Peptides 68 (2015) 190–196

Contents lists available at ScienceDirect

Peptides
journal homepage: www.elsevier.com/locate/peptides

Structure and antimicrobial activity relationship of royalisin, an

antimicrobial peptide from royal jelly of Apis mellifera
Katarina Bílikova a , Sheng-Chang Huang b , I-Ping Lin b,c , Jozef Šimuth a , Chi-Chung Peng b,∗
a
Institute of Forest Ecology, Slovak Academy of Sciences, Zvolen, Detasched workplace Department of Molecular Apidology, Bratislava, Slovakia
b
Department of Biotechnology, National Formosa University, Yunlin, Taiwan
c
Department of Research and Development, Challenge Bioproducts Co., Ltd., Yunlin, Taiwan

a r t i c l e i n f o a b s t r a c t

Article history: Royalisin is a 5.5-kDa antibacterial peptide isolated from the royal jelly of the honeybee (Apis mellif-
Received 24 November 2014 era). The antimicrobial activity of royalisin against fungi, Gram-positive and Gram-negative bacteria
Received in revised form 3 March 2015 has been revealed. Compared with another insect antibacterial peptide, there is an extra stretch of 11
Accepted 5 March 2015
amino acid residues at the C-terminus of royalisin. In this study, a recombinant shortened form of roy-
Available online 14 March 2015
alisin named as royalisin-D, was constructed without the 11 amino acid residues at the C-terminal of
royalisin and linked to the C-terminal of oleosin by an inteinS fragment. The recombinant protein was
Keywords:
overexpressed in Escherichia coli, purified by artificial oil body system and subsequently released through
Royalisin
Shortened form Royalisin
self-splicing of inteinS induced by the changes of temperature. The antibacterial activity of royalisin-D
Antimicrobial properties was compared with royalisin via minimal inhibitory concentration (MIC) assay, minimal bactericidal
Cell membrane permeability concentration (MBC) assay, microbial adhesion to solvents (MATS) methods, and cell membrane perme-
ability. Furthermore, the recombinant royalisin and royalisin-D have also been treated with the reducing
agent of disulfide bonds, dithiothreitol (DTT), to investigate the importance of the intra-disulfide bond
in royalisin. In our results, royalisin-D exhibited similar antimicrobial activity to royalisin. Royalisin and
royalisin D lost their antimicrobial activities when the intra-disulfide bonds were reduced by DDT. The
intra-disulfide bond plays a more important role than the extra stretch of 11 amino acid residues at the
C-terminus of royalisin in terms of the antimicrobial properties of the native royalisin.
© 2015 Elsevier Inc. All rights reserved.

Introduction
Antimicrobial peptides (AMPs) represent ancient host defense
effector molecules in organisms across the evolutionary spectrum
and take an important part in the innate immune system of orga-
nisms, including insects [7,9,17,23]. The research of proteinaceous
antimicrobial substance of insect origin has proven the actual effi-
cacy against the multidrug-resistant bacteria [24,25,29]. One of the
groups of AMPs are defensins belonging to cysteine-rich cationic
antimicrobial peptides that act against a variety of microorgan-
isms and constitute the primary defense system of most organisms
including honeybee [20]. Defensins with distinct structures have
been categorized into three subfamilies: ␣-defensins, ␤-defensins
and insect defensins. ␣-defensins and ␤-defensins are found in
mammalian neutrophils and play important roles in defending
against Gram-positive and Gram-negative bacteria, mycobacteria,
∗ Corresponding author. Tel.: +886 5 6315505; fax: +886 5 6315502.
E-mail address: bocky@nfu.edu.tw (C.-C. Peng).
fungi and some enveloped viruses. Insect defensins comprise 28–54
amino acids, which possess sequence similarity and share common
structural features with each other, such as an amino-terminal loop,
one ␣-helix and two anti-parallel ␤-strands stabilized by three
disulfide linkages [6,14,18].
Royalisin, an insect defensin isolated from the royal jelly (RJ) of
honeybee (Apis mellifera) [16]. The molecular weight of royalisin is
5523 Da, consisting of 51 amino acids, in which six cysteine residues
form three intramolecular disulfide linkages resulting in a compact
globular structure [4]. Royalisin contains a typical disulfide-rich
structure (40 amino acids) with a unique amphipathic ␣-helix and
an amidated carboxyl-terminal tail (11 amino acids) [2]. Inhibitory
effect of royalisin toward fungi, some Gram-negative bacteria [35]
and Paenibacillus larvae, a honeybee pathogen that causes Amer-
ican foulbrood, a lethal disease in honeybee larvae, was observed
[2,4,19]. Recently was found that royalisin is a common component
of honey [5] and participates in the antimicrobial effects of honey
for wound healing [21].
In the previous study, the recombinant royalisin fused with
oleosin and purified via artificial oil bodies (AOBs) expression/

http://dx.doi.org/10.1016/j.peptides.2015.03.001
0196-9781/© 2015 Elsevier Inc. All rights reserved.
 K. Bílikova et al. / Peptides 68 (2015) 190–196
purification system could successfully perform the antimicrobial
activity against Gram-positive bacteria and several Gram-negative
bacteria [35]. AOBs expression/purification system has been suc-
cessfully developed for purifying recombinant protein or enzyme
immobilization in one step by linking a desired protein or
enzyme to oleosin on the surface of AOBs. This novel tech-
nique offers us a more powerful and competitive alternative for
protein purification compared with the affinity chromatography
[11,28,30].
The goal of this study is to investigate the antimicrobial activ-
ity of the recombinant royalisin with a deletion of 11 amino
acid residues at the C-terminal and the disruption of the intra-
disulfide bonds. This recombinant protein, for which we propose
the name royalisin-D, was linked to the C-terminal of oleosin
by an inteinS fragment. The recombinant protein was overex-
pressed in Escherichia coli AD494 (DE3), and purified by artificial
oil body system [15]. The recombinant royalisin-D was further
assayed for its antibacterial activities and compared with royalisin
via minimal inhibitory concentration (MIC) assay, minimal bacte-
ricidal concentration (MBC) assay, MATS (microbial adhesion to
solvents) methods and cell membrane permeability. Furthermore,
the recombinant proteins of royalisin and royalisin-D were treated
with a reducing agent, dithiothreitol (DTT), to demonstrate the
importance of intracellular disulfide bonds and the 11 amino acids
at the C-terminus of royalisin.
Materials and methods
Construction of pET-Roy-OleC-RoyD
The cDNA fragment encoding the 51 amino acid of the
mature royalisin (accession number AY496432) was constructed
in the fusion expression vector pET-Roy-OleC-Roy [35] by
using of the NcoI and EcoRI sites of the vector. The result-
ing plasmid, pET-Roy-OleC-RoyD, was digested by NcoI and
EcoRI; the desired cleaved fragment was isolated and purified
with a Geneclean III kit (Carlsbad). The sequence encoding
the shorten form of royalisin which lacks of the C-terminal
11 amino acids was synthesized by polymerase chain reaction
(PCR) with the forward primer, AAGTTGCCATGGTGCGCGAGTC,
containing a NcoI site (underlined), and the reverse primer,
AAGAATTCTTATTTTCGACAAATACAAACTCCTTTC, containing a
EcoRI site (underlined). The desired PCR product was purified,
digested with NcoI and EcoRI, and then ligated at 16 ◦ C overnight
with the cleaved fragment from the pET-Roy-OleC-Roy plasmid.
The resultant plasmids were used to transform E. coli AD494 (DE3)
(Novagene, Madison, WI) by standard techniques [35]. Trans-
formants were selected on LB agar plates containing ampicillin
(100 ␮g/mL) (Sigma Chemical Co., St. Louis, MO).
Overexpression of oleosin-inteinS-royalisin and
oleosin-inteinS-royalisin-D fusion protein
The plasmids, pET-Roy-OleC-Roy and pET-Roy-OleC-RoyD were
transformed into E. coli AD494 (DE3) (Novagene, Madison, WI) by
standard techniques [31] separately. Transformants were selected
on LB agar plates containing ampicillin (100 ␮g/ml; Sigma Chemi-
cal, St. Louis, MO). The expression system of E. coli AD494 (DE3) with
the plasmid was induced by adding isopropyl-␤-d-thiogalactoside
(IPTG) for recombinant protein production. Overexpression of
the recombinant fusion proteins, oleosin-inteinS-royalisin and
oleosin-inteinS-royalisinD, was induced by adding IPTG to a
final concentration of 0.1 mM in a bacteriophage T7 RNA poly-
merase/promoter system. After induction for 2 h, the E. coli cells
were harvested, lysed by sonication in 10 mM sodium phosphate
191
buffer, pH 7.5, fractionated into supernatant and pellet by cen-
trifugation (13,000 rpm, 10 min), and then subjected to analyses
by SDS-PAGE and western blotting.
Protein recovery
The fusion protein, oleosin-inteinS-royalisin and oleosin-
inteinS-royalisin-D, was expressed in E. coli AD494 (DE3) and
resolved by SDS-PAGE on 12.5% and 4.75% polyacrylamide gels,
as the separating and stacking gels, respectively [22]. After elec-
trophoresis, the gel was stained with Coomassie Blue R250, and
then destained.
The pellet was washed twice with cell lysis buffer II (50 mM
Tris–HCl pH 7.5, 10 mM EDTA, 100 mM NaCl and 0.5% Triton
X-100) and resuspended in 10 mM sodium phosphate buffer,
pH 7.5. AOBs were reconstituted with fusion protein, oleosin-
inteinS-royalisin-D, and purified by centrifugation according to
the reported method with some modification [35]. The compo-
sition of AOBs was 15 mg TAG (olive oil from Sigma), 150 ␮g PL
(Sigma) and 315 ␮g proteins. AOBs were formed by sonication.
Subsequently, the reconstituted AOBs were collected after centrifu-
gation, washed in the sodium phosphate buffer (0.1 M, pH 7.5), and
incubated at 37 ◦ C overnight for inteinS self-splicing. All the pro-
cesses must be kept at a low temperature of 4 ◦ C, except the final
reaction of inteinS self-splicing. Finally, centrifugation was applied
to segregate the oil and the aqueous phases. The proteins in each
phase were analyzed by 12% tricine-SDS-PAGE. Recombinant roy-
alisin was also recovered according to the reference article as a
comparison [35].
Western blotting
The proteins in the SDS-PAGE gel were transferred onto a
nitrocellulose membrane in a Bio-Rad Trans-Blot system (Bio-
Rad) according to the manufacturer’s instructions. The membrane
was blocked with 3% gelatin in Tris-buffer saline (TBS) contain-
ing 10 mM Tris–HCl, pH 7.5, and 150 mM NaCl for 30 min. It was
then incubated with anti-oleosin/anti-royalisin antibodies [35] for
15 min, and diluted to 1:1000 in TBS containing 1% gelatin at room
temperature for 2 h. The membrane was rinsed with distilled water
and washed twice (10 min each) in TBS containing 0.05% Tween-20
before the addition of the peroxidase-conjugated goat anti-chicken
IgG in TBS containing 1% gelatin. After 1-h incubation, the mem-
brane was briefly rinsed in a large volume of water and then washed
twice (10 min each) in TBS containing 0.05% Tween-20. It was then
incubated with 3 mM 4-chloro-1-naphthol containing 0.015% H2 O2
for color development. In addition, sesame seed oil bodies were pre-
pared based on the protocol developed by Tzen et al. and used as
the control [35].
In vitro antimicrobial activity assay
Microorganisms were grown in the sterile 96-well microtiter
plate (Iwaki, Japan) in a final volume of 300 ␮l. The assay mix-
ture contained 100 ␮l of a 10x suspension of each microorganism
(final concentration 1–5 × 105 CFU/ml), 100 ␮l of culture medium
[Tryptone Soya Broth (TSB)] and 100 ␮l of the purified recombinant
protein solution (royalisin and royalisin-D). Plates were incubated
at the appropriate growth conditions. Bacterial growth was deter-
mined by optical density (OD) measurements at 600 nm using a
Bio-tek ␮Quant microplate spectroplate spectrophotometer (Bio-
TEK, VT). MIC was determined as the lowest peptide concentration
that prevents the OD increase. Each peptide concentration was
performed in triplicate in three independent experiments [1]. The
MBC, corresponding to the concentration that kills 99.9% of the
microorganism, was determined by spreading 20 ␮l from each well
192 K. Bílikova et al. / Peptides 68 (2015) 190–196

of the MIC onto the TSB-agar plate and incubating the plate at 37 ◦ C
overnight. The MBC was defined as the lowest concentration at
which no growth on the agar plate was observed. Each microor-
ganism was tested in triplicate in three independent experiments
[13].

Time-killing determination

Killing curves were obtained by adding the recombinant

proteins, at concentrations corresponding to 1 × MBC, at about
1 × 105 CFU/ml and grown in 1.5 ml eppendorf at 37 ◦ C. No recom-
binant proteins were added to the negative control. Colony counts
were determined at 0, 1, 2, 4, 8 and 16 h by removing the samples
(100 ␮l) at each time-point and following serial 10-fold dilutions in
TSB, plating on TSB agar plates. Colonies were counted and averaged
after 16 h of incubation at 37 ◦ C. Results were charted graphically
by plotting CFU against time. The killing rate over time was deter-
mined to be bactericidal if a reduction of CFU/ml could be achieved
by the antimicrobial test levels at 16 h incubation [33]. Recombi-
nant proteins were assayed for time-killing determination against
four strains of Gram-positive (S. aureus, S. alactolyticus) and Gram-
negative bacteria (S. cholearasuis, V. parahaemolyticus) chosen from
the results of antimicrobial activity assay.

Cell surface hydrophobicity

Cell surface hydrophobicity was determined according to the

microbial adhesion to solvents (MATS) method [3]. Gram-positive
and Gram-negative bacteria (S. intermedius B and P. aeruginosa)
were suspended in 0.1 M sodium phosphate buffer (pH 7.5) contain-
ing approximately 108 CFU/ml. The OD of each bacterial suspension
was measured at 400 nm and recorded as A0 . Bacterial suspensions
were mixed with recombinant protein samples at MIC, and incu-
bated at 37 ◦ C for 1 h. Sterilized ddH2 O were used as the blank
control. Each bacterial suspension (2.4 ml) was added with 0.4 ml
hexadecane, and the mixture was vortexed for 2 min. To allow
complete phase separation of the mixture, the aqueous phase
was removed after 15 min and the OD at 400 nm was measured
and recorded as A1 . Cell surface hydrophobicity was calculated by
(1 − A1 /A0 ) × 100%.
Cell membrane permeability
Gram-positive and Gram-negative bacteria were suspended in
sterile normal saline containing approximately 107 CFU/ml. These
suspensions were mixed with the recombinant protein samples at
MIC, and incubated at 37 ◦ C. The blank control was using the ster-
ilized ddH2 O. Each specimen was taken at 0, 15, 30, 45 and 60 min
and filtered through a 0.2 ␮m-pore-size filter. The OD was then at
260 nm [10].
Results
Expression of recombinant proteins, oleosin-inteinS-royalisin and
oleosin-inteinS-royalisin-D in E. coli AD494
Royalisin and royalisin D (shortened royalisin) were overex-
pressed in E. coli AD494 as a recombinant protein fused to the
C-terminus of oleosin by a linker polypeptide, intein S. The protein
extract of the induced and non-induced recombinant bacteria con-
taining the royalisin or royalisin-D gene was subjected to SDS-PAGE
analysis. The protein bands at 37 kDa corresponding to the oleosin-
inteinS-royalisin and oleosin-inteinS-royalisin-D were obviously
observed after IPTG induction and predominately found in the
insoluble fraction of the cell lysates (Fig. 1A). AOBs were recon-
stituted using this insoluble fraction, oleosin-inteinS-royalisin or
Fig. 1. SDS-PAGE and Western blotting of the oleosin-inteinS-royalisin and the
oleosin-inteinS-royalisin-D overexpressed in E. coli (A) with (ID, induction) or with-
out (NI, non-induction) IPTG induction, total proteins of E. coli containing fusion
proteins were extracted and then fractioned into supernatant (sup) and precipitate
(ppt), sesame oil body (Sesame OB). The sizes of the marker proteins were listed
on the left of SDS-PAGE. (B) The duplicated SDS-PAGE gels were transferred to two
pieces of nitrocellulose membrane and then individually subjected to immunoas-
saying using chicken antibodies against sesame 15 kDa oleosin and (C) royalisin.
oleosin-inteinS-royalisin-D, as well as other insoluble bacterial
proteins were found in the oil body fraction after centrifugation
(Fig. 1A). The 37-kDa fusion proteins were recognized by antibod-
ies against sesame 15 kDa oleosin and royalisin by Western blot
analysis to confirm the presence of oleosin and royalisin in this
recombinant protein (Fig. 1B and C).
Purification of the recombinant royalisin and royalisin-D
Recombinant royalisin and royalisin-D were harvested via
self-splicing of the inteinS linker induced by shifting the tem-
perature from 37 ◦ C to 4 ◦ C. After centrifugation, royalisin and
royalisin-D were found predominately in the supernatant, whereas
oleosin-inteinS remained in AOBs. The protein bands of the recom-
binant royalisin and royalisin-D were detected in the supernatant
using Tricine-SDS-PAGE and Western blotting analyses (Fig. 2).
Furthermore, the recombinant royalisin and royalisin-D under
reducing/non-reducing conditions were subjected to 12% Tricine-
SDS-PAGE analysis to assay the presence of the intra-disulfide
bonds. As shown in Fig. 2, the recombinant proteins treated with
the reducing agent, ␤-mercaptoethanol, moved electrophoretically
faster than that without any reducing agent. The production yields
of the purified recombinant royalisin and royalisin-D were about
1 mg/L of cell culture, more than the production yields of the pre-
vious study [35].
 K. Bílikova et al. / Peptides 68 (2015) 190–196 193

Antibacterial activity and time-killing determination

Recombinant proteins were assayed for bactericidal and bac-

teriostatic activity against nine strains of Gram-positive and
Gram-negative bacteria (Table 1). The recombinant royalisin-D
showed the weaker antibacterial activity against most of the Gram-
positive bacteria as well as several Gram-negative bacteria than the
recombinant royalisin.
To determine the rate of bactericidal activity of royalisin, a
kinetic study of the royalisin was performed on the bacteria that
were inhibited in the MBC assay. The time courses to kill the
bacterial culture suspensions of Gram-positive bacteria, Strepto-
coccus alactolyticus (Fig. 3a), Staphylococcus aureus (Fig. 3b) and
Gram-negative bacteria, Salmonella cholearsuls (Fig. 3c), Vibro para-
haemolyticus (Fig. 3d), were compared to each other to evaluate
the bactericidal activity of the royalisin and royalisin-D. According
to time-killing curve (Fig. 3), our data revealed that the royalisin
had a higher bactericidal activity than the royalisin-D, regardless
Gram-positive or Gram-negative bacteria.

Cell surface hydrophobicity and membrane permeability

The ability of the royalisin and royalisin-D to alter cell surface

Fig. 2. Tricine SDS-PAGE analysis and western blotting of royalisin purified from
AOBs. (A) The AOBs (AOB) constituted of fusion proteins were induced for the self-
splicing of the inteinS linker by reducing the temperature from 37 to 4 ◦ C, and then
fractioned into the oil-body layer (AOB/digested)and supernatant (sup) by centrifu-
gation. To confirm whether the disulfide bond was reduced or not, the supernatant
was resolved in tricine-SDS-PAGE without the reducing agent, ␤-mercaptoethanol
(sup/+DTT). Native royalisin from royal jelly (RJ) was shown as a 5 kDa peptide. (B)
The duplicated SDS-PAGE gel was transferred to a nitrocellulose membrane and then
subjected to immunoassaying using chicken antibodies against royalisin.
hydrophobicity of S. intermedius B and P. aeruginosa was evaluated
by the percentage of bacterial cells adhering to hexadecane (Fig. 4).
Compared with a blank control, royalisin significantly decreased
the bacterial cell surface hydrophobicity of S. intermedius B and
P. aeruginosa ranging from 56–63% to 13.7–18.2%, whereas the
royalisin-D decreased that ranging from 56–63% to 20.4–25.1%.
S. intermedius B and P. aeruginosa cell membrane permeability
was evaluated by UV absorbance at 260 nm, as shown in Fig. 5.
The recombinant royalisin could induce much the release of 260-
nm-absorbing material, which we interpret to be mostly DNA and
RNA, than the royalisin-D. The absorbance of S. intermedius B and
P. aeruginosa treated by royalisin increased quickly from 0.011 and
0.023 at 0 min to 0.060 and 0.061 at 15 min, and reached 0.076
and 0.081 at 60 min. The absorbance values of the royalisin-treated
samples were significantly higher than the royalisin-D group and
the blank control. This result suggests that the ability to disrupt
bacterial cell membrane permeability of the royalisin was higher
than the royalisin-D.

Table 1
Bacteriostatic and bactericidal activities of royalisin against nine different animal- and human-specific pathogens.

Bacteria Peptide MIC (␮g/ml) MIC (␮g/ml) (with DTT) MBC (␮g/ml) MBC (␮g/ml) (with DTT)

Staphylococcus aureus (+) Royalisin 7.5 20 13 NB

Royalisin-D 9.5 20 13.5 NB

Streptococcus alactolyticus (+) Royalisin 9 NI 11 NB

Royalisin-D 12 NI 18 NB

Staphylococcus intermediusB (+) Royalisin 4 NI 6.5 NB

Royalisin-D 4.6 NI 7 NB

Staphylococcus xylosus (+) Royalisin 10.5 NI 12 NB

Royalisin-D 18 NI 19 NB

Paenibacillus larvae (+) Royalisin 6 10 15 NB

Royalisin-D 10 50 20 NB

Pseudomonas aeruginosa (−) Royalisin 10 NI 15 NB

Royalisin-D 11 NI 17 NB

Salmonella cholearasuis (−) Royalisin 9 20 11 NB

Royalisin-D 12 20 18 NB

Vibro parahaemolyticus (−) Royalisin 4 8 6.5 NB

Royalisin-D 4.6 8 7 NB

Escherichia coli (hemolytic) Royalisin NI NI NB NB

Royalisin-D NI NI NB NB

NB: no bactericide activity.

194 K. Bílikova et al. / Peptides 68 (2015) 190–196
Fig. 3. Time-killing curve of recombinant proteins assayed on Gram-positive bacteria (A) Streptococcus alactolyticus, (B) Streptococcus aureus, and Gram-negative bacteria
(C) Salmonella cholearasuis, (D) Vibro parahamelyticus. Colony counts were determined at 1, 2, 4, 8 and 16 h. The recombinant proteins are shown as different symbols on the
bottom right in the figure.
Fig. 4. The bacterial cell surface hydrophobicity. The ability of royalisin and
royalisin-D to alter cell surface of P. aeruginosa and S. intermedius B was evaluated
by the percentage of bacterial cells adhering to hexadecane.
Discussion
Royalisin is a member of the insect defensin family with a
characteristic six cysteine/three disulfide bridge pattern [16]. All
insect defensins, including royalisin, have the same cysteine pair-
ing: Cys1-Cys4, Cys2-Cys-5 and Cys3-Cys6 [20]. Royalisin contains
the secondary structure comprising an amino-terminal loop, an
␣-helix and two antiparallel ␤-strands stabilized by three intra-
molecular disulfide linkages [16,20]. They are active against a broad
spectrum of Gram-positive bacteria, some of the Gram-negative
bacteria and fungi [2,4,16,19,20]. Defensins are known to exert
action by binding to the surface of microbial membranes and caus-
ing a lysis of the intracellular contents [29]. In this study, the
formation of the intra-disulfide bonds in royalisin and royalisin-
D were achieved since the E. coli AD494 (DE3) strain was selected
for protein expression. E. coli AD494 (DE3) contains the deletions
of the genes coding for glutaredoxin reductase and thioredoxin
reductase (gor trxB), which allow disulfide bonds to form in
the cytoplasm. The DTT treatment of royalisin and royalisin-D
shows the importance of intramolecular disulfide linkages which
are supposed to stabilize the construction and antimicrobial activ-
ity. Our results indicate that intramolecular disulfide linkages
of royalisin do play a very important role in the antimicrobial
activity.
Royalisin shares common structural motifs with other insect
defensins [14], but it contains a unique amphipathic ␣-helix and
amidated carboxyl-terminal tail (11 amino acid) [8]. The 11-amino-
acid-long peptide extension is supposed to adopt the ␣-helix
structure that is stabilized by the C-terminal amidation [8]. In this
study, 11 amino acid residues were removed at the C-terminal
of the royalisin to generate the royalisin D, which performed a
lower antimicrobial activity than the full mature royalisin. The 11-
amino-acid-long peptide at C-terminal of royalisin would stable the
royalisin structure.
 K. Bílikova et al. / Peptides 68 (2015) 190–196
Fig. 5. The effect of recombinant proteins on the cell membrane permeability of
Gram-positive and Gram-negative bacteria. (A) Pseudomonas aeruginosa (Gram-
negative) and (B) Staphylococcus intermedius B (Gram-positive). The bacterial cell
membrane was evaluated by UV absorbance at 260 nm, and at the time of 0, 15, 30
45, and 60 min. The recombinant proteins are shown as different symbols on the
bottom right in the figure.
The primary mechanism of action of defensins is bacterial
cytoplasmic membrane lysis [26]. The mode of action of an
insect definsin A from the Phormia terranova against M. luteus
has been addressed. It was shown that the defensin A formed
voltage-dependent channels in bacteria, and then disrupted the
permeability barrier of the cytoplasmic membrane of bacteria,
resulting in the loss of cytoplasmic potassium, a partial depolar-
ization of inner membrane, a decrease in cytoplasmic ATP, and
inhibition of respiration [12]. Many groups of bacteria have been
shown to exist predominantly attached to surfaces in contact with
liquids. This advantage gained by the bacteria attached to a surface
are thought to benefit the bacterial growth by the higher con-
centration of nutrients closed to a surface and the promotion of
genetic exchange [27]. The greater hydrophobicity values always
coincided with enhanced adhesion to the liquids or mineral par-
ticles [34]. Royalisin would decrease bacterial cell hydrophobicity
and disrupt cell membrane permeability in certain Gram-positive
bacteria for inducing the disruption and dysfunction of the bacterial
cell walls and membranes [32]. Royalisin and royalisin-D decreased
the bacterial cell hydrophobicity and disrupted the cell membrane
permeability (Figs. 4 and 5), but when its intramolecular disulfide
195
linkages were disrupted, the proteins lost the ability to alter the
cell surface hydrophobicity of S. intermedius B and P. aeruginosa.
These data indicate that intramolecular disulfide linkages and the
11 amino acids at the C-terminus in royalisin are both essential for
antimicrobial function of royalisin.
Acknowledgment
This work were supported by grants from Ministry of Science
and Technology, Taiwan, ROC (NSC 102-2313-B150-001 and MOST
103-2313-B-150-001-MY2 to C.C. Peng) and Slovak Academy of
Sciences (Taiwan-Slovak Joint Research Cooperation).
References
[1] Altman H, Steinberg D, Porat Y, Mor A, Fridman D, Fridman M, et al. In vitro
assessment of antimicrobial peptides as potential agents against several oral
bacteria. Journal of Antimicrobial Chemotherapy 2006;58:198–201.
[2] Bachanova K, Klaudiny J, Kopernicky J, Simuth J. Identification of honeybee
peptide active against Paenibacillus larvae larvae through bacterial growth-
inhibition assay on polyacrylamide gel. Apidologie 2002;33:259–69.
[3] Bellon-Fontaine MN, Rault J, van Oss CJ. Microbial adhesion to solvents: a
novel method to determine the electron-donor/electron-acceptor or Lewis
acid-base properties of microbial-cells. Colloids and Surfaces B: Biointerfaces
1996;7:47–53.
[4] Bílikova K, Gusui W, Šimúth J. Isolation of a peptide fraction from honeybee
royal jelly as a potential antifoulbrood factor. Apidologie 2001;32:275–83.
[5] Bílikova K, Bortolotti L, Truchado P, Allende A, Kaatz HH, Bertelli D, et al. In:
Behrens D, Moritz RFA, editors. The quality of honey for bees and man. Nova
Science Publishers; 2010. p. 6–62.
[6] Bonmatin JM, Bonnat JL, Gallet X, Vovelle F, Ptak M, Reichart JM, et al.
Two-dimensional 1H NMR study of recombinant insect defensin A in water:
resonance assignments, secondary structure and global folding. Journal of
Biomolecular NMR 1992;2:235–56.
[7] Brogden KA. Antimicrobial peptides: pore formers or metabolic inhibitors in
bacteria. Nature Microbiology 2005;3:238–50.
[8] Bulet P, Hetru C, Dimarcq JL, Hoffmann D. Antimicrobial peptides in
insects; structure and function. Developmental & Comparative Immunology
1999;23:329–44.
[9] Bulet P, Stocklin R. Insect antimicrobial peptides: structures,properties and
gene regulation. Protein & Peptide Letters 2005;12:3–11.
[10] Carson CF, Mee BJ, Riley TV. Mechanism of action of Melaleuca alternifolia
(tea tree) oil on Staphylococcus aureus determined by time-kill, lysis, leakage,
and salt tolerance assays and electron microscopy. Antimicrobial Agents and
Chemotherapy 2002;46:1914–20.
[11] Chiang CJ, Chen HC, Chao YP, Tzen JTC. Efficient system of artificial oil bod-
ies for functional expression and purification of recombinant nattokinase in
Escherichia coli. Journal of Agricultural and Food Chemistry 2005;53:4799–804.
[12] Cociancich SA, Ghazi HG, Hoffmann JA, Letellier L, Yumakawa M. Insect
defensin, an inducible antibacterial peptide, form voltage-dependent channels
in Micrococcus luteus. The Journal of Biological Chemistry 1993;268:19239–45.
[13] Cole AM, Weis P, Diamond G. Isolation and characterization of pleurocidin, an
antimicrobial peptide in the skin secretions of winter flounder. The Journal of
Biological Chemistry 1997;272:12008–13.
[14] Cornet B, Bonmatin JM, Hetru C, Hoffmann JA, Ptak M, Vovelle F. Refined three-
dimensional solution structure of insect defensin A. Structure 1995;3:435–48.
[15] Derman AI, Prinz WA, Belin D, Beckwith J. Mutation that allows disulfide bond
formation in the cytoplasm of Escherichia coli. Science 1993;262:1744–7.
[16] Fujiwara S, Imai J, Fujiwara M, Yaeshima T, Kawashima T, Kobayashi K. A
potent antibacterial protein in royal jelly. Journal of Biology and Chemistry
1990;265:11333–7.
[17] Hancock REW, Chapple DS. Peptide antibiotics. Antimicrobial Agents and
Chemotherapy 1999;43:1317–23.
[18] Hanzawa H, Shimada I, Kuzuhara T, Komano H, Kohda D, Inagaki F, et al. 1H
nuclear magnetic resonance study of the solution conformation of an antibac-
terial protein, sapecin. FEBS Letters 1990;269:413–20.
[19] Hetru C, Hoffmann D, Bulet P. Antimicrobial peptides from insects. In: Brey PT,
Hultmark D, editors. Molecular mechanisms of immune responses in insects.
London: Chapman & Hall; 1998. p. 40–66.
[20] Klaudiny J, Albert S, Bachanova K, Simuth J. Two structurally different defensin
genes, one of them encoding a novel defensin isoform, are expressed in honey-
bee Apis mellifera. Insect Biochemistry and Molecular Biology 2005;35:11–22.
[21] Kwakman PHS, Zaat SAJ. Antibacterial components of honey. IUBMB Life
2012;64:48–55.
[22] Laemmli UK. Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature 1970;227:680–5.
[23] Li Y, Xiang Q, Zhang Q, Huang Y, Su Z. Overview on the recent study of antimicro-
bial peptides: origins, functions, relative mechanisms and application. Peptides
2012;37:207–15.
[24] Livermore DM. Has the era of untreatable infections arrived. Journal of Antimi-
crobial Chemotherapy 2009;64:29–36.
196 K. Bílikova et al. / Peptides 68 (2015) 190–196
[25] Michael RY, Nannette YY. Mechanisms of antimicrobial peptide action and
resistance. Pharmacological Reviews 2003;55:27–55.
[26] Nakajima Y, Ishibashi J, Yukuhiro F, Asaoka A, Taylor D. Antibacterial activ-
ity and mechanism of action of tick defensin againt Gram-positive bacteria.
Biochimica et Biophysica Acta 2003;1624:125–30.
[27] Palmer J, Flint S, Brooks J. Bacterial cell attachment, the beginning of a biofilm.
Journal of Industrial Microbiology & Biotechnology 2007;34:577–88.
[28] Peng CC, Chen JCF, Shyu DJH, Chen MJ, Tzen JTC. A system for purification of
recombinant proteins in Escherichia coli via artificial oil bodies constituted with
their oleosin-fused polypeptides. Journal of Biotechnology 2004;111:51–7.
[29] Poole K. Efflux-mediated multiresistance in Gram-negative bacteria. Clinical
Microbiology and Infection: The Official Publication of the European Society of
Clinical Microbiology and Infectious Diseases 2004;10:12–26.
[30] Roberts NJ, Scott RW, Tzen JTC. Recent biotechnological applications using
oleosin. The Open Biotechnology Journal 2008;2:13–21.
[31] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001.
[32] Shen L, Liu D, Li M, Jin F, Din M, Parnell LD, et al. Mechanism of action of recom-
binant Acc-Royalisin from royal jelly of Asian honeybee against Gram-Positive
bacteria. PLoS ONE 2012;7:e47194.
[33] Speciale A, Musumeci R, Blandino G, Milazzo I, Caccamo F, Nicoletti G. Minimal
inhibitory concentrations and time-kill determination of moxifloxacin against
aerobic and anaerobic isolates. International Journal of Antimicrobial Agents
2002;19:111–8.
[34] Stenstrom TA. Bacterail hydrophobicity, an overall parameter for the mea-
surement of adhesion potential to soil particles. Applied and Environmental
Microbiology 1989;55:142–7.
[35] Tseng JM, Huang JR, Huang HC, Tzen TC, Chou WM, Peng CC. Facilitative pro-
duction of an antimicrobial peptide royalisin and its antibody via an artificial
oil-body system. Biotechnology Progress 2011;27:153–61.