (Felis silvestris silvestris) is seriously threatened by introgression from
domestic cats (Felis silvestris catus). PloS one, 9, e106083.
37
Appendices
Appendix 1: Allele frequencies at the 35 SNPs in the 82 individual test dataset
Estimate of Ancestral Estimate in Domestic
Locus Allele Freq Cat Estimate in Wildcat
SNP001 G 0.488 0.966 0.08
C 0.376 0.03 0.918
Null 0.136 0.003 0.002
38
SNP048 C 0.451 0.95 0.115
T 0.346 0.04 0.837
Null 0.203 0.01 0.048
39
SNP127 C 0.384 0.966 0.007
T 0.451 0.029 0.99
Null 0.164 0.004 0.003
40
SNP190 C 0.319 0.843 0.003
G 0.481 0.103 0.993
Null 0.2 0.054 0.004
41
Pelage score (7Ps)
(Scored by Andrew
mtDNA Kitchener/ Charlotte
ID Other_ID Q (83loci) LBQ UBQ type Wagener NMS) Sex Locality description
rHK60 0.065 0.018 0.12 SWISS DOMESTIC REF
rHK64 0.058 0.014 0.112 SWISS DOMESTIC REF
rWK24 0.736 0.661 0.807 SWISS BxWC REF
rWK28 0.989 0.966 1 SWISS WILDCAT REF
rWK54 0.558 0.478 0.637 SWISS F1 Ref REF
rWK56 0.992 0.974 1 SWISS WILDCAT REF
WCQ0047 PH04.96 0.931 0.878 0.975 wild 18 F A832
WCQ0052 R171.99 0.898 0.842 0.946 wild 18 F Scotland, Argyll, Ardslignish
Scotland, Ross-shire, Black Isle, Munlochy, On
WCQ0053 R172.99 0.93 0.88 0.972 wild 12+ F A832 Eof
WCQ0073 2/408 0.042 0.004 0.094 domestic 8 F Garve, Inchbae
WCQ0097 PH23.12 0.046 0.006 0.099 domestic F Glenlivet estate
WCQ0098 PH24.12 0.503 0.42 0.586 domestic 11 F Glenlivet estate
WCQ0099 GH22.12 0.089 0.038 0.147 domestic 16 F Portlethen/Aberdeenshire
WCQ0100 GH37.12 0.317 0.24 0.398 wild 12 F Castle Grant\Strathspey
WCQ0104 PH13.12 0.477 0.394 0.561 wild F Road B976
WCQ0105 R103.03 0.424 0.342 0.507 wild M A947, Parkside, near Oldmeldrum
WCQ0107 RL45/97 0.659 0.576 0.739 domestic F Grantown-on-Spey
WCQ0110 GH10.12 0.854 0.786 0.915 wild M Between Kinveachy and Rattray/Strathspey
WCQ0114 GH40.12 0.544 0.458 0.629 domestic 12 F Dunbeath/Caithness
WCQ0116 GH42.12 0.544 0.462 0.625 wild M Tarras Woodland\Moray
WCQ0118 GH44.12 0.546 0.462 0.629 wild 14 F East Lodge, Balavil Estate/Badenoch
WCQ0119 GH45.12 0.441 0.358 0.524 wild F B9119 near Wester Tulloch/Aberdeenshire
WCQ0132 PH125.13 0.828 0.756 0.894 wild 14 F na- captive
WCQ0137 PH30.11 0.528 0.445 0.611 domestic M Road A944 Delhand Bridge
42
WCQ0155 GH05.10 0.926 0.861 0.979 domestic 12 F Port Lympne WAP
WCQ0157 GH07.10 0.943 0.893 0.984 domestic 17 M 90/92 L
WCQ0158 GH08.10 0.92 0.869 0.963 wild 12 M Kinveachy Junction
WCQ0159 GH09.10 0.868 0.799 0.93 wild M Ballintean, Glen Feshie
WCQ0160 GH10.10 0.882 0.822 0.934 wild 13 M Lochranza, Cullicudden, Culbokie
WCQ0161 GH14.10 0.668 0.585 0.749 wild M Drumtochty Glen, Auchenblae
WCQ0165 GH27.10 0.072 0.026 0.127 domestic 9 M Nethy Bridge
WCQ0166 GH28.10 0.333 0.252 0.416 wild F na- captive
WCQ0167 GH29.10 0.974 0.924 0.999 domestic M na- captive
WCQ0168 GH31.10 0.406 0.323 0.49 domestic 10 M A944 near Strathdon
WCQ0170 GH38.10 0.437 0.356 0.519 wild F na- captive
WCQ0171 GH39.10 0.51 0.427 0.593 wild M Laggantrygonn Cemetry
WCQ0172 GH40.10 0.22 0.149 0.295 wild 13 M Upcott Grange Farm, Devon
WCQ0208 PH114.13 0.719 0.639 0.795 wild 14 F Auchleven
WCQ0209 GCB 0.685 0.605 0.761 wild 16 F Gartly, Aberdeenshire
WCQ0210 GH10.12 0.854 0.786 0.915 wild M Between Kinveachy and Rattray/Strathspey
WCQ0211 GH16.10 0.905 0.85 0.952 wild 13 F A837 Lochinver-Inchnadamph, Assynt
WCQ0212 GH31.12 0.804 0.731 0.872 wild 17 M A957 Slug Road, Rickarton, Stonehaven
WCQ0213 GH4.10 0.807 0.731 0.878 wild 15 F Rymore, Tulloch, Nethybridge
WCQ0214 GH6.10 0.904 0.846 0.954 wild 13 Banffshire, Ordiquill, near Cornhill
WCQ0215 GH8.12 0.359 0.278 0.442 wild 12 F Between Newtonmore and Kingussie
MOR-CB
WCQ0216 = MO 0.659 0.58 0.736 wild 15 F Morvern, Lochaber
WCQ0217 P2M1 0.915 0.852 0.969 wild 13+ na-captive
WCQ0218 PH18.12 0.74 0.662 0.813 wild 13 M Road A9 at pass of Binnam
WCQ0221 WCT-T1 0.3 0.223 0.379 wild 17 Near Wick- Bridge of gillock
WCQ0222 G-CC 0.754 0.679 0.824 wild 12 Gartly, Aberdeenshire
WCQ0223 GCD 0.54 0.456 0.622 wild 15 M Gartly, Aberdeenshire
WCQ0224 GCE 0.801 0.731 0.866 wild 8 F Gartly, Aberdeenshire
43
A939 Grantown-on-Spey to Tomintoul rd ,
WCQ0225 GH17.10 0.697 0.618 0.772 wild 16 about 5 mile south of Grantowen-on-Spey
WCQ0226 GH25.12 0.588 0.504 0.67 wild M Drumochter Pass/Badenoch
WCQ0227 GH36.12 0.267 0.192 0.346 wild 13 F A95 South of Grantown-on-Spey
WCQ0228 GH60.10 0.22 0.149 0.295 wild 14 M Nethy Bridge
MOR-CA
WCQ0229 = MOR- 0.403 0.321 0.487 wild 11 F Morvern, Lochaber
WCQ0230 PH27.12 0.404 0.322 0.488 wild 15 M Drumtochty,Aberdeenshire
WCQ0231 PH31.12 0.477 0.394 0.561 wild 17 M Drumtochty, Aberdeenshire
ANG-CA
WCQ0234 =ANG J 0.597 0.515 0.678 wild 7 F Angus
WCQ0235 GH23.12 0.361 0.282 0.442 wild 12 M Gartly, near Huntly
WCQ0236 GH24.12 0.476 0.395 0.557 wild 12 F Blacklunans, Glenshee/Perthshire
WCQ0243 P1F1 0.935 0.866 0.989 domestic 19 F na- captive
WCQ0244 P1M1 0.862 0.787 0.932 domestic 18 M na-captive
WCQ0245 P2F1 0.913 0.84 0.978 domestic 19 F na- captive
BO-CA =
WCQ0246 SBO-B 0.556 0.473 0.638 domestic 14 M Strathbogie, Aberdeenshire
WCT-CPL
WCQ0247 (Diesel) 0.75 0.675 0.821 domestic Male Aviemore
WCQ0248 WCT-T2 0.918 0.847 0.981 domestic 17 Roadside- Moy Bridge Brahan Estate A835
WCQ0249 GCA 0.581 0.497 0.663 domestic 10 M Gartly Aberdeenshire
WCQ0250 Kitten' 0.665 0.584 0.743 domestic Glen Muick, Aberdeenshire.
WCQ0251 Scaniport 0.187 0.119 0.26 domestic M Scaniport, Invernesshire
SBO-CC =
WCQ0252 SBO-C 0.505 0.421 0.588 domestic 15 M Strathbogie, Aberdeenshire
WCQ0253 CV1 0.185 0.12 0.256 domestic F Ben Wyvis area
WCQ0255 GH30.12 0.375 0.294 0.459 domestic 18 M Kaims of Airlie
WCQ0256 GH34.12 0.313 0.236 0.393 domestic 12 M Dava moor
WCQ0335 Cama 0.913 0.843 0.972 wild Female na- captive
44
WCQ0336 Edana 0.886 0.758 0.987 domestic Female na- captive
WCQ0337 Sid 0.924 0.853 0.979 domestic Male na- captive
WCQ0338 Finn 0.849 0.758 0.93 domestic Male na- captive
WCQ0339 Muira 0.886 0.816 0.947 domestic Female na- captive
WCQ0340 Iona 0.863 0.787 0.933 domestic Female na- captive
WCQ0341 Forba 0.841 0.762 0.914 domestic Male na- captive
WCQ0342 Alvie 0.885 0.82 0.943 wild na- captive
WCQ0343 Kendra 0.928 0.869 0.977 wild na- captive
WCQ0344 Iona 0.953 0.899 0.993 wild na- captive
WCQ0345 Garton 0.945 0.89 0.989 wild na- captive
45
Appendix 4: Physical validation of the test
This section details how the test was validated in the laboratory at RZSS:
The SNP marker assays were ordered from Applied Biosystems as Order Custom TaqMan®
Probes and tested on a dataset of reference indivduals from the WildGenes laboratory,
RZSS. The alleles that correspond to given dyes can be found in Table 1. Probe information
including reodering numbers can be found in Appendix 4.
The probes were tested on a dataset of reference individuals from the WildGenes
laboratory. These consisted of 45 wild and domestic type cats including 4 individuals
previously part of the test dataset generated on the Swiss system of 83 SNPS
(WCQ073,WCQ105,WCQ118,WCQ0227) and 12 internal controls that were repeated twice
(denoted r in Table 9) . A single sample of sand cat Felis margarita (SCA098) was also
included as this species is commonly processed in the WildGenes laboratory and is closely
related. Two non-template (negative) controls were included as is standard.
Samples were run according to the conditions detailed in the standard test protocol (see
below). Results were as follows, plots of all the SNPs can be found in Appendix 6:
100% of the genotypes that were called matched with the internal positives.
100% of the genotypes that were scored matched between the data generated by
the Swiss system and the data generated by RZSS.
46
Appendix 5: Standard Test protocol at RZSS
- Extract two replicates of sample using 100µl EDTA blood using standard fuji film protocol. One
blank extraction extracted along side.
PER SAMPLE:
3.75ul ddH2O
-Label the reaction plate on the side only (do not write on the top of the plate).
-Pipette 1ul of DNA in to the appropriate well (remember to use four positive controls and two non-
template controls per SNP (one of 1ul ddH2O, and the other of 1ul extraction control)).
-See below for an example of plate set up for one sample, testing six SNPs.
1 2 3 4 5 6 7 8
SNP001 A NTC ddH2O NTC extraction Run Run Run Run Sample1.1 Sample1.2
control1 control2 control3 control4
SNP012 B NTC ddH2O NTC extraction Run Run Run Run Sample1.1 Sample1.2
control1 control2 control3 control4
SNP014 C NTC ddH2O NTC extraction Run Run Run Run Sample1.1 Sample1.2
control1 control2 control3 control4
SNP016 D NTC ddH2O NTC extraction Run Run Run Run Sample1.1 Sample1.2
control1 control2 control3 control4
SNP019 E NTC ddH2O NTC extraction Run Run Run Run Sample1.1 Sample1.2
control1 control2 control3 control4
SNP026 F NTC ddH2O NTC extraction Run Run Run Run Sample1.1 Sample1.2
control1 control2 control3 control4
-Add 9ul of the mastermix to each well (use 8ul if using 2ul of DNA) and seal the plate with
MicroAmp optical adhesive lids or MicrAmp optical 8-stip caps.
47
Briefly spin the plate to ensure all the samples are at the bottom of the wells.
The PCR can be run on either the StepOne or using a thermocycler. The endpoint read must be done
on the StepOne.
PCR Conditions:
Stage Step Temp Time (StepOne)
Holding DNA polymerase 95˚C 20 sec
activation
Cycling Denature 95˚C 3 sec
(40 cycles) Anneal/Extend 60˚C 30 sec
Data analysis
-Step one machine is step up to automatically call genetpyes as laid out in Table 1.
- Data analysed in STRUCTURE using the following (standard) model: 500,000 burn-in, 1000,000
MCMC, Admixture model (infer alpha), Correlated allele frequencies model (Lamda =1). Null allele
frequencies were estimated simultaneously using the RECESSIVEALLELES=1 option and by setting
dummy values at each locus (see STRUCTURE manual). The model run at K=2 for 3 replicates.
-Qhat values of reference data set compared to known Qhat values for this data set
48
Appendix 6: Nuclear SNP assay information and reorder numbers
ROYAL ZOOLOGICAL SOCIETY SCOTLAND 5556093 19-JAN-15
4332077 Custom Taqman(R) SNP Genotyping Assay Service
AHS1P79 96-position tube rack v1 1382223
10-digit barcoded tube 0168673674 A01 40x SNP195_F
TCCTGTCTGGCCAGTCTTCTT 36 SNP195_R CCTGCATCCACTGCTTTATAAGGT
36 SNP195_V VIC ATGAACCAATCTCTCCCC 8 NFQ SNP195_M
FAM TATGAACCAATCCCTCCCC 8 NFQ
SNP195
49
ROYAL ZOOLOGICAL SOCIETY SCOTLAND 5556093 19-JAN-15
4332077 Custom Taqman(R) SNP Genotyping Assay Service
AHZAG3D 96-position tube rack v1 1382223
10-digit barcoded tube 0168673669 A06 40x SNP190_F
CAGTGTCTGTCTGGCCATCATTATT 36 SNP190_R
AGAGCTGCTGGTCTCCTCAT 36 SNP190_V VIC TCCAATCCTATCGCACTCA
8 NFQ SNP190_M FAM CTCCAATCCTATCCCACTCA 8 NFQ
SNP190
50
SNP098
51
CAAGAAGAACTATCCTGATGTGGGAAA 36 SNP084_V VIC
TGTATTCAGTGTCTGTATCT 8 NFQ SNP084_M FAM
ATTCAGTGCCTGTATCT 8 NFQ
SNP084
52
ROYAL ZOOLOGICAL SOCIETY SCOTLAND 5556093 19-JAN-15
4332077 Custom Taqman(R) SNP Genotyping Assay Service
AHLJ06Y 96-position tube rack v1 1382223
10-digit barcoded tube 0168673651 B11 40x SNP062_F
CTCTTGTGGACACCCACCAA 36 SNP062_R
GGCATTTCTTAGGAATCCAGATGTGT 36 SNP062_V VIC
ACCTACTGTTTGGTAGGCA 8 NFQ SNP062_M FAM
ACCTACTGTTTTGTAGGCA 8 NFQ
SNP062
53
ATTATGTTTCTAAACCCC 8 NFQ SNP155_M FAM
ATTATGTTTCTAACCCCC 8 NFQ
SNP155
SNP060n
54
AHZAG3E 96-position tube rack v1 1382223
10-digit barcoded tube 0168673635 C10 40x SNP133n_F
AGATTAGTGATTCTCAAAAAGGGAAGCA 36 SNP133n_R
GCTTTAAACACCTTGCTCAGGAGAT 36 SNP133n_V VIC
CAACCCGTGGGTATC 8 NFQ SNP133n_M FAM ACAACCCATGGGTATC 8
NFQ
SNP133n
ROYAL ZOOLOGICAL SOCIETY SCOTLAND 5556093 27-JAN-15
4332077 Custom Taqman(R) SNP Genotyping Assay Service
AHRSR11 96-position tube rack v1 1384653
10-digit barcoded tube 0168673430 A01 40x SNP148_F
CTTTTGGGTACATTTGCTTCACTGAA 36 SNP148_R
TGGTGCTGGAGAACTTGGAATG 36 SNP148_V VIC
TTGGGTAGTCAGGCAACT 8 NFQ SNP148_M FAM
TGGGTAGTCAGACAACT 8 NFQ
SNP148
55
Appendix 7: SNP assay clustering
SNP001
SNP012
56
SNP014
SNP016
57
SNP019
SNP026
58
SNP030
SNP044
59
SNP045
SNP047
60
SNP048
SNP050
61
SNP058
SNP060
62
SNP062
SNP084
63
SNP098
SNP101
64
SNP102
65
SNP114
SNP115
66
SNP127
SNP129
SNP133
67
SNP143
SNP146
68
SNP148
69
SNP155
SNP166
70
SNP176
SNP178
SNP187
71
SNP190
72
SNP195
SNP196
73
WCID
74