ORIGINAL STUDY
A Novel Nested Real-time Polymerase Chain Reaction
for Treponema pallidum DNA in Syphilis Biospecimens
Yi Zhang, MD,*† Xiangnong Dai, BM,*† Zefang Ren, PhD,‡ Hongda Lin, MD,‡
Wenling Cao, BM,*† and Xingdong Ye, MD*†
Downloaded from http://journals.lww.com/stdjournal by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AWnYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC1y0abggQZXdtwnfKZBYtws= on 12/02/2021
Background: Early diagnosis of Treponema pallidum infection is help-
ful for disease management, and conventional PCR is suitable for lesion
swabs of patients with probable early syphilis. We thus tested nested and
real-time PCR (NR-PCR) in various biosamples from syphilitic patients.
Methods: Samples were collected from syphilis patients before treatment.
Specific primer sequences targeting the T. pallidum gene polA were
designed for NR-PCR.
Results: Across syphilis types, most samples assayed with NR-PCR returned
a positive result, including earlobe blood (92.0%), cerebrospinal fluid
(CSF) (90.2%), lesion swabs (74.3%), serum (66.9%), and whole blood
(64.2%). No significant differences were observed in positive samples for
whole blood, serum, and lesion swabs between primary and secondary
syphilis (P > 0.05 for all comparisons). However, more whole-blood sam-
ples from patients with secondary syphilis were positive for NR-PCR than
whole blood samples from patients with tertiary and latent syphilis
(P < 0.05 for all comparisons). For neurosyphilis patients, significantly
more earlobe blood samples tested positive than did whole-blood samples
(P < 0.05), but there was no difference in positive results for earlobe blood
and whole blood in latent syphilis. Significantly more serum samples tested
positive in latent syphilis patients with rapid plasma regain (RPR) titers of
1:8 or greater, compared to those with RPR of 1:4 or less.
Conclusions: Nested and real-time PCR can be used to identify T. pallidum
DNA in biosamples from syphilitic patients, especially earlobe blood.
S yphilis is a chronic systemic sexually transmitted infection
caused by Treponema pallidum, a pathogen that cannot be
subcultured in the laboratory on any biochemical medium.1 Early
diagnosis of T. pallidum infection is helpful for disease management.
*From the Department of Dermatology, Guangzhou Institute of Dermatology;
†Department of Dermatology, Guangzhou Medical University; and
‡School of Public Health, Sun Yat-sen University, Guangzhou, P.R. China
Acknowledgements: The authors thank Prof. Yin Yueping (National Venereology
Reference Laboratory, Nanjing STD Research Center, China) for providing
the reference T. pallidum DNA strain Nichols.
Y.Z. drafted the article. X.Y. conceptualized the research design and revised
the draft, X.D. analyzed the data. W.C. handled samples. Z.R. and H.L.
completed all experiments, and all authors were involved in revising the
manuscript and approving the final version.
Y.Z. and X.D. are co-first authors.
Conflicts of Interest and Source of Funding: None declared.
Correspondence: Xingdong Ye, MD, Department of Dermatology,
Guangzhou Institute of Dermatology, 56, Heng Fu St, Guangzhou,
Guangdong province, China. E‐mail: yxingdong@qq.com.
Received for publication April 16, 2018, and accepted August 18, 2018.
DOI: 10.1097/OLQ.0000000000000908
Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc.
on behalf of the American Sexually Transmitted Diseases Association.
This is an open-access article distributed under the terms of the Creative
Commons Attribution-Non Commercial-No Derivatives License 4.0
(CCBY-NC-ND), where it is permissible to download and share the work
provided it is properly cited. The work cannot be changed in any way or
used commercially without permission from the journal.
Sexually Transmitted Diseases • Volume 46, Number 1, January 2019
Serum-specific treponemal antibody arrays (e.g. T. pallidum particle
agglutination [TPPA]), T. pallidum Western blot, chemiluminescent
magnetic microparticle immunoassays (CMIAs), and nonspecific
treponemal antibody arrays (e.g. rapid plasma regain [RPR]), are
suitable for the identification and management of suspected syph-
ilis infections.2 However, nontreponemal antibody arrays may
give false positives, not only for cases of nonvenereal treponema-
tosis, but also in the event of concurrent pregnancy, autoimmune
disease, or other infections. Furthermore, a positive treponemal or
nontreponemal test result may indicate serostate, not active syphilis.3
With serum treponemal antibodies, electrochemiluminescent
immunoassays and CMIAs have high sensitivity and specificity
and can be used to screen for T. pallidum infection.2 Marra's group
reported that a CSF-TPPA titer threshold of 1:640 was sufficient
for neurosyphilis diagnosis, and that CSF-TPPA might be useful
for identifying patients with neurosyphilis when a CSF venereal
disease research laboratory (VDRL) test is nonreactive.4 The con-
ventional test for T. pallidum DNA using PCR is suitable for lesion
swab specimens from lesions of patients with probable early syph-
ilis.5,6 Indeed, conventional PCR testing has a sensitivity of up to
78.4% for lesion swabs of primary genital or anal chancres, and up
to 83.0% for blood from neonates with congenital syphilis; the
specificity of both tests is approximately 95%.7 However, the sen-
sitivity of PCR was low for T. pallidum DNA in peripheral blood
specimens in adult.8,9 There is an optimal window for PCR-based
diagnosis of neurosyphilis, although nested and real-time PCR
with T. pallidum polA or tpp47 is preferable.10 Grange's group
found no agreement between T. pallidum in blood using nested
PCR and a syphilis serological diagnosis; nested PCR had a sensi-
tivity of only 29% for peripheral blood mononuclear cells and
14.7% for serum.3 Conventional PCR is more likely to contami-
nate DNA leading to unstable results, and real-time quantitative
PCR can omit an electrophoresis step, decreasing contamination
in a sealed reaction environment. However, its sensitivity for T.
pallidum DNA array is low.10,11 The nested PCR, after several ini-
tial cycles, can amplify the target gene and increase accuracy.3,10
Thus, we tested the sensitivity and specificity of nested real-time
PCR (NR-PCR), which is sensitive to a minimum of 2 T. pallidum
strain Nichols cells/mL,12 which is greater than 103 T. pallidum
strain Nichols cells/mL using real-time quantitative PCR11 and
20 T. pallidum strain Nichols cells/mL of nested PCR.3
Available studies of T. pallidum DNA in biospecimens of
syphilis patients are limited, so we investigated the feasibility of
NR-PCR for identifying T. pallidum DNA from biological sam-
ples from syphilitic patients.
MATERIALS AND METHODS
Participants and Specimens
Inclusion Criteria for Participants
All patients with suspected syphilis visiting the out-patient
dermatology or sexually transmitted disease (STD) departments of
41
Zhang et al.

seven hospitals in Guangzhou, China between July 2012 and June
2014 were asked to participate in this study if they met the follow-
ing criteria: a history of high-risk sexual behavior or more than 1
partner in the past; a reactive treponemal serological antibody test,
with or without manifestations consistent with syphilis; and no
prior syphilis treatment. Patients gave informed consent for partic-
ipation prior to enrollment. All procedures used in this study were
approved by the medical ethics committee of the Guangzhou Insti-
tute of Dermatology (N20121A031001_1).
Syphilis Diagnosis
All participants were tested using TPPA and RPR. Syphilis
was diagnosed based on previously published methods.13 Briefly,
based on a history of high-risk sexual behavior in the past
12 months, patients were diagnosed with confirmed primary syph-
ilis if they had one or more chancres and if they were positive for T.
pallidum based on dark field microscope regardless of result of
RPR and/or TPPA test (RPR could be negative if the T. pallidum
infection is less than 2 to 3 weeks, and TPPA could be negative
at an early stage). Patients were diagnosed with confirmed second-
ary syphilis if they manifested syphilitic polymorphic skin erup-
tions and/or mucosa condylomata lata, and if both TPPA and
RPR were positive, regardless of DFM results. We diagnosed pa-
tients with confirmed tertiary syphilis if they had either primary
or secondary syphilis for more than 2 years; or if syphilitic skin
nodules or gummas were observed; and if the patient presented
with bone, eye, or other visceral syphilis, or with cardiovascular
syphilis, such as simple aoristic, aortic regurgitation, or aortic an-
eurysm. We diagnosed patients with neurosyphilis based on serum
TPPA and RPR positivity, and a routine CSF test recovered protein
greater than 500 mg/L and white blood cell counts greater than
5  106/L without another explanation. Also, diagnoses were
made if CSF fluorescent treponemal antibody absorption and/or
VDRL were positive, and neurosyphilis was classified according
to symptoms. For example, patients were considered to have a di-
agnosis of asymptomatic neurosyphilis if they had been without
symptoms but had a positive serum TPPA and RPR test, a positive
CSF routine test, and a positive CSF treponemal antibody test. Pa-
tients with meningeal neurosyphilis presented with fever, headache,
stiff neck, and papilledema. Patients with cerebrovascular syphilis
presented with cerebral vascular occlusive syndrome (e.g., hemiple-
gia aphasia) and epilepsy. Patients were diagnosed with brain paren-
chyma syphilis with additional mental symptoms, such as apathy
and disorientation, and/or with nervous system symptoms, such as
ataxia, thrill, and myasthenia. Confirmed early latent syphilis was
diagnosed if the patients were positive for TPPA and RPR, and
had no obvious CSF abnormality, and if patient had a sexual partner
with a history of confirmed early syphilis within the past 2 years, or
if patient had a history of high-risk sexual behavior or a blood trans-
fusion within the past 2 years. Also, if the patient had untreated
manifestations consistent with either primary or secondary syphilis
within the past 2 years, a diagnosis of confirmed early latent syphilis
was made. Late latent syphilis was considered if asymptomatic pa-
tient were TPPA- and RPR-positive, and had a syphilis history of
more than 2 years. All syphilis patients were treated according to
STD guidelines.13 The “first visit” was defined as the visit when
syphilis was identified for the first time.
Specimen Collection
All biospecimens were collected according to
prescribed procedures.12
Lesion Swabs
For patients with ulcerate eruptions, the lesion exudate was
collected with a lesion swab. For secondary syphilis with skin le-
sions, such as macules or papules without mucosal lesions, lesions

TABLE 1. Distribution of the 452 Biospecimens Obtained From 266 Participants

Samples Size
Characteristics No. Participants (%) *Subtotal (%) Lesion Swabs Serum Earlobe Blood Whole Blood CSF
Sex
Males 159 (60.0) 310 (69.0) 40 118 18 102 32
Females 107 (40.0) 142 (31.0) 13 58 7 45 19
Study group
Primary syphilis 19 (7.0) 45 (10.0) 19 9 0 14 3
Secondary syphilis 23 (9.0) 57 (13.0) 16 16 0 23 2
Tertiary syphilis 10 (4.0) 13 (3.0) 0 10 0 3 0
Latent syphilis
Early latent 85 (32.0) 149 (33.0) 0 86 2 61 0
Late latent 21 (8.0) 26 (6) 0 20 0 2 4
Neurosyphilis
Asymptomatic neurosyphilis 13 (5.0) 30 (7.0) 0 1 8 1 13
Meningeal neurosyphilis 15 (6.0) 25 (6.0) 0 3 6 3 15
Cerebrovascular syphilis 14 (5.0) 23 (5.0) 0 3 9 2 14
c1
Subtotal 200 (75.0) 368 (81.0) 35 148 25 109 51
Control group
Negative controls
Genital herpes 9 (3.0) 18 (4.0) 9 0 0 9 0
Scrotal eczema 4 (2.0) 8 (2.0) 4 0 0 4 0
Fixed drug eruption 5 (2.0) 10 (2.0) 5 0 0 5 0
Healthy person 20 (8.0) 20 (4.0) 0 0 0 20 0
Probable syphilis 28 (11.0) 28 (6.0) 0 28 0 0 0
c2
Subtotal 66 (25.0) 84 (19.0) 18 28 0 38 0
†
Total 266 (100.0) 452 (100.0) 53 176 25 147 51

* Subtotal = number of swab samples+ serum samples + earlobe blood samples + whole blood samples + CSF samples.
†
Total = c1subtotal + c2subtotal.

42 Sexually Transmitted Diseases • Volume 46, Number 1, January 2019


were scraped gently with a lesion swab to obtain serous exudate.
For DFM analysis, lesion exudate was collected with a bacteriol-
ogy loop and transferred immediately to a glass slide for examina-
tion. For DNA extraction, lesion exudate was collected with a
lesion swab, then immediately placed in 1-mL sterile PBS.
Whole Blood, Serum, and CSF Collection
We collected 3-mL whole blood in dry tubes from patients
with primary, secondary, tertiary, and latent syphilis. We divided
1 mL of the collected blood into five 0.2-mL aliquots, and centri-
fuged the remaining 2 mL for 10 minutes at 2500g at room temper-
ature. We then collected the supernatant (sera) and subpackaged it in
0.2-mL aliquots. We collected 50- to 100-μL earlobe peripheral
blood from latent syphilis and neurosyphilis patients, and to the
blood, we added 200-μL 0.9% NaCl. We collected CSF via lumbar
puncture from suspected neurosyphilis patients without contraindi-
cations. Patients who received lumber punctures were given 500 mL
of 10% glucose plus 2 g vitamins C (intravenously guttae), and were
asked to lie flat for 6 hours of observation. Irrespective of syphilis
type or stage, we attempted to amplify T. pallidum DNA in all col-
lected samples which were stored at −80°C until NR-PCR was per-
formed. We also collected 38 samples from nonsyphilitic patients as
negative controls for DNA amplification. Table 1 depicts the charac-
teristics of these collections.
DNA Amplification
Preparation for Reference T. pallidum DNA
Rabbit testis cultures containing T. pallidum strain Nichols
were donated by Dr. Yin Yueping (National Venereology Refer-
ence Laboratory, Nanjing STD Research Center, Nanjing, Jiangsu
province, China) to be prepared for reference DNA. We isolated T.
pallidum DNA with a TIAN Amp Micro DNA kit (TianGen Biotech
Co., Ltd., Beijing, China), following the manufacturer's instructions.
We used Nano Drop ND-1000 Ultraviolet spectrophotometers
(Thermo Scientific Co., Guangzhou, China) to quantify extracted
DNA. We amplified T. pallidum DNA using Taq Man Master Mix
(ABI Co., Ltd, Guangzhou, China) for PCR.
Patients DNA Extraction
We extracted DNA from 200 μL each of lesion swabs,
whole blood, serum, earlobe peripheral blood, and CSF using a
TIAN Amp Micro DNA Kit mentioned above, following the man-
ufacturer's instructions. A UV spectrophotometer was used for
quantitating DNA from patient samples, which were stored at
−80°C until amplification.
TABLE 2. Primer Sequences for polA
Method Primer Pair polA Sequence (5`–3`)
PCR F1 TGC GCG TGT GCG AAT GGT GTG GTC
R1 CACAGTGCTCAAAAACGCCTGCACG
NR PCR F2 AGG ATC CGG CATATG TCC AA
R2 GTG AGC GTC TCA TTC CAA A
Probe FMA-ATG CACCAGCTTCGA
TPU57757 Treponema pallidum PolA gene, Partial cds:116761–117352.
ATGTGCAAAT GAGTGTTTCT TATCTCAGGT AGAAGGGAGG GCTAGTACAC CGGAGGTGAA CTCCGTATTG AAGTCGGAGT TGAAGACGAG
TGCTGTGTCT GGCGCCATAC CTATAGAAAA TAGAGATCTT AGGCAGGATG TTATGCTTGC ACGCAGTGCA GGTCATTATC GTGGTGTTAC
TGACCCTGTA GAACTTAAAC GTATTATTGA TTGCGCGTGT GCGAATGGTG TGGTCGCGTT TGATTGTGAA ACGGATGGAT TGCATCCGCA
CGATACACGT CTGGTCGGAT TTTCGATCTG CTTTCAGGAA GCAGAGGCTT TTTATGTTCC.
TCTTATTGTT CCGGACGTTT CTCTTCATAC CGAGTCAACT CAGTGTACAT GTGCACGTAG CACTAATGTC GAGACTGAAA AGGAGTGCAC
AGAACAGCAT GGGGTATCTG CATCTGCTGT GCAGGATCCG GCATATGTCC AAGCTGTCAT GCACCAGCTT CGACGTCTTT GGAATGATGA
GACGCTCACA CTTGTTATGC ATAATGGAAA GTTTGATTA TCACGTTATG CATCGTGCAG GCGTTTTTGA GCACTGTGCA TGTAATATTT TCG.
Sexually Transmitted Diseases • Volume 46, Number 1, January 2019
Real-Time PCR for T. pallidum
PCR Primer Design
Primers and TaqMan Minor Groove Binder Probe
All PCR was performed at the School of Public Health, Sun
Yat-sen University, Guangzhou, China. For the NR-PCR assay, we
designed two pairs of primers specific to the target T. pallidum gene,
polA (partial coding sequence (CDS); GenBank accession no.
TPU57757.1; Table 2). We renewed additional sets of primers for
PCR and real-time PCR using published primer sequences.14,15
Primers and the TaqMan Minor Groove Binder probe (Table 2)
were synthesized by Applied Biosystems (Guangzhou, China).
NR-PCR Assay
We amplified T. pallidum DNA using Taq Man Master Mix
(ABI Co., Ltd, Guangzhou, China) for PCR. Each 25 μL initial
PCR volume contained 3 μL extracted DNA as the template,
1 μL of each outer primer (F1/R1, 0.4 μM), and 20 μL Platinum
PCR Super Mix (Invitrogen, Guangzhou, China). Initial PCR
was performed in a Thermal Cycle PTC-200 (Bio-Rad, Shanghai,
China), with the following cycling program: degeneration at 94°C
for 5 minutes; 30 cycles of 94°C for 30 seconds, 68°C for
30 seconds, and 72°C for 2 minutes; and a final extension at 72°
C for 7 minutes. The product of initial amplification was diluted
in 1:2, We then added 4 μL of dilution as template to each well
of a 384-well plate, the remaining dilution was stored in −20°C.
Plates were dried in an incubator at 65°C for 30 minutes. We next
added 2.5 μL TaqMan Master Mix (ABI, Guangzhou, China) and
1 μL of each inner primer (F2/R2, 0.3 μM) to each well. PCR cy-
cling conditions were as follows: incubation 50°C for 2 minutes,
followed by 40 cycles of 95°C for 15 minutes, 95°C for 15 sec-
onds, and 60°C for 1 minute. For each specimen, we also ampli-
fied negative and positive controls (negative sample, sterile
water and T. pallidum strain Nichols, respectively). For all speci-
mens, Ct values were derived using Sequence Detection System
(SDS, ABI) software. We considered Ct values less than 40 posi-
tive for T. pallidum DNA.
Statistical Analysis
We used χ2 tests and SPSS 17.0 (SPSS, Chicago, IL) to as-
sess the relationship between positive T. pallidum PCR results and
syphilis type (P < 0.05 was considered statistically significant).
RESULTS
There were 266 participants in our study, between the ages
of 21 and 65 (median: 36) (Table 1). Of these participants,
228 patients with suspected syphilis, with an average disease dura-
tion of 6.8 months (range, 3 days to 52 months), and 38
Locus in Genome (TPU57757.1) Length
116972–116995 377 bp
117323–117347
117213–117232 67 bp
117258–117279
117239–117253 15 bp
43
Zhang et al.

Yat's continuous correction algorithm χ21, χ22, and P values indicate the results of χ2 tests comparing secondary syphilis with other types of syphilis (in serum and whole blood samples), or comparing adjacent
—

—
—
—
nonsyphilitic individuals used as controls of these patients. Of the
P

1
1
228 patients, 200 were eventually diagnosed with confirmed in-
%

0
4
1
0

0
5

0
0
0
5
fections (Table 1). All 19 of the patients diagnosed with primary
CSF

syphilis presented with chancres. Of the 23 patients diagnosed

38 (90.5)

46 (90.2)
4 (100)
+ (%)

with secondary syphilis, 12 presented with a rose rash and 11 pre-

0 (0)
0 (0)
0 (0)
46
0
2
2 sented with condyloma lata. The remaining 28 patients, without
confirmed infections, were considered probably syphilitic: 11
were diagnosed with probable primary syphilis, 12 were TPPA-

—
—
—
1*
0
0
0

positive with no other symptoms, indicating nonreactive syphilis,

P
Earlobe blood

and 5 were suspected to have latent syphilis or be in a syphilitic

%

0
0
0

0
0
0
2
2
0
2

serostate (RPR positive with a history of syphilis treatment within

the last 2 years).
21 (91.3)

23 (92.0)
2 (100)
+ (%)

0 (0)
0 (0)
0 (0)
23
0
0
0

Positive T. pallidum Tests in Different Specimen

Types From Patients at Various Stages of
Syphilis Progression
0.008*
0.09*

0.08*

0.00f
0.02

Our NR-PCR identified 71.7% of the syphilitic patient

—
—

samples (264/368) as positive for T. pallidum DNA (Table 3); all

P

38 control samples were negative for T. pallidum DNA. In patients

TABLE 3. Nested Real-Time PCR Analysis of Different Types of Samples Indicating Those Positive for Treponema pallidum DNA (N = 452)

5.25†

46.59‡

diagnosed with neurosyphilis, there were no significant differ-

Whole Blood
χ22

—
—
—
—

—
—

ences between the results for the serum and whole-blood samples
(P = 0.2), or between the earlobe blood and CSF samples
—

3
3

0
3

24
39

38

38
77

(p = 0.74). When serum and whole-blood samples were combined

(to generate venous whole blood samples [VWB]), earlobe blood
8 (57.1)

3 (50.0)
20 (87.0)

39 (61.9)
70 (64.2)

samples tested positive significantly more often than did the

+ (%)

0 (0)

0 (0)
0 (0)

0 (0)
70

VWB samples (Fisher exact test, P = 0.02), but no significant dif-

Pearson χ2 tests comparing subtotal of syphilis type and control group (in serum, lesion swab and whole blood samples).

ference was observed between the CSF and VWB samples

(P = 0.14). In the patients diagnosed with latent syphilis, there
0.69*
0.06*

0.37*

0.00‡

were no significant differences between the number of serum

0.65
—

and whole blood samples positive for T. pallidum DNA

P

(P = 0.18); all earlobe blood and CSF samples tested positive

0.21†

(Table 3). Of the 84 biospecimens considered negative for the

38.4‡
χ21

—
—
—
—

NR PCR test, 1 serum sample from a patient with serological

Serum

RPR positive was positive for T. pallidum DNA.

—

27
6
5
1

49

27
76
7

30

Testing for T. pallidum DNA in Serum From Patients

1 (3.57)
10 (62.5)
5 (50.0)
6 (72.3)

99 (66.9)

1 (3.57)
2 (22.2)

76 (71.7)
+ (%)

With Different RPR Titrations

100
0 (0)

We divided all syphilis patients with serum samples into 2

groups based on serum RPR titer (≥1:8 or ≤ 1:4). We tested these
159 serum samples independently for T. pallidum DNA (1 serum
0.13*

0.00‡
—
—
—

—
—

sample per patient). All 33 patients (23 diagnosed with secondary,

P

and 10 with tertiary syphilis) had RPR titers >1:4 (Table 4). In all
Lesion Swab

23 cases of secondary syphilis, RPR titer was 1:8 or greater;

—

—
—
—

0
18

18
27
2

9
7

62.5% of these samples tested positive for T. pallidum DNA. Of

14 (87.5)

26 (74.3)
12 (63.2)

the 10 tertiary syphilis patients with RPR of 1:8 or greater; 50%

+ (%)

0 (0)
0 (0)

0 (0)
—
—
—

26

of these samples tested positive for T. pallidum DNA. There were

no significant differences in number of positive NR-PCR results
between the RPR groups for primary and neurosyphilis. However,
*Fisher exact test; gTotal = g1subtotal + g2subtotal.
Positive %

there were significantly more positive T. pallidum DNA tests in the

3.57
1.19

latent syphilis patients with RPR titers of 1:8 or greater, as com-

38.5
87.2
69.9
53.3
80.7

71.7

pared with the patients with RPR titers of 1:4 or less (Table 4).
samples (e.g., lesion swabs, earlobe blood).
Total samples

DISCUSSION
56

452
13
78

28
84
173
45
57

368

Nested and real-time PCR to assess T. pallidum DNA in

various biospecimens from syphilis patients correctly returned a
positive result for 71.7% of samples: lesion swab samples were
74.3% positive, serum samples were 66.9% positive, whole blood
Negative controls
Probable syphilis

samples were 64.2% positive, earlobe blood samples were 92%

Characteristic

Control group

positive, and CSF samples were 90.2% positive across all patients
Neurosyphilis
Syphilis type

with confirmed syphilis infections. No significant differences

Secondary

Subtotal
Subtotal
Primary

were observed in positive results from lesion swab and whole

Tertiary

Latent

Total

blood samples from early syphilis cases, perhaps due to small

†

‡
g1

g2

sample size.
g

44 Sexually Transmitted Diseases • Volume 46, Number 1, January 2019


TABLE 4. Relationship Between Serum RPR Titer and T. pallidum DNA Results in Syphilis Patients at Initial Visit (N = 159)*
Primary Syphilis
DNA Result Sample Size ≤1:4 ≥1:8 p†1
Positive 72 0 2 0.44
Negative 54 4 3
Total 126 4 5
*Of the 159 serum samples, 33 serum samples including 23 from secondary and 10 from tertiary syphilis were not included in this table, because their
RPR titers were ≥1:8.
†
P values calculated with Fisher exact test for both primary syphilis and neurosyphilis groups.
Nested and real-time PCR accurately returned more correct
positive results than previous PCR approaches for the collection
methods used here3,11,14,16; nevertheless, NR-PCR did not return
more positive results than previous PCR approaches for lesion
swabs.3,7,14 This may be due to insufficient T. pallidum DNA in le-
sion swab samples. The NR-PCR results also indicated specificity
for T. pallidum DNA of 99%—only 1 of 84 control samples was
positive for T. pallidum DNA (Table 3), and the positive DNA re-
sult was from a patient with positive serological RPR. Increased
accuracy of NR-PCR may be explained by three differences be-
tween NR-PCR and previous PCR approaches. First, we increased
the concentration of the T. pallidum DNA template after amplifica-
tion with the outer primer pairs, increasing sensitivity. Second, we
used a sensitive and specific TaqMan Minor Groove Binder probe.
Third, we used a more specific target gene polA, which encodes
DNA polymerase I which has a high cysteine content and four
unique insertions. The T. pallidum polA gene has low homology
with polA from other microorganisms.6
PCR can be used to diagnose early syphilis and asymptom-
atic neurosyphilis when serum antibodies and CSF VDRL are
negative.7,17,18 Currently used PCR methods identify between 1
and 400 T. pallidum cells/mL. For example, Marra's group de-
signed an improved RT-PCR method to identify up to 10 T.
pallidum cells/mL in CSF.19 Zeng and Zheng's group reported that
regular and nested PCR found 400 and 10 T. pallidum cells/mL,
respectively,20,21 whereas Grange's group reported that nested
PCR identified 20 T. pallidum strain Nichols cells/mL.3 Except
for a congenital syphilis a neonate sample with more greater T.
pallidum DNA positivity than an adult sample,22 PCR data for
syphilitic samples were the least sensitive for whole blood samples
and most sensitive for lesion swab samples.3,9,14,23 Insufficient T.
pallidum cells in lesion swabs sample may have resulted in less
DNA positivity.18 Meanwhile, NR-PCR assays were positive for
38.5% to 87.2% of all syphilis cases tested, an improvement over
previous nested PCR assays.3,24,25 Nested and real-time PCR
was the most successful at identifying T. pallidum in earlobe blood
of neurosyphilis and latent syphilis patients. In addition, NR-PCR
assays of CSF samples from latent syphilis and neurosyphilis pa-
tients were more accurate than previous tests using real-time
PCR.7 T. pallidum DNA positivity was associated with serum
RPR titers in latent syphilis patients: NR-PCR was significantly
more likely to return a positive result for latent syphilis patients
with serum RPR titers of 1:8 or greater, compared to RPR titers
of 1:4 or less. The RPR titers 1:8 or greater are typically consid-
ered to indicate active syphilis.26,27
Thus, NR-PCR can be used to quantify T. pallidum DNA,
but limitations include the following: we used no controls for
real-time PCR, and we did not analyze syphilis diagnoses for pos-
itive DNA tests using NR-PCR and positive serum treponemal an-
tibody with TPPA arrays. Finally, different sample sizes of syphilis
types might have introduced bias, and larger sample sizes are nec-
essary to validate our results.
Sexually Transmitted Diseases • Volume 46, Number 1, January 2019
Real-Time PCR for T. pallidum
Neurosyphilis Latent Syphilis
≤1:4 ≥1:8 pj2 ≤1:4 ≥1:8 χ21 p3
1 7 0.15 7 55 23.3 <0.01
2 1 24 20
3 8 31 75
Key Message
(1) NR-PCR is feasible and valuable for identifying T. pallidum
DNA from biospecimens of patients at various stages of syphilis
disease progression.
(2) Peripheral earlobe venous blood from latent syphilis
and neurosyphilis patients had the greatest T. pallidum
DNA positivity.
(3) Serum T. pallidum DNA positivity for latent syphilis patients
with RPR titers ≥ 1:8 was greater than that for RPR titers ≤ 1:4.
REFERENCES
1. Zobanikova M, Mikolka P, Cejkova D, et al. Complete genome sequence
of Treponema pallidum strain DAL-1. Stand Genomic Sci 2012; 7:12–21.
2. Zhou J, Liang Y, Zhang J, et al. The analyzation and clinical evaluation
of ECLIA and CMIA in the detection of Treponema pallidum. Medi-
cine (Baltimore) 2017; 96:e7139.
3. Grange PA, Gressier L, Dion PL, et al. Evaluation of a PCR test for de-
tection of Treponema pallidum in swabs and blood. J Clin Microbiol
2012; 50:546–552.
4. Marra CM, Maxwell CL, Dunaway SB, et al. Cerebrospinal fluid Trep-
onema pallidum particle agglutination assay for neurosyphilis diagno-
sis. J Clin Microbiol 2017; 55:1865–1870.
5. Burstain JM, Grimprel E, Lukehart SA, et al. Sensitive detection of
Treponema pallidum by using the polymerase chain reaction. J Clin
Microbiol 1991; 29:62–69.
6. Liu H, Rodes B, Chen CY, et al. New tests for syphilis: Rational design
of a PCR method for detection of Treponema pallidum in clinical spec-
imens using unique regions of the DNA polymerase I gene. J Clin
Microbiol 2001; 39:1941–1946.
7. Gayet-Ageron A, Lautenschlager S, Ninet B, et al. Sensitivity, specific-
ity and likelihood ratios of PCR in the diagnosis of syphilis: A system-
atic review and meta-analysis. Sex Transm Infect 2013; 89:251–256.
8. Li J, Zheng HY. Advances in syphilis detection. Zhongguo Yi Xue Ke
Xue Yuan Xue Bao Acta Academiae Medicinae Sinicae. 2012; 34:
95–98.
9. Wang LN, Li J, Huang W, et al. Detection of the Treponema pallidum
gene and variation of treponemal DNA load before and after therapy.
Int J STD AIDS 2012; 23:e6–e8.
10. Ye X, Lin H, Dai X, et al. Application of polymerase chain reaction in
detection of Treponema palladium : An update. Int J Deramatol
Venereol 2016; 42:15–18.
11. Gayet-Ageron A, Ninet B, Toutous-Trellu L, et al. Assessment of a
real-time PCR test to diagnose syphilis from diverse biological sam-
ples. Sex Transm Infect 2009; 85:264–269.
12. Ye X, Gao F, Cao W, et al. Application of net real time PCR in detecting
Tp DNA from various clinic samples for syphilis patients of preliminary
diagnosis: Preliminary result. Chin J Dermatol 2017; 50:346–350.
13. Department For STD Control. Center For Chinese Disease Prevention
And Control Branch Of Dermatology And Venereology CSOS.
Management guideline for syphilis, gonorrhea, genital herpes, geni-
tal Chlamydia trachomatis infection (2014). Chin J Dermatol 2014; 47:
365–372.
14. Sutton MY, Liu H, Steiner B, et al. Molecular subtyping of Treponema
pallidum in an Arizona County with increasing syphilis morbidity: Use
of specimens from ulcers and blood. J Infect Dis 2001; 183:1601–1606.
45
Zhang et al.
15. Leslie DE, Azzato F, Karapanagiotidis T, et al. Development of a real-
time PCR assay to detect Treponema pallidum in clinical specimens
and assessment of the assay's performance by comparison with sero-
logical testing. J Clin Microbiol 2007; 45:93–96.
16. Marfin AA, Liu H, Sutton MY, et al. Amplification of the DNA poly-
merase I gene of Treponema pallidum from whole blood of persons
with syphilis. Diagn Microbiol Infect Dis 2001; 40:163–166.
17. Wicher K, Noordhoek GT, Abbruscato F, et al. Detection of Treponema
pallidum in early syphilis by DNA amplification. J Clin Microbiol
1992; 30:497–500.
18. Jethwa HS, Schmitz JL, Dallabetta G, et al. Comparison of molecular
and microscopic techniques for detection of Treponema pallidum in
genital ulcers. J Clin Microbiol 1995; 33:180–183.
19. Marra CM, Maxwell CL, Smith SL, et al. Cerebrospinal fluid abnor-
malities in patients with syphilis: Association with clinical and labora-
tory features. J Infect Dis 2004; 189:369–376.
20. Zeng T, Wu Y, Huang S, et al. Preliminary study on molecular
subtyping of Treponema pallidum in Hengyang and Jiangmen region.
Chin J Dermatol 2004; 37:10–12.
21. Zheng H, Ou Z, Hu Y, et al. Detection and subtyping of Treponema
pallidum with nested PCR. Chin J Dermatol 2005; 38:546–548.
46 Sexually Transmitted Diseases
22. Woznicova V, Smajs D, Wechsler D, et al. Detection of Treponema
pallidum subsp. pallidum from skin lesions, serum, and cerebrospinal
fluid in an infant with congenital syphilis after clindamycin treatment
of the mother during pregnancy. J Clin Microbiol 2007; 45:659–661.
23. Shen HJ, Sun MY, Liu AM. Clinical features of 121 infants below
3 months of age with congenital syphilis. Zhonghua Er Ke Za Zhi
2009; 47:871–873.
24. Castro R, Prieto E, Aguas MJ, et al. Detection of Treponema pallidum
sp pallidum DNA in latent syphilis. Int J STD AIDS 2007; 18:
842–845.
25. Wu H, Chang SY, Lee NY, et al. Evaluation of macrolide resistance
and enhanced molecular typing of Treponema pallidum in patients
with syphilis in Taiwan: A prospective multicenter study. J Clin
Microbiol 2012; 50:2299–2304.
26. Gupte S, Daly C, Agarwal V, et al. Introduction of rapid tests for large-
scale syphilis screening among female, male, and transgender sex
workers in Mumbai India. Sex Transm Dis 2011; 38:499–502.
27. De Santis M, De Luca C, Mappa I, et al. Syphilis infection during preg-
nancy: Fetal risks and clinical management. Infect Dis Obstet Gynecol
2012; 2012:430585.
• Volume 46, Number 1, January 2019