www.sciencemag.

org/content/345/6196/535/suppl/DC1

Supplementary Material for

Decreased motivation during chronic pain requires long-term
depression in the nucleus accumbens
Neil Schwartz, Paul Temkin, Sandra Jurado, Byung Kook Lim, Boris D. Heifets,
Jai S. Polepalli, Robert C. Malenka*

*Corresponding author. E-mail: malenka@stanford.edu

Published 1 August 2014, Science 345, 535 (2014)

DOI: 10.1126/science.1253994

This PDF file includes:

Materials and Methods

Figs. S1 to S10
Full Reference List
Materials and Methods
Animals: Male mice (8 to 16 weeks old) from our in-house colony of DRD1A–
tdTomato/DRD2–eGFP BAC and Adenosine A2a CRE transgenic mice were backcrossed to
C57BL/6 mice from Charles River and used for all experiments. All experiments were approved
by Stanford University’s Administrative Panel on Laboratory Animal Care in accordance with
the animal care standards set forth by the National Institutes of Health and complied with the
guidelines established by the Committee for Research and Ethical Issues of the International
Association for the study of pain and the Canadian Council on Animal Care.

Operant Behavior: Equipment and procedures were based on published methods (49, 50).
Briefly, food restricted mice (85-90% free feeding weight) were first trained to nose poke for
reward on a FR1 schedule of reward delivery in operant chambers in which the flooring had been
covered with a hard plastic sheet. In this task, every correct response switches a light off and
earns the animal a reward (a 14 mg flavored food pellet). After 2 days on this task, a 20 second
delay was introduced after a correct response and before reward delivery. After a minimum of 2
consecutive days of earning the maximum 30 rewards in an hour on this task, animals were
switched to a PR schedule. For the first 2 days of PR training, the nose pokes required for reward
equaled 4 times the number of rewards earned. For the remaining days of the experiment, the
nose pokes required for reward equaled 6 times the number of rewards earned. The session
ended at one hour or if the mouse did not make a nose poke in 5 minutes. Testing sessions were
run daily until the difference between rewards earned on two consecutive days was less than or
equal to 2. Animals that did not meet this criterion in 5 days or earned less than five rewards
during baseline testing were excluded from the study. Once animals met these criteria they
underwent sham or model induction. Animals were then tested within four day windows starting
at 7, 12, and 18 days after model induction or until the difference between rewards earned on two
consecutive days was less than or equal to 2. The responses for two days at each of the time
points were used to monitor the behavior of the animals.

Chronic pain models: The SNI model was induced as described (51). Briefly, under anesthesia,
the common peroneal and tibeal branches of the sciatic nerve were exposed by blunt dissection.
These nerve branches were then ligated with 6-0 silk ligature and a 2-4 mm section of nerve was
removed distal to the ligature. The wound was then closed in two layers with sutures. In sham
animals, the nerve branches were exposed and the wound was closed. The nerve and
surrounding wound were kept moist with saline throughout the surgery. The CFA model was
induced by intraplantar injection of 10 µl of complete Freund’s adjuvant (1:1 with sterile saline)
into the right hind paw. Three to 4 days later a second booster injection was administered to
prolong the effects of the model. Sham animals received two injections of saline. Diclofenac
(20 mg/kg) was administered subcutaneously (s.c.) approximately 90 minutes before the start of
PR testing. Clonidine was administered intrathecally (i.t.) with a Hamilton syringe (5 µl; 1 mg/5
ml saline) immediately before the start of PR testing. Mechanical sensitivity was determined
post PR testing. For all behavioral experiments animals were either housed in pairs or alone
with nesting material.

Mechanical sensitivity: To acclimatize animals to the testing apparatus, individual animals

were placed into transparent containers on a peg board for approximately 30 min a day for 3

2
days. For testing on the 4th day, the plantar surface of the hind paw was stimulated using a
series of 5 von Frey filaments in ascending order from 0.04 to 1 gram. To determine the
mechanical threshold or the lowest force in the series able to reproducibly elicit paw withdrawal,
a single steady >1 sec application of each filament was used, starting with the smallest filament.
If paw withdrawal was elicited, the preceding filament in the series was then applied 8 times
with >15 sec between applications. If paw withdrawal occurred 4 or more times in response to
this filament then this force was recorded as the mechanical threshold. If paw withdrawal
occurred less than 4 times in response to 8 applications, then filaments were tested in ascending
order for the filament which could elicit a minimum of 4 withdrawals in response to 8
applications.

Sucrose preference test: Two water bottles were attached to the home cages of individually
housed sham or model animals. On the first day both bottles contained water. The amount of
water consumed from each bottle was measured after 24 hours. The water in the bottle from
which less water was consumed was then replaced with a 2% sucrose water solution. The
amount of liquid consumed was then measured twice at 24 hour intervals and sucrose preference
was calculated as the average of the daily amount of sucrose solution consumed divided by the
total liquid consumed from both bottles.

Electrophysiology: Whole cell recordings were done as previously described (52). Briefly, after
isoflurane anesthesia the brain was removed and placed into an ice-cold sucrose solution.
Parasagittal slices (250 µm) containing the NAc identified by the anterior commissure were
prepared using a Leica vibroslicer. Slices were then incubated at ~25oC in oxygenated (95% O2,
5% CO2) artificial cerebrospinal fluid (ACSF) consisting of 124 mM NaCl, 4.4 mM KCl, 2.5
mM CaCl2, 1.3 mM MgSO4, 1 mM NaH2PO4, 11 mM glucose and 26 mM NaHCO3 for at least
an hour before recording in the same ACSF with the GABA-A receptor antagonist picrotoxin (50
μM) at 25-30oC. Electrodes (3.0–8.0 MΩ) filled with 120 mM CsMeSO4, 15 mM CsCl, 8 mM
NaCl, 10 mM HEPES, 0.2 mM EGTA, 10 mM TEA-Cl, 4 mM Mg2+ATP, 0.3 mM NaGTP, 0.1
mM spermine and 5 mM QX-314 were used for recording. Afferents were stimulated with an
isoflex stimulus isolator and a bipolar nichrome wire electrode placed at the border between the
NAc and cortex dorsal to the anterior commissure. Data were acquired at 10 kHz and filtered at
3-5 kHz. No data were collected in the first 5 min after entering whole cell configuration. For
LTD and cell loading experiments, cells were discarded if it took longer than 25 min to obtain a
stable baseline recording. Input resistance and access resistance were monitored throughout each
experiment and experiments were terminated if access resistance changed by >20%. Data were
analyzed using custom Igor Pro software. A 50 msec inter-pulse interval was used for paired
pulse ratios, calculated as EPSC2/EPSC1. CV was determined by dividing the standard deviation
by the mean amplitude of 20 consecutive events. AMPAR/NMDAR ratios were calculated by
dividing the peak amplitude of an averaged AMPAR EPSC at -70 mV by the amplitude of an
averaged EPSC at +40 mV at 50 msec after the peak (NMDAR EPSC). Miniature EPSCs were
recorded at -70 mV in the presence of TTX (500 nM) and detected using a 6 pA threshold with a
rise time <3 msec. One hundred consecutive events were used from each cell. NMDAR EPSCs
were recorded at +40 mV in the presence of NBQX (100 µM) and were fit with a double
exponential function. For LTD experiments EPSCs were averaged together in 2 min bins. LTD
was induced by applying 1 Hz afferent stimulation for 10 min while holding cells at -45 mV.

3
Additional reagents used were: ifenprodil (3 µM), galanin (1 µM), and M40 (0.4 µg per µL intra-
NAc injection).

Immunochemistry: After being deeply anesthetized animals were transcardially perfused with
4% paraformaldehyde in phosphate buffered saline. Brains were then removed, kept in this
solution at 4oC overnight and then cut into 50 µm free floating coronal sections. Sections were
first washed in 0.5% Triton X-100 in PBS (PBST), then blocked for an hour with a 1% solution
of normal goat and horse serum, and then incubated overnight at 4oC in α-galanin (1:2,000)
(Bachem T-4334) antibodies. The next day sections were washed in PBST and then incubated
for 2 hours at room temperature in donkey anti-rabbit AlexaFlour 594 (Molecular Probes) at
1:250 each. For the GalR1 staining, α-GalR1 antibody (1:1,000) (Origene TA313171) and
secondary AlexaFlour-633 (1:250) were used. Image acquisition was performed with a confocal
microscope (Zeiss LSM510) using a 40X oil immersion objective.

Viruses and shRNA: The AAVs used in this study were produced by the Stanford
Neuroscience Gene Vector and Virus Core. The procedures for generating AAVs, rabies virus,
and lentiviruses are as previously reported (30, 36). For the GalR1 shRNA, an oligonucleotide
consisting of sense strand (ACTTCATTACGCTGGTAGT targeted to GalR1- GenBank
accession: NM_008082.2) and antisense sequences, connected with a hairpin loop followed by a
poly(T) termination signal was purchased from IDT–DNA (Iowa). This sequence was sub
cloned into an AAV vector expressing eGFP. For the rescue constructs PCR based mutagenesis
was used to generate a shRNA resistant version of GalR1-eGFP (53) that was inserted into the
same AAV backbone:
(Forward:TTCGGCATTGGCGTGGAGAACTTCATCACACTAGTAGTGTTTGGCCTGATTT
TCGCGATG,
reverse:CATCGCGAAAATCAGGCCAAACACTACTAGTGTGATGAAGTTCTCCACGCCA
ATGCCGAA). The CRE dependent construct was generated as previously reported (30).
Briefly, the shRNA resistant GalR1 GFP tagged mutant was cloned between loxP and loxP2722
in the reverse orientation in the AAV vector expressing the GalR1 shRNA. To verify
knockdown and expression of the GFP-tagged replacement GalR1 hippocampal cultures DIV10-
16 were infected with the respective constructs. RNA was isolated using the RNAqueous-Micro
reagent kit and primers for GalR1, and β-Actin, were used in a 7900HT Fast RT-PCR
instrument. The shRNA produced >80% reduction in GalR1 expression compared to GFP
infected sister cultures. Although the specificity of antibodies generated against the synthesized
GalR1 peptide sequences has been questioned (54), we found that staining for GalR1 in cells
expressing the shRNA in the NAc was visibly reduced compared to neighboring uninfected cells
(Fig. 4E). This difference was not quantified.

Stereotaxic injections: Unless otherwise stated animals were anesthetized with a mixture of
ketamine (75 mg/kg body weight) and dexmedetomidine (0.375 mg/kg body weight). Following
the procedure atipamezole (10 mg/kg body weight) was administered by intraperitoneal injection
to reverse the effect of dexmedetomidine. A glass pipette filled with viral solution was lowered
through a small hole drilled through the skull to the appropriate depth using a stereotaxic setup.
Virus was then injected (100 nl per min) using a syringe pump. A concentrated aliquot (0.9 µl) of
AAVs was injected bilaterally into the NAc (bregma 1.54, lateral 1.1, ventral 4.2). A smaller
volume of rabies virus (0.4 µl) was injected unilateraly using the same coordinates. To

4
compensate for the smaller spread of lentivirus, two aliquots (0.4 µl) were injected into each
NAc (bregma 1.52, 1.54, lateral 1.1, 1.1, ventral 4.25, 4.1). This resulted in eGFP being
expressed and visible in >75% of the NAc. The injection pipette was withdrawn 5 min after the
end of the infusion and the scalp was then sealed. Animals were used a minimum of 3 weeks
after AAV or lentivirus injection and at 3 days after rabies injection. For animals not used for
electrophysiology the injection site was verified post hoc.

Intra-NAc infusion: To infuse M40 animals were implanted with bilateral cannulas (bregma
1.53, lateral 1.1, ventral 4.1) two weeks before the experiments. On the two days before the
experiment PE10 tubing was affixed to the adaptor on the cannulas and the animals were
acclimatized to the testing environment for an hour. On the day of the experiment infusions
began 2 hours before the injection of saline or CFA into the hind paw. Infusions continued at 3
hour intervals until the animals were sacrificed for electrophysiology.

Statistics: Unless otherwise stated, Student’s two-tailed t-tests were used to compare two
groups. Multiple groups were compared using ANOVA with Dunnett’s post hoc t-tests, unless
otherwise indicated. Data are presented as mean ± SEM. Approximately two thirds of the
behavioral assays (Figs. 1, 5 and 6) were performed blindly with respect to the history of virus
manipulation of the animals as well as SNI sham or SNI model induction.

5
Fig. S1.
Pain models do not affect reward seeking or food consumption. (A) During baseline testing
(i.e. before induction of the pain models) animals in all groups earned a comparable number of
rewards. (B) On a FR1 schedule on the day after PR testing all animals earned the maximum
number of rewards (30) at a comparable rate (left bar graph) and searched the food magazine for
reward a comparable number of times (right bar graph) (Control n=12 includes SNI sham
surgery n=4, CFA Sham injections n=5, untreated n=3; CFA n=10; SNI n=8). (C) In their home
cages all animals consumed a comparable amount of chow per day (Control n=6, CFA n=6, SNI
n=5).

6
Fig. S2
Mechanical sensitivity does not co-vary with impairment on PR task. The mechanical
thresholds for animals used in the PR testing were significantly reduced 13 to 14 days
following CFA or SNI induction but did not co-vary with the change in the number of rewards
earned on the PR test (CFA n=8, SNI n=5).

7
Fig. S3
Presynaptic function is not affected in either pain model. (A) No differences were detected in
paired pulse ratios for evoked AMPAR EPSCs (EPSC2/EPSC1) at a 50 msec inter-stimulus
interval. (B) No differences were detected in the coefficient of variation for AMPAR EPSCs in
either pain model (D2-MSN: Control n=15, CFA n=13, SNI n=12; D1-MSN: Control n=12, CFA
n=7, SNI n=11).

8
Fig. S4
Galanin causes a transient presynaptic depression of AMPAR EPSCs. (A) Sample
experiment showing time course of the effect of Gal on AMPAR EPSCs from a D2-MSN.
Representative average traces are taken at the times indicated in the graph. (B,C) Summary
graph of time course of Gal’s effect on AMPAR EPSC (B) and AMPAR EPSC coefficient of
variation (C) (n=8). (D, E) Summary graphs of Gal’s effects on AMPAR EPSCs in D2 and D1-
MSNs with and without GDPβs in the patch pipette. Representative average traces before and 25
to 35 min after bath application of Gal are shown on right. (F) Corresponding summary data for
coefficient of variation before application of Gal (1) and 25 to 30 min after start of Gal
application (2). Vertical scale bars: 100 pA, horizontal scale bars: 50 msec. (D2-MSN n=5; D2-
MSN+GDPβs n=6; D1-MSN n=8; D1-MSN+ GDPβs n=7; *p<0.5 t-test).

9
Fig. S5.
Galanin induced slowing of NMDAR EPSCs kinetics requires postsynaptic G-protein
signaling. (A,B) Summary graphs showing time course of effects of Gal on NMDAR EPSCs in
control D1- and D2-MSNs (A) and in D2-MSNs loaded with GDPβs (B) (D2-MSN n=8, D2-
MSN+GDPβs n=6m D1-MSN n=5). (C) Summary data after 25 to 35 min of Gal application,
showing that the change in coefficient of variation is not blocked by postsynaptic loading with
GDPβs, but the Gal-induced change in decay kinetics of NMDAR EPSCs is inhibited, (*p<0.05
t-test).

10
Fig. S6.
Galanin facilitates NMDAR-dependent LTD in NAc D2-MSNs. (A) Time line of
experiments in B-C. (B) Summary LTD plots show that a 30 min pre-incubation in Gal
facilitates the induction of LTD in D2-MSNs. (C) Summary of LTD magnitude at 30 to 35 min
post-LTD induction (Control n=11, post-Gal incubation n=6, *p<0.05 t-test). (D) Time line of
AP5 experiments. (E) Summary graph for LTD experiments in D2-MSNs in presence of AP5
(n=4).

11
Fig. S7.
NMDAR-dependent LTD requires GluN2B after Galanin treatment. (A) Time line of
experiments: slices were kept in ACSF only or incubated in Gal for at least 30 min, then kept in
ACSF for at least 30 min before experiments began. (B,C) Summary graphs for LTD
experiments reveal that ifenprodil does not affect LTD in slices kept in ACSF (control from Fig
5; control & ifenprodil n=5) (B) but inhibits LTD in slices pre-incubated in Gal (C) (incubated
in Gal from Figure S6; incubated in Gal & ifenprodil n=5). (D) Summary of LTD magnitude 30
to 35 min after LTD induction (*p<0.05 t-test).

12
Fig. S8.
Conditional replacement of GalR1 in NAc D2-MSNs expressing GalR1
shRNA rescues the decrease in nose pokes post SNI induction. (A) Schematic
of virus construct. (B,C) Cumulative distribution (B) and summary plots (C)
reveal that Adenosine A2a CRE transgenic animals that were injected bilaterally
into the NAc with the rescue construct show a decrease in nose poking following
SNI induction. (SNI and GalR1 KD SNI taken from Fig. 5; DIO-Rep.GalR1 KD
SNI n=5; p<0.05 post hoc t-test).

13
Fig. S9.
Knockdown of GalR1 does not affect the value of food rewards, mobility or mechanical
thresholds. (A,B) Virus manipulations did not affect the number of searches for reward during
the PR task (A) or mechanical withdrawal thresholds (B). (C, D) On a FR1 schedule on the day
after PR testing all animals earned the maximum number of rewards (30) at a comparable rate
(C) and searched the food magazine for reward a comparable number of times (D). PR and FR1
tasks all time points. (Control n=10; CFA n=6 includes eGFP n=3, naïve n=3; GalR1 KD+CFA
n=12; SNI n=6 includes eGFP n=2, naïve n=4; GalR1 KD+SNI n=6) (Mechanical threshold:
Control n=8; CFA n=6 includes eGFP n=3, naïve n=3; GalR1 KD+CFA n=8; SNI n=4; GalR1
KD+SNI n=6)

14
Fig. S10.
Expression of AKPA∆PP2B does not affect the value of food rewards, mobility or
mechanical thresholds. (A,B) Expression of AKPA∆PP2B did not affect the number of
searches for reward during the PR task (A) or mechanical withdrawal thresholds (B). (C,D) On a
FR1 schedule on the day after PR testing, all animals earned the maximum number of rewards
(30) at a comparable rate (C) and searched the food magazine for reward a comparable number
of times (D). (Control taken from Fig S9; CFA n=6 includes eGFP n=2, AKAPWT n=4;
AKAP∆PP2B+CFA n=4; SNI n=6 includes eGFP n=2, AKAPWT n=4; AKAP∆PP2B+SNI,
n=6).

15
Reference and Notes
1. B. Nicholson, S. Verma, Comorbidities in chronic neuropathic pain. Pain Med. 5, S9–S27
(2004). Medline doi:10.1111/j.1526-4637.2004.04019.x
2. D. C. Turk, J. Audette, R. M. Levy, S. C. Mackey, S. Stanos, Assessment and treatment of
psychosocial comorbidities in patients with neuropathic pain. Mayo Clin. Proc. 85, S42–
S50 (2010). Medline doi:10.4065/mcp.2009.0648
3. J. Dersh, P. B. Polatin, R. J. Gatchel, Chronic pain and psychopathology: Research findings
and theoretical considerations. Psychosom. Med. 64, 773–786 (2002). Medline
4. T. Jonsson, L. L. Christrup, J. Højsted, H. H. Villesen, T. H. Albjerg, L. V. Ravn-Nielsen, P.
Sjøgren, Symptoms and side effects in chronic non-cancer pain: Patient report vs.
systematic assessment. Acta Anaesthesiol. Scand. 55, 69–74 (2011). Medline
doi:10.1111/j.1399-6576.2010.02329.x
5. J. P. Johansen, H. L. Fields, B. H. Manning, The affective component of pain in rodents:
Direct evidence for a contribution of the anterior cingulate cortex. Proc. Natl. Acad. Sci.
U.S.A. 98, 8077–8082 (2001). Medline doi:10.1073/pnas.141218998
6. D. Borsook, L. Becerra, W. A. Carlezon Jr., M. Shaw, P. Renshaw, I. Elman, J. Levine,
Reward-aversion circuitry in analgesia and pain: Implications for psychiatric disorders.
Eur. J. Pain 11, 7–20 (2007). Medline doi:10.1016/j.ejpain.2005.12.005
7. C. A. von Hehn, R. Baron, C. J. Woolf, Deconstructing the neuropathic pain phenotype to
reveal neural mechanisms. Neuron 73, 638–652 (2012). Medline
doi:10.1016/j.neuron.2012.02.008
8. A. I. Basbaum, D. M. Bautista, G. Scherrer, D. Julius, Cellular and molecular mechanisms of
pain. Cell 139, 267–284 (2009). Medline doi:10.1016/j.cell.2009.09.028
9. J. D. Salamone, M. Correa, The mysterious motivational functions of mesolimbic dopamine.
Neuron 76, 470–485 (2012). Medline doi:10.1016/j.neuron.2012.10.021
10. G. J. Mogenson, D. L. Jones, C. Y. Yim, From motivation to action: Functional interface
between the limbic system and the motor system. Prog. Neurobiol. 14, 69–97 (1980).
Medline doi:10.1016/0301-0082(80)90018-0
11. B. W. Balleine, J. P. O’Doherty, Human and rodent homologies in action control:
Corticostriatal determinants of goal-directed and habitual action.
Neuropsychopharmacology 35, 48–69 (2010). Medline doi:10.1038/npp.2009.131
12. D. J. Scott, M. M. Heitzeg, R. A. Koeppe, C. S. Stohler, J.-K. Zubieta, Variations in the
human pain stress experience mediated by ventral and dorsal basal ganglia dopamine
activity. J. Neurosci. 26, 10789–10795 (2006). Medline doi:10.1523/JNEUROSCI.2577-
06.2006
13. M. N. Baliki, B. Petre, S. Torbey, K. M. Herrmann, L. Huang, T. J. Schnitzer, H. L. Fields,
A. V. Apkarian, Corticostriatal functional connectivity predicts transition to chronic back
pain. Nat. Neurosci. 15, 1117–1119 (2012). Medline doi:10.1038/nn.3153
14. R. Urban, G. Scherrer, E. H. Goulding, L. H. Tecott, A. I. Basbaum, Behavioral indices of
ongoing pain are largely unchanged in male mice with tissue or nerve injury-induced

1
 mechanical hypersensitivity. Pain 152, 990–1000 (2011). Medline
doi:10.1016/j.pain.2010.12.003
15. I. Yalcin, Y. Bohren, E. Waltisperger, D. Sage-Ciocca, J. C. Yin, M. J. Freund-Mercier, M.
Barrot, A time-dependent history of mood disorders in a murine model of neuropathic
pain. Biol. Psychiatry 70, 946–953 (2011). Medline doi:10.1016/j.biopsych.2011.07.017
16. H. S. Roane, On the applied use of progressive-ratio schedules of reinforcement. J. Appl.
Behav. Anal. 41, 155–161 (2008). Medline doi:10.1901/jaba.2008.41-155
17. C. P. O’Brien, E. L. Gardner, Critical assessment of how to study addiction and its treatment:
Human and non-human animal models. Pharmacol. Ther. 108, 18–58 (2005). Medline
doi:10.1016/j.pharmthera.2005.06.018
18. J. A. Shuen, M. Chen, B. Gloss, N. Calakos, Drd1a-tdTomato BAC transgenic mice for
simultaneous visualization of medium spiny neurons in the direct and indirect pathways
of the basal ganglia. J. Neurosci. 28, 2681–2685 (2008). Medline
doi:10.1523/JNEUROSCI.5492-07.2008
19. A. Sanz-Clemente, R. A. Nicoll, K. W. Roche, Diversity in NMDA receptor composition:
Many regulators, many consequences. Neuroscientist 19, 62–75 (2013). Medline
doi:10.1177/1073858411435129
20. B. R. Lee, Y. Dong, Cocaine-induced metaplasticity in the nucleus accumbens: Silent
synapse and beyond. Neuropharmacology 61, 1060–1069 (2011). Medline
doi:10.1016/j.neuropharm.2010.12.033
21. M. B. Max, T. Wu, S. J. Atlas, R. R. Edwards, J. A. Haythornthwaite, A. F. Bollettino, H. S.
Hipp, C. D. McKnight, I. A. Osman, E. N. Crawford, M. Pao, J. Nejim, A. Kingman, D.
C. Aisen, M. A. Scully, R. B. Keller, D. Goldman, I. Belfer, A clinical genetic method to
identify mechanisms by which pain causes depression and anxiety. Mol. Pain 2, 14
(2006). Medline doi:10.1186/1744-8069-2-14
22. P. G. Unschuld, M. Ising, A. Erhardt, S. Lucae, M. Kohli, S. Kloiber, D. Salyakina, C. K.
Thoeringer, N. Kern, R. Lieb, M. Uhr, E. B. Binder, B. Müller-Myhsok, F. Holsboer, M.
E. Keck, Polymorphisms in the galanin gene are associated with symptom-severity in
female patients suffering from panic disorder. J. Affect. Disord. 105, 177–184 (2008).
Medline doi:10.1016/j.jad.2007.05.006
23. N. R. Wray, M. L. Pergadia, D. H. Blackwood, B. W. Penninx, S. D. Gordon, D. R. Nyholt,
S. Ripke, D. J. MacIntyre, K. A. McGhee, A. W. Maclean, J. H. Smit, J. J. Hottenga, G.
Willemsen, C. M. Middeldorp, E. J. de Geus, C. M. Lewis, P. McGuffin, I. B. Hickie, E.
J. van den Oord, J. Z. Liu, S. Macgregor, B. P. McEvoy, E. M. Byrne, S. E. Medland, D.
J. Statham, A. K. Henders, A. C. Heath, G. W. Montgomery, N. G. Martin, D. I.
Boomsma, P. A. Madden, P. F. Sullivan, Genome-wide association study of major
depressive disorder: New results, meta-analysis, and lessons learned. Mol. Psychiatry 17,
36–48 (2012). Medline doi:10.1038/mp.2010.109
24. Y. S. Nikolova, E. K. Singhi, E. M. Drabant, A. R. Hariri, Reward-related ventral striatum
reactivity mediates gender-specific effects of a galanin remote enhancer haplotype on
problem drinking. Genes Brain Behav. 12, 516–524 (2013). Medline
doi:10.1111/gbb.12035

2
25. M. E. Anderson, J. Runesson, I. Saar, U. Langel, J. K. Robinson, Galanin, through GalR1 but
not GalR2 receptors, decreases motivation at times of high appetitive behavior. Behav.
Brain Res. 239, 90–93 (2013). Medline doi:10.1016/j.bbr.2012.10.045
26. V. Sergeyev, C. Broberger, T. Hökfelt, Effect of LPS administration on the expression of
POMC, NPY, galanin, CART and MCH mRNAs in the rat hypothalamus. Brain Res.
Mol. Brain Res. 90, 93–100 (2001). Medline doi:10.1016/S0169-328X(01)00088-2
27. H. Imbe, T. Abe, K. Okamoto, M. Sato, H. Ito, S. Kumabe, E. Senba, Increase of galanin-like
immunoreactivity in rat hypothalamic arcuate neurons after peripheral nerve injury.
Neurosci. Lett. 368, 102–106 (2004). Medline doi:10.1016/j.neulet.2004.06.073
28. H. Nishii, M. Nomura, H. Aono, N. Fujimoto, T. Matsumoto, Up-regulation of galanin and
corticotropin-releasing hormone mRNAs in the key hypothalamic and amygdaloid nuclei
in a mouse model of visceral pain. Regul. Pept. 141, 105–112 (2007). Medline
doi:10.1016/j.regpep.2006.12.022
29. X.-L. Gu, Y.-G. Sun, L.-C. Yu, Involvement of galanin in nociceptive regulation in the
arcuate nucleus of hypothalamus in rats with mononeuropathy. Behav. Brain Res. 179,
331–335 (2007). Medline doi:10.1016/j.bbr.2007.02.033
30. B. K. Lim, K. W. Huang, B. A. Grueter, P. E. Rothwell, R. C. Malenka, Anhedonia requires
MC4R-mediated synaptic adaptations in nucleus accumbens. Nature 487, 183–189
(2012). Medline doi:10.1038/nature11160
31. Y. Dong, J. P. Tyszkiewicz, T. M. Fong, Galanin and galanin-like peptide differentially
modulate neuronal activities in rat arcuate nucleus neurons. J. Neurophysiol. 95, 3228–
3234 (2006). Medline doi:10.1152/jn.01117.2005
32. E. B. Einstein, Y. Asaka, M. F. Yeckel, M. J. Higley, M. R. Picciotto, Galanin-induced
decreases in nucleus accumbens/striatum excitatory postsynaptic potentials and morphine
conditioned place preference require both galanin receptor 1 and galanin receptor 2. Eur.
J. Neurosci. 37, 1541–1549 (2013). Medline doi:10.1111/ejn.12151
33. E. J. Cobos, N. Ghasemlou, D. Araldi, D. Segal, K. Duong, C. J. Woolf, Inflammation-
induced decrease in voluntary wheel running in mice: A nonreflexive test for evaluating
inflammatory pain and analgesia. Pain 153, 876–884 (2012). Medline
doi:10.1016/j.pain.2012.01.016
34. K. Yashiro, B. D. Philpot, Regulation of NMDA receptor subunit expression and its
implications for LTD, LTP, and metaplasticity. Neuropharmacology 55, 1081–1094
(2008). Medline doi:10.1016/j.neuropharm.2008.07.046
35. P. F. Durieux, B. Bearzatto, S. Guiducci, T. Buch, A. Waisman, M. Zoli, S. N. Schiffmann,
A. de Kerchove d’Exaerde, D2R striatopallidal neurons inhibit both locomotor and drug
reward processes. Nat. Neurosci. 12, 393–395 (2009). Medline doi:10.1038/nn.2286
36. S. Jurado, V. Biou, R. C. Malenka, A calcineurin/AKAP complex is required for NMDA
receptor-dependent long-term depression. Nat. Neurosci. 13, 1053–1055 (2010). Medline
doi:10.1038/nn.2613
37. S. M. Nicola, The flexible approach hypothesis: Unification of effort and cue-responding
hypotheses for the role of nucleus accumbens dopamine in the activation of reward-

3
 seeking behavior. J. Neurosci. 30, 16585–16600 (2010). Medline
doi:10.1523/JNEUROSCI.3958-10.2010
38. A. M. Farrar, K. N. Segovia, P. A. Randall, E. J. Nunes, L. E. Collins, C. M. Stopper, R. G.
Port, J. Hockemeyer, C. E. Müller, M. Correa, J. D. Salamone, Nucleus accumbens and
effort-related functions: Behavioral and neural markers of the interactions between
adenosine A2A and dopamine D2 receptors. Neuroscience 166, 1056–1067 (2010).
Medline doi:10.1016/j.neuroscience.2009.12.056
39. J. L. Santerre, E. J. Nunes, R. Kovner, C. E. Leser, P. A. Randall, L. E. Collins-Praino, L.
Lopez Cruz, M. Correa, Y. Baqi, C. E. Müller, J. D. Salamone, The novel adenosine
A(2A) antagonist prodrug MSX-4 is effective in animal models related to motivational
and motor functions. Pharmacol. Biochem. Behav. 102, 477–487 (2012). Medline
doi:10.1016/j.pbb.2012.06.009
40. M. K. Lobo, E. J. Nestler, The striatal balancing act in drug addiction: Distinct roles of direct
and indirect pathway medium spiny neurons. Front. Neuroanat. 5, 41 (2011). Medline
doi:10.3389/fnana.2011.00041
41. J. C. Lemos, M. J. Wanat, J. S. Smith, B. A. Reyes, N. G. Hollon, E. J. Van Bockstaele, C.
Chavkin, P. E. Phillips, Severe stress switches CRF action in the nucleus accumbens
from appetitive to aversive. Nature 490, 402–406 (2012). Medline
doi:10.1038/nature11436
42. B. B. Land, M. R. Bruchas, J. C. Lemos, M. Xu, E. J. Melief, C. Chavkin, The dysphoric
component of stress is encoded by activation of the dynorphin kappa-opioid system. J.
Neurosci. 28, 407–414 (2008). Medline doi:10.1523/JNEUROSCI.4458-07.2008
43. G. Dölen, A. Darvishzadeh, K. W. Huang, R. C. Malenka, Social reward requires
coordinated activity of nucleus accumbens oxytocin and serotonin. Nature 501, 179–184
(2013). Medline doi:10.1038/nature12518
44. M. Marinelli, P. V. Piazza, Interaction between glucocorticoid hormones, stress and
psychostimulant drugs. Eur. J. Neurosci. 16, 387–394 (2002). Medline
doi:10.1046/j.1460-9568.2002.02089.x
45. G. Cui, S. B. Jun, X. Jin, M. D. Pham, S. S. Vogel, D. M. Lovinger, R. M. Costa, Concurrent
activation of striatal direct and indirect pathways during action initiation. Nature 494,
238–242 (2013). Medline doi:10.1038/nature11846
46. F. Kasanetz, V. Deroche-Gamonet, N. Berson, E. Balado, M. Lafourcade, O. Manzoni, P. V.
Piazza, Transition to addiction is associated with a persistent impairment in synaptic
plasticity. Science 328, 1709–1712 (2010). Medline doi:10.1126/science.1187801
47. A. Chaudhuri, P. O. Behan, Fatigue in neurological disorders. Lancet 363, 978–988 (2004).
Medline doi:10.1016/S0140-6736(04)15794-2
48. K. B. Norheim, G. Jonsson, R. Omdal, Biological mechanisms of chronic fatigue.
Rheumatology (Oxford) 50, 1009–1018 (2011). Medline
doi:10.1093/rheumatology/keq454

4
49. D. M. Haluk, K. Wickman, Evaluation of study design variables and their impact on food-
maintained operant responding in mice. Behav. Brain Res. 207, 394–401 (2010). Medline
doi:10.1016/j.bbr.2009.10.025
50. N. R. Richardson, D. C. S. Roberts, Progressive ratio schedules in drug self-administration
studies in rats: A method to evaluate reinforcing efficacy. J. Neurosci. Methods 66, 1–11
(1996). Medline doi:10.1016/0165-0270(95)00153-0
51. S. D. Shields, W. A. Eckert 3rd, A. I. Basbaum, Spared nerve injury model of neuropathic
pain in the mouse: A behavioral and anatomic analysis. J. Pain 4, 465–470 (2003).
Medline doi:10.1067/S1526-5900(03)00781-8
52. B. A. Grueter, G. Brasnjo, R. C. Malenka, Postsynaptic TRPV1 triggers cell type-specific
long-term depression in the nucleus accumbens. Nat. Neurosci. 13, 1519–1525 (2010).
Medline doi:10.1038/nn.2685
53. E. Moreno, S. H. Vaz, N. S. Cai, C. Ferrada, C. Quiroz, S. K. Barodia, N. Kabbani, E. I.
Canela, P. J. McCormick, C. Lluis, R. Franco, J. A. Ribeiro, A. M. Sebastião, S. Ferré,
Dopamine-galanin receptor heteromers modulate cholinergic neurotransmission in the rat
ventral hippocampus. J. Neurosci. 31, 7412–7423 (2011). Medline
doi:10.1523/JNEUROSCI.0191-11.2011
54. X. Lu, T. Bartfai, Analyzing the validity of GalR1 and GalR2 antibodies using knockout
mice. Naunyn Schmiedebergs Arch. Pharmacol. 379, 417–420 (2009). Medline
doi:10.1007/s00210-009-0394-z