What Is Biotechnology An Overview

Dr. Fahd M.
Nasr
Faculty of Sciences-I
What Is Biotechnology
Processed by Prof. Dr. Fahd M. Nasr
1
Dr. Fahd M. Nasr
Table of Contents
I. What is biotechnology? 5
I.1. Then and now 5
I.1.1. Then 5
I.1.2. Now 5
I.1.3. Hearing recent history 7
I.1.4. Gene technology 8
I.2. DNA and genes 8
I.2.1. What is DNA? 8
I.2.2. Where is DNA? 9
I.2.3. The full set 9
I.2.4. What does DNA look like? 10
I.2.5. How does DNA work? 10
I.2.6. What is a gene? 11
I.2.7. Genes code for proteins 12
I.2.8. DNA unknown 13
I.3. Why do we do biotechnology? 14
I.3.1. For ourselves 14
I.3.2. For the environment 14
I.3.3. For food and agriculture 14
I.4. How do you do biotechnology? 14
I.4.1. Finding the gene you want 15
I.4.2. Cutting and pasting genes 16
I.4.3. Moving genes 17
I.4.3.a. Transferring genes to bacteria 17
I.4.3.b. Transferring genes to plant, animal and yeast cells 17
I.4.3.c. Transferring genes to egg cells 17
I.4.3.d. Other transformation methods 18
I.4.4. Reading and interpreting genes 19
I.4.5. Cloning a gene (polymerase chain reaction) 21
I.4.6. Cloning plants 22
I.4.7. Cloning animals 22
I.5. Regulation of gene technology in Australia 25
I.6. Ethics of biotechnology 26
II. Human uses 28

II.1. Fighting infectious diseases 28
II.1.1. Severe Acute Respiratory Syndrome (SARS) 29
II.1.2. Bird flu (Avian influenza) 29
II. 2. Antibiotics 30
II.2.a. Antibiotic resistance 31
II.3. Producing human products 31
II.3.1. Insulin for diabetes 31
II.3.2. Vaccines 32
II.3.3. ‘Pharming’ proteins 34
II.3.3.a. Biopharming 34
II.3.3.b. Pharming with animals 34
II.3.3.c. Pharming with plants 35
II.4. Reproductive technologies 35
II.4.1. IVF 36
II.4.1. Pre-implantation genetic diagnosis 36
II.5. The human genome project 37
II.5.1. What have we found? 37
2
Dr. Fahd M. Nasr
II.5.2. Who owns it? 39

II.5.3. What do we do with it? 39
II.5.4. Comparative genomics 39
II.6. Genetic disorders 41
II.6.1. Genetic testing 41
II.6.2. Newborn screening 44
II.6.3. Having a genetic test 44
II.7. Gene therapy 45
II.7.1. How to do gene therapy 45
II.7.2. The uses 45
II.7.3. The challenges 46
II.7.4. Just your genes…? 46
II.7.5. One possible future 47
II.8. Cloning 47
II.8.1. Cloning genes 47
II.8.2. Cloning animals 48
II.8.2.a. Australia’s first clones 49
II.8.2.b. Calf clone with a difference 49
II.8.3. Cloning humans? 50
II.8.3.a. Nuclear transfer - cloning human cells for therapy 50
II.8.3.b. Reproductive cloning - cloning a whole human 51
II.9. Stem cells 51
II.9.1. Types of stem cells 51
II.9.2. Embryonic stem cells 52
II.9.3. Embryonic germ cells 53
II.9.4. Adult stem cells 53
II.9.5. Babies saving lives - umbilical cord blood stem cells 54
II.9.6. Potential uses of stem cells 55
II.9.7. Stem cell research in Australia 55
II.9.8. Stem cells and cloning 56
II.9.9. Ethics of stem cell research 57
II.10. Transplantation 58
II.10.1. Transplants from animals 58
II.10.2. What do others think? 58
II.11. DNA profiling 60
II.11.1. DNA profiles for forensic use 60
II.11.1.a. Forensic profiling in Australia 61
II.11.1.b. DNA testing of prison inmates 61
II.11.1.c. Disaster victim identification 62
II.11.2. DNA profiles can reveal family relationships 62
II.12. Ethics of research involving humans 64
II.13. Freedom and choice 64
II.13.1. The value of technology in providing greater choice 64
II.13.2. Issues 65
III. Environment 66
III.1. Biological control of pests 66
III.1.1. Traditional methods to control feral pests 67
III.1.2. Carp: a case study 67
III.1.3. Cane toad: a case study 69
III.1.4. Canegrubs: a case study 70
III.1.5. Mice: a case study 71
III.2. Protecting threatened species 73
III.2.1. The Frozen Ark 73
III.2.2. Seed banks 74
3
Dr. Fahd M. Nasr
III.2.3. The Bilby: a case study 76

III.2.4. Wollemi pine 77
III.3. Resurrecting extinct species 77
III.3.1. The thylacine: a case study 78
III.4. Cleaning up and managing the environment 79
III.4.1. Removing the excess 79
III.4.2. Removing the hazardous 80
III.5. Researching new products 82
III.5.1. Sugarcane as a biofactory 83
III.6. Ethics of research involving the environment 83
III.7. Ways of seeing the environment 84
IV. Food and agriculture 86

IV.1. Feed Me 86
IV.1.1. A food biotechnology timeline 87
IV.1.2. Gene technology and crops 89
IV.2. A problem with weeds - the canola story 91
IV.2.1. Why do we grow canola? 91
IV.2.2. What's the problem with weeds? 91
IV.2.3. Using herbicides to kill weeds 92
IV.2.4. A biotechnology solution to weeds 92
IV.2.5. Concerns about herbicide tolerance 93
IV.2.6. Concerns about GM herbicide tolerance 93
IV.2.7. Is GM canola good or bad? 94
IV.3. A problem with insects - the cotton story 94
IV.3.1. What is cotton? 95
IV.3.2. Why do we grow cotton? 95
IV.3.3. What's the problem with insects? 95
IV.3.4. Using insecticides to kill insect pests 96
IV.3.5. Using viruses and venoms to kill insect pests 96
IV.3.6. A biotechnology solution to insect pests in the case of cotton 97
IV.3.7. Concerns about insecticide resistance 97
IV.3.8. Controlling insecticide resistance 98
IV.4. Other reasons to modify crops - soybeans 98
IV.4.1. To suit Australian conditions 98
IV.4.2. Modifying nutritional value 99
IV.4.3. Better cooking oil 99
IV.4.4. Herbicide tolerance 100
IV.5. The international scene 100
IV.6. Genetically modified food labeling 101
IV.6.1. Safety of genetically modified foods 101
IV.6.2. Assessing the safety of genetically modified foods 102
IV.6.3. Is it a food or food ingredient? 103
IV.6.4. Concerns about safety 103
IV.6.5. Labeling of genetically modified foods 104
IV.6.6. Concerns about labeling of genetically modified food 104
IV.7. Ethics for Food and Agriculture research 105
V. Glossary 106
4
Dr. Fahd M. Nasr
I. What is biotechnology?
Using living things to create products or to do tasks for human beings is a general
description of biotechnology. 'Biotechnology' is the practice of using plants, animals and
micro-organisms such as bacteria, as well as biological processes - such as the ripening of
fruit or the bacteria that break down compost - to some benefit. For example, in industry,
medicine and agriculture, biotechnology is used to produce foods, medicines, test for diseases
and remove waste. It can also be used to solve problems and conduct research. Over time
biotechnology has formed the basis of learning about people and diseases. Biotechnology has
also underpinned the development of treatments. This section explains the basic science
behind biotechnology, including gene technology, and can be used as an introduction to the
topic, or as a cross-reference when working through the rest of this resource.
I.1. Then and now

Biotechnology existed long before there was a special word for it. Many of the
principles and some of the techniques involved in biotechnology are ancient. For example,
fermentation, in which microbes are used, has been practiced for thousands of years to
produce beer, wine, cheese, bread and yoghurt. Traditional animal and plant breeding
techniques are also a form of pre-industrial biotechnology. What is new about biotechnology
today is that researchers can take a single gene from a plant or animal cell and insert it into
another plant or animal cell of a different species (this is called transgenic technology).
Modern biotechnology also includes altering the genes within an organism to control the
expression of a particular protein. Changing genes in this way can go far beyond the changes
that occur naturally during evolution, or the artificial, but slower, changes brought about by
traditional selective breeding. Other areas of modern biotechnology that do not necessarily
involve genetic engineering include the use of enzymes and bacteria in a wide range of
applications, such as waste management, industrial production, food production and
remediation of contaminated land. Animal breeding, pharmaceutical products and medical
procedures are also benefiting from advances in biotechnology.
I.1.1. Then
How many times have you heard that you look just like your Mum or Dad? Is it your
nose? Your eyes? Or perhaps your bad temper? For a lot of these sorts of appearances and
behavioral patterns, we can often blame our parents. But it wasn't always known how traits or
characteristics could be inherited. In the middle of the 1800s, a monk named Gregor Mendel
methodically recorded the passing of traits from one generation to the next by crossing
different pea plants to produce offspring with red or white flowers, and wrinkled or smooth
peas. His writings went on to become Mendel’s principles of inheritance.
Knowing that characteristics are passed from one generation to the next led to humans
selecting specific plants and animals for breeding. For example, humans selected plants with
bigger or sweeter fruit, or with the ability to survive in dry conditions or resist disease, and
healthier animals with more meat and less fat. The different dogs pictured here are examples
of selective breeding. Cheese, yoghurt, wine, beer and bread are all made using micro-
organisms such as bacteria and yeast. Beer is recorded in Egyptian medical texts from 1600
BC for use as a prescription medicine, and primitive cheese-making tools have been found in
Iron Age settlements in Britain. These uses are often referred to as traditional biotechnology.
I.1.2. Now
Biotechnology has grown from these humble beginnings. In 2005, we can use
biotechnology to change cells in other living things to make products and discover new things
5
Dr. Fahd M. Nasr
about the genetic basis of life. We can do this because we now know a lot more about genes
in plants and animals and how they relate to different characteristics such as eye color or
susceptibility to disease. While some characteristics such as hair color are controlled by a
single gene, most traits are controlled by a larger number of genes. Until recently, we have
looked at how well animals and plants perform or grow, as well as how their relatives
perform, to get an idea of whether they have genes of interest to us. Understanding more
about genes and how they work means we can have greater control over breeding processes.
The domestic dog belongs to the most diverse species in the world: Canis familiaris. Different breeds are
known for their herding ability, their intelligence and their looks!
While we don’t yet know about the function of every gene in humans, plants and
animals, we can work with the knowledge we do have. For example, researchers can locate an
area of a chromosome that seems to include a group of genes that has a significant effect on a
characteristic of the animal or plant. While they don’t know what the genes are or their exact
function, they know the genes affect a certain characteristic. They also know where the genes
are located – i.e. which chromosome and which area on the chromosome. To work out which
variation of genes the plant or animal has, genetic markers are used. Genetic markers are
thought to have no function and no impact on animal survival, but can be easily identified in
the laboratory. Genetic markers act like landmarks to indicate where in the genome the genes
of interest are located.
We have also learnt a lot more about ourselves, how our genes work inside our cells
and what happens when things go wrong. We can detect diseases earlier, diagnose them more
accurately and because we understand more about how diseases work, we can work to prevent
it by modifying our behavior. Studying the genetics and biochemistry of pathogens (such as
bacteria and viruses) has led to drugs designed to reduce the impact of disease symptoms or to
boost the immune system to prevent disease.
6
Dr. Fahd M. Nasr
I.1.3. Hearing recent history

1970s
o The 1970s saw the birth of modern biotechnology. In 1973, Herb Boyer and Stanley
Cohen showed it was possible to take a human gene and put it in a bacterium that
could then mass-produce quantities of that gene. Bacteria were genetically engineered
to produce human insulin and scientists immediately recognized the industrial
possibilities of this discovery, but also the potential dangers.
o A voluntary moratorium on biotech research and the subsequent Asilomar conference
of 1975 saw the first safety regulations for biotechnology. In 1976, Herb Boyer
teamed up with a venture capitalist to form Gentech, the world's first genetic
engineering company. Their goal was to genetically modify bacteria to produce human
insulin, and Boyer became the first molecular multi-millionaire.
1980s
o The 1980s saw more great advances in biotechnology. In 1980 Cohen and Boyer were
awarded a US patent for gene cloning that allowed them to make human insulin from
GM bacteria. The world's first GM vaccine was created for hepatitis B.
o The first genetically modified organisms were released into the environment, GM
foods were created and the anti-biotechnology movement began. Jeremy Rifkin was
an important anti-biotechnology activist who argued against awarding the first patent
for a GM bacterium that could break down oil.
o Jeremy Rifkin continued his campaign against scientists' 'tampering' by transferring
genes from one species to another and prevented field trials of GM potatoes for five
years. He argued that the development of monoculture GM crops could endanger the
world's food supply.
o Australia saw its first GMO release in the form of an Agrobacterium that no longer
caused crown gall, but instead conferred protection.
1980s - The impacts of PCR
o The new technique of polymerase chain reaction (PCR) generated a series of new
applications. Scientists could analyze bacteria in ancient rocks, speed up drug
development and in 1984, scientists accidentally discovered DNA fingerprinting using
PCR. This now generates evidence for use in courts across the world and some
countries now have large DNA databases.
1980s - Human Genome Project
o Plans were announced to embark on the most ambitious biological project ever - the
Human Genome Project. The first draft of the human genome was available in 2000 -
12 years after the project began and three years ahead of schedule. It is thought the
information about the human genome will allow scientists to find out the role of
different genes and how they interact. It also raised ethical issues about the use of the
information and access to any treatments that it generates.
1990s - Specific genes are identified
o Researchers pinpointed genes that cause diseases such as obesity, Alzheimer's disease
and breast cancer. In 1990, the gene that determines gender was found and a few years
later the 'gay gene' was discovered. In 1994, John Wasmuth found the gene for
dwarfism and realized his work was going to raise controversial ethical issues.
1990s - Cloning and stem cells
o In 1997 Dolly the sheep was cloned, raising fears that humans would also be cloned
and scientists would create designer babies.
o In 2000, Professor Alan Trounson from Monash University announced he had taken
stem cells from human embryos and grown them in the lab, highlighting their potential
for developing a cure for paraplegia, Parkinson's disease and diabetes. Embryonic
7
Dr. Fahd M. Nasr
stem cell research led to public debate over the potential benefits and the ethics of
harvesting human embryos.
o In 2002 politicians voted to allow stem cell research to continue and Prime Minister
John Howard announced funding for a new Centre for Stem Cell and Tissue Repair.
2001- Biotechnology unravels the past
o Australian anthropologist Dr Alan Thorne from the Australian National University
used biotechnology to analyze DNA from skeletons found in the dried-up bed of Lake
Mungo in the western outback of New South Wales. Thorne controversially dated the
skeleton to be 60,000 years old - the oldest Australian ever found - and suggested
humans arrived in Australia 70,000 year ago, allowing 10,000 years for humans to
migrate from the north of Australia to Lake Mungo.
Looking into the future
o Although the anti-biotechnology movement began in the 1970s, there continue to be
ethical issues relating to biotechnology and increased persistent fears of the potential
dangers of GM organisms. People are still concerned about the implications of the
Human Genome Project and the safety of GM food. Where will biotechnology take us
in the future?
I.1.4. Gene technology

Gene technology involves the modification of deoxyribonucleic acid (DNA), the
chemical that makes up the genetic code of living things. The use of gene technology to
produce a genetically modified organism may involve: eliminating a gene, altering a gene,
adding extra copies of an existing gene, or adding a gene from another organism. The new or
altered genes change the way in which cells function and so, change the characteristics of the
organism. When DNA from an organism is modified using gene technology, the organism is
then referred to as a genetically modified organism. The DNA on its own isn’t.
I.2. DNA and genes

All living things are made of tiny ‘building blocks’ called cells. Each cell contains
inherited genetic information (packaged in the form of genes). A gene is made of a length of
DNA (deoxyribonucleic acid) that has a message encoded in its chemical structure. Genes are
the instructions that give organisms their particular characteristics - for example, your genes
code for your hair color and eye color. Although the chemical building blocks of DNA are the
same for every living organism, the ordering or sequence of the chemicals varies and it is this
variation that determines an organism’s physical make-up and features. By altering the
sequence within DNA, inserting new sequences, or turning off certain genes, an organism’s
characteristics can be changed.
I.2.1. What is DNA?

Deoxyribonucleic acid (DNA) is a very important molecule found in all living cells. It
contains information used in everyday metabolism and growth and influences most of our
characteristics. DNA is often described as the blueprint of an organism because it enables
various cells to develop and work together to form a fully functional body, and controls
characteristics such as eye color. How much DNA influences very complex features, such as
intelligence, is not yet fully understood. The information that DNA contains is passed from
one generation to the next and there is much debate over how much of what we are like is due
to inheritance and defined by our DNA (nature) or by the influence of the environment
(nurture). Using gene technology, DNA can be modified or transferred from one organism to
8
Dr. Fahd M. Nasr
another. Genes are made up of short lengths of DNA and modern gene technology is able to
make changes at the level of individual genes.
I.2.2. Where is DNA?

You are made up of billions of cells: current estimates put the figure somewhere
between 10 and 100 billion cells. Inside nearly every cell is a nucleus which has your own
unique set of 46 chromosomes. Each of these chromosomes consists of a compact coil of an
incredibly long molecule of deoxyribonucleic acid (DNA). The DNA is so tightly coiled that
approximately 1.8 meters of it is able to fit into the nucleus of a human cell. The DNA stores
all the coded information for everyday growth and metabolism, and contains information that
is passed between generations. It has a major influence on what you look like and how your
body functions.
Like a mini factory, cells have a number of working areas called organelles which perform very specific
functions. The nucleus is the largest organelle and acts as the control room with the DNA as instructions.
I.2.3. The full set

Half of your DNA comes from your mum and half from your dad. When the sperm
and egg combined to make you, 23 chromosomes from the egg combined with 23
chromosomes from the sperm to form a full complement of human DNA - 46 chromosomes.
Chromosomes pair up and copy themselves every time before cells divide. This division
happens billions of times in your lifetime as you grow, and to replace old cells (like skin cells
or cells in the lining of your mouth). If a cell is stopped during cell division, and stained with
Giemsa dye, the 23 pairs of human chromosomes are visible with a light microscope. The dye
stains regions of chromosomes that are rich in the base pairs adenine (A) and thymine (T),
producing banding patterns in the chromosomes, each one different from the rest. DNA is
9
Dr. Fahd M. Nasr
packaged so tightly together that even the thinnest bands contain over a million base pairs and
potentially hundreds of genes.
The chromosomes can be matched in their pairs, arranged and numbered by size from
largest to smallest based on the banding patterns that you see and the position of the
centromere. The centromere is the central most condensed and constricted region of a
chromosome and also the part to which the spindle fiber attaches during cell division to allow
the chromosomes to separate. Once the chromosomes are lined up, this is called a karyotype.
If a person has too many or too few chromosomes, missing pieces of chromosomes, or mixed
up pieces of chromosomes, it can lead to a genetic disease. Karyotyping is one of many
techniques that can detect chromosomal abnormalities, by looking at the number and structure
of chromosomes. Cytogenetics is the study of chromosomes using a microscope.
Chromosome preparations can be taken from different types of tissue including blood, bone
marrow, amniotic fluid, and embryos.
I.2.4. What does DNA look like?

Surprisingly, while the DNA molecule is very long, it is stunningly simple. DNA
looks like an incredibly long twisted ladder. This shape is called a double helix. The sides of
the ladder are a linked chain of alternating sugar and phosphate molecules. The rungs connect
to the sugar molecules and are known as bases. There are four bases - adenine (A), thymine
(T), guanine (G) and cytosine (C). Each rung is made up of two bases that link together and
because of their chemical nature, A will only link with T and G will only link with C. DNA
from all living organisms is made of the same sugar and phosphate molecules and the same
four bases. Whether DNA is in your cells, those of a cactus, of a worm or a bacterium, it is
made of the same chemicals and has the same structure. The only difference is the order or the
sequence of the bases in the DNA molecule. It is this sequence that is referred to as the
genetic code, and why it is sometimes called the code of life.
I.2.5. How does DNA work?

DNA1 is an ideal molecule to transfer genetic messages to every cell of your body.
When an egg and sperm met to form the first cell that was to become you, you were given the
1
Several teams of scientists are trying to make a new form of living being from non-living chemicals? They will
need to find this new Los Alamos Bug the equivalent of a cell wall and make sure it can metabolize and
reproduce itself. The Bug will use a completely different way to hold genetic instructions than DNA – currently
scientists are looking to use a molecule called peptide nucleic acid (PNA). Like DNA, PNA is made up of two
strands containing the nucleotides A, T, G and C which complement each other, but the molecule itself is soluble
in fat instead of water.
10
Dr. Fahd M. Nasr
complete genetic code that all of your cells will use for rest of your life. In that first cell, half
of the chromosomes (half of the DNA molecules) came from your father and the other half
came from your mother. That first cell divided to become two cells, these both divided to
become four, then eight then 16 and so on. Some of the cells in your body are still dividing,
for example to produce new skin or blood cells. Most of the time a cell divides perfectly and
each of the DNA molecules is copied exactly, with one copy going to each of the new cells. If
mistakes are made, they are fixed, or the cell marked for destruction. If a problem occurs in
this process the new cells often die, but on rare occasions the faulty cells survive and can
cause a wide range of problems. However, sometimes these faults (mutations) can be
beneficial for the organism: this is the basis for evolution.
In order to make a copy of itself the DNA molecule unzips lengthwise leaving
unpaired bases along each backbone. In the cell there are nucleotides available which are
made up of a sugar, a phosphate and one of the four bases. Because A can only pair with T
and G can only pair with C, the nucleotides match up with the unpaired bases along the DNA
backbone and, like building blocks, form a new strand that is complementary (a match) to the
sequence. This forms strands identical to the original strand before it unzipped.
I.2.6. What is a gene2?

The DNA double helix stores information in the form of a code. Sections of DNA that
contain complete messages are known as genes. They can be thought of as 'words' along the
DNA 'sentences'. Genes are messages in code that provide the information for all cellular
functions. They carry information that is passed on to future generations. An organism's genes
determine: (i) the characteristics that are used to classify it into the plant or animal kingdom
and into a specific family and species; (ii) how it uses food; (iii) how well it fights infection;
and (iv) at times how it behaves. There are between 25,000 and 42,000 of these words in each
human cell. Genes control the production of proteins that make up most of your body.
How genes work
Genes need more than just the code for a product in order to do their job. Each gene also has
regulatory (manager) sections, which are important for its control. The first regulator is a
promoter section that controls such things as switching the gene off or on. This effectively
controls which cells the gene will work in, when the gene will work, for how long and how
hard. The second regulator section comes at the end of the gene. This is the stop regulator
which controls such things as when the gene will stop working and how long the product of
the gene will last. Between these two regulator sections of the gene is the code for the protein
product. Each organism has its own regulators and so a whole gene from one organism will
2
The word ‘gene’ was not invented until 1909
11
Dr. Fahd M. Nasr
not automatically work if it is placed in a different organism. To make a gene work in a

different organism, the regulator sections usually need to be inserted along with the gene into
the new second organism.
A gene is made up of three main parts, two of which are regulator sections. Between these two regulator
sections is the section that provides the code for a protein.
I.2.7. Genes code for proteins

Genes contain the coded formula needed by the cell to produce proteins. Proteins are
the most common of the complex molecules in your body. Types of proteins include: (i)
structural proteins, such as those which form hair, skin and muscle; (ii) messenger proteins,
such as hormones, which travel around your body controlling such things as the sugar content
of your blood; and (iii) enzymes, which carry out most of the life processes inside your body,
for example making hemoglobin for your red blood cells.
Reading genes - transcription
When you wish to send information to a friend who lives far away, you write the information
onto a letter and send the letter to them, you don’t physically go to your friend and inform
them personally. This is a bit like how genes instruct other parts of a cell to do their work for
the body. The first step in the process is transcription. The information from the gene is
written onto another molecule called messenger RNA (short for ribonucleic acid) which takes
the information to other parts of the cell to process.
Interpreting genes - translation
If your friend far away speaks a different language, they would need the letter translated
before they could understand it. If you were to send the letter via a translation agency of some
description, then when your friend receives the letter, they will understand it perfectly. In a
cell, before any part of the cell can receive and carry out the information, the instructions
must be translated into a format it can understand. This new format for the information is
called protein. Translation of messenger RNA into protein takes place at the ribosomes. They
are the ‘translation agencies’ of a cell. The protein is then sent to the part of the cell that needs
the information, or it is sent out into the body. Each gene is a different set of instructions to
12
Dr. Fahd M. Nasr
produce proteins of different shape and chemical composition which perform different
functions in the body.
One gene being translated to a protein.
I.2.8. DNA unknown

In between the well structured genes are large sections of DNA for which no function
has yet been identified. These areas have been called ‘junk DNA’ and make up a large
proportion of the genomes of both plants and animals. But is it junk at all? We don’t really
know. This DNA appears to act as a filler in between genes and a number of ideas are starting
to emerge about what role it plays. This is a mystery to be solved in the next couple of
decades. Some of the ideas are:
 it is where defective genes, or pseudogenes, are dumped
 it is the accumulated DNA of viruses that have infected the body and failed to take
over the cell
 it acts as a protective buffer against genetic damage and harmful mutations because
the area is irrelevant to the metabolic and developmental processes; if a random
change occurs in the sequence, there is no effect on the body
 it acts as a reservoir of sequence from which potentially advantageous new genes can
emerge
Researchers believe that this unknown DNA probably plays some role in regulating the
'coding DNA' and therefore cellular processes. But there is currently very little knowledge
about the relationship between non-coding DNA and the DNA of genes3.
3
Onions contain 12 times more DNA per cell than humans. A puffferfish’s genome is only about one tenth the
size of the human, yet seems to have about the same number of genes. The ratio of functional DNA to
‘inbetween filler’ DNA of unknown function differs widely per species. Chickens have a similar number of
genes to humans: 20,000 to 23,000 for chickens and 25,000 to 30,000 for humans. But their genome is much
smaller having a total of 1 billion DNA letters, compared with about 3 billion in humans. Their genome appears
to contain less repetitive 'junk' DNA.
13
Dr. Fahd M. Nasr
I.3. Why do we do biotechnology?

Biotechnology is used in a wide range of applications in food science, medicine, the
environment and agriculture and research is rapidly expanding the possibilities of where it
will be used next. Any technology brings with it risks as well as benefits, and gene technology
is no exception. These risks need to be carefully assessed before a GM plant, animal or micro-
organism is released4.
I.3.1. For ourselves

Biotechnology and biotechnology-based research has been used to assist human health
with: producing antibiotics to fight bacterial infections, making vaccines and other products to
boost the immune system against disease, reproductive technologies, including in vitro
fertilization to assist infertile couples to have children, the Human Genome Project, detecting
and treating genetic disorders and diseases, transplantation technologies, DNA profiling and
forensics
I.3.2. For the environment

Biotechnology is a tool that is being used (or is being researched and developed for
use) in the environment to: (i) assist with controlling pest animals and plants, (ii) protect and
preserving endangered species by storing DNA samples for potential future use, (iii) clean up
oil spills, (iv) remove excess nutrients from the soil and water, and (v) leach metals out of the
soil for cleaner mining. Further research is trying to improve the techniques we already have
as well as being used in techniques such as detecting landmines or cleaning up arsenic and
heavy metal contamination.
I.3.3. For food and agriculture

Selective breeding of plants and animals does change the genetic make-up of the
organisms. With the use of biotechnology and gene technology, these changes can be more
specific and many more changes are possible than ever before because genes can now be
moved between types of animals, plants and micro-organisms that were not possible using
‘conventional’ breeding methods. Plant geneticists are trying to develop new plants including:
frost-tolerant sugar cane plants, salt and drought tolerant plants, salad vegetables which do not
‘brown’, fruits and vegetables with extra vitamins, sweeter peas, slow-ripening pineapples
and tomatoes, long-lasting flowers, blue roses. Animal geneticists are seeking new
biotechnologies to: produce blowfly-resistant sheep, produce cattle that can withstand greater
temperature and water stresses, increase wool production, reduce diseases in aquaculture,
improve defenses against stock animal disease, improve pig welfare, and protect cattle against
tick-borne diseases
I.4. How do you do biotechnology?

DNA contains all of the information required to grow and build a whole organism,
from a bacterium to a plant, to a human. Studying the DNA of living organisms provides us
with more information on how our body (or a plant or an animal) works and what happens
when things go wrong. Biotechnology is the use of living organisms to create products or to
do tasks for us. Researchers use DNA, genes, yeast, bacteria and cells to create things. This
section discusses some of the main techniques used in modern gene technology.
4
Government regulatory authorities assess the risks, which may include how readily the released organism could
cross-breed with similar organisms in the environment. They may also consider whether the modification gives
the organism extra survival advantages, and whether this could upset a balanced ecosystem.
14
Dr. Fahd M. Nasr
I.4.1. Finding the gene you want

Gene probes
Every gene contains a unique sequence of the four bases: adenine (A), cytosine (C),
guanine (G) and thymine (T). We can test to see if a specific gene is present in a person’s
genetic make-up by searching for its unique base sequence. The search uses a gene probe,
which is a piece of single-stranded DNA. The design of a probe uses the fact that when DNA
strands pair up, adenine only pairs with thymine and cytosine only pairs with guanine. The
base sequence on the probe matches the unique sequence in the gene that the probe is
designed for. To test a DNA sample using a gene probe, the DNA is first treated so that each
of the double-stranded DNA molecules unzips into single strands. The probe is then added to
the solution. Because of the way the bases pair up, the probe will attach itself only to the
section of DNA that contains a base sequence that matches the probe’s sequence.
Probes are constructed with a radioactive or a fluorescent section, or tag, in them, so
that they can be detected after attaching to the DNA. Detecting the probe gives us information
about which chromosome the gene is on, and where the gene is on that chromosome. We
know the base sequences in a number of disease-causing genes, and can find out if they are
present using probes specifically designed for them.
Here, cells are stained with a fluorescent dye which attaches to chromosome 18. These cells all contain
an extra copy of chromosome 18 which is known as Edward syndrome. This is called FISH - fluorescent
in situ hybridization.
Microarrays
At any one time in a cell, some genes are switched on and working while others are
switched off. To find out which genes are working and ‘expressing’ (producing copies of the
gene as messenger RNA) at any one time, microarrays can be used. Microarrays are like sets
of miniaturized chemical reactions arranged on a small glass, filter, or silicon wafer. They can
be used to test DNA fragments, antibodies, or proteins. A DNA microarray can take a sample
and record the level of expression for every gene within that sample. Microarrays can assist us
by finding: (i) drugs that interact with a gene of interest, (ii) individuals with similar
biological patterns and (iii) the most appropriate individuals for participating in clinical trials
of new drugs. This is a tool which scientists can use to determine the function of genes and
get a clearer idea of what is happening inside cells when things go wrong, as in disease.
15
Dr. Fahd M. Nasr
This microarray shows genes involved in expressing the yeast protein Tup1. In this experiment you ca n
see that those in red are highly expressed and those in green are under expressed.
I.4.2. Cutting and pasting genes

Cutting
Genes can be cut out from the DNA of an organism and pasted into a new position in that
organism or into the DNA of a different organism. This cutting and pasting process is called
gene splicing. One of the basic tools that scientists use to study or transfer segments of DNA
is a group of chemicals called restriction enzymes. Restriction enzymes are like molecular
scissors that are used to cut up DNA. They were originally found in bacteria, where they act
as a defense mechanism. The bacterial restriction enzymes recognize foreign DNA, such as
that from a virus when it enters a bacterial cell, and inactivates it by cutting it up. The handy
thing for scientists is that restriction enzymes do not cut randomly - they cut at very specific
places. Bacterial restriction enzymes will work on DNA from other organisms because DNA
is chemically identical, whether it comes from bacteria, a rose or a human. The chemicals in
DNA are always the same; it's just the arrangement of the bases that varies.
Different restriction enzymes cut at different sites. Each restriction enzyme recognizes
a certain DNA sequence, usually about four to six base pairs long, and cuts the DNA within
this sequence. For example, the enzyme EcoRI which is taken from the human gut bacteria E
coli recognizes the genetic sequence GAATTC. It cuts the DNA between the guanine (G) and
the adenine (A). Some enzymes cut straight through both strands of the DNA molecule to
produce 'blunt' ends of DNA. Others cut one strand of the DNA molecule in one spot and the
second strand slightly to the left or right. This creates two ends with one strand that hangs
slightly over; these are called 'sticky' ends. When cutting and pasting a gene, researchers
usually use the enzymes that cut and produce sticky ends so that the overhanging strand of
DNA can be matched up with another strand of DNA.
Pasting
The cut piece of DNA can be pasted either into a new chromosome or into a plasmid, one of
the small circular DNA molecules found in bacteria. Plasmids are used when transferring a
gene from one organism to another. The DNA of the new chromosome or plasmid is usually
cut using the same restriction enzyme that cut the gene out. This means the sticky ends will
have the same jagged DNA code as the ends of the piece being pasted in. The overhanging
strands of DNA bind together and another enzyme, called a ligase, is used to seal the join.
16
Dr. Fahd M. Nasr
I.4.3. Moving genes

Adding a new gene to a cell is called transformation. The new DNA has to get into the
nucleus of cell which means going past the cell membrane and cell wall that protect the cells
and their contents, and finally through the nuclear membrane. New genes can be inserted into
plant, animal and bacterial cells in several different ways.
I.4.3.a. Transferring genes to bacteria

To transform bacteria such as Escherichia coli, there are two common methods –
calcium chloride treatment and electroporation. Calcium chloride: the bacteria and the
bacteria with the new gene in them are placed in an ice-cold solution containing calcium
chloride. The calcium chloride changes the nature of the cell wall which allows the new DNA
to enter the cells more easily. The cells are then 'heat shocked' by taking the solution
containing the cells and the plasmids to 42°C for 2 minutes. Researchers usually do this by
placing the tube into a water bath. The heat shock causes the cells to take up the plasmid with
the new DNA. The cells are returned to normal growing conditions so that they can recover
and the new gene begins to function within the cell.
For plants, the most commonly used method is to use the bacterium called
Agrobacterium tumefaciens as a carrier of the new gene because it naturally infects plant
cells. It usually infects plant cells forming crown galls which are large tumor-like swelling at
the crown of the plant, just above soil level. The new DNA is first transferred to the circular
DNA molecules called plasmids which are found within bacteria. When the bacteria infect the
plant cells, the new DNA enters the plant cell. The cells are then treated to encourage them to
take up new DNA. There are a few methods that can be used such as electroporation, calcium
chloride treatment and biolistics.
I.4.3.b. Transferring genes to plant, animal and yeast cells

Electroporation can be used to transform cells of animals, yeast, plants and bacteria.
With plant cells, they are first treated to remove their cell walls. Animal cells don’t have cell
walls and don’t require this first step. The cells are placed in a solution with the new DNA
that is to be added to the cells. The solution is then subjected to a high voltage electric shock -
usually between 4 000 and 8 000 V/cm - for a fraction of a second. This causes small holes to
form in the cell membrane through which the DNA enters the cells. The cells are then placed
in a nutrient solution so they can repair their membranes and cell walls and recover their
normal functions.
I.4.3.c. Transferring genes to egg cells

The most commonly used method to transfer DNA directly into animal cells such as
egg cells is to inject the DNA directly into a newly-fertilized egg cell using a glass capillary
tube. This is called microinjection. The egg cell containing the new DNA is implanted into a
female animal. Because the gene was inserted into the DNA at the egg stage, when the cell
divides, every cell in the growing embryo will contain the new DNA.
17
Dr. Fahd M. Nasr
I.4.3.d. Other transformation methods

 Calcium phosphate precipitation and phagocytosis: used to transform cells of
mammals. Only about 1-2 per cent of the cells are transformed so it is not a
particularly efficient procedure. The DNA to be transferred is mixed with calcium
phosphate. The DNA and the calcium phosphate react to form tiny grains that are
solid. Cells are placed into the mixture with the grains. The cells engulf the grains in a
process called phagocytosis (like amoebas eating their food). Some of the new DNA
becomes a part of the cell's DNA.
 Lipofection: used to transform cells of animals, yeast, plants and bacteria. Plant cells
are first treated to remove their cell walls. The DNA to be transferred is placed into
liposomes which are special kinds of fats that form tiny hollow bubbles. The cells to
be transformed are added to the solution containing the liposome bubbles. Since the
liposomes are made up of lipids, they become part of the cell membrane of the cells
and the content - the new DNA - enters the cells.
 Biolistics: used widely in the production of genetically modified corn, and also in the
genetic immunization of animals. Tiny tungsten or gold particles are coated with the
DNA to be transferred. The particles are usually about 0.004 of a millimeter in
diameter. A blast of high-pressure helium gas or gunpowder shoots the particles
carrying the DNA into the cells that are to be transformed.
A specially designed gene gun using compressed helium gas fires dozens of metal pieces at target cells.
The tiny pellets, usually of tungsten or gold, are much smaller then the target cell, and coated with DNA.
While the shell cartridge is stopped in its tracks by a perforated metal plate, the metallic particles are able
to penetrate into living cells where the genetic material is then carried to the nucleus to be integrated
among the host organism’s genes.
 Viruses as carriers: used to transform cells of plants and animals but it is not a
commonly used technique. A virus is chosen that will enter the cell to be transformed
but not kill it. The DNA to be transferred is added to the virus DNA. The virus injects
its DNA, including the new DNA, into the cell when it infects the cell.
Using a virus to insert DNA into a cell. The gene is inserted into the genetic make-up of harmless viruses
that then invade cells, carrying the gene into the cells.
18
Dr. Fahd M. Nasr
I.4.4. Reading and interpreting genes

Electrophoresis
Electrophoresis can be used to analyze DNA. Electrophoresis is a molecular 'sieving'
technique that separates DNA fragments according to size. Pieces of DNA are slightly
negatively charged when in solution and it is possible to use this property to separate DNA
pieces of various lengths. A drop of solution containing a mixture of DNA strands of different
lengths is placed at one end of a plate made of a gel (a jelly-like substance). An electric field
is applied so that the end where the DNA mixture is placed is negatively charged and the
other end is positively charged. When the field is turned on, the negatively charged DNA
fragments are dragged through the gel towards the positive end. The shorter the strand of
DNA the faster it will move through the gel and so the further it will travel. If the DNA
strands are stained with a dye or made radioactive, it is possible to detect where the strands
have moved to in the gel. The typical pattern of bands produced by electrophoresis develops
because each different length of DNA will move a different distance through the gel, with the
longest pieces moving the shortest distance.
DNA samples are loaded into small holes (wells) in a square piece of agarose gel. The gel is then placed
into an apparatus. When the terminals are switched on, the negatively charged DNA will be drawn
through the gel toward the positive terminal, separating the DNA fragments.
DNA profiles
A DNA profile or DNA ‘fingerprint’ for a person is like their barcode. It is a different pattern
for every single person, except identical twins. To produce a DNA profile, one must look to
where there are differences in DNA sequences among individuals - these are called
polymorphisms. There are sections in our DNA where a sequence of bases is repeated a
number of times. For example: GTACGTACGTACGTACGTACGTAC. These are called
short tandem repeats (STRs) and the number of repeats varies between individuals in a
population. To produce a DNA profile, several known STRs are selected and copied using
polymerase chain reaction (PCR). PCR mimics DNA replication that occurs naturally within
cells, but at a much faster pace. Millions of copies of the selected STRs are produced.
Restriction enzymes are used to cut the DNA up into fragments. Restriction enzymes cut very
specifically between bases in a sequence, for example, the enzyme EcoRI cuts between the
guanine (G) and the adenine (A) in the sequence GAATTC. Because no two people have
19
Dr. Fahd M. Nasr
exactly the same sequence of bases in their DNA (except identical twins), the cuts will
produce DNA pieces of different lengths. When the DNA pieces are separated on an
electrophoresis gel, the resulting pattern is a bit like a strip of bands of different thicknesses
and at different distances from each other. This pattern is called a DNA profile. DNA profiles
can be produced from biological samples of hair, skin or blood. They can be used to identify
who the sample came from by comparing it to a number of different people’s profiles and
matching it. This is used by police to determine who was present at a crime scene. Profiles
can also be used to determine parentage. Because each parent contributes half of its genetic
material (one chromosome of each pair) to their offspring, the resulting pattern for the
offspring would have a match with the mother and also the father in every STR area. Cattle
producers use DNA profiling to determine parentage in order to maintain the pedigree and
assist with breed selection. It enables them to identify sires – the father - and sire lines that
produce high performing calves – calves with particular characteristics such as high milk
production or more muscle.
An electrophoresis gel showing DNA profiles from six different cows with lanes 1 and 2 being the
optimal breeding pair. To be selected for the premium market, the calves must come from this optimal
pair. If they do, they would match with a band from both the mother and the father in each STR area. The
rows marked L have DNA fragments of known lengths, which act as a scale to compare the lengths of
the bands in the other samples.
DNA sequencing
DNA sequencing is used to work out the exact sequence of the base pairs in a section of
DNA. Knowing the base sequence can be helpful if you want to locate a specific gene by
using a gene probe, or to make an artificial chromosome with a specific gene on it. DNA
sequencing is also being used to identify and locate all the genes in an organism. A DNA
sequencer is a machine that uses the same principle as electrophoresis, but it is so sensitive
that it can separate DNA strands that differ in length by only one nucleotide – that is one base
at a time (nucleotides consist of the base that forms the rung of the ladder, plus a sugar and a
phosphate molecule which form the backbone of the DNA strand). The base sequence of a
strand of DNA is worked out by: (i) copying the DNA many times, each time constructing
DNA chains of different lengths; and (ii) using electrophoresis to separate the strands from
shortest to longest.
To do this, single strands of the DNA being sequenced are placed in a solution with an
ample supply of nucleotides carrying the four bases (adenine - A, cytosine - C, guanine - G
and thymine - T). Correct enzymes are added to control the reaction. Matching strands of
20
Dr. Fahd M. Nasr
DNA are constructed, each one of different lengths. The different lengths are formed by
having ending nucleotides present in the reaction. Ending nucleotides are slightly different
forms of the four nucleotides (A*, C*, G* and T*), each one designed to fluoresce in a
different color. When one of these is attached to a chain, it prevents any more nucleotides
being added - and chain formation stops. With the right balance of normal and ending
nucleotides in the solution, the new DNA forms in strands of lots of different lengths. For
example, imagine that the DNA being sequenced has bases in the following sequence at one
end: GATCCCGCATTGAA . . .
The new DNA strands will include:
C*
CT*
CTA*
CTAG*
CTAGG*
CTAGGG*
CTAGGGC* and so on. Some chains will be hundreds of nucleotides long before
construction is stopped by the inclusion of an ending nucleotide. The final stage in DNA
sequencing is electrophoresis. This separates the strands according to their length. The color
of the fluorescent ending nucleotide on each strand is read in order, from shortest to longest,
to work out what the base sequence was in the original DNA strand. This can be done
manually or by computer analysis, which provides a read-out called a chromatogram.
I.4.5. Cloning a gene (polymerase chain reaction)

We can make exact genetic copies of whole organisms, cells or pieces of DNA. These
copies are called clones. A clone is a copy of a plant, animal or micro-organism derived from
a single common ancestor cell or organism. Clones are genetically identical. However, some
confusion arises because the word 'clone' can also be applied to genes. A gene is said to be
cloned when its sequence is multiplied many times in a common laboratory procedure called
polymerase chain reaction (PCR).
A photograph of DNA amplified using PCR.
21
Dr. Fahd M. Nasr
To study genes, researchers need large amounts of DNA to work with. PCR copies the
cell’s natural ability to replicate its DNA and can generate billions of copies within a couple
of hours. There are four main stages:
 The DNA to be copied is heated, which causes the paired strands to separate. The
resulting single strands are now accessible to primers (short lengths of DNA).
 Large amounts of primers are added to the single strands of DNA. The primers bind to
matching sequences along the DNA sequence, in front of the gene that is to be copied.
The reaction mixture is then cooled which allows double-stranded DNA to form again.
Because of the large amounts of primers, the two strands will always bind to primers,
instead of to each other.
 DNA polymerase is added to the mixture. This is an enzyme that makes DNA strands.
It can synthesize strands from all the DNA primer combinations and dramatically
increases the amount of DNA present. One enzyme used in PCR is called Taq
polymerase which originally came from a bacterium that lives in hot springs. It can
withstand the high temperature necessary for DNA strand separation and therefore,
can be left in the reaction and still functions.
 The above steps are repeated until enough DNA is obtained.
This whole process is automated and happens very quickly. The reaction occurs in a
small tube which is placed inside a specialized machine which can make the big temperature
adjustments quickly. Researchers use the many gene copies to research the function of the
gene.
I.4.6. Cloning plants

Many plants clone themselves naturally to reproduce. They send a small shoot-like
structure called a runner, along the soil. The runner grows into a new separate plant, which is
genetically identical to the original plant - a clone. People can clone plants by simply taking a
cutting of the plant such as a twig or stem and planting it. This is called vegetative
propagation. Horticulturists use cloning to grow plants with specific qualities, like height,
flower color and quality. They use a more complex method than vegetative propagation called
tissue culture. Tissue culture starts by using a small piece of the desired plant such as a bud,
node, leaf segment or root segment. It is grown in a test tube on a culture medium that
provides nutrients. It is then chemically treated to produce shoots. Buds from each of these
shoots can then be separated to grow more shoots, and the shoots are then treated to grow
roots so that they develop into whole plants. All the plants produced in this way are
genetically identical because they have all come from the same plant initially and so share that
plant’s genetic make up.
Cloning plants: a case study
There are a number of diseases that affect banana plants including Panama, Banana Bunchy
Top Virus, Cucumber Mosaic Virus and Banana Streak Virus. Bananas are also attractive to
nematodes (worms), which damage the fruit. Tissue culture is used to produce bananas that
are free from disease. Some nurseries have a banana planting material scheme based on tissue
culture and are qualified as a QBAN – a Quality Banana Approved Nursery. The Quality in
QBAN refers to disease freedom. Registered QBAN facilities must pass inspection and satisfy
guidelines so that all plants are produced in a disease-free condition.
I.4.7. Cloning animals

Complex biotechnological procedures have enabled scientists to successfully clone
mice, sheep, cows and other mammals. The technology is still at early stages and currently,
one in three cloned animals is born abnormally large or with other developmental problems.
22
Dr. Fahd M. Nasr
Scientists at the Monash Institute of Reproduction and Development in Melbourne believe

these problems could be linked to a process called gene 'imprinting'. Embryos contain two
copies of each gene – one from each parent. It is thought that about 60 genes are ‘imprinted'
with instructions to switch one copy on or off to allow for normal growth and development. If
this doesn’t happen correctly and both copies are switched on, or both copies are switched off,
it results in problems in growth and development, both prenatal and postnatal. We do not
understand this imprinting process in cloned embryos. The closest scientists have come to
cloning a non-human primate occurred in October 2004. Biologists successfully transferred
cloned monkey embryos into monkey mothers. None of the resulting pregnancies lasted more
than a month5.
A cutting or a plant clone grown in a tissue culture tube.
a. Somatic cell nuclear transfer

Dolly, the first animal to be cloned, was created using the technique of somatic cell nuclear
transfer (SCNT). To do this, cells are taken from the animal that is going to be cloned. In the
case of Dolly the sheep, a cell was taken from her udder. These are normal body cells –
somatic cells - and the nucleus is removed. The nucleus contains all of the genetic material to
make the animal and so, is termed the donor cell. Egg cells are used for cloning because of
their ability to grow rapidly. The egg cell’s nucleus is removed and the nucleus from the
donor cell is inserted in its place. The egg is then stimulated to grow by numerous stimulants
which activate the reconstructed embryo to divide and grow. The division of the egg cell
follows the same process that would occur if the egg was fertilized by sperm during natural
reproduction. The cell division continues for 5 days until a blastomere forms. A blastomere is
a ball of nearly 100 cells all with the same genetic material as the donor. Once a cloned
embryo reaches the blastomere stage of development, it can follow two paths. Either it can be
implanted into a uterus of a female to create a whole organism. This is called reproductive
cloning. When Dolly was born, she was the only lamb born from 277 attempts. She was a
clone of the sheep whose udder cell was used. Blastomeres can also be used as a source of
stem cells6.
5
Did you know flies are the latest animals to be cloned? Fruit flies have long been a ‘model’ to study
reproductive biology and researchers think the insect may help science understand why cloning is often flawed.
6
Did you know that dogs are particularly difficult to clone? The first cloned dog, an Afghan hound called
Snuppy, was cloned by South Korean researchers and was shown to the world in August 2005.
23
Dr. Fahd M. Nasr
Dolly, the world famous sheep - the first animal to be cloned.
b. Embryo splitting
Another cloning technique is embryo splitting. Using microsurgery (surgery conducted under
a microscope), an embryo is split while it still consists of only a few cells. Genetically
identical individuals develop from each portion in the same way as identical twins are formed
in nature. This technique has been used to successfully create cloned embryos and cloned
animals.
Idaho Gem was born 4 May 2003 and is the full sibling of a champion racing mule. Idaho is the first
clone of a hybrid animal, the mule.
c. Chromatin transfer
There are a number of problems associated with nuclear transfer - the method used to clone
Dolly and almost all cloned animals since then. When the nucleus is transferred to a new egg
cell, the egg reprograms the incoming nucleus to allow it to go back to its undifferentiated
state. Because it has come from an adult cell, it no longer needs to produce the proteins,
hormones and other molecules associated with it being an embryo and growing to produce all
the different tissues in a whole body. Incomplete reprogramming of the donor cell is thought
to be a leading factor in the low success rate of animal cloning. Chromatin transfer is a new
cloning technique aimed at reducing these problems. It involves treating the cell of the animal
to be cloned to remove molecules associated with cell differentiation before the nucleus is
removed. This is a very new method created by Genetic Savings and Clone, a company in the
USA that clones pets.
24
Dr. Fahd M. Nasr
The first cat clones produced using chromatin transfer born in June 2004. They are clones of Tahini, a
one year old female Bengal cat.
I.5. Regulation of gene technology in Australia

Throughout 1999 and 2000 the State, Territory and Australian governments worked
together with interested parties to develop the Gene Technology Act 2000. The Act was
passed by the Australian Government in December 2000 and took effect on 21 June 2001.
The legislation is the Australian Government's component of a national scheme for the
regulation of genetically modified organisms (GMOs), which includes legislation in every
Australian State and Territory. The objective of the Act is to protect the health and safety of
people and to protect the environment by identifying risks posed by or as a result of gene
technology and by managing those risks. It does this by creating laws for certain dealings (or
activities) with GMOs. While most GM products are regulated by agencies such as the
Therapeutic Goods Administration (TGA), Food Standards Australia New Zealand (FSANZ)
and the Australian Pesticides and Veterinary Medicines Authority (APVMA), GM products
which were not already covered by an existing national regulation scheme are now regulated
by the Gene Technology Regulator under the legislation. The Gene Technology Ministerial
Council is currently conducting a review of the operation of the Act and the Gene Technology
Regulator is undertaking public consultation on proposed changes to clarify and improve the
workability of the Gene Technology Regulations 2001.
A scientific, ethical and precautionary approach
The Act7 establishes three key advisory groups to provide advice, on request, to the Gene
Technology Regulator and the Gene Technology Ministerial Council: (i) the Gene
Technology Technical Advisory Committee (GTTAC) provides advice on scientific and
technical matters; (ii) the Gene Technology Ethics Committee (GTEC) provides advice on
7
Section 4 requires that the object of the Act is to be achieved through a regulatory framework which: (aa)
provides that where there are threats of serious or irreversible environmental damage, a lack of full scientific
certainty should not be used as a reason for postponing cost-effective measures to prevent environmental
degradation; and (a) provides an efficient and effective system for the application of gene technologies; and (b)
operates in conjunction with other Commonwealth and State regulatory schemes. Section 4(aa) outlines a
‘precautionary approach’, meaning that where there are threats of serious or irreversible environmental damage,
a lack of full scientific certainty should not be used as a reason for postponing cost-effective measures to prevent
environmental degradation. However, the legislation also requires that the object of the Act is achieved by
balancing a precautionary approach with the other two, equally important, provisions of efficiency/effectiveness
and co-regulation. A precautionary principle is, therefore, one of three 'pillars' in a regulatory framewor k for
gene technology that seeks to protect human health and safety and the environment.
25
Dr. Fahd M. Nasr
ethical matters; and (iii) the Gene Technology Community Consultative Committee (GTCCC)
provides advice on community issues regarding gene technology.
International arrangements
Working in international forums is one way Australia can encourage other countries to take
up comprehensive arrangements to ensure the protection of people and the environment in the
development of gene technology. We need to ensure Australians and other nations act
responsibly when exporting or transporting genetic material internationally. Likewise we need
to ensure that people importing or transporting genetic material across Australian boundaries
act appropriately.
Convention on Biological Diversity
Australia is signatory to the Convention on Biological Diversity (CBD) and a member of the
Intergovernmental Committee on the Cartagena Protocol on Biosafety. In response to the
CBD, an international biosafety protocol was negotiated and came into force on 11 September
2003. The protocol governs the ‘transboundary movement’ (i.e. movement across
international borders) of living modified organisms resulting from modern biotechnology,
which may have an adverse effect on the conservation and sustainable use of biodiversity.
You can find evidence about the safety of genetically modified products by examining the
different regulatory arrangements around the world and the outcomes of other countries'
research. While many countries are developing or have just established arrangements for
regulating GMOs, some countries rely on self-regulation by industry and scientists. The
Australian arrangements under the Gene Technology Act 2000 set an international benchmark
for managing the risks associated with GMOs.
I.6. Ethics of biotechnology

Ethics are the rules or standards that govern the way people behave and their decisions
on the ‘right thing’ to do. It asks basic questions about what is right and wrong, how we
should act towards others and what we should do in specific situations. It is important to note
that ethics discussing biotechnology and its applications are not fundamentally different from
other situations. Ethics are practiced by everyone, every day. One common feature of ethics is
that different people with different values often disagree on the ‘right thing’ for individuals
and society. One reason for this disagreement is that one thing that benefits some may not be
of benefit to others. An example is embryonic stem cell research, which some people see as
having great potential to develop cures for diseases; but others object to because it involves
the destruction of human embryos that have the potential to become a human being.
There is no clear right or wrong position in ethics, as a person’s individual experience
and view of the world often guides the way they make ethical choices. For instance, someone
who has a strong environmental outlook might see the use of genetically modified (GM) crops
as unnatural. But someone who has a strong scientific-based view of the world might see the
use of GM crops as a natural extension of traditional crop breeding technologies. Many new
technologies raise ethical concerns that might not be part of the world view held by those who
develop the technologies in the first place.
When it comes to developing products for commercial use, the goal is usually to
increase sales and increase profits for shareholders. The decision for developing products can
be seen as good for industry development, but perhaps not as good for some individuals who
do not have products developed to suit their needs when there is not enough company profit to
be made. Also, in some areas of biotechnology development, the money needed to fund
research projects is out of the range of individuals or small groups and can only be undertaken
by multinational or overseas companies. For some this is perceived as acceptable, as it helps
local researchers form links with wealthy larger companies. But others do not think it is not
26
Dr. Fahd M. Nasr
acceptable, as local research and development leave the community and are then controlled by
international corporations.
Many people believe that biotechnology products and applications should respond to
and fulfill community needs. For example, some products may be of obvious social benefit
(such as a drug that treats cancer), while others may be created by a business by attractive
advertising and skilful marketing (for example, unusual colored flowers for the floral industry
or fluorescent fish for the pet industry). In a world with decreasing resources, where many
people go hungry, is spending research dollars on developing a fluorescent fish an acceptable
thing or not? Your answer will differ depending on your world view.
When looking at ethical positions it is important to realize that the ‘right thing’ for one
person may not be right for others and it can be very difficult to balance these conflicting
views. There are particular ethical positions that are commonly shared, such as the view that it
is essential for all biotechnology products to be safe for humans and the environment (which
is why Australia has developed a sound regulatory system to look at safety). But other ethical
positions are diverse, such as an individual’s rights to do what they want with their body.
There are many different ethical ways to view the world and none of these are
inherently right or wrong. There are many approaches, or frameworks, to ethics. Some of
these approaches are listed below:
Action-based (whether or not actions in a particular circumstance are ethical):
 Principalism uses benefit-maximizing and harm-reducing principles.
 Consequentialism is based on the greatest good for the greatest number.
 Non-consequentialism (deontology) refers to rights and responsibilities.
Agent-based (emphasis on the person rather than the action they perform):
 Virtue-based can acknowledge character traits over consequences.
Situation-based (a broader perspective that takes into account other factors such as time, place
and culture):
 Casuistry considers each situation to be completely unique.
 Feminist concentrates on communication, consultation and sensitivity.
 Geocultural focuses on relativity (cultural, special and time-specific contexts).
27
Dr. Fahd M. Nasr
II. Human uses

Biotechnology is leading the way to a new era in health care, with the development of
better methods for detecting, preventing and treating disease. Biotechnological techniques,
such as DNA profiling, are also proving enormously useful in other areas of human life, such
as forensic science and identification. This section looks at the way biotechnology is being
applied for human uses, including updates on the human genome project, the development of
new diagnostic and therapeutic tools, DNA profiling, stem cells and cloning.
II.1. Fighting infectious diseases

Biotechnology is used extensively in the study of emerging infectious diseases. These
are diseases that are: (i) new and previously unrecognized, such as SARS – Severe Acute
Respiratory Syndrome, or (ii) known diseases that have increased in number and spread over
the past two decades, such as foot-and-mouth disease, or (iii) diseases that threaten to increase
in occurrence and severity in the near future, such as influenza.
Infectious diseases pose a threat to humans as they can pass quickly from person to
person and affect a large number of people in a very short time. A disease-causing agent is
called a pathogen and can be a virus, bacterium or a prion. Their ability to infect and cause
disease is referred to as pathogenicity. There are a number of issues involved in emerging
infectious diseases. Some of them are:
 Growing tourism and trade, or political instability which results in more people and
animals moving from one place to another. It can lead to a drop in standards of health
or increase in the spread of infectious diseases, increasing the risk of transmitting
disease from one place to another.
 The evolution of new and more deadly disease-causing strains of infectious agents.
Viruses and bacteria can naturally modify their genetic material over time (mutate).
Some of these changes can increase their pathogenicity, while others can allow
normally harmless pathogens to transmit disease.
 Changes in climate and ecology can contribute to increases in vector-borne diseases
(diseases carried by insects). The pathogens, their vectors (the insects that transmit
them) and their hosts (the animals, including humans, that can be infected by them)
can all be influenced by the environment. A change of just a few degrees Celsius
could impact on the distribution of either a pathogen, its vector or its host. For
example, mosquitoes, which carry a lot of diseases, prefer a warm climate. Global
warming could increase the range of places where mosquitoes can live, allowing
malaria to spread. Alternatively, people are increasingly encroaching into wilderness
areas to farm, as vacant land becomes scarce. This increases those people’s exposure
to wild animals, many of which may harbor bacteria or viruses that do not cause
disease in the animal because they have evolved together, but may cause diseases in
people who have never had contact with these bacteria or viruses before.
Human behavior also allows pathogens to exploit new niches, such as hepatitis C,
HIV, SARS and variant CJD (the human form of mad cow disease). Biotechnology is
used to study the genetic material of viruses, bacteria and other organisms like prions,
and can work out whether a disease is caused by a totally new pathogen, or a new type
(strain) of a known pathogen. This information can be used to develop rapid
diagnostic tests which enable specific detection and identification of a disease. This is
important, as speedy detection of a pathogen can allow for a quick response to
eradicate the disease, or develop vaccines and effective drugs for treating infections.
28
Dr. Fahd M. Nasr
II.1.1. Severe Acute Respiratory Syndrome (SARS)

In 2003, SARS caught the attention of the world’s media and highlighted the
importance of emerging infectious diseases. Although the disease was contained, it still found
its way around the world and killed more than 700 people in 11 countries. The origin of the
virus is still unknown. The scientific response to the SARS outbreak was unprecedented. The
World Health Organization (WHO) pulled together international teams of virologists and
within a month of the first global health alerts about SARS the pathogen was found to be a
previously unidentified strain of coronavirus. A prototype diagnostic test for SARS was made
available shortly after the coronavirus was identified. The SARS coronavirus was identified
by amplifying portions of its genetic material using polymerase chain reaction (PCR), and
examining the resulting sequences. Further identification was also achieved through the use of
microarray technology. Coronaviruses have a crown-like ‘corona’ halo of protein spikes that
help them to latch on to their host cells. While many coronaviruses that infect people cause
nothing nastier than common colds, some animal coronaviruses cause more serious diseases.
The complete genome sequence of the SARS virus was published in May 2003. Analysis of
this sequence indicates that the coronavirus that causes SARS is unique; it has evolved
independently from the other known coronaviruses, probably over a long period of time in an
animal host. Finding the origin of the SARS virus is crucial for controlling re-emergence of
the disease. A molecular diagnostic test is being developed to detect the SARS infection in
various animal species.
II.1.2. Bird flu (Avian influenza)

While we sniffle our way through winter, we are not alone. Birds can also be affected
by various strains of bird ‘flu. The avian influenza (AI) virus generally causes mild disease in
birds, but there are some strains of the virus that are very powerful and cause death. Such
strains are called ‘highly pathogenic avian influenza’ (HPAI) or ‘fowl plague’. Recently in
some parts of Asia, one of these powerful stains, called H5N1, devastated chicken and other
poultry flocks. This outbreak has hit countries such as Thailand and Vietnam hardest, as they
rely on chickens for food and export. Thailand is the fourth largest chicken exporter in the
world 8.
The new strain is also causing concern because it has infected some people who have
had close contact with sick birds, and has led to numerous human deaths in Thailand and
Vietnam. Whilst these people were infected directly from birds, there is a fear that the virus
8
Other countries such as Cambodia, Indonesia, Japan, China, South Korea and the Philippines have also
reported cases of H5N1 virus infection; some countries such as Japan and South Korea have been able to control
these outbreaks quickly and safely. Avian influenza has also reached Europe and the United Kingdom, although
no human cases of the infection have been reported.
29
Dr. Fahd M. Nasr
could mutate to gain the ability to transmit from one person to another as easily as a normal
‘flu virus. If the virus also adapts to humans, it could lead to a global pandemic that could kill
millions of people.
The World Health Organization (WHO) is also concerned as the H5N1 strain has been
detected in migratory geese, which means that the disease could be spread when the birds
travel during change of seasons; they predict that India could be at greatest risk from these
birds. The WHO is also encouraging changes to farming practices and marketing of live
animals to reduce the risk of the H5N1 strain to humans.
There is currently no vaccine against the H5N1 strain to protect people or birds and
because a pandemic strain of influenza could appear at any time, the WHO maintains a
worldwide surveillance of ’flu strains and makes predictions of suitable strains for vaccine
production. An experimental vaccine that stimulates the body to fight off the H5N1 virus
appears to be effective, but a major problem remains – in the event of a flu pandemic, there
would be a shortage of the vaccine as the vaccine is grown in chicken eggs and production
can take months. Human ’flu can be detected in the doctor’s surgery using a test that detects
antibodies to the influenza virus, but does not identify the specific strain. For this, a DNA-
based test is needed. Currently any researchers working with the H5N1 virus wear a special
suit (a biocontainment suit) to prevent infection and they work in a laboratory which is
certified as a biocontainment laboratory and has strict controls against infection.
II. 2. Antibiotics
Antibiotics are natural substances that can be used to fight bacterial infections. They
are produced and secreted naturally by bacteria and fungi. Biotechnology is used to produce
them in forms and quantities that allow safe administration to people suffering from bacterial
infections. The first antibiotic discovered was penicillin. Penicillin was first widely used on
large numbers of patients in World War II (1939–45), after being discovered in 1928 by
Scottish scientist Alexander Fleming9. Bacteria can be gram-positive, with thick cell walls
made of peptidoglycan. Examples include Staphylococcus aureus (which causes mastitis in
cows) and Streptococcus cremoris, a bacterium used in dairy production. Bacteria can also be
gram-negative, with a cell wall high in lipid content and low in peptidoglycan content.
Examples include the Yersinia pestis bacterium that is thought to have caused the Black
Plague and most bacteria that cause bowel-related illnesses such as Salmonella food
poisoning.
A few antibiotics used to fight infections include:
9
Howard Florey (from Australia) and Ernst Chain (originally from Germany) later discovered how to collect and
purify penicillin from the fungus that produces it.
30
Dr. Fahd M. Nasr
Erythromycin: obtained from Streptomyces erythreus and effective against many gram-
positive bacteria and some gram-negative bacteria.
Ampicillin: a semisynthetic penicillin which acts against more bacteria than penicillin. It is
effective against gram-negative and gram-positive bacteria and used to treat gonorrhea and
infections of the intestinal, urinary, and respiratory tracts.
Novobiocin: produced by Streptomyces nivens and used to treat infections by gram-positive
bacteria.
II.2.a. Antibiotic resistance

Antibiotics are used to treat people when they have a bacterial infection. The antibiotic
kills most of the disease-causing bacteria; however, a few will naturally have some resistance
and survive. If not enough of the drug is given to overwhelm the bacteria, or if it is not taken
for long enough, then the resistant bacteria survive and outgrow the majority of bacteria who
are susceptible. Over time, this leads to antibiotic-resistant bacteria. For example, an
antibiotic-resistant bacterium causing concern in hospitals is Staphylococcus aureus, also
known as Golden Staph. Although a common bacterium found on the skin, it can cause
infection after surgery. S. aureus has built up resistance to common antibiotics such as
penicillin, methicillin and gentamycin.
There are also bacteria that live in your gut called Enterococci. They live in most
people’s lower gastrointestinal tract, and are normally harmless – but they can sometimes
cause wound infections, septicemia (blood poisoning) and urinary tract infections. The
antibiotic vancomycin is often used for the treatment of serious, life-threatening infections by
gram-positive bacteria which are unresponsive to other less toxic antibiotics. Some strains of
Enterococci have become resistant, meaning the patient can no longer be treated with
vancomycin and different antibiotics are needed. In order to control the spread of
vancomycin-resistant Enterococcus (VRE) and methicillin resistant S. aureus (MRSA),
hospitals have stringent infection control procedures and the careful use of antibiotics 10.
II.3. Producing human products

Biotechnology can be used to produce large amounts of proteins, hormones and
enzymes that are of benefit to humans and to produce new and safer vaccines. As well as
using genetically modified bacterial cells, GM yeasts are often used to produce the large
protein molecules of some hormones.
II.3.1. Insulin for diabetes

Diabetes is a common and sometimes fatal disease in which the supply of insulin is
insufficient for the body to break down sugar properly. The majority of insulin used by people
to manage diabetes is produced using biotechnology. Bacterial cells are genetically modified
to produce large quantities of human insulin, which is then purified for therapeutic use.
Millions of people worldwide now use Humuline, which is a major brand name for ‘human’
insulin produced from genetically modified bacteria. For many years, individuals with
diabetes were treated with insulin derived from the pancreases of abattoir animals (usually
pigs and cows). Although animal insulin is similar to the human form, there are differences
which mean some individuals cannot tolerate it and there are issues regarding the sustainable
10
The National Health and Medical Research Council (NHMRC) is the government body responsible for
providing advice to government on all health issues. They provide guidelines for hospitals on infection control.
A group of experts has been set up to advise the government on how to reduce the risks of antibiotic resistance in
agriculture and human health. The group is called the Expert Advisory Group on Antimicrobial Resistance
(EAGAR).
31
Dr. Fahd M. Nasr
use of animals for this purpose. Some human proteins that have been generated in similar
ways to insulin include human growth hormone, blood-clotting factors needed to treat
hemophilia, and erythropoietin which is used to treat anemia.
As well as using genetically engineered bacterial cells, engineered yeasts are often used to produce the
large protein molecules of some hormones. For many years, individuals with diabetes were treated with
insulin derived from the pancreas of abattoir animals (usually pigs and cows). Although animal insulin is
similar to the human form, there are differences which mean some individuals cannot tolerate it and there
are issues regarding the sustainable use of animals for this purpose. The advent of biotechnology
radically changed this. By inserting a copy of the human insulin gene into a bacterial vector, it was
possible to produce insulin chemically identical to the naturally produced form. Millions of people
worldwide now use Humuline, which is a major brand name for ‘human’ insulin produced using this
method.
II.3.2. Vaccines
Vaccines are a product of biotechnology. The process of vaccination relies on boosting
the body’s natural defense system – its immune response. Most vaccines are: (i) low doses of
dead pathogenic (disease-causing) microorganisms, or (ii) inactivated toxins from pathogenic
bacteria, or (iii) weakened live pathogenic organisms that are unable to cause the severe form
of the disease. A vaccine is recognized by the body as a foreign substance and so the cells of
the immune system mount an immune response to destroy it. Specific antibodies are produced
that recognize the foreign substance and they remain in the body, ready to fight future
infections by the naturally-occurring form of the disease. Vaccination was developed by
Edward Jenner. The practice of vaccination began in England in 1796 when Jenner vaccinated
an eight-year-old boy against smallpox by using the closely related cow pox virus. Since then,
vaccines have revolutionized the fight against infectious diseases. They have been, and still
are, used to control a number of life-threatening illnesses including measles, polio 11,
tuberculosis, tetanus, rabies, small pox 12, cholera, typhoid fever, diphtheria, pertussis
(whooping cough), Japanese encephalitis and yellow fever.
11
Currently, there is a global campaign to eradicate polio, a highly infectious disease that mainly infects
children. It is a virus which attacks the nervous system and can cause total paralysis in a matter of hours. For
those it does not kill, it causes life-long problems.
12
Smallpox, an acute, contagious, and sometimes fatal disease where one gets a fever and raised skin rash, was
declared completely eradicated in 1980 after a worldwide vaccination program.
32
Dr. Fahd M. Nasr
The process of vaccination relies on finding a way to treat a microorganism so that it will not cause harm
to the body but will cause the body’s immune system to produce the antibodies. These antibodies will
destroy the naturally occurring virus if it enters the body at a later stage.
Vaccines are now being researched and developed in a very different way from earlier
methods. Genetic modification allows a gene that codes for a protein of a disease-causing
organism to be isolated from the DNA of the organism and transferred into bacteria. The
bacteria then produce large quantities of the protein that can be purified and used as a vaccine.
This approach has also been used with GM yeast to produce the hepatitis B vaccine.
Vaccines in our food?
Imagine if you went to the doctor and instead of an injection, you were handed an apple to
eat. Researchers have been looking at ways to produce vaccines that are edible, which would
mean vaccination programs would be as easy as eating a piece of fruit or vegetable. The hope
was that the foods would provide cheap sources of vaccines that could be grown and
administered in poorer countries without the need for costly refrigeration or needle injections.
However, developers have changed direction and decided not to pursue this research to avoid
any possibility of vaccine-laden food straying into shops or markets. If this occurred, it could
be unwittingly eaten by consumers, with unpredictable results. Instead, developers are now
focusing on making vaccines in the edible leaves of plants that are not on sale as food. While
edible vaccine research has been largely directed at preventing human diseases this
technology could also be valuable for the production of vaccines to add to animal feed. The
first ‘prototype’ edible vaccines were produced in potatoes and tobacco leaves. The plants
were genetically modified to produce a toxin from the strain of Escherichia coli which causes
severe intestinal disease and can be fatal in developing countries. The GM potatoes and
tobacco leaves were fed to laboratory mice and studies showed their immune systems
mounted a sufficient response to the toxin that it protected their bodies from the bacterium in
further experiments. The gene for a non-toxic part of the cholera toxin has similarly been
produced in alfalfa plants. Mice fed with this GM alfalfa have produced an immune response
33
Dr. Fahd M. Nasr
against cholera toxin. Plants such as tomatoes and lettuce have also been transformed
(genetically modified) with the gene encoding the hepatitis B surface protein. This surface
protein is used in the commercial vaccine which is produced using yeast.
DNA vaccines
Instead of stimulating the body’s immune system using the pathogen itself, DNA vaccines use
its genetics. One or more genes from a pathogen are copied and multiplied using polymerase
chain reaction (PCR). The copied DNA is then injected into a muscle of the organism to be
vaccinated. Some of the muscle cells take up the genes and make the protein product that it
describes – usually a protein from the surface of the virus that you want protection against.
While only a few muscle cells take up the gene and make the protein, the organism’s immune
system recognizes the gene product as foreign and remembers it, just as it does in ‘traditional’
vaccination.
Some advantages of DNA vaccination are:
 purity. Because it is made artificially, the vaccine is much purer than if made directly
from pathogens.
 specificity. The vaccine contains only one of the many genes necessary for the
pathogen to reproduce. The small amount of DNA is enough for the immune system to
recognize it as foreign, but not enough to cause illness.
 the fact that different genes can be mixed and injected at the same time, making it
possible to vaccinate against variants of a pathogen or several different pathogens at
one time.
 cost and ease of storage. Unlike ‘traditional’ protein vaccines, DNA is inexpensive to
produce, doesn’t require refrigeration and can be stored for a long time.
DNA vaccination is still an experimental procedure as no results demonstrating an immune
response strong enough to protect against disease have been obtained.
II.3.3. ‘Pharming’ proteins

II.3.3.a. Biopharming
This is an experimental application of biotechnology in which organisms are
genetically modified to produce pharmaceutical proteins and chemicals they do not produce
naturally. A few examples include a contraceptive, a potent growth hormone, a blood clotting
agent, blood thinners, industrial enzymes, and vaccines.
II.3.3.b. Pharming with animals

Some animals have been genetically modified to produce human proteins in their
milk. The animals are like living pharmaceutical ‘factories’ and the technique is often referred
to as ‘pharming’. Animals which may be used include cows, sheep, pigs, goats, rabbits and
mice. The section of human DNA containing the genes for the specific protein required is
injected into the host animal embryo. The embryo is then placed into the uterus of a surrogate
mother where it develops to full term. As an adult, the animal produces the human protein in
its milk. The animal is milked and the protein is purified from the milk for therapeutic use for
humans. A GM animal produced for pharmaceutical production should be able to produce the
desired drug at high levels without endangering its own health, and pass this ability to its
offspring. The first use of this technology was in 1987 with mice that produced a human drug,
tissue plasminogen activator (tPA), which is used to treat blood clots. Other research has
included:
 cows that produce human serum albumin, used to maintain fluid balance in the blood,
and lactoferrin which is a protein from breast milk that promotes infant growth.
34
Dr. Fahd M. Nasr
 sheep that produced a number of proteins including factor VIII and factor IX which
are essential for blood clotting, natural anticoagulants used during heart surgery, and
proteins to treat lung and liver disease.
 rabbits that produce human interleukin-2, a protein essential in the immune response
to infection and may be useful in fighting some types of cancer.
II.3.3.c. Pharming with plants

Researchers know a lot about the molecular make-up of plants such as proteins,
minerals, sugars and fibers, as well as the genes responsible for these components. Plants can
be bred to emphasize certain traits and to overproduce compounds that are known to have a
therapeutic benefit. Plants also have the potential to be used as biological factories in a
process called molecular pharming13. The plants are genetically modified to produce different
proteins, bioplastics and other products rather than traditional foods or fibers in their leaves,
stems and roots.
Just like sugarcane is harvested and refined to produce sugar, the compound produced
inside the GM plant is extracted and processed after the crop is harvested. Instead of
producing a food product, the end result could be a plastic, medicine or even an additive for
the paper manufacturing process. So far, researchers have used tobacco, bananas and
sugarcane. These plants have several advantages:
 tobacco is a non-food crop which reduces the risk of someone accidentally eating a
plant with pharmaceuticals inside. It is also grown in a highly regulated environment
in Australia.
 bananas are a sterile plant which means there is no risk of the new gene being
transferred to other banana plants through cross-pollination.
 sugarcane is a crop that produces very large amounts of plant material or biomass and
can be grown essentially as a sterile crop.
Commercial production of pharmaceuticals 14 by this method is still a long way off and will
need to consider issues such as:
 the large amount of crop required to produce the compound in sufficient quantity
 ensuring that the plants do not cross-pollinate with other plants and transfer the new
gene to other species. One way to ensure this doesn’t occur is by creating sterile male
plants.
II.4. Reproductive technologies

In medicine, technology and biotechnology can be used to help people who are unable
to have an unaided pregnancy. Reproductive technologies include: (i) collecting and storing
sperm (below 0°C) for artificial insemination, (ii) collecting and storing eggs (below 0°C) for
artificial insemination, (iii) artificial insemination in which collected sperm are placed in the
reproductive system of a female, (iv) in vitro fertilization (IVF) in which collected sperm and
eggs are placed for fertilization in a test tube, The developing egg is then placed in the
reproductive system of a female, and (v) storage of developing fertilized eggs (embryos) so
13
Corn is by far the most popular biopharm plant, followed by soybeans, tobacco and rice. Around the world
some 400 biopharm products are reportedly in the pipeline, and over 300 open-air field trials have already been
conducted in locations across the USA.
14
‘Norman’, the no-morphine. Australian scientists have genetically modified opium poppies that may, in the
future, ‘grow’ their own drugs to fight cancer and malaria. ‘Norman’, the no-morphine poppy, has been
developed by tweaking genes that control the production of certain poppy molecules. The scientists found that
when they blocked the second-last step in the morphine production process a build up of a particular chemical
earlier on in the biochemical pathway, called reticuline, occurred. Reticuline is a non-narcotic chemical that is
useful in developing antimalarial and anticancer drugs.
35
Dr. Fahd M. Nasr
that they may be used later if an initial implantation of fertilized eggs produced by the IVF
procedure fails.
II.4.1. IVF
Infertility is the inability of a couple to fall pregnant after 12 months of unprotected
intercourse, or the inability to carry pregnancies through to a live birth. It is believed that up
to one in six Australian couples suffer infertility. Research into human reproduction now
means that many of these couples may achieve a successful pregnancy with medical or
surgical techniques, or lifestyle changes. IVF is one of the options open to these couples. IVF
stands for in vitro fertilization, which literally means ‘fertilization in glass’ although IVF
procedures today involve an egg and sperm being placed together in a plastic dish so that
fertilization might occur. The fertilized egg then develops into an embryo which is implanted
into the mother’s uterus between day 7 and day 14. Babies born as a result of IVF are often
referred to as ‘test tube babies15’. The term IVF is now commonly used to refer, in general, to
any form of assisted conception. There are a number of new methods of assisted conception
and different forms of assistance are suitable for different couples depending on the cause of
their infertility.
II.4.1. Pre-implantation genetic diagnosis

Parents with a family history of a serious or fatal genetic condition now have the
option of combining IVF and genetic testing in a technique known as pre-implantation genetic
diagnosis, or PGD. Couples using PGD first need to use IVF procedures to generate embryos.
A single cell can then be removed from the very early embryo without damaging it. This cell
can be tested to see if it carries the genetic defect that causes the condition. Only embryos that
do not carry the defective gene are implanted in the mother. While there has only been limited
use of PGD so far, the potential applications of PGD are increasing rapidly as researchers
identify more of the genes associated with serious genetic conditions. As with all IVF
procedures, a successful pregnancy is not guaranteed. However, for many couples who have
experienced a serious genetic condition or lost family members, PGD is more acceptable than
using prenatal genetic testing on a growing baby, or not having children at all. Genetic testing
in any context raises many significant issues for our community, but particularly when
embryos are involved. In general, PGD is usually only permitted for serious or life-
threatening conditions and if it leads to an improvement in the welfare and the interests of the
child being born. Some families have used PGD to test their embryos to ensure they can
provide a bone marrow transplant for a sick sibling. The bone marrow cells for the sick
sibling are taken from the umbilical cord blood of the new baby. Using this process of tissue
15
The first test tube baby, Louise Brown, was born in Britain in 1978. Australia’s first IVF baby was born in
Melbourne in 1980. Many thousands of children have since been born through IVF procedures. Australia has
always been at the forefront of research into reproductive technologies and 12 of the world’s first 15 successful
IVF babies were born in Melbourne!
36
Dr. Fahd M. Nasr
typing, these babies are sometimes called ‘savior siblings16’ as they can literally save their
sick brother or sister’s life. Regulations regarding this use of PGD testing vary from country
to country, and in Australia some states are regulated while others are not.
II.5. The human genome project

The Human Genome Project (HGP) is an international collaboration which officially
began in 1990. Originally, the expected project completion date was 2005, but rapid
technological advances saw the completion of this venture four years ahead of schedule. The
aims of the project were to: (i) determine the sequences that comprise human DNA, (ii)
identify all of the genes in human DNA, (iii) store this information in databases and improve
tools available for its analysis, (iv) transfer technologies gained from the project to private
industry (e.g. biotechnology companies) to develop new medical applications, and (v) address
the ethical, legal and social issues that may arise from the project.
II.5.1. What have we found?

The sequence of a ‘working draft’ of the human genome was published in the science
journals Science and Nature in early 2001. This was a special event, as the public and private
research efforts were publishing their results at the same time.
Analysis of the draft sequence revealed a vast amount of information including:
 the average human gene consists of 3,000 nucleotide bases, but sizes vary greatly – the
largest known human gene has 2.4 million bases,
 the order of 99.9% of nucleotide bases is exactly the same in all people,
 the functions of over 50% of discovered genes remain unknown,
 less than 2% of the genome encodes for the production of proteins,
 much of the genome consists of repetitive base sequences. These repeats appear to
have no direct function, but over time reshape the genome by rearranging it; creating
new genes or modifying and reshuffling existing genes,
 gene-rich areas of the genome are predominantly made up of G and C bases, whereas
gene-poor regions are mainly composed of A and T bases,
 chromosome 1 has the most genes (2968) whereas the Y chromosome has the least
(231).
Much is still unknown about our genome. Some of the things we still don’t know are:
 the exact number of genes in the human genome,
 the exact location, function and regulation of these genes,
 the amount, distribution, information content and functions of ‘non-coding’ DNA, that
is, DNA that does not code for a protein product,
 how gene expression, protein expression and post-translational events are orchestrated,
 evolutionary conservation of genes and proteins amongst different organisms,
 correlation of genetic variation between individuals with respect to health and disease.
How many genes did you say?
 The size of genomes differs from one organism to the next. The human genome
contains more than 3.2 billion base pairs and about 30,000 genes.
16
Savior sibling. In March 2004 the first 'savior sibling' to be born in Australia was reported. A couple from
Tasmania used PGD with tissue typing in order to have a second child who would be free from a particular
genetic condition, Hyper IgM syndrome, and to also be a matched tissue donor for the couple's existing child
who is affected by the same condition. As a result of the treatment, carried out at Sydney IVF, the woman started
her pregnancy knowing that her baby will be free from Hyper IgM and a potential tissue donor for her existing
son.
37
Dr. Fahd M. Nasr
 The largest known genome belongs to a microscopic amoeba, Amoeba dubia, which is
closely followed in size by the lungfish and the Easter lily.
 Three quarters of the Japanese pufferfish’s 31,000 genes have direct human
counterparts.
The number of genes in humans

Although the completion of the Human Genome Project was celebrated in April 2003 and
sequencing of the human chromosomes is essentially "finished," the exact number of genes
encoded by the genome is still unknown. October 2004 findings from The International Human
Genome Sequencing Consortium, led in the United States by the National Human Genome
Research Institute (NHGRI) and the Department of Energy (DOE), reduce the estimated
number of human protein-coding genes from 35,000 to only 20,000-25,000, a surprisingly low
number for our species17. Consortium researchers have confirmed the existence of 19,599
protein-coding genes in the human genome and identified another 2,188 DNA segments that are
predicted to be protein-coding genes. In 2003, estimates from gene-prediction programs
suggested there might be 24,500 or fewer protein-coding genes 18. The Ensembl genome-
annotation system estimates them at 23,299.
When analysis of the draft human genome sequence was published by the International
Human Genome Sequencing Consortium on February 15, 2001, the paper estimated only about
30,000 to 40,000 protein-coding genes, much lower than previous estimates of around 100,000.
This lower estimate came as a shock to many scientists because counting genes was viewed as a
way of quantifying genetic complexity. With around 30,000, the human gene count would be
only one-third greater than that of the simple roundworm C. elegans at about 20,000 genes 19.
Studies since the publication of the draft genome sequence have generated widely different
estimates. An analysis by scientists at Ohio State University suggested between 65,000 and
75,000 human genes20, and another study published in Cell in August 2001 predicted a total of
42,000 21.
Although the number of human genes is still uncertain, a winner of GeneSweep was
announced in May 2003. GeneSweep was an informal gene-count betting pool that began at the
2000 Cold Spring Harbor Laboratory Genome Meeting. Bets ranged from around 26,000 to
more than 150,000 genes. Since most gene-prediction programs were estimating the number of
protein-coding genes at less than 30,000, GeneSweep officials decided to declare the contestant
with the lowest bet (25,947 by Lee Rowen of the Institute of Systems Biology in Seattle) the
winner.
It could be years before a truly reliable gene count can be assessed. The reason for so much
uncertainty is that predictions are derived from different computational methods and gene-
finding programs. Some programs detect genes by looking for distinct patterns that define
where a gene begins and ends ("ab initio" gene finding). Other programs look for genes by
comparing segments of sequence with those of known genes and proteins (comparative gene
finding). While ab initio gene finding tends to overestimate gene numbers by counting any
segment that looks like a gene, comparative gene finding tends to underestimate since it is
limited to recognizing only those genes similar to what scientists have seen before. Defining a
gene is problematic because small genes can be difficult to detect, one gene can code for
several protein products, some genes code only for RNA, two genes can overlap, and there are
many other complications 22. Even with improved genome analysis, computation alone is simply
not enough to generate an accurate gene number. Clearly, gene predictions will have to be
17
Stein, L.D. (2004). Human genome: End of the beginning. Nature, 431: 915-916.
18
Pennisi, E. (2003). A Low Number Wins the GeneSweep Pool. Science, 300: 1484.
19
Claverie, J.-M. (2001). Gene number. What if there are only 30,000 human genes? Science, 291: 1255–7.
20
Briggs, H. (2001). Dispute over number of human genes. BBC News Online.
21
Wright, F.A. et al. (2001). A draft annotation and overview of the human genome. Genome Biology, 2: 1–18.
22
Pennisi, E. (2003). Gene counters struggle to get the right answer. Science, 301: 1040–1041.
38
Dr. Fahd M. Nasr
verified by labor-intensive work in the laboratory before the scientific community can reach
any real consensus23.
II.5.2. Who owns it?

The Human Genome Project was a truly collaborative project. Researchers from
across the world were involved and the actual sequencing was conducted at numerous
universities and research centers throughout the United States, the United Kingdom, France,
Germany, Japan and China. A rough draft of the sequence was made public on 26 June 2000
with the finished version completed in April 2003. The sequence is made available free of
charge to academic researchers and new data on the genome is posted every 24 hours
II.5.3. What do we do with it?

As the Human Genome Project continues to provide information about our genes,
more opportunities for genetic testing will become available. Genetic testing methods identify
the presence or absence of a particular allele, or form of a gene, in an individual. Genetic
screening is the testing of a whole population for the presence of particular alleles. The draft
sequence has aided finding some genes and single nucleotide polymorphisms (SNPs)
associated with disease. SNPs, (pronounced ‘snips’) are a common form of DNA variation
where an alteration has occurred to a single base. If the SNP is in a gene, it can sometimes
disrupt the gene’s function.
Over 30 genes have been identified and linked to conditions such as deafness,
blindness, breast cancer and muscle disease and DNA sequences have been associated with
various cancers, arthritis, diabetes and cardiovascular heart disease. This type of information
is enormously useful as it provides specific targets for the development of new diagnostic
tests and treatments. We now know a lot more about our genes and how they affect our
susceptibility to disease, and it can be very tempting to think that our genes are responsible
for everything about us. However, the ways we think and behave are shaped by more than just
our genetic code. Our environment, our society, including the country we live in, the food we
eat, the way we view the world and how we look after our health, all affect our behavior as
much as the genes we were born with. Some researchers are working with information from
the Human Genome Project with the ultimate aim of being able to advise individuals what to
eat to ward off inherited conditions, such as diabetes and heart disease.
II.5.4. Comparative genomics

Now that we have a map of the human genome, we have to learn how to read it. That
means figuring out which gene does what. Of the estimated 30,000 genes in the human
genome, we have very little idea about what each one does. One way of studying genes is to
directly compare the entire genome with other organisms. This study is called comparative
genomics. The human genome is extremely complicated and so, by comparing it with others,
such as the mouse or fruit fly genome, we gain insights into the similarities and differences.
Scientists can learn much about the function of human genes by comparing them with their
mouse counterparts.
All the organisms that scientists are using for genome comparison are known as model
organisms, in that they are a model against which the human genome can be studied. So how
can we compare mice genes with human genes when we have 2 legs and mice have 4, when
we have opposable thumbs and mice have claws? On a DNA level humans and other
23
Hollon, T. (2001). Human genes: how many? The Scientist, 15: 1.
39
Dr. Fahd M. Nasr
organisms aren’t that different - on average, mouse and human genes are 85% similar. So far
completely mapped ‘model organism’ genomes include chimpanzee, mouse, rat, pufferfish,
fruit fly, sea squirts, roundworm, baker's yeast, the bacterium Escherichia coli and in February
2005, the kangaroo. All of these organisms are being used by comparative genomics
researchers to further understanding of the human genome. Around the world scientists from
different nations are sequencing genomes. In early 2005 research was underway into the dog,
chicken, honey bee and sea urchin genomes.
Wallaby Genome Project

Australia is adding to the global genome research effort with the Wallaby Genome Project. The
tammar wallaby (Macropus eugenii), an Australian marsupial, is the subject of this project
being conducted by a group of leading Australian geneticists who aim to produce the entire
genome sequence of the wallaby in two years. Why the wallaby? To find out important genes
that make us human, we compare our genome with that of other animals. Mammals such as the
mouse are too similar and while animals like chickens are too different. Marsupials like the
tammar wallaby are perfectly in between.
Marsupials are particularly valuable ‘alternative mammals’ for comparative studies. The have a
number of unique features such as their reproduction and lactation. We study them at the
genetic level to better understand the mechanisms that control fertility, seasonal breeding,
pregnancy and lactation in all mammals. Some of the research is focusing on the following
areas:
 Tammar wallabies are only 400 mg at birth. They are hairless and blind yet manage to
find their way to the mother’s pouch where they complete their development. Scientists
can study their development that may provide more information on how a young
human develops inside its mother’s uterus and the genetic control of this. This
information may also lead to better treatments for babies born very prematurely.
 Kangaroo mothers are able to suspend the development of a fertilized egg until an older
joey has left the pouch, or until environmental conditions are suitable for bringing a
new Joey into the world. Understanding how this is controlled may present new
opportunities for control of mammalian fertility and development, which will be useful
in infertility treatments for humans, and may also have benefits for breeding programs
in farming.
Mice are too close, chickens are too far. Wallabies are just the right distance from humans in evolution
terms to reveal important genes when their genome is compared to humans.
 A kangaroo mother is able to produce two types of milk at the one time, to feed a joey
still in the pouch and another at heel. Understanding milk composition and control is
important both for our understanding of human nutrition and our ability to manipulate
milk production in domestic animals.
40
Dr. Fahd M. Nasr
Thus, sequencing the wallaby genome has the potential to provide benefits in human medicine
and agriculture. There will also be benefits that flow from applying genome scale information
to conservation, ecology and pest management in a wide variety of marsupial species.
II.6. Genetic disorders

There is huge diversity in many features found in the human race – skin color, size,
intellectual and athletic abilities to name just a few. This variation has arisen largely due to
changes in the DNA determining these features, plus changes to and interactions with the
environment. Any change in our genes or DNA is called a mutation and all genetic variation
has arisen from mutations. The different forms of a gene that arise through mutation are called
alleles. While we most often associate mutations with genetic diseases, much of the variation
has led to a highly complex body that works extremely well in our environment. Some
mutations may change the gene so that it codes for a protein that works just as well, or maybe
even better than the protein coded for by the original gene. Unfortunately, however, some
gene changes result in the production of a different protein that does not work as efficiently or
in the same manner as the one usually coded for by that gene. In some cases, no functional
protein is produced at all. In such cases, the mutation or gene change may cause a genetic
condition or disease, such as cystic fibrosis or Huntington disease. Most babies in Australia
are born healthy. However approximately 3% may be born with a genetic condition where one
or more genes that played an important role have been mutated.
Cystic fibrosis – a case study

Cystic fibrosis is a hereditary disease which affects around 1 in every 2,500 babies born. Its
occurrence in African-Americans is much lower – about one in every 17,000 births. It affects
several organs in the body, causing thick, sticky mucous secretions in the lungs and pancreas.
This leads to respiratory problems, including recurrent infections, and difficulty digesting
food. For every child affected by cystic fibrosis, there are around 100 people who carry the
faulty gene. Everyone has two copies of the gene which, when both copies are faulty, causes
cystic fibrosis. Being a carrier means that one copy of the gene is faulty, and the other is
normal. Carriers are not affected by cystic fibrosis because the normal gene compensates for
the faulty one. If both parents carry the gene responsible for the disease, they have a one-in-
four chance of having an affected child. This diagram illustrates how genes for diseases like
cystic fibrosis can be passed from parents to their children. If two carriers of the CF gene have
a child, there is a 1 in 4 chance that the child will have cystic fibrosis, a 2 in 4 chance that it
will be a carrier like its parents, and a 1 in 4 chance that it will not carry the gene at all. Where
there is a risk that genes for diseases may be passed on, it is important to note that the figures
above apply to every child. For example, if a couple has three healthy children, it does not
mean that the fourth child will have cystic fibrosis.
II.6.1. Genetic testing

Does your grandmother or grandfather have heart trouble? Does a particular type of
cancer run in your family? Until recently, family histories were the only tools available for
identifying an inherited disease. These histories can now be combined with genetic testing.
Genetic tests look at a person’s genetic material: genes or DNA. Such tests can compare the
base sequences in sections of DNA, look at the results of a change or mutation that is present
in the DNA or examine the shape and structure of chromosomes. The DNA is usually taken
from a blood sample, but other body fluids or tissues may be used. The tests may look for
predisposition to disease, or confirm a genetic mutation in an individual or family. As well as
studying changes to chromosomes or genes, genetic testing also includes biochemical tests for
41
Dr. Fahd M. Nasr
certain proteins that indicate disease-causing gene variations. Carrier testing can determine if
a couple is ‘carrying’ a particular gene mutation for an inherited disorder (such as cystic
fibrosis) that they may pass on to their children. Predictive genetic testing focuses on tests that
identify if someone will develop a disease before any symptoms appear, such as Huntington
disease. These tests can be useful for early detection, diagnosis, prognosis and treatment (if
available). Genetic testing is also used to identify people with an increased risk or
predisposition of developing a particular condition, such as certain cancers. This information
may be useful in helping to prevent, treat or manage the disease, but it also raises many issues
for our community.
Cystic fibrosis is a hereditary disease which affects around 1 in every 2500 babies born in Australia. It
affects several organs in the body, causing thick, sticky mucous secretions in the lungs and pancreas.
This leads to respiratory problems, including recurrent infections, and difficulty digesting food. For every
child affected by cystic fibrosis, there are around 100 people who carry the faulty gene. Everyone has
two copies of the gene which, when faulty, causes cystic fibrosis. Being a carrier means that one copy of
the gene is faulty, and the other is normal. Carriers are not affected by cystic fibrosis because the normal
gene compensates for the faulty one. This diagram illustrates how genes for diseases like cystic fibrosis
can be passed from parents to their children. If two carriers of the CF gene have a child, there is a 1 in 4
chance that the child will have cystic fibrosis, a 2 in 4 chance that it will be a carrier like its parents, and
a 1 in 4 chance that it will not carry the gene at all. Where there is a risk that genes for diseases may be
passed on, it is important to note that the figures above apply to every child. For example, if a couple has
three healthy children, it does not mean that the fourth child will have cystic fibrosis.
42
Dr. Fahd M. Nasr
Looking at DNA
Small changes in genes cannot be seen using a microscope. Other techniques are used to
detect tiny changes in the DNA code. These usually involve extracting the DNA from a tissue
sample, such as blood or saliva, from the person being tested and making many copies of the
gene being tested for. One method to detect changes is to cut the DNA into small fragments
using restriction enzymes. The cut DNA samples are then compared with other samples from
people with and without the particular mutation. For some types of DNA tests, gene probes
are used. These are short sequences of DNA that have base sequences exactly matching the
gene change that is being tested for. If the altered sequence is present in a sample of a
person’s DNA, the probe will bind onto that piece of DNA, which indicates the presence of
the disease-causing gene. Currently, gene tests are available for a number of diseases,
including: cystic fibrosis, some forms of hemophilia, muscular dystrophy, Huntington disease,
thalassaemia and Tay-Sachs disease.
Looking at chromosomes
Some genetic disorders occur due to changes in chromosome number and structure. These can
be detected by examining a person’s cells using high-powered microscopes. When cells
divide, chromosomes reproduce themselves and then coil up into compact shapes to make cell
division easier. In this state (called metaphase) the chromosomes can be stained,
photographed and arranged for easy identification and comparison. These photographs are
called karyotypes. Sometimes, when eggs or sperm are being produced, the chromosome pairs
do not separate properly resulting in an egg or sperm cell that has more or less than the usual
23 chromosomes. If an egg or sperm carrying 24 chromosomes combines with an egg or
sperm carrying the usual 23 chromosomes, the result will be an individual with cells in which
there are 47 chromosomes instead of 46. An extra copy of chromosome 21 is responsible for
Down syndrome and is called Trisomy 21. An extra copy of chromosome 18 results in
Edward syndrome.
In this karyotype, you can see there is an additional copy of the chromosome 21. This leads to Down
syndrome.
43
Dr. Fahd M. Nasr
II.6.2. Newborn screening

In Australia, all newborn children are screened for several diseases, including
phenylketonuria (PKU24), congenital hypothyroidism and cystic fibrosis, and some rare
metabolic conditions. All or some of the symptoms of these disorders can be prevented or
their severity reduced if the condition is diagnosed and treated early in life. Newborn
screening programs use a heelprick to obtain a blood sample from babies about three days
after birth. These blood samples are stored on a special pre-printed filter paper called a
Guthrie card. Different chemicals and proteins are measured in this sample to determine
whether the baby may have a particular disease. If these tests indicate that the baby may have
a genetic condition such as cystic fibrosis, then their DNA may be tested to see if they carry a
gene change causing this. This will provide information to the parents if they are hoping to
have more children. The Guthrie cards are stored by the laboratory doing the testing.
Concerns have been expressed about how the DNA in the blood of these cards may be used in
the future.
II.6.3. Having a genetic test

When you have a genetic test, you have a few choices to make. You need to decide: (i)
whether or not to have the test in the first place, (ii) who to tell about the results of the test,
(iii) how to live your life with the information provided by the test, and (iv) how much
support you need to deal with the choices you must make and the way you may have to
change your lifestyle. Your choices may affect you and your family. In order to make these
choices the following need to be considered:
What does the test result mean?
Will you definitely develop the disease you’ve been tested for? Gene tests do not always
provide a definite ‘yes’ or ‘no’ answer. Or do you have an increased risk (predisposition) for
developing a disorder? An increased risk means that you have a greater chance of developing
a condition than other people around you, but it may never happen. However, if you find out
that you do have an increased risk, this information may enable you to more closely monitor
the condition, or make lifestyle choices to help prevent its development.
Choice
For some disorders, such as Huntington disease, gene tests are available but there is currently
no treatment or cure. In these circumstances some people may choose to know if they carry
the gene, while others may not. Results from the test can help people make choices for the
future if the result of the test indicates that they will develop symptoms later in life. However,
some people would prefer not to know if there is no treatment available. Testing can also
reveal information to prospective parents about their risk of having a child with a genetic
condition. The results of such a test provide couples with information to help them make
decisions about having children.
Implications
Gene tests may have far-reaching effects. Understanding the possible implications of a gene
test is an important step in the process. Gene tests can identify people who carry mutations in
their DNA, but are unaffected by them. The results may only matter when the person has
children. Gene tests can affect more people than the one having the test. Discovering your
24
PKU is an inherited disorder where affected children cannot convert phenylalanine (an amino acid commonly
found in food) to tyrosine, because they lack a liver enzyme called phenylalanine hydroxylase. If the disease is
not treated with a special diet as soon as possible after birth, the child will develop severe brain damage and
developmental delay. If the child is fed a special diet, which is low in phenylalanine, development will be
normal. For this reason, it is important to diagnose babies as soon as possible. PKU is one of several diseases
looked for through newborn screening programs.
44
Dr. Fahd M. Nasr
own genetic make-up may reveal or rely on genetic information about close relatives who do
not want to know or reveal this information. It is also possible for gene tests to inadvertently
disclose family secrets involving paternity or adoption. Genetic counselors are individuals
specifically trained to help people through the process of genetic testing.
Who would you have to tell?
Our understanding of human genetics is progressing at a phenomenal rate. With this increased
knowledge and potential for new diagnostic and therapeutic tools comes the question of an
individual’s rights. If you had a genetic test, would you have to tell your employer? Your
health insurance company? Your parents? Your children? Over two years, there were
community consultation sessions held by the Australian Law Reform Commission (ALRC)
and the Australian Health Ethics Committee on these issues. From this public inquiry they
produced a report on genetic testing and personal privacy which was presented to Parliament.
The report covers a number of topics including information on how to regulate things such as
genetic privacy, discrimination and the use of genetic testing and information in employment.
II.7. Gene therapy

Genetic testing can reveal if a person has a genetic condition. Can we use
biotechnology to cure them? Disease can occur when genes become defective through
mutations. These changes result in a new form of the gene – a new allele – which may cause it
to function less effectively or not at all. In time it may be possible to use gene therapy to
replace an abnormal or faulty gene with a normal copy of the same gene. Currently, gene
therapy is an experimental procedure that aims to correct only defective genes that cause
disease and not other characteristics. In the future it may be used to treat ailments such as
heart disease, inherited diseases or cancers25.
II.7.1. How to do gene therapy

Gene therapy requires some way of delivering a functioning gene into the cells of a
patient. In recent trials, several different ways have been researched, using carriers to deliver
the gene.
Disabled viruses can transfer genes into a cell efficiently. However, it can be difficult
to make a virus totally harmless so some disease symptoms associated with the virus
may also develop.
Non-viral carriers include fat globules called liposomes and artificial chromosomes,
where a sequence of DNA is created in a laboratory. These can transport large
amounts of DNA, but they are not as easily incorporated into the genetic material of
the cell.
II.7.2. The uses

Gene therapy research and trials are being conducted to treat a number of conditions:
(i) inherited disorders such as severe combined immunodeficiency syndrome (SCID),
diabetes, thalassaemia, hemophilia and cystic fibrosis, (ii) cancers of different types, (iii) heart
disease, and (iv) age-related diseases, including arthritis and dementia.
25
None of us are perfect. Each human carries about half a dozen defective genes. Most of us do not suffer any
harmful effects from our defective genes because we carry two copies of nearly all genes. Scientists are looking
at gene therapy as a treatment for genetic disorders. This is a technique whereby the absent or faulty gene is
replaced by a working gene, so that the body can make the correct enzyme or protein and consequently eliminate
the root cause of the disease.
45
Dr. Fahd M. Nasr
Mending a broken heart

Heart attacks cause damage to the muscle cells of the heart. Scar tissue forms which disrupts
the heart's electrical system and weakens the heart. Recently, researchers have been able to
reprogram the scar tissue to behave like heart muscle cells. The researchers at the Children's
Medical Research Institute in Sydney, in collaboration with Children's Hospital Westmead,
added two extra genes to the cells. The first gene programs the cell to be excitable like a muscle
cell, the second gene allows the cells to communicate with each other, passing on the electrical
pulse of the heart.
Trials
In 1990, a four-year-old American girl Ashanthi DeSilva, became the first person to be treated
with gene therapy for severe combined immunodeficiency (SCID) syndrome. This is a disease
which affects the immune system so that children born with it are very susceptible to any
infectious diseases. Because they are kept in germ-free environments such as a plastic
enclosure, SCID is sometimes referred to as ‘Bubble Boy disease’. This girl’s cells were
provided with genes to produce an infection-fighting enzyme that she lacked. Doctors
removed white blood cells from her body, let the cells grow in the lab, inserted the missing
gene into the cells using a viral vector, and then infused the genetically modified blood cells
back into her bloodstream. This procedure is not a cure; the genetically treated white blood
cells only work for a few months, and the process must be repeated every few months. Since
that trial, more than 3,000 people have received this treatment in human clinical trials. Gene
therapy is still an experimental procedure and has suffered a number of major setbacks since
this first trial. In 1999, 18-year-old Jesse Gelsinger died from multiple organ failure only four
days after beginning gene therapy to help cure him of an inherited disorder. It is believed that
his death was the result of a severe immune response to the viral vector and since then other
problems with the trial have been identified. In early 2003, a temporary halt was placed on all
United States-based gene therapy trials using viral vectors in blood cells. This occurred after
two children developed leukemia-like conditions after being treated by gene therapy for
SCID. Future techniques may be better able to guarantee the safety of the techniques and
deliver the correct gene to the correct cells in the correct tissues. There are currently about
3,000 trials being carried out worldwide.
II.7.3. The challenges

For gene therapy to be effective, a gene must reach the right place in the body and
become part of the normal workings of the cells involved. It is important: (i) to find the right
gene, (ii) to target the right cells in the body, (iii) to deliver the DNA of the required gene into
these cells, (iv) to make sure the DNA is used correctly by these cells, and (v) that the
procedure is performed safely causing no injury or harmful side-effects. To date, gene therapy
has only been performed experimentally in human clinical trials, as there are several possible
adverse consequences. To see real benefit, future techniques will need to guarantee the safety
of the technique and deliver the correct gene to the correct cells in the correct tissues.
II.7.4. Just your genes…?

Gene therapy26 is only used on non-reproductive (somatic) cells - that is, any cells
other than sperm or egg cells. The genetic change introduced by the therapy is not passed on
to the patient's children. For the ‘new’ gene to be passed on to the patient's offspring, germline
gene therapy has to occur - that is, a permanent transfer of the gene into the patient’s egg or
sperm cells. This is illegal in some countries such as Australia. Currently, there is insufficient
26
Gene therapies on humans are allowed under Australian legislation, but the National Health and Medical
Research Council (NHMRC) sets strict guidelines for conducting trials and gene therapies on humans.
46
Dr. Fahd M. Nasr
knowledge about the possible consequences for future generations of the use of these
therapeutic techniques. There are a number of ethical considerations that would need to be
taken into account before the therapy can be used widely. These include weighing up the
potential benefits for the patient with the harm that might be done to them or their children,
and considering under what conditions it would be justifiable to make changes so that they do
not occur in future generations. The genetics underlying most conditions is quite complex and
completely eradicating a particular form of a gene we believe to cause disease may have far-
reaching consequences for future generations. That particular gene change may actually be
advantageous in some circumstances. For example, people who carry a copy of the allele that
causes sickle cell anemia have an increased resistance to the deadly infectious disease,
malaria. If the sickle cell allele is removed from the population, many more might die in areas
affected by malaria.
II.7.5. One possible future

Although gene therapy is still an experimental technique, some futurists have
speculated that with expanded knowledge, scientists may potentially be used to 'improve'
characteristics such as intelligence, personality or physical features. However, since hundreds
of genes may be involved in any of these characteristics and these genes interact with the
environment in which we develop, the task of genetically enhancing individuals would be
difficult and complex. An example of such concern is ‘gene doping’. That is, the possibility of
athletes abusing gene therapy to ‘genetically modify’ themselves to gain a competitive
advantage. Research is underway to use gene therapy to increase red blood cell production
(and therefore oxygen delivery to cells) in people with severe anemia – however, this therapy
could potentially be used to boost the capacity of athletes. Gene therapy which has so far been
found to increase muscle size in animal models, and which is intended for patients with
muscle wasting diseases, could in theory be adapted to strengthen particular muscles in
athletes.
Controversy exists as to whether ‘designer babies’ and gene doping will actually
happen – some people maintain that such genetic alterations are too complex and have too
many serious ethical implications, while others claim it is ‘only a matter of time’. Recently, a
number of popular films have attempted to visualize a ‘genetically modified’ future. For
example, the 1997 science fiction film, ‘GATTACA’ is about a futuristic society in which
embryos are selected and modified for intelligence, physical perfection, resistance to disease
and athletic ability. Children conceived in the normal way are treated as second-class citizens
and relegated to menial jobs. While the film combines Hollywood action and adventure, it
touches on a vision of a future that reflects many of the topical ethical issues and public
concerns surrounding biotechnology today.
II.8. Cloning
Cloning is the ability to create an exact copy of a biological entity by means other than
the joining of a sperm and an egg. Whether it is DNA, a cell or an organism, it is genetically
identical to the original. The most famous clone is Dolly the sheep, the very first cloned
mammal born in 1997. But genes, plants and animals can all be cloned. The techniques
behind cloning are discussed in the chapter called What is Biotechnology? Here, we look at
what has been done with clones and why.
II.8.1. Cloning genes

When researching DNA and genes, researchers need lots of copies of the gene or
section of DNA to study it. Polymerase chain reaction (PCR) is used to make many copies of
47
Dr. Fahd M. Nasr
the gene of interest. The fragments of DNA can be analyzed for forensic purposes, medical
research and genetic studies.
II.8.2. Cloning animals

Cloning of animals became a reality when scientists at the Roslin Institute in Scotland
created the famous sheep Dolly in 1997. She aroused worldwide interest and concerns about
cloning because of scientific and ethical implications.
Dolly was produced by a method called somatic cell nuclear transfer (SCNT). The
nucleus from a mammary (udder) cell of an adult sheep was injected into a sheep egg cell.
The original nucleus of the egg cell had been removed before the new DNA was injected. The
egg was then inserted into the uterus of a different sheep, as though she had been fertilized by
artificial insemination. When Dolly was born she was an exact genetic copy (clone) of the
animal from which the nucleus was taken - her genetic mother. That is, Dolly was genetically
identical to the sheep from which the mammary cell nucleus was taken.
There is an important difference between Dolly and her 'mother', and a pair of
identical twins. Identical twins are genetically identical because they developed from the same
fertilized egg. Dolly and her 'mother' are genetically identical because Dolly's DNA came
from a mature cell of her 'mother'. Dolly was put down at the age of six, when it was
discovered that she had a chronic lung disease. Her breed of sheep normally lives for between
48
Dr. Fahd M. Nasr
ten and twelve years. An extensive post-mortem was carried out on Dolly and no evidence
was found to suggest that being a clone contributed to her early death. Since Dolly, many
other mammalian species have been cloned, including cows, pigs, mice and rats. Monkeys
have also been cloned using a similar process to embryo splitting. Tetra, a rhesus monkey,
was the first primate to be cloned using a method that splits the original cells in an embryo to
make multiple identical animals. However, the cloning process is still inefficient: only around
3% of cell nuclei that are transferred to donor eggs result in live births.
II.8.2.a. Australia’s first clones

Australia's first cloned cow, Suzi, was born in April 2000. In 2002 she gave birth to a
healthy heifer calf called Suzitru, who was conceived by artificial insemination using semen
from an elite bull called Truman. As expected of a top Holstein cow, Suzi milked well and the
milk was analyzed before being discarded. Tests showed the milk to be the same as milk from
any other cow. Suzi's twin sister Mayzi, likewise gave birth in 2001 to a healthy Truman
daughter (called Mayhem). Unfortunately, shortly after giving birth, Mayzi contracted acute
toxic mastitis (a condition that affects around 1% of dairy cows) and died soon after despite
intensive veterinary treatment. In July 2004, Suzi also died after calving, due to acute mastitis.
Australia's first cloned bull, Rameses II, a clone of one of Australia's top dairy bulls at
the time, is now an adult and is producing good quality semen. The semen from Rameses II is
collected to demonstrate that he can produce semen normally, but it will not be used to
inseminate cows.
Rameses II, born in July 2001, isn’t just any Holstein Friesian bull calf, he’s an exact genetic copy of
Rameses, a top dairy sire. The semen of Rameses is highly sort after by dairy farmers because of his
proven ability to sire cows with high milk production and excellent milking behavior.
Matilda was Australia’s first cloned sheep. She was born in April 2001 having been
cloned by Dr Simon Walker and his team at the South Australian Research and Development
Institute (SARDI). Matilda was produced using techniques similar to those that produced
Dolly. In February 2003, Matilda died of natural causes. Between Matilda’s birth in 2001 and
early 2005, four more cloned sheep have been born and continue to show excellent health.
The South Australian team are now looking at how cloned animals perform under various
conditions; what causes problems that result in some cloned embryos not growing; and how
cloning can be used to breed GM animals.
II.8.2.b. Calf clone with a difference

Researchers in Victoria combined genetic modification with nuclear transfer
technology to produce a dairy cow with a new and valuable characteristic – an extra gene to
produce higher levels of protein in her milk. Skin cells were collected from an elite Holstein
49
Dr. Fahd M. Nasr
cow. They were placed in culture and genetically modified with an additional cow gene
responsible for milk protein production. These cells were further cultured to reproduce
millions of these GM cells, which were then used to create embryos. The embryos were then
transferred into surrogate cows. In early 2002, Australia's first GM calves were born as a
result of this research project undertaken though Monash University and Genetics Australia
Cooperative Limited and supported by the Cooperative Research Centre (CRC) for Innovative
Dairy Products. The four calves - Holly, Molly, Lolly and Jolly - had an extra gene for milk
protein production – a first for the Australian dairy industry. The technology is still in early
stages and three of the clones died or were put to sleep to as they had health problems. Holly
is the only calf to have survived. She continues to be a normal, healthy dairy cow and it is
expected that this genetic modification will result in higher protein content in Holly's milk.
Milk is recognized as a major source of nutrition, particularly calcium and protein. This
research project was designed to investigate a means to efficiently increase milk's nutritional
value. Once this technique is perfected, there is the potential to clone cows that produce milk
containing vaccines and medicines.
Holly was one of four genetically identical female calves, produced by cloning, that have an extra gene
that boosts the amount of protein produced in their milk.
II.8.3. Cloning humans?

It was on 13 October 2001 that a laboratory in the USA produced the first cloned
human embryo by the process of nuclear transplantation. But why would we want a cloned
human embryo? The cloned embryo can either be: (i) implanted into a uterus to grow into a
whole organism, called reproductive cloning, or (ii) harvested for embryonic stem cells which
are used to grow into any type of tissue, called nuclear transfer technology (previously known
as therapeutic cloning).
II.8.3.a. Nuclear transfer - cloning human cells for therapy

Nuclear transfer does not result in pregnancy or the birth of a cloned baby. Instead
embryonic stem cells are removed at a very early stage and grown in the laboratory until there
are enough to be stimulated to develop into other human cell types like skin or muscle cells.
This is the basis of stem cell research. Stem cells could be used in many applications
including production of healthy cells to replace damaged cells in the body, or growth of
organs for organ transplants. Although nuclear transfer holds great potential as a mechanism
to treat and cure diseases, it is also very controversial. This is because the embryo is destroyed
when the stem cells are removed. For this reason, research is currently focused on collecting
50
Dr. Fahd M. Nasr
stem cells from other sources like cord blood and adult tissues. These sources do not require
the production of a cloned human embryo and are therefore less controversial.
II.8.3.b. Reproductive cloning - cloning a whole human

The aim of reproductive cloning is to produce a living clone of a human from their
DNA. This technology is illegal27 in many countries around the world as the technique is not
well established and there are a number of ethical issues to be discussed first. The success rate
of animal reproductive cloning is still very low, with many cloning attempts needed before a
cloned embryo is formed, each time using hundreds of donor and egg cells. Those animals
have presented a number of abnormalities, in their genes and also in their development. At
present, the scientific community in general considers it unethical to clone a human because
of the safety and social concerns. The possible uses of reproductive cloning could be to
reproduce endangered wildlife, produce children for people who are unable to have a child or
to clone a child that may have passed away.
II.9. Stem cells

Stem cells are stirring great excitement in medical research. What are they? Why are
scientists so intrigued by them? And what are some of the concerns about stem cell research?
When an egg is fertilized by a sperm to make a human embryo, that single fertilized egg cell
divides millions of times to form the six billion or more cells that make up our bodies. Most
of these cells have undergone a process called differentiation that leads to them becoming
specialized for a certain function, such as neurons (nerve cells) that convey electrical
messages around the body. Stem cells differ from other cells in the body in three main ways.
 Stem cells are unspecialized. They have not developed into cells that perform a
specific function (differentiation).
 Stem cells are capable of self-renewal. Once a cell has become specialized it has a
very limited capacity to produce new cells, and then only cells of the same type. Thus,
if a muscle or blood cell is damaged it cannot replace itself. Stem cells, however, are
able to divide and produce copies of themselves and lead to self-renewal.
 Stem cells can differentiate. That is, they can divide and produce cells that have the
potential to become other more specialized cell types. These new cells and tissues are
used to repair or replace damaged or diseased cells in the body. Stem cells from
different tissues and from different stages of development vary in the number and
types of cells that they can give rise to.
Thus, stem cells play a critical role in normal growth and development by providing new cells
for growth and for replacing and repairing used and damaged tissues.
II.9.1. Types of stem cells

There are three main types of stem cells being investigated for their potential use in
research and medicine. They differ in their degree of differentiation and ability to self-renew.
In the human:
 Embryonic stem cells come from a five to six-day-old embryo. They have the ability
to form virtually any type of cell found in the human body.
 Embryonic germ cells are derived from the part of a human embryo or fetus that will
ultimately produce eggs or sperm (gametes).
27
The Australian Government, in agreement with most other countries, is also opposed to the cloning of human
beings for reproductive purposes, and has passed the Prohibition of Human Cloning Act 2002 (Cth). In fact, all
forms of human cloning are illegal in Australia.
51
Dr. Fahd M. Nasr
 Adult stem cells are undifferentiated cells found among specialized or differentiated
cells in a tissue or organ after birth. Based on current research they appear to have a
more restricted ability to produce different cell types and to self-renew.
In addition, umbilical cord blood stem cells are currently being used to treat a range of
blood disorders and immune system conditions. Stem cells that have the potential to develop
into any of the cell types found in an adult organism are called pluripotent. Embryonic stem
cells are pluripotent. Stems cells that only have the potential to make a few cell types in the
body are called multipotent. Adult stem cells appear to be multipotent. Cells that are capable
of forming a completely new embryo that can develop into a new organism are called
totipotent. A fertilized egg is totipotent. None of the stem cells used in research appear to
have this capacity. More basic research is required to find out how stem cells can be located
and extracted, kept alive in the laboratory, multiplied for extended periods of time, and
directed to form specific types of specialized cells.
II.9.2. Embryonic stem cells

Human embryonic stem (ES) cells are derived from human embryos that are 5 to 6
days old. At this stage of development the embryo is a hollow ball of about 200 to 250 cells,
no bigger than a pinhead, and is called a blastocyst. Within the blastocyst is a small group of
30 to 34 cells, called the inner cell mass. These inner mass cells are able to develop into any
type of cell (pluripotent) and are the source of all the highly specialized cells found in an adult
organism. The remaining cells generate all other tissues such as the fetal membranes and
placenta. Once the inner mass cells are obtained, they may be used to create pluripotent stem
cell ‘lines’ – cell cultures that can be grown indefinitely in the laboratory. These lines are
important tools for scientists, as they are all the same and it means new cells do not need to be
isolated every time they want to do an experiment28.
ES cells can become any cell type of the body because they are pluripotent, making
them attractive for developing different tissues for cell-based therapies. Large numbers of
embryonic stem cells can be grown in the laboratory relatively easily. ES cell lines are
sometimes referred to as immortal, due to their ability to keep dividing (self-renew) over
many generations. Therefore established cell lines can be maintained in laboratories for
further research and generation of cells for cell-based therapies for many years29.
ES cells may have great potential in forming the basis of long-term therapies, but
issues regarding their safety must be overcome first. It is not yet known how transplanted ES
cells would behave inside the body, but scientists are particularly worried that the transferred
ES cells might not stop dividing. This uncontrolled growth may generate tumors, and this has
already been shown to occur in laboratory cultures. While the cells in these tumors are benign,
scientists do not know how they might behave in the body. However, cells differentiated from
ES cells have been used in a number of studies, and have developed normally. This issue must
be fully explored before clinical trials can proceed in people.
Another issue with the use of ES cells in regenerative medicine is that they may
trigger immune rejection by the patient’s immune system. A number of alternatives are being
investigated to overcome this, including combining stem cell technology with cloning
methods in a process called somatic cell nuclear transfer. This is discussed in the section on
28
It is illegal in Australia to conduct any type of research on embryos that are conceived naturally. ES cells are
taken from embryos that come from eggs fertilized in an IVF (in vitro fertilization) clinic. Only embryos not
required for implantation are used. They are donated for research purposes only with informed consent from the
donors. They are not derived from eggs fertilized within a woman’s body, and embryos are not created
specifically for research purposes.
29
Human embryonic stem cells could be used to seek out and destroy a fatal form of brain cancer. Experiments
in mice with brain tumors show that the cells will migrate across the brain and deliver an anti-cancer payload.
52
Dr. Fahd M. Nasr
stem cells in cloning. There are a range of opinions about ES cell research in the community.
The overwhelming issue for most people opposed to ES cell research is that taking inner mass
cells inevitably leads to the destruction of the embryo. For those that view a fertilized egg as a
human life this is most distressing. Others consider the blastocyst to be nothing more than a
ball of cells with the potential to become a human. Debate on this issue remains considerable
and controversial.
II.9.3. Embryonic germ cells

Human embryonic germ cells (EG cells) are derived from a specific part of the
embryo called the gonad ridge. These germ cells normally develop into eggs and sperm. They
are isolated from fetuses older than 8 weeks of development. While ES cells are similar to EG
cells in many ways (such as being able to develop into any cell type), they are different in the
way they grow in the laboratory. ES cell cultures have been grown for over 2 years in the
laboratory as immortal cell lines, but embryonic germ cell cultures can only survive about 70
to 80 cell divisions. This makes them less suitable for establishing cell lines for research. But
one advantage of EG cells is that they do not appear to generate tumors when transferred into
the body, as embryonic stem cells do. This potentially may make them useful as a source of
transplant tissue and cell-based therapies. One of the greatest issues facing researchers is that
their derivation results from the destruction of a fetus. EG cells are isolated from terminated
pregnancies and no embryos or fetuses are created for research purposes. Only mouse EG
cells are being studied in Australia.
II.9.4. Adult stem cells

Adult stem cells are undifferentiated cells found in tissues and organs. They are
capable of self-renewal and can differentiate to form the major specialized cell types of that
tissue or organ. Their main role is to maintain and repair the tissue in which they are found.
Skin stem cells, for example, give rise to new skin cells, ensuring that old or damaged skin
cells are replenished. It now appears that probably all tissues contain adult stem cells but only
in very small numbers. Scientists think they remain dormant until activated by disease or
injury to that tissue. Because of their small numbers, adult stem cells have proven difficult to
isolate but to date adult stem cells have been derived from various tissues, such as the brain,
bone marrow, blood, muscle, skin, pancreas and liver. Most research has been done on
haematopoietic (blood forming) stem cells isolated from bone marrow and blood.
53
Dr. Fahd M. Nasr
Adult stem cells appear to only generate the cell types of the tissue in which they are
found30. Haematopoietic stem cells, for example, are found in the bone marrow and give rise
to the many types of cells found in the blood, including red and white blood cells and
platelets. The existence of this type of stem cell has been known for a long time and bone
marrow transplants have been used for over 30 years to treat people with a variety of life-
threatening blood disorders such as leukemia and thalassaemia. Adult stem cells are attractive
as research tools and for treating disease as they do not involve the destruction of embryos.
They are also attractive as it may be possible to use a patient’s own stem cells to generate
tissue for transplant, thus avoiding problems with immune rejection common to other types of
transplantation. However, one of the potential hurdles for the use of adult stem cells for
transplants is their limited ability to generate different cell types. Recent experiments,
however, have revealed that certain types of adult stem cells from one tissue may be able to
generate cell types of a completely different tissue if exposed to the right conditions. This
phenomenon is called plasticity and some researchers believe that adult stem cells may be as
potentially useful as ES cells in generating tissue for transplants. Research into the factors and
conditions that control their differentiation in the laboratory is proceeding.
Adult stem cells found in the bone marrow become specialized mature cells of the blood and immune
system
II.9.5. Babies saving lives - umbilical cord blood stem cells

Blood can be collected from the umbilical cord of a newborn baby shortly after birth.
This blood is rich in cord blood stem cells that can be used to generate blood cells and cells of
the immune system. Blood stem cells can be used to treat a range of blood disorders and
immune system conditions such as leukemia and sickle cell anemia31. Once collected, cord
30
Researchers in the UK have reported success in using adult bone marrow stem cells to reverse the effects of
cirrhosis of the liver, negating the need for a transplant of rarely available organs. The experiment involved
separating blood from the patient into its components, isolating stem cells from white blood cells and injecting
them into the liver’s hepatic artery, returning red blood cells to the body.
31
A South Korean woman paralyzed for 20 years is walking again after scientists repaired her damaged spine
using stem cells derived from umbilical cord blood. The woman had been bedridden since damaging her back in
an accident two decades ago, but is walking again with the help of a walking frame.
54
Dr. Fahd M. Nasr
blood can either be stored in a ‘cord blood bank’ for use as a potential source of tissue for
transplant for that baby should it ever be required. As this blood originated from the person
receiving it, there would be no problem with rejection of the transplanted tissue.
Alternatively, the cord blood may be donated to a general cord blood bank for use by other
people in need of a transplant. It is hoped that over time a store of cord blood samples from
people of different tissue types may be established. Someone requiring a transplant would be
treated with stem cells from the sample most closely matching their own tissue type, thus
minimizing complications associated with tissue rejection.
II.9.6. Potential uses of stem cells

Stem cells have potential uses in many different areas of research and medicine.
Replace damaged tissue
Human stem cells could be used in the generation of cells and tissues for cell-based therapies
(that is, treating patients by transplanting specialized cells that have been grown from stem
cells in the laboratory). Due to their ability to replace damaged cells in the body, stem cells
could be used to treat a range of conditions including heart failure, spinal injuries, diabetes
and Parkinson disease. It is hoped that transplantation and growth of appropriate stem cells in
damaged tissue will regenerate the various cell types of that tissue. For example,
haematopoietic stem cells (stem cells found in bone marrow) could be transplanted into
leukemia patients to generate new blood cells, or neural stem cells may be able to regenerate
nerve tissue damaged by spinal injury.
Study human development
Stem cells could be used to study early events in human development and how cells
differentiate and function. This may help researchers find answers as to why some cells
become cancerous and how some genetic diseases develop, which may lead to clues as to how
they may be prevented.
Testing of new drugs
Stem cells grown in the laboratory may be useful for testing drugs and chemicals before they
are trialed in people. The cells could be directed to differentiate into the cell types that are
important for screening that drug. These cells may be more likely to mimic the response of
human tissue to the drug being tested, compared to some of the animal models currently being
used. This may make drug testing safer, cheaper and more ethically acceptable to those who
oppose the use of animals in pharmaceutical testing.
Screening toxins
Stem cells may be useful for screening potential toxins in substances such as pesticides before
they are used in the environment.
Testing gene therapy methods
Stem cells may prove useful during the development of new methods for gene therapy that
may help people suffering from genetic illnesses.
These applications are all likely to be 10-20 years away.
II.9.7. Stem cell research in Australia

Stem cell research is a new area of science and a lot more basic information on their
growth and behavior is needed before they can be used to develop new treatments.
Researchers around the world are focusing on investigating the molecular characteristics of all
stem cell types and improving the methods for culturing them. This includes growing cells
without using animal products, such as mouse feeder cells. These animal products may be a
source of new viruses and infections that may limit the use of the cells in transplants.
Scientists are now beginning to have success in making cells differentiate into particular types
of cells and identifying whether these specialized cells function normally. Australian
55
Dr. Fahd M. Nasr
scientists have been at the forefront of this research. For example, scientists at the Walter and
Eliza Hall Institute of Medical Research in Melbourne and at the University of Queensland
are looking at brain stem cells, with a long-term view of treating patients with brain injury or
a degenerative disease. Others are looking at whether stem cells could be used to make a
complex organ, by trying to make a type of scaffolding for cells to grow on or around.
In 2000 a group of scientists from the Monash Institute of Reproduction and
Development first reported the development of nerve stem cells from embryonic stem cells.
This even made the front page of the scientific journal Nature, which is the science equivalent
to having your photo on the cover of the Rolling Stone magazine! Today, much of the
research in Australia on stem cells is directed through the newly-established Australian Stem
Cell Centre, a Biotechnology Centre of Excellence established by the Australian Government
in 2003. This Centre brings together stem cell researchers from around Australia to do
research on both embryonic and adult stem cells.
Clusters of immature nerve cells derived from human embryonic stem cell
The main areas of research for new therapies are:

 finding ways of regenerating damaged cardiac (heart) tissue,
 investigating stem cell technologies for blood and bone marrow regeneration to
improve bone marrow transplantation techniques and to generate safer blood cell
products for patients needing transfusion,
 investigation of the use of stem cell therapies in lung diseases such as cystic fibrosis.
II.9.8. Stem cells and cloning

The promise of stem cells to generate tissue for cell-based therapies is an exciting one,
however several hurdles need to be overcome before this can be realized. A major problem
with the use of ES cells to generate tissue for transplant is that the immune system of the
patient would detect them as foreign and attack. Immune rejection is a major problem in all
transplant therapies. Cells in our body display a set of markers, known as MHC (major
histocompatibility complex) which the immune system recognizes – it helps work out what is
meant to be in the body (self), and what is foreign (non-self). Invading pathogens and
transplant tissue display different patterns of MHC, which the body recognizes as foreign and
thus the immune system attacks them.
One strategy for overcoming this could involve the use of somatic cell nuclear transfer
(this used to be called therapeutic cloning, but scientists no longer use the term as it is
56
Dr. Fahd M. Nasr
misleading). This would involve replacing the nucleus of an egg cell with that from a cell
from the patient’s body and allowing it to develop to form a blastocyst. ES inner mass cells
would then be harvested and used to establish an ES cell line that has the genetic makeup of
the patient. These cells would then be directed to develop into the tissue needed for transplant.
This tissue would display the same antigen markers as the patient’s, and therefore would not
be rejected32. This potential application of cloning technology would not result in the
formation or development of a new fetus or adult human. However, there has been
considerable opposition to this research as it involves the generation of embryos specifically
for research which is considered unethical by many. Additionally, the embryos are genetic
clones of the patient, and thus could, in theory, be used to generate a new human.
Reproductive cloning is widely regarded as unethical by the medical and scientific
community.
Alternative strategies for overcoming immune rejection

The current strategy for overcoming tissue rejection is the use of drugs that suppress the
immune system. However, this means that the patient may then be more susceptible to
infections and researchers are investigating new drugs that have fewer side effects. An
alternative strategy for overcoming immune rejection is to use adult stem cells from patients
themselves to derive the transplant tissue. These cells would display the MHC markers that the
patient recognizes as self, so that the immune system would not reject it.
Researchers are also working to establish stem cell banks that contain tissue of many
different types. Cells from those that most closely match the patient would then be used for
transplant. The thymus gland is the organ most responsible for programming our immune
system to recognize its own cells very early in life. It ceases this function shortly after birth so
that any cells entering the body after that will be rejected. Scientists are researching ways of
possibly reactivating the thymus gland so that it will recognize the transplanted tissue. This
work is still in its early stages and is very complex – treatments such as this are likely not to be
available for at least ten years.
II.9.9. Ethics of stem cell research

The overwhelming objection to stem cell research is that it involves the destruction of
an embryo or fetus. For many this constitutes destruction of a potential human, and conflicts
with religious and moral views held in our society. For others, the potential for this research
to provide treatments and possibly cures for debilitating illnesses that have no cure and
significantly impact on our way of life overrides this concern. Central to any argument on this
is what actually constitutes the beginning of life for a human. Opinions on this vary from the
32
However, this technology is not legal in Australia.
57
Dr. Fahd M. Nasr
moment of conception, to a 14 day embryo, to a living baby at birth. This issue is highly
emotive and it will always be necessary to consider all opinions and to balance the harm that
might be done against the potential good this research may provide for those suffering from
debilitating diseases. In Australia, legislation states that no embryo may be created for the
purpose of this research or to generate stem cell lines. The embryonic stem and germ cells are
obtained from either donated embryos not required for an IVF procedure that would otherwise
be destroyed, or from pregnancies that were terminated for medical or social reasons.
The other major ethical issue associated with stem cell research ties in with the
combination of embryonic stem cell and cloning technologies, leading to generation of an
embryo that is a genetic clone of the donor of the nucleus (see section on stem cells and
cloning). What is critically different in this context as opposed to that above is that an embryo
is actually created for research or therapeutic purposes, and this raises a wider range of
objections, in that a potential life is created for a specific purpose. Also of issue here is the
purpose of this cloning, which would be done purely for the purpose of generating tissue for
transplantation. The embryo generated could be allowed to continue development and could
potentially lead to the birth of a new human if implanted into a willing mother. There are
serious ethical and medical concerns associated with the use of somatic cell nuclear transfer
technologies to reproduce humans and it is illegal in Australia 33, UK and the USA to conduct
any research into reproductive cloning of humans.
Given these concerns, which stem cell research should be permitted?

There are pluses and minuses associated with the research and use of all types of stem cells.
Which ones should research focus on? The ethical issues surrounding the origin of embryonic
stem cells will always be a sensitive issue. There are strict guidelines and legislation regarding
any research involving embryos, but for many, research on adult stem cells is the only
acceptable alternative.
Embryonic stem and germ cells can give rise to every cell type in the body. Adult stem
cells, however, are multipotent, giving rise to a limited range of cell types. This may limit their
use in cell-based therapies, and many researchers believe research using embryonic cells will be
more fruitful. However, recent research has revealed that some adult stem cells may be able to
generate different tissues under the right conditions and this may increase their therapeutic
potential.
Embryonic stem cells have a greater capacity for self-renewal and the cell lines that have
been established will be useful for research into the effects of drugs and toxins, and also into
early human development. Their uncontrolled growth also leads to the development of tumors
called teratomas, which may restrict their use in cell-based therapies. Research is continuing
into ways to control and regulate the growth of ES cells more effectively. Embryonic germ and
adult stem cells do not form these tumors in culture, which may make them better alternatives
for transplant tissue sources.
Obviously there are pros and cons to the use of all three types of stem cells and most
scientists agree that it is important to continue to pursue research into embryonic stem and germ
cells and adult stem cells. All scientists are aware that they must undertake their work ethically
and within the bounds of the law, and these can vary from country to country. In Australia, all
research involving humans must be approved by Human Research Ethics Committees.
33
In Australia the Prohibition of Human Cloning Act 2002 (Cth) prohibits all types of human cloning by any
method. The Research Involving Human Embryos Act 2002 (Cth) allows for regulated use of an appropriate
number of excess ART embryos in approved research programs. State and Territory governments are introducing
complementary legislation to provide nationally consistent prohibition and regulation of use of excess ART
embryos in research. Some people speculate that allowing any somatic cell nuclear transfer will be the start of a
slippery slope into reproductive cloning.
58
Dr. Fahd M. Nasr
II.10. Transplantation
Transplanting living tissue from person to person is a standard surgical procedure.
Successful organ transplants between humans have created an increased demand for donor
organs that has vastly outgrown supply. Closing the gap between supply and demand is not
easy. The tissue of the donor and the recipient need to be compatible so that rejection does not
occur, and the tissue needs to be able to be collected in a strict medical environment. Around
half of all people who need a transplant die whilst on waiting lists. This need for organs and
tissues for transplantation increases the pressure on researchers to find other ways of
providing the needed tissues. These include using human cells in tissue culture and using
embryonic or other stem cells to grow new cell types. Growing specialized human cells such
as skin, blood and ligament cells is referred to as tissue culture. This is a very important
method of providing healthy tissue for transplantation. It is a very useful technique because
the tissue produced has developed from a patient's own cells – the body may try to reject cells
from a different person.
For more than 25 years skin cells have been cloned to produce more healthy skin for
people who require skin grafts after burns or accidents. Healthy cells are removed from the
person who requires the cultured tissue, and then separated from each other, placed in a
container of liquid nutrients and kept under conditions that enable them to multiply to make
more skin cells. Specialized adult cells can be cloned in this way but they usually stop
dividing after about 20 cell divisions. Therefore, with current technology, very large patches
of skin cannot be produced. Increased understanding of the mechanisms of transplant organ
rejection means that organs from other species may soon be used as an alternative to human
tissues to help alleviate organ shortages.
II.10.1. Transplants from animals

Transplantation from one species to another is called xenotransplantation. For people,
we call it animal-to-human transplantation. The National Health and Medical Research
Council decided in 2004 to stop xenotransplantation for five years. If it was allowed to go
ahead after that time, pigs would be the preferred donor animal for use in humans because
their organs are so similar to ours. However, they would need to be genetically modified to try
and avoid rejection. This kind of research is underway overseas. Other experimental
procedures aim to use xenografts (cells or tissues transplanted from other species) to treat
illnesses such as AIDS, cancer, diabetes and Parkinson's disease 34. Concerns regarding
xenotransplantation include the risk that the transplant tissue may carry unknown latent
infections that once introduced into the recipient could be activated and lead to infection and
the possibility that previously animal-specific infections could become pathogenic to humans.
Work is underway to assess the extent of such risks.
II.10.2. What do others think?

Over the past couple of years there have been a number of community forums to
discuss animal-to-human transplantation. These forums were hosted by the National Health
and Medical Research Council (NHMRC), the government organization responsible for
looking at ethical considerations with research. In 2004, after public consultation, they
produced a report on the topic of whether or not clinical trials into animal-to-human
34
The first recorded instance of xenotransplantation was in 1682 when part of a dog’s skull was used to repair a
Russian nobleman's broken skull. The first successful organ xenotransplant occurred in 1963, with chimpanzee
kidneys being transplanted into 13 patients, however only one survived more than nine months. The first heart
xenotransplant occurred in 1964, using a chimpanzee heart. In 1984, baby Fae received a baboon heart and lived
for 21 days. In addition to primates, organs for xenotransplantation have been taken from pigs and sheep.
59
Dr. Fahd M. Nasr
transplantation therapies should proceed in Australia. This report details that there is
considerable feeling in the community against animal-to-human transplantation. Some of the
concerns include:
 the risk of introducing new diseases from animals to humans,
 ethical and social concerns about the welfare of the animals used,
 doubts about the benefits to the patient and whether these outweigh the risks,
 that there is a need for more regulation before proceeding further,
 that funds and resources would be better spent in other areas of medicine.
In response to these concerns the Council announced that there should be a five-year
moratorium on any clinical research into animal-to-human whole organ transplants in
Australia. The Council has also ruled that non-human primates such as baboons should never
be considered as source animals for any future clinical trials of animal-to-human
transplantation. It also requested more time to consider other animal-to-human transplantation
therapies.
II.11. DNA profiling

Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis
is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding
DNA – DNA that does not code for a protein. We have many sections of non-coding DNA in
our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For
example, you may have a stretch of DNA made up of the following base sequence:
ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATA
GCACAT
This sequence starts off looking random and then has repeats of the sequence CATG
towards the middle and then becomes random again. The repetitive section of the sequence is
what is referred to as an STR. For a given STR, you will have inherited different numbers of
the repeated sequence from each of your parents. For example, you may have inherited 11
repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3
repeats of this sequence within the STR on the matching chromosome from your father.
Because the number of repeats within an STR will create different lengths of DNA for that
STR, electrophoresis can be used to show how many repeats you have.
Generating a DNA profile usually involves analyzing an individual's DNA for ten
different STRs on different chromosomes. Statistically, no two people (except identical twins)
are likely to have the same numbers of repeats in all of these STRs. Polymerase chain reaction
(PCR) is used first to produce many copies of the ten STRs before they are analyzed using
electrophoresis. The different lengths will show up as bands at different spots on the
electrophoresis gel. The banding pattern produced is called a DNA profile or fingerprint, and
can be analyzed
II.11.1. DNA profiles for forensic use

Each of the chromosomes in your cells contains many sections of non-coding DNA –
DNA that does not code for a protein, but contains areas called short tandem repeats (STRs).
Each STR contains repeats of short sequences of bases, such as CATG in the sequence
CATGCATGCATG. If DNA is analyzed for 10 different STRs on different chromosomes,
there is only a one in a million chance that two people will have the same number of repeats
in all of these STRs, except for identical twins. This means that if the DNA profile (or
fingerprint) for 10 STRs for a crime suspect matches the profile for the same 10 STRs from a
sample found at the crime scene, there is a very high probability that they come from the same
60
Dr. Fahd M. Nasr
person. However, if the profiles differ for even one of the tested STRs, this cannot be
assumed. DNA is being used increasingly as evidence in court, but it is considered
‘circumstantial’ evidence and can only be used as proof with other supporting evidence.
However, it has proven useful in establishing the innocence of suspects on its own 35.
Generating a DNA profile usually involves analyzing an individual's DNA for ten different single tandem
repeats (STRs) on different chromosomes. Statistically, no two people (except identical twins) are likely
to have the same numbers of repeats in all of these STRs. Polymerase chain reaction is used to produce
many copies of the ten STRs before they are analyzed using electrophoresis. The different lengths will
show up as bands at different spots on the electrophoresis gel. The banding pattern produced is called a
DNA profile or fingerprint, and can be analyzed.
II.11.1.a. Forensic profiling in Australia

Forensic profiling began in Australia in 1988, and has assisted police in thousands of
investigations since. The Australian Government is in the process of setting up a DNA
database of known criminals called CrimTrac. Only DNA profiles from convicted criminals
(and not suspects) will be included on the database. According to the Victoria Police, it takes
approximately 2 weeks to obtain a full DNA profile from a tissue sample. This can be sped up
in urgent cases, however there are many samples to process with several samples collected at
each crime scene. In Australia, forensic DNA testing is done at government laboratories, as
well as at some universities and private organizations.
II.11.1.b. DNA testing of prison inmates

A number of crimes remain unsolved due to lack of evidence. The majority of crimes
are committed by only a few people. Of these few, there are a number of repeat offenders. In
the USA, England and New Zealand there are central DNA databases containing the profiles
of all previously convicted people. This allows for a quick identification if they re-offend. In
Australia, the central database, CrimTrac, is likely to help solve some unsolved crimes. At the
moment criminals in different states have different rights when it comes to DNA profiling. It
is also an issue that has a lot of concerns surrounding it with some people feeling that to DNA
sample inmates is a breach of legal rights.
35
Just like our favorite forensic science TV dramas, forensic scientists can analyze DNA samples from crime
scenes and compare them with DNA samples from victims and suspects to help solve crimes. However, unlike
on TV, the techniques are a bit more complicated and take much longer than ten minutes – more like two weeks,
in fact. And in a real forensic investigation, specialists would be performing specific tasks, rather than one small
doing everything. Lawyers and forensic scientists have also noted that people now have a distorted view of how
forensic science is really used in criminal cases and believe that all forensic evidence is infallible.
61
Dr. Fahd M. Nasr
II.11.1.c. Disaster victim identification

After a disaster such as a bombing or fire, it is often difficult to identify the victims.
Forensic scientists are called in to identify the DNA obtained from body parts or teeth. During
the aftermath of the 2002 Bali bombing for example, relatives of victims were asked to send
DNA samples from objects at home, such as a toothbrush, comb or item of clothing. So far, of
the missing or deceased in Bali, 182 have been identified, including 88 Australians. DNA
profiling is just one of the identification methods used. In Bali, 12 people were identified
using fingerprints, 115 people identified by methods including DNA, 100 identified by
methods including dental records and 7 identified by methods including medical records.
More recently, Australian forensic experts have been sent over to Thailand to assist with the
identification of bodies following the 2004 tsunami.
II.11.2. DNA profiles can reveal family relationships

DNA samples can be analyzed to explore possible paternal and maternal relationships
between parents and children. This is possible because half of each person's chromosomes –
humans have 23 pairs – half came from their mother and half from their father. Each of the
chromosomes contains many sections of non-coding DNA – DNA that does not seem to code
for a protein, but contains areas called short tandem repeats (STRs). Each STR contains
repeats of short sequences of bases, such as CATG in CATGCATGCATG. When STRs are
tested in DNA profiling, they occur in pairs. One chromosome in a pair carries an STR from
the person's mother and the other chromosome in the pair carries an STR from the person’s
father.
A person’s DNA profile as seen on an electrophoresis gel usually shows two lines for
each of the STRs tested because usually the STRs inherited from the parents are of different
lengths. Occasionally only one line appears because both STRs in a pair are of the same
length. When the DNA profile of a child is compared to the profiles of its genetic parents, it is
possible to match one line in each STR area with a line in that area of the mother's profile. In
this way, DNA profiling can also reveal non-paternity. Three or four STRs, of very different
sizes, are analyzed when exploring family relationships36.
36
DNA profiling in the media. Elizabeth Hurley, the British actor and cosmetics spokesperson, was recently in
court to prove who the father of her baby was. The case was brought to the family court by her ex-boyfriend,
Hollywood producer Stephen Bing. DNA testing proved that Bing was indeed the father – this news came at a
rather unfortunate moment, as Bing was waiting for results from a DNA test relating to another paternity case
with a different person.
62
Dr. Fahd M. Nasr
Regulation of research in Australia

Throughout 1999 and 2000 the State, Territory and Australian governments worked
together with interested parties to develop the Gene Technology Act 2000. The Act was passed
by the Australian Government in December 2000 and took effect on 21 June 2001. The
legislation is the Australian Government's component of a national scheme for the regulation of
genetically modified organisms (GMOs), which includes legislation in every Australian State
and Territory. The objective of the Act is to protect the health and safety of people and to
protect the environment by identifying risks posed by or as a result of gene technology and by
managing those risks. It does this by creating laws for certain dealings (or activities) with
GMOs. While most GM products are regulated by agencies such as the Therapeutic Goods
Administration (TGA), Food Standards Australia New Zealand (FSANZ) and the Australian
Pesticides and Veterinary Medicines Authority (APVMA), GM products which were not
already covered by an existing national regulation scheme are now regulated by the Gene
Technology Regulator under the legislation. The Gene Technology Ministerial Council is
currently conducting a review of the operation of the Act and the Gene Technology Regulator
is undertaking public consultation on proposed changes to clarify and improve the workability
of the Gene Technology Regulations 200137.
A scientific, ethical and precautionary approach
The Act38 establishes three key advisory groups to provide advice, on request, to the Gene
Technology Regulator and the Gene Technology Ministerial Council:
 the Gene Technology Technical Advisory Committee (GTTAC) provides advice on
scientific and technical matters;
 the Gene Technology Ethics Committee (GTEC) provides advice on ethical matters;
and
 the Gene Technology Community Consultative Committee (GTCCC) provides advice
on community issues regarding gene technology.
International arrangements
Working in international forums is one way Australia can encourage other countries to take up
comprehensive arrangements to ensure the protection of people and the environment in the
development of gene technology. We need to ensure Australians and other nations act
responsibly when exporting or transporting genetic material internationally. Likewise we need
to ensure that people importing or transporting genetic material across Australian boundaries
act appropriately.
Convention on Biological Diversity
Australia is signatory to the Convention on Biological Diversity (CBD) and a member of the
Intergovernmental Committee on the Cartagena Protocol on Biosafety (see
http://www.dfat.gov.au/environment/bsp). In response to the CBD, an international biosafety
protocol was negotiated and came into force on 11 September 2003. The protocol governs the
‘transboundary movement’ (i.e. movement across international borders) of living modified
37
Details about the regulatory framework for gene technology in Australia, including information on the Act,
Regulations and the Gene Technology Ministerial Council, which oversees the operation of the national
regulatory scheme for gene technology, can be found at the Office of the Gene Technology Regulator (OGTR)
web site: http://www.ogtr.gov.au/
38
Section 4 requires that the object of the Act is to be achieved through a regulatory framework which: (aa)
provides that where there are threats of serious or irreversible environmental damage, a lack of full scientific
certainty should not be used as a reason for postponing cost-effective measures to prevent environmental
degradation; and (a) provides an efficient and effective system for the application of gene technologies; and (b)
operates in conjunction with other Commonwealth and State regulatory schemes. Section 4(aa) outlines a
‘precautionary approach’, meaning that where there are threats of serious or irreversible environmental damage,
a lack of full scientific certainty should not be used as a reason for postponing cost-effective measures to prevent
environmental degradation. However, the legislation also requires that the object of the Act is achieved by
balancing a precautionary approach with the other two, equally important, provisions of efficiency/effectiveness
and co-regulation. A precautionary principle is, therefore, one of three 'pillars' in a regulatory framework for
gene technology that seeks to protect human health and safety and the environment.
63
Dr. Fahd M. Nasr
organisms resulting from modern biotechnology, which may have an adverse effect on the
conservation and sustainable use of biodiversity.
II.12. Ethics of research involving humans

In our society, people can exercise a wide range of choices. For example, we can
choose our friends and partners, our dentists, doctors and schools. We can choose where we
live, where we shop and what we want to buy, wear, watch and read. Our society offers us a
lot of choices in terms of lifestyle, recreation, culture and social opportunities. We place a
high value on individual freedom and often think that having more choice automatically leads
to this. If freedom is seen as a good thing, then we often assume that more products or
processes that give us freedom must also be positive.
II.13. Freedom and choice

II.13.1. The value of technology in providing greater choice
A clear product of technology is that it gives people more choices. For example,
consider different kinds of activities that are available through home computer systems, such
as word processing, games, music, internet access, and e-mail. Technology has greatly
increased choice in human reproduction or 'making babies'. For most couples, having a child
happens naturally after having sex. However, for a small number of people, conception does
not occur for many different reasons. Not being physically able to have children is called
infertility. Around fifteen per cent of Australian couples are affected by infertility. Until the
late 1970s the only way for these couples to have a child was through adoption. Since then,
advances in reproductive technology have dramatically changed the ways infertile couples can
conceive children. There has been an increase in treatments that use methods like artificial
insemination - where sperm (from a woman's partner or a donor) is injected into the woman's
reproductive system to help fertilize an egg.
Assisted reproductive technologies (ARTs) is the name for techniques that have come
from the work of English scientist, Professor RG Edwards and obstetrician, Mr Patrick
Steptoe. This team was responsible for the first successful in vitro fertilization (IVF). It was
used to help an English couple, Leslie and John Brown, have a healthy baby daughter
(Louise) who was born in 1978. The IVF procedure involved the removal of eggs from Mrs.
Brown, which were then fertilized with Mr. Brown's sperm in a sterilized glass dish in the
laboratory. The fertilized eggs were then put back into Mrs. Brown's uterus. All ARTs involve
collecting eggs and sperm and helping fertilization to occur (usually in a laboratory) and then
returning the fertilized eggs to the female's body.
While ARTs now help infertile couples to have children, these technologies have also
changed traditional parenthood. For example, ARTs help: (i) a couple to have a child when
the woman is unable to conceive naturally; (ii) single people or same-sex couples to have a
child, as long as there is someone to donate the egg or sperm; (iii) surrogacy, where a woman
who is not the biological mother carries a child until it is born; (iv) fertilized eggs/embryos to
be stored frozen for later use. ARTs have also raised speculation that there could be the future
possibility of parents being able to design their baby by changing the embryo (altering its
DNA) before returning it to the woman's body. Through technology, we certainly have more
choice in child bearing. However, is greater choice all that is necessary for these
developments to be seen positively?
There is a lot of debate about the use of reproductive technologies in our society.
Some people consider a procedure like IVF worthwhile from a health perspective - it can
improve human wellbeing. For others, cultural or religious beliefs may give them a different
64
Dr. Fahd M. Nasr
point of view. In the ART area, infertility is seen as a medical condition. Therefore, the need
for the person to make their own decisions follows the same ethical considerations that apply
to any patient needing medical treatment.
II.13.2. Issues
The following activities explore the issues associated with the use of biotechnology
that may make it possible, now or in the future, to: (i) genetically enhance human offspring;
clone cells, tissues, organs or whole human bodies; (ii) carry out genetic testing for diseases
or other characteristics; (iii) produce DNA profiles to identify individuals or reveal
relationships. The exploration of these issues involves consideration of moral and ethical
values, economic and social concerns and the rights of the individual versus the wellbeing of
the majority.
65
Dr. Fahd M. Nasr
III. Environment
Biotechnology has the potential to have both positive and negative impacts on the
environment. It can be used to support work on recovering threatened species and controlling
or even eradicating introduced predators and pests. Organisms can even be engineered to
remove wastes and pollution from the environment. This section highlights case studies where
biotechnology is being used to address some environmental issues. It is important to consider
the ideas that scientific decisions are never without risk and that they can be colored by the
particular world-view of the scientists who are trying to solve the problem. For example, a
paleontologist who studies the history of the earth over millions of years brings a very
different understanding of species extinction to an environmental debate than an
environmental biologist. It is also important to think about actions taken based on conflicting
advice and how they are weighed up, as these decisions may have the potential to deprive
future generations of their right to determine some aspects of their lives.
Biotechnology as it relates to the environment usually means introducing a new
organism into an existing situation. The food and agriculture section of Biotechnology Online
also investigates case studies on genetically modified organisms (GMOs) and the potential
environmental impact of releasing these organisms. It is important to make a proper
assessment of risks and benefits before the release of any bioengineered organism to prevent
environmental damage and to preserve our biodiversity.
III.1. Biological control of pests39

If you have been to some of the islands off Tasmania where rabbits and foxes have not
been introduced, the first thing you notice is the diverse birdlife flitting freely in the
grasslands. It is a stark reminder of the impact of introduced species on the mainland. One
application of biotechnology is biological control – attempting to eradicate introduced plant or
animal pests (such as prickly pear and rabbits), or to reduce the harm they do to the
environment. Being an island continent makes such an exercise conceivable, but what could
Europeans do to re-establish diversity? Which year would they take as their starting point for
measuring diversity?
Feral animals
Feral animals40 in Australia are either domestic animals that have gone wild or those that
were introduced for pest control or for recreational use. Feral animals causing most public
concern are: rabbits, foxes, cats, pigs, goats, donkeys, horses, camels, water buffalo, introduced
fish, the northern Pacific seastar (Asterias amurensis), and the Indian mynah and cane toads.
These species have few natural predators or fatal diseases in Australia and some have high
reproductive rates. As a result, their populations can multiply rapidly if conditions are
favorable. Drought is the main factor in controlling their populations, as numbers drop quickly
when food and water are limited. Some feral animals prey on native animals and compete with
them for food, shelter and habitat. Some feral animals may compete with livestock for food or
eat our livestock. They can also cause damage to the land and waterways used by farmers and
native animals.
39
In Australia, our native plants and animals have adapted to life on an isolated continent over millions of years.
However, particularly since European settlement, our native animals have had to compete with a range of
introduced animals for food, habitat and shelter. Some of our native species have also had to face new predators.
Rapid changes in land usage, such as increased crop growing areas, have had a major effect on our soils and
waterways.
40
Domestic rabbits were first introduced into Australia with the first fleet in 1788, but they did not become
established in the wild until Thomas Austin brought 24 wild rabbits from England in 1859, and released them on
his property in southern Victoria, for hunting. They bred so well that by 1866, only 7 years later, 14,253 rabbits
were recorded as being shot for sport on Mr. Austin's property.
66
Dr. Fahd M. Nasr
III.1.1. Traditional methods to control feral pests

Many of the traditional methods used to remove or control these feral pests are not
biotechnological methods. Such methods include fencing, trapping, poisoning and shooting.
You can investigate the practicality, effectiveness, cost and effect on other species of each of
these methods at a number of websites. These feral animal websites make it clear that in the
control of feral pests, animals must be treated humanely.
Biological control
Methods of control that use other living things such as natural predators, insects, parasites,
disease carrying bacteria or viruses are, by definition, biotechnology, and the method is
described as 'biological control'.
Natural predators and diseases
An introduced organism often becomes established because it has no natural predators in its
new environment. To control the pest biologically, we can find a natural predator for this
organism and introduce it into the environment where the animal or plant is a pest. Ideally,
using a specific predator means that we do not need to rely on chemicals such as pesticides or
other methods that may harm the ecosystem. However, care is needed because introduced
species are among the biggest causes of extinction of native plants and animals, and the
predator can sometimes do more harm than good. In Australia, biological control has often been
used successfully, including the introduction of a beetle to control prickly pear and a weevil to
control water hyacinth. But one application of this form of biological control went very wrong.
The cane toad was introduced into Queensland in 1935 to eat a pest beetle that was ruining
sugar cane crops. However, the cane toad failed to control the beetle and instead thrived in the
warm climate. The cane toad has now spread widely through northern Australia, devastating
populations of native species and changing the ecology of areas well beyond the borders of
Queensland. It has even reached Kakadu National Park – a World Heritage Area in the
Northern Territory, where it has the potential to do tremendous damage. Before any new
organism can be introduced there must be extensive research carried out on its biology and its
potential effects on Australian ecosystems. This may take several years. Other precautions
include the strict controls that the Australian Quarantine and Inspection Service (AQIS) applies
to help prevent the unauthorized introduction of new organisms into Australia. These steps are
designed to avoid a repeat of the cane toad episode. However, we cannot always predict how
new species will interact in a complex and open system such as the environment.
Fertility control
A new biological control method aims to reduce the fertility of the pests by suppressing
fertilization to produce fewer young. This is called 'immunocontraception'. The scientists
developing this technology take seriously issues such as the risk of exporting an
immunocontraceptive virus in live animals, and risks to non-target species both here and in
other countries. It is unlikely that biotechnology will provide a magic bullet solution for feral
animal control. Usually a biotechnology solution will have to be used in combination with other
control methods mentioned above.
III.1.2. Carp: a case study

During the nineteenth century, a fish was introduced to some South-Eastern Australian
waterways that was to have a disastrous effect on those ecosystems. That fish was the
Common Carp (Cyprinus carpio), often referred to as the European Carp. Carp is a species
that is native to many temperate regions of Asia. The carp is closely related to the Goldfish
and is the largest member of the Cyprinidae family. At least three strains of carp have been
introduced to Australia, including an ornamental strain near Sydney (1850–60), a Singaporean
strain in the Murrumbidgee (1876), and a hybrid ‘Boolara’ strain in Victoria (1961). All have
become major pests in those waterways by their domination of the environment.
67
Dr. Fahd M. Nasr
Carp are a pest in Australia because they contribute to the degradation of waterways in
a number of different ways. Carp increase water turbidity by uprooting aquatic plants, and
sifting through sediment during feeding. The greater the water turbidity, the less light can
penetrate, which stunts surrounding plant growth. This in turn can lead to the erosion and
subsidence of river and lake banks, which further contributes to water turbidity. Carp also
compete with native fish for habitat and food resources.
Traditional methods of control

Carp are extremely adaptable animals and can thrive in environments that would kill other
freshwater fish. It is thought it will be impossible to totally eradicate the existing population
and so, the most realistic approach is to control carp numbers. There have been a number of
attempts to control the carp population in South-Eastern Australia. Simple measures rely on the
cooperation of anglers and hobbyists: if you catch a carp in Victorian waters, it is illegal to
throw it back. It is also illegal to keep live carp in Victoria, including Koi carp, which are
desired by some people as ornamental fish. Other current control methods include commercial
harvesting and poisoning. While these options may reduce carp numbers in some areas, other
options are being explored for more widespread control.
Biological control – the Daughterless Carp Program
Scientists are investigating this ‘daughterless technology’ which aims to control carp
numbers through creating a fish population with many more males than females. By blocking a
specific gene involved in female carp development, only male fish are produced. The project
began in 2003 and is a collaborative project between the Murray-Darling Basin Commission,
CSIRO Marine Research and the Pest Animal Control Cooperative Research Centre (PAC
CRC). They have targeted a gene called aromatase which codes for an enzyme that converts
testosterone to oestrogens in the developing carp embryo. Without aromatase, the embryo
cannot make the hormones required to develop into a normal female fish. With fewer females
in the population, and in conjunction with other management practices, it is hoped that carp
numbers in the Murray-Darling Basin will plummet. This research is in its very early stages and
is part of a long-term program, as carp have a very long generation time. A successful
Daughterless Carp approach would need to operate over about 40-50 years and be used in
conjunction with other short-term control techniques. Any new technology involves risks that
need to be identified and assessed. The researchers are assessing and reviewing the risks from
the beginning of the project to identify any risks associated with the technology and to take the
steps to ensure they are addressed. The technology involves manipulating only carp genes and
as such is aiming to produce a biocontrol mechanism highly specific to carp, thereby
minimizing the risk to non-target species. The release of any genetically modified organism
into the environment is subject to legislation which considers any economic, social and ethical
concerns related to the technology.
68
Dr. Fahd M. Nasr
III.1.3. Cane toad: a case study

Another animal introduced to Australia is the cane toad. It was deliberately released at
Gordonvale in Queensland in 1935 in an attempt to control French’s Cane Beetle and the
Greyback Cane Beetle in sugarcane. It was unsuccessful in controlling the cane beetles.
Instead, it flourished in Queensland’s warm environment, spreading rapidly south and west.
By March 2001 it had reached the wetlands of Kakadu National Park, and one isolated
community was recently discovered as far south as Port Macquarie in New South Wales.
An adult cane toad
Although not officially recognized as a pest by all Australian states, there is evidence
to suggest that there are environmental impacts of cane toads in the areas they inhabit and
they are considered a threat to biodiversity for a number of reasons:
Cane toads exude and can squirt poison from the parotoid glands on their shoulders
when threatened or handled. This toxin contains a cocktail of chemicals that can kill
animals that eat it. Freshwater crocodiles, goannas, tiger snakes, dingos and northern
quolls have all died after eating cane toads, as have pet dogs.
Cane toads are likely to compete with native animals for food.
Cane toads eat mainly insects, including honey bees, but will eat any small creature
that fits in their mouth.
Cane toads occupy holes and hollows used by native animals for nesting or hiding
from predators. Cane toads are capable of carrying diseases that could be transmitted
to native frogs and fishes.
Current conventional control methods against cane toads concentrate mainly on
quarantine checks of vehicles, public involvement in 'toad hunts' and education. But these
have not been effective in stopping the cane toad spreading. For many years, scientists have
looked for different ways to control the cane toad, but have been unsuccessful to date.
Naturally occurring, cane-toad specific biological control agents have not been found. Current
research conducted by CSIRO is using gene technology to try and find a biocontrol method.
69
Dr. Fahd M. Nasr
Researchers are now looking at how to stop tadpoles developing (metamorphosing)

into adults meaning they cannot mature and cannot reproduce. They are hoping to identify a
cane toad gene critical to toad metamorphosis. If that gene product is used to immunize can
toads at the tadpole stage, the tadpole would see the protein as foreign and mount an immune
response to it. This would interrupt toad development. Scientists are also looking at viruses to
deliver the gene to the cane toad population. They are looking at a combination of virus and
gene to be specific to cane toads so it does not affect native frogs and toads. They also want to
make sure the toad is responding to the gene or protein produced by the gene rather than the
virus itself. As with all research, there are possible risks which need to be determined and
managed before any biological control agents are released into the environment. Even if all
research goes to plan, it could still take up to ten years before a product is available to control
the march of cane toads.
III.1.4. Canegrubs: a case study

As much as we love sugary cakes and desserts, there are a number of insects that like
their sugar fix too. Sugarcane is a feast for numerous pests, including rats, solider flies and
worms. One of the worst pests of sugarcane crops are the native canegrubs, including the
greyback cane beetle. Canegrubs cause extensive crop damage by chewing off the roots,
which stunts plant growth and results in reduced sugar yields.
Australian sugarcane growers have five insecticides (four synthetic and one natural)
and a range of agricultural practices that allow them to control canegrubs. Recently, one of the
most commonly used synthetic insecticides has failed (due to the canegrubs developing
resistance) which means new ways to control them are needed. With the proximity of
Australian sugarcane fields to the Great Barrier Reef, the sugarcane industry has been put
under a lot of pressure to reduce the use of synthetic chemicals that might run off into the
ocean damaging the reef's ecosystem.
Researchers at the Cooperative Research Centre for Sugar Industry Innovation through
Biotechnology (CRC SIIB) are looking at other options for controlling the canegrub to try and
minimize the environmental impact. They are developing four new strategies for combating
canegrubs:
o New insecticides: Together with the CRC SIIB, Australian Institute of Marine Science
researchers are exploring their vast collection of marine organisms in search of a new
form of insecticide that affects special chemical detectors, found only in insects. These
products will not affect mammals (including humans).
70
Dr. Fahd M. Nasr
o Insect resistant plants: Several compounds have been identified that retard the
development of canegrubs. New sugarcane varieties that are grub-resistant are
currently being developed with the hope to release them to cane growers in the future.
o Improved Metarhizium (a natural insecticide) production: research is focusing on
economical and reliable delivery of the biocontrol agent Metarhizium to cane growers.
o Identification and development of new biocontrol agents: Bacterial diseases of
canegrubs have been identified as key factors affecting the survival of grubs in
Queensland. Researchers are further investigating these bacterial diseases as possible
canegrub biocontrol agents.
III.1.5. Mice: a case study

When the first Europeans arrived in Australia with the First Fleet, so did the house
mouse (Mus domesticus). In the south-eastern Australian grain belt which stretches from the
South Australia-Victoria border to the Darling Downs in southeast Queensland, mouse
population levels are normally quite low. However, favorable seasonal conditions can trigger
extensive breeding. Mouse plagues now erupt in these regions on average every three years
with an estimated 100,000 to 500,000 hectares of grain crops affected each year.
Mouse breeding facts
 Mice breed in the Southern Hemisphere from August to May
 Mice commence breeding from six to eight weeks of age
 A mouse is pregnant for 19 days and re-mates 1-3 days after giving birth
 A mouse normally gives birth to a litter of five to six young, but it can be as high as
nine to ten during the lead up to a plague
 One breeding pair of mice and their offspring has the potential to produce 500 mice in
just 21 weeks
 During a typical plague in southern Australia, mouse densities of 1000 per hectare are
common
These plagues cause massive disruption to communities and losses to farmers in

Australia of around $36 million annually in lost agricultural production and control. Mouse
plagues don’t just cause economic problems either. Swarms of mice invade households,
hospitals, livestock pens, food storage and other facilities, causing significant damage to
infrastructure. They consume large quantities of grain and contaminate grain shipments with
their faeces. They pose a major threat to health and welfare, inflicting stress on humans and
livestock.
71
Dr. Fahd M. Nasr
Traditional controls
Mice have traditionally been controlled using trapping and powerful poisons. However,
these can only provide limited control and the poisons can also kill dogs and cats, as well as
native predatory animals that eat poisoned mice.
Biotechnology controls
Biotechnology is being used to develop a new approach to controlling mice through
limiting their reproduction. The process is called immunocontraception and it involves fooling
the body into thinking that certain proteins found on mouse egg cells are foreign. The body's
immune system produces antibodies that bind on to these proteins, preventing pregnancy.
Researchers at the Pest Animal Control Cooperative Research Centre (PAC CRC), CSIRO and
the University of Western Australia, have genetically modified a virus that occurs naturally in
mouse populations – mouse cytomegalovirus (MCMV). Scientists added a modified gene to the
virus, which causes it to make an altered form of a protein called ZP3. In its natural form, ZP3
is a component of a jelly-like material called the zona pellucida that surrounds the eggs of all
mammal species. To fertilize an egg, a sperm must first pass through the zona pellucida, but
first certain proteins on the sperm’s surface must match up with complementary proteins on the
surface of the egg.
The mouse’s immune system normally sees ZP3 as ‘self’, but mouse cells infected by the
transgenic MCMV produce a modified form of ZP3, which the immune system sees as ‘non-
self’ and attacks. Without functioning ZP3 proteins on the egg surface, fertilization cannot
occur. Researchers have tested the transgenic MCMV on laboratory mice and captive wild
mice. Results showed that all female mice infected with a large dose of the virus became
infertile, with the infertility lasting for up to six months in most mice. MCMV naturally infects
only the introduced house mouse, and all tests so far confirm that the modified virus does not
affect native species or introduced rats. Every mammal species has its own version of the ZP3
protein and so the virus is programmed to target only the house mouse ZP3 protein. This
technique carries further insurance against the remote possibility that the contraceptive virus
might infect another mammal species. PAC CRC researchers are also investigating whether a
non-infectious oral contraceptive can be developed for use in grain baits to produce an identical
immune response in female mice. Unlike poisoned grain, the grain 'Pill' would have to be
harmless to other mammals and birds. Although there are clear benefits in preventing mouse
plague by immunocontraception using GM viruses, biosafety needs to be taken very seriously.
All research involving modified viruses is conducted in secure containment laboratories in
accordance with regulations set by the Office of the Gene Technology Regulator. Rigorous
safety testing and extensive community consultation would precede any decision to release a
genetically modified MCMV in the Australian environment.
72
Dr. Fahd M. Nasr
III.2. Protecting threatened species

All of the efforts to control pests mentioned in this section aim to restore some balance
to our environment. In Australia we have many plants and animals that are unique. However,
largely because of changes made in our ecosystems since European settlement, many of these
species have already disappeared and many more are in danger of extinction. Changing our
natural ecosystems for use in farming, recreation, industry or housing means that the habitats
of many species are changed or destroyed. Many of the species introduced into Australia not
only prey on native animals and plants, but also compete with native animals for food, shelter,
and territory, or destroy the habitat of native plants. The best method of protecting threatened
animals or plants is to conserve their habitat and to control introduced invasive species.
Breeding programs carried out in zoos and botanical gardens can preserve populations of
animals and plants that are genetically varied. Some of the organisms bred in this way may
even be reintroduced to areas where the populations have disappeared. The release of an
endangered marsupial, the Chudditch (Western Quoll), in Western Australia is an example of
such a successful program.
III.2.1. The Frozen Ark

Many recovery programs for threatened species have considered the use of cloning
and some have already taken steps to freeze tissue samples from a wide range of individuals
to create a gene bank for the species as a first step to conserve the genetic diversity of these
dwindling populations. This step is an attempt to provide an insurance against future
catastrophes that would further reduce those critically threatened populations. In most cases
there is no intention yet to attempt cloning. The Frozen Ark 41 is the world's first DNA bank to
preserve threatened animals in an attempt to preserve their genetic material for future
scientific research. The Frozen Ark is collecting DNA samples from all kinds of species and
freezing them at minus 80 degrees Celsius. Priority is given to species most in danger of
extinction and the first seriously threatened animals to enter the Frozen Ark will be the
Yellow seahorse, Scimitar horned oryx, Socorro dove and Polynesian tree snails.
Frozen Ark, the world's first DNA bank to preserve endangered animals is launched.
 The Frozen Ark will collect, preserve and store DNA and tissue samples from animals in danger
of extinction
 It will be the world's first DNA bank dedicated to all the world's endangered animals
 It will be a global reference collection for research and conservation
Extinctions
Within the next 30 years 1,130 species (24%) of mammals and 1,183 species (12%) of birds are expected
to disappear, along with their genetic material and any chance of future scientific research on them.
Priority species
This new project will collect DNA samples from all kinds of species and freeze them at minus 80°c.
Priority will be given to species most in danger of extinction and the first seriously endangered animals
to enter the Frozen Ark will be the Yellow seahorse, Scimitar horned oryx, Socorro dove and Polynesian
tree snails. ‘Natural catastrophes apart, the current rate of animal loss is the greatest in the history of the
Earth and the fate of animal species is desperate’, said Prof Phil Rainbow, Keeper of Zoology at the
Natural History Museum. ‘Progress in molecular biology has been so fast that we cannot predict what
extraordinary things may be possible in the next few decades. For future biologists and conservationists
and for the animals they seek to protect this global network will be of immeasurable value.’ The Frozen
Ark is supported by the Natural History Museum, the Zoological Society of London and the Institute of
Genetics at the University of Nottingham , and will have duplicate specimens located in other institutions
across the world as an insurance against damage or loss.
41
The Frozen Ark is supported by the Natural History Museum UK, the Zoological Society of London and the
Institute of Genetics at the University of Nottingham, UK and has links with institutions around the world.
73
Dr. Fahd M. Nasr
Wombat goes onboard the Ark

In Australia, the first project for the Frozen Ark has been the northern hairy-nosed wombat, a
strong, well-built marsupial weighing up to 40 kilograms and measuring more than one meter
long. Although it looks slow and clumsy, it can move at up to 40 km/hour over short distances.
By the late 1960s, the only remaining population of the great northern hairy-nosed wombat was
found in 16 square kilometers in Epping Forest in central Queensland. This is still the only
known population, now contained within an area of only three square kilometers. It is estimated
that about 113 animals are left and it is feared that if a fire went through the forest, they would
become extinct overnight. Researchers have frozen 40 cells from 40 animals and are now
looking at the reproductive biology of the common wombat and wondering if they could
perhaps clone tissue from the great northern hairy-nosed wombat to eventually, over three or
four generations, produce the threatened animal.
This is a procedure which has already been carried out in America where they have implanted
cells from an extinct cow species (gaur) into a common cow to produce a gaur calf. This was a
difficult and costly process and the calf did not survive, highlighting that there is no guarantee
of success. Many conservationists are concerned that cloning may be seen as the easy way out
compared with attempting to solve the problems caused by increasing human populations and
the destruction of native plant and animal habitats. Others point out that there is no point
cloning native species if there is no habitat to return them into. Most acknowledge that this
method does not mean we replace our need to maintain habitats and places for our biodiversity
but it can be seen as a supportive measure. More generally, the collection of the genetic
material forms a knowledge store, the benefits of which are yet to be seen.
III.2.2. Seed banks

In 2004, scientists at the University of Queensland announced their inclusion in the
Millennium Seed Bank Project, a UK initiative which aims to collect the seeds of 24,000
native plant species worldwide – 10 per cent of the world’s flora – over the next six years.
There are many reasons for making such a collection:
 to build up stocks of rare and threatened species to ensure they do not become extinct,
 to preserve local stocks of seeds which are well-adapted to Queensland conditions,
 to research the seed biology to see how they may help address current environmental
problems, and
 to try to identify the optimum time for collecting high quality seed, the best post-
harvest handling and storage practices, germination protocols and dormancy-breaking
techniques so that they can be quickly employed to rejuvenate mine sites, assist
floriculture and help with forest and other ecological restoration projects in less than
ideal conditions.
74
Dr. Fahd M. Nasr
The Millennium Seed Bank Project (MSBP)

The MSBP is the largest ex situ conservation project ever conceived. Its partners will have
banked seed from 10% of the world's wild plant species by the end of the decade. These will
not be just any plants, but will include the rarest, most threatened and most useful species
known to man. The MSB and its partner seed banks are not mausoleums - the seed they contain
remains alive for decades and, in many cases, hundreds of years. More importantly, that seed is
being used now to provide a wide range of benefits to mankind, ranging from food and building
materials for rural communities to disease-resistant crops for agriculture. The collections held
in the MSB, and the knowledge we are deriving from them, gives us almost infinite options for
their conservation and use. With future climate change scenarios and the ever-increasing impact
of human activities, the MSBP is already looking towards the next 10%.
Why save seeds ?

All life on earth depends on plants. Plants are the basis of ecosystems in which all animals,
including humans, live, survive and grow. By saving seeds we can save plants. Despite our
reliance on plants, we are at a crisis point. It is thought that 60,000 to 100,000 plant species are
under threat. Direct threats to plant survival are climate change, habitat loss, invasive alien
species, and over exploitation. The root causes of these threats are difficult to control and
include human population growth and socio-economic factors. Seed banks provide an insurance
policy against the extinction of plants in the wild and provide options for their future use. They
complement in situ conservation methods which conserve plants and animals directly in the
wild. The Millennium Seed Bank already holds seeds from plants thought to be extinct in the
wild. In addition, seed banks provide a controlled source of plant material for research, provide
skills and knowledge that support wider plant conservation aims, and contribute to education
and public awareness about plant conservation.
What We Do
The Millennium Seed Bank Project seeks to develop a global seed conservation network,
capable of safeguarding wild plant species. This will make direct contributions to national and
global conservation/development programs, and will make a big contribution to meeting the
objectives of the Convention on Biological Diversity (CBD). The current project runs until
2010 and the key objectives are:
 To collect seeds, herbarium specimens and data from 24,200 species worldwide,
including the entire UK seed bearing flora, and to conserve these collections to
international standards, both at the Millennium Seed Bank and in the countries of
origin;
 To establish and develop partnerships to meet these conservation objectives;
 To make seeds available for conservation in the wild and for research;
 To carry out research to improve all aspects of seed conservation;
 To facilitate access to information and transfer of best practice in seed banking to all
project partners, and the wider scientific community, and
 To increase public awareness of the need for plant conservation.
75
Dr. Fahd M. Nasr
Where the MSBP works

The Millennium Seed Bank Project is based on partnerships and collaborations with other
organizations around the world. At the core of the main project are 'partnership projects' in
many countries. These vary in their structure and scope but all aim to collect and conserve
seeds from dryland plant species and to strengthen in-country capacity for seed banking. In
addition to the seed collecting activities, the MSBP partnerships include research and training
and other capacity-building elements. Partnerships may focus their activities to support
conservation or development objectives relevant to their country. In this way the partnerships
are helping their countries to implement international objectives such as the Global Strategy for
Plant Conservation and the Millennium Development Goals. In all cases seed collections are
kept in the country of origin, in partner seed banks, and duplicates are brought to the
Millennium Seed Bank in the UK. Each project is based on a legally binding Access and
Benefit Sharing Agreement.
III.2.3. The Bilby: a case study

Bilbies have long pointed snouts, small compact bodies, large ears, long silky fur and
long tails. They are remarkable burrowers, using their strong forelimbs and claws to dig
extensive tunnels. One Bilby may make up to twelve burrows within its home range to use for
shelter. They are active at night, sheltering in their burrows during the daytime. They have
long slender tongues to eat a specialized diet of seeds, insects, bulbs, fruit and fungi. Bilbies
breed throughout the year and the females usually have two young in their pouch at any time.
Bilbies stay in the pouch for about 80 days after they are born and continue to be suckled by
the mother for another two weeks after they become too big for the pouch.
Where are they found?
The Bilby is unique to Australia. A hundred years ago, Bilbies were common in many places
throughout Australia. Changes to the habitat of the Bilby have seen Bilby numbers greatly
reduced and today they only found in small populations in the Tanami Desert of the Northern
Territory; in the Gibson and Great Sandy Deserts and the Pilbara and Kimberley regions of
Western Australia; and the Mitchell Grasslands of southwest Queensland.
What are the threats?

Scientists generally agree that predation by introduced foxes and cats, changes to their habitat
caused by farming and land clearing, competition from cattle and sheep for the same plants,
rabbits competing with bilbies for their food and burrows and changes in fire regimes (both
Aboriginal and European) have all combined to reduce Bilby populations.
What is happening?
The Bilby is now protected throughout Australia where it occurs. A national Recovery Plan is
being developed to ensure the survival of the Bilby. Key actions include: (i) managing the
remaining habitat of the Bilby; (ii) breeding in captivity; (iii) monitoring existing populations;
and (iv) re-establishing bilbies in areas where they previously occurred. The ‘Save the Bilby’
project, based in Charleville in Queensland is one example of a number of protection and
recovery programs. The Charleville group's plan includes the building of a predator-proof
enclosure surrounding part of a national park and the reintroduction of bilbies into far western
76
Dr. Fahd M. Nasr
Queensland. Other activities are recorded throughout Australia. Restoration of the Bilby
population would offer some measure to show that our efforts to reduce the impact of
introduced species and past farming practices has had some success.
III.2.4. Wollemi pine

If you visit many of the Botanic Gardens in Australia, you will find an unassuming
conifer housed in a strong steel cage. It is only when you read the words on the plaque nearby
that you realize the tree’s significance, for you are looking at a Wollemi pine.
A dinosaur plant42
When it was discovered in 1994, Professor Carrick Chambers of the Royal Botanic
Gardens, Sydney said, “The discovery of the Wollemi Pine is the equivalent of finding a
small dinosaur on Earth.” The Wollemi pine (Wollemia nobilis, Family Araucariaceae) is one
of the world's oldest and rarest trees. Its relatives are the Kauri, Norfolk Island, Hoop, Bunya
and Monkey Puzzle pines. The tree was discovered by David Noble, a NSW National Parks
and Wildlife Officer and avid bushwalker, in a rainforest gorge within the 500,000 hectare
Wollemi National Park in the Blue Mountains, 200 kilometers west of Sydney. Fossil
evidence of this tree dates back 90 million years. As there are also fossil records of dinosaurs
in Australia at that time (before they became extinct globally around 65 million years ago)
paleontologists say the pine may well have provided food for dinosaurs. This conifer has
attractive, unusual dark green foliage, bubbly bark and sprouts multiple trunks. It is fast
growing in light and favors acid soils and temperatures from -5-45°C. The largest wild
Wollemi Pine in the rainforest gorge is 40m tall with a main trunk 1.2m wide. The wild
population is less than 100 mature trees.
There are a number of threats to the trees’ survival in the wild such as inadvertent
wildfires, the introduction of weeds and plant disease. The greatest threat is humans and it is
well known that once any species is labeled as rare and exotic, people want to see them and
some will even pay a great deal to own them. The exact location of the Wollemi Pines in the
wild is a secret. There is also a Recovery Plan in place which monitors the site to guard
against unwanted visits and illegal removal. In anticipation of demand for the plants, the Pine
is being cultivated to be released worldwide from late 2005. Soon, Wollemi Pines will be
available at selected garden centers with royalties funding the conservation of other rare and
threatened species.
III.3. Resurrecting extinct species

The movie Jurassic Park provided the fantasy, and Dolly the sheep gave us the reality
when, after over 200 attempts, a new individual was cloned using the nucleus of an udder cell.
Since Dolly, mice, cattle and many other animals have also been successfully cloned. What
about those species which have already become extinct? Specimens of these animals (and
their DNA) can sometimes be found in alcohol-filled preserving bottles in the store rooms of
museums. Is cloning likely to help resurrect these species? Cloning is presently very
inefficient. Even in the Hawaiian laboratory of Professor Ryuzo Yanagimachi where the best
results have been achieved so far, only 3% of cloned mice embryos survive to birth. This
laboratory has the best possible conditions for mouse cloning and all the relevant knowledge
42
Since its discovery in 1994, conservationists, horticulturalists and ecologists have developed a range of
measures to protect the lone and threatened wild population of Wollemi Pines near Sydney's Blue Mountains as
well as preserve its genetic stock. The Wollemi Pine is protected by the New South Wales (NSW) Threatened
Species Conservation Act 1995. It is listed as endangered at a national level under the Environmental Protection
and Biodiversity Conservation Act 1999 and is on the directory of Rare or Threatened Australian Plants
(RoTAP). As of December 2000, the Wollemi National Park (where the Wollemi Pines are located) was added to
the World Heritage list as part of the Greater Blue Mountains Area.
77
Dr. Fahd M. Nasr
available on the timing of reproduction. In addition, many females can be treated to receive
the embryos at the appropriate time in their reproductive cycle. The laboratory of Professor
Yanagimachi now has a population of only about 80 mice which have been cloned using
nuclei from tissues including nerves, tail tips and the diffuse cloud of cells which surround
recently ovulated eggs. Extracting DNA from an insect trapped in amber, as in Jurassic Park,
is a very long way from making a real dinosaur. Despite successful efforts to date in
extracting bacteria from insects preserved in amber, it is still only speculation that we could
ever extract DNA from the blood sucked by mosquitoes from dinosaurs millions of years ago.
There are still big leaps of technology and skill required before creating a dinosaur could be
contemplated.
III.3.1. The thylacine: a case study

Despite successes in cloning mice and a small number of other currently living
species, the possibility of successfully cloning an individual from the frozen remains of a
woolly mammoth recently discovered in the Siberian permafrost or a 100-year-old alcohol-
preserved thylacine (Tasmanian Tiger) seems remote.
'Thylacine, This image is of a juvenile male at Hobart Zoo taken by B Sheppard in 1928. The animal died
the day after it was photographed.
For both these specimens it would be relatively easy to reach the first stage of the
process - extracting DNA samples from the preserved tissue. From there the going gets
tougher, even though the starting materials are far better than those available for the dinosaur
cloning seen in Jurassic Park. In 1999 DNA was successfully extracted from an ethanol
preserved Tasmanian Tiger pup sample. In 2001 additional DNA was extracted from two
other pups using tissue from bone, tooth, bone marrow and dried muscle.
As recently as 2002, the Evolutionary Biology Unit at the Australian Museum in
Sydney successfully replicated individual Tasmanian Tiger genes using a process known as
PCR. These PCRs replicated short fragments of the DNA which were undamaged and
undoubtedly of Tasmanian Tiger origin, which could possibly be functional if introduced into
a living animal cell. The next stage would have been to use PCR to make copies of all the
genes of the Tasmanian Tiger, so these can be used to construct synthetic chromosomes.
However in early 2005, the researchers announced that the project will be abandoned, as the
DNA was found to be too degraded (fragmented) to work with effectively. Producing viable
embryos would be too difficult - perhaps even impossible – using the DNA preserved through
freezing or in alcohol, as it is often damaged. Given the low efficiency of mouse cloning
experiments where intact nuclei from living cells were used as the source of DNA for cloning,
the likelihood of being able to clone an animal from a preserved specimen is extremely low
78
Dr. Fahd M. Nasr
with current technology. Even if the difficulties with the technology were overcome, unless
new genes could be artificially introduced into DNA from a thylacine in a museum, the only
individuals produced from this alcohol-preserved specimen would all have exactly the same
genetic make-up and would be the same sex. All science is carried out in a social and
economic context. A group of individuals like this could not make up a viable population. The
idea of a lone and lonely mammoth or thylacine in a zoo or wildlife park is of concern to
wildlife managers and to the community.
III.4. Cleaning up and managing the environment

Bioremediation is cleaning up the environment using living organisms. Naturally
occurring, as well as recombinant (genetically modified), micro-organisms such as bacteria
and fungi, and enzymes are used to break down toxic and hazardous substances present in the
environment because of some human activity. Huge numbers of bacteria exist naturally in
soil, in rubbish, in recycling and land fill sites. Some of these bacteria slowly break down the
many different types of waste. Some bacteria use oil as a source of nutrients just as we use
food, and these bacteria can be used to break down oil spills at sea or on the shore.
Biological treatment to solve waste or hazardous chemical problems is not a new idea.
What is new is the greatly increased range of treatments that may be possible using
biotechnology. Biotechnologists can use gene technology to recombine, or mix and match, the
most desirable traits of several bacterial species to create recombinant (genetically
engineered) varieties. In the future they could, perhaps, extract a gene from one strain that
allows it to break down some specific hazardous waste and the gene from another that allows
it to withstand wide temperature ranges, lack of oxygen or other environmental extremes.
These genes could then be transferred into a common, harmless bacterium that can be easily
mass produced. The ideal result would be a bacterium custom-made to clean up a specific
problem waste at a particular site under defined conditions.
III.4.1. Removing the excess

Starting at home
Do you have a compost heap at home where you leave all your food and plant scraps?
Bacteria love to eat these scraps, breaking them down into compost which can be used on the
garden. Another area we use garbage-loving bacteria is in sewage treatment plants. In almost
every city raw sewage is treated in processing plants. First, the solids are separated from the
liquids and washed, dried and disposed of. Grit and sand are also removed. The liquid goes
into a settling tank where most of the remaining solid material sinks to the bottom, this is
called sludge. Then the bugs and bacteria are called in to do their job.
Naturally occurring micro-organisms are used to break down the organic material and
purify the liquid. They can work in two ways. Either they can be encouraged to grow on
stones over which the sewage is trickled (the micro-organisms feed on the sewage and purify
the water) or the process can be sped up using aeration tanks: air is blown into tanks of
sewage where the micro-organisms are suspended and feed on the waste. The waste water is
settled and sometimes given a final treatment using sand filters, reed beds or grass plots.
Some sewage treatment plants also disinfect using ultraviolet light to kill bacteria.
Removing nutrients from waste water
Toxic blue-green algal blooms and red tides are responsible for millions of dollars
worth of stock losses each year in Australia. Run-off from farms and from livestock areas
causes a lot of minerals and organic nutrients such as phosphorus and nitrogen to collect in
rivers and lakes. This causes algae to proliferate which can quickly use up a lot of the
dissolved oxygen in the water, killing other organisms in the water. This is called
79
Dr. Fahd M. Nasr
eutrophication and is a well-recognized environmental problem both in Australia and

worldwide. To combat this, there are tough standards on nutrient discharge and industries are
researching biological nutrient removal (BNR) systems to treat their wastewater before
discharging it into rivers. Biological treatment is by far the cheapest and most
environmentally friendly way of removing nutrients from waste water. Existing methods
involve micro-organisms that work together to take out nutrients from the water. However,
they are not regarded as being reliable enough to do away with the use of chemicals
altogether. As an example, removing high levels of phosphorus from wastewater requires
expensive chemicals, and a large quantity of them. Furthermore, additional (chemical) waste
sludge is generated in the process. Scientists are working on ways to use micro-organisms
grown in the lab to achieve good nutrient removal from waste water containing high
concentrations of nutrients.
Reducing nitrogen use in sugarcane farming
Australian cane growers spend in excess of $80 million on nitrogen fertilizer each
year. After heavy rains, fertilizers get washed into river systems and nitrogen fertilizer in
particular is considered a major threat to surrounding ecosystems. Much of Australia’s
sugarcane is grown along coastal regions which border the Great Barrier Reef and World
Heritage rainforests which are environmentally sensitive. Researchers at the Cooperative
Research Centre for Sugar Industry Innovation through Biotechnology (CRC SIIB) are
examining ways to reduce nitrogen application in sugarcane fields without reducing
productivity. Compared with other sugarcane cropping systems around the world, Australian
sugarcane production uses a high level of applied nitrogen (N) fertilizer. Some growers decide
to exceed industry recommendations for N application in the hope of improving crop
performance. Researchers are in the process of identifying traits in Australian and overseas
cane varieties, and in ancestral species, that make sugarcane use N more efficiently.
Researchers are aiming to work out which traits are required for efficient N use in sugarcane
in order to enhance the sustainability of the Australian sugarcane industry.
Stopping burping sheep reduces methane
Australian scientists are currently tackling the problem of burping sheep. One-fifth of
the world's methane emissions come from farm animals belching, farting and exhaling.
Methane-producing microbes, or methanogens, are opportunistic organisms that live in the
sheep’s gut and provide no benefit to the animals, and the animals are released into the air
through burping. For the past few years, researchers have been developing an anti-
methanogen vaccine. As well as reducing methane emissions into the atmosphere, they hope
the vaccine will return some lost energy back to the animal. In a recent trial, Queensland
sheep immunized against methane-producing microbes in their rumen produced almost 8%
less methane than those that weren't immunized. The researchers found, however, that there
are many different types of methanogens living in sheep stomachs and these vary according to
where in the country the sheep live. They are now aiming to produce a second vaccine which
will target different methanogens.
III.4.2. Removing the hazardous

Treating petroleum sludge and oil spills: a case study
An oil spill or oil in waste discharged into the sea from refineries, factories or
shipping, contains poisonous compounds that are a danger to all the plant and animal wildlife
in the area. These poisons can pass into the food chain and may eventually be eaten by
humans. There are several approaches to cleaning up oil spills: treating with chemicals, using
physical barriers to contain the oil and pumping the collected oil away from the site into
storage tanks. A natural process occurs very slowly in which bacteria and other micro-
80
Dr. Fahd M. Nasr
organisms in the environment break down oil into harmless small molecules. This process is
called bioremediation and can be sped up by:
 adding nutrients to the water in the area of the spill. This ensures that the naturally
occurring bacteria in the ocean are provided with increased nutrients and therefore
increase their rate of reproduction and therefore also increase the rate of oil
breakdown.
 adding bacteria known to digest oil to the water in the area of a spill.
Researchers are also working to genetically engineer effective oil-digesting bacteria
that are well suited to the environmental conditions of the ocean. They could be used to speed
up the bioremediation process even more at the time of any future oil spill disaster.
Oil-eating bacteria
After the Exxon Valdez oil tanker crashed off the shore of Alaska in 1989, spilling its
contents all over the area, one of the biggest contributors to cleaning up the environment was
a bacterium known as Pseudomonas. Scientists found that by enriching the contaminated area
with oxygen and waste water, the bacteria present there were provided with the nutrients
needed to flourish, thereby encouraging the breakdown of the hydrocarbons within the oil.
Cleaning up arsenic
By adding genes to common weeds, scientists have created a new tool for cleaning up
arsenic in the soil. Although very small doses of arsenic and other heavy metals are essential
for good health, high levels are toxic to animals and humans. The researchers added two
bacterial genes to the weed Arabidopsis thaliana. The first bacterial gene helps convert arsenic
from soil to a form that can be 'sucked up' and stored. The second gene helps the plant
detoxify heavy metals and accumulate the molecules in its leaves. The use of plants to clean
the earth is called phytoremediation. Plants are cheap and use solar power! Researchers are
now experimenting on using larger plants to make the process more practical by taking up
more of the arsenic.
Land mines
Land mines are explosives usually laid just below the surface of the ground and are
triggered when someone steps onto them. They cause terrible injuries, often to innocent
people farming land which used to be old battlefields where the mines had been laid.
Researchers have been working on genetically engineering plants which could detect
explosives housed in a land mine, and then fluoresce and highlight the presence of a land
mine. This was successfully trialed in 1999, but it has limitations and some environmental
concerns. Whether or not it is successful, the trial highlights that new science and
technologies can be applied to a wide variety of problems.
Get that barnacle off my boat!
Anything that is left in the sea for a while will start to become colonized with marine
life. The colonization of submerged surfaces by living organisms is called marine biofouling
and is commonly seen as barnacles attached to the hulls of ships. Biological fouling can occur
on a range of surfaces, from ship hulls to the walls of houses and the interior of water pipes. It
results in increased fuel consumption, corrosion, breakdown of materials and buildings, the
transport of introduced pests and many other problems worldwide. Biofouling also harbors
pathogens, or disease-carrying bacteria. The major focus of fouling and antifouling
technologies has been in the marine shipping industry, where fouling is estimated to cost
more than $5 billion per year. Other than repeated cleaning of surfaces, by far the most
common commercial approach to fouling control is to coat surfaces with antifouling paints
that contain heavy metals (copper or tin). The main problems with these coatings are the
environmental effects of the heavy metals they release. The most commonly used paints in the
marine environment for the past 30 years, tributyltin-based coatings, are in the process of
being banned by the International Maritime Organization.
81
Dr. Fahd M. Nasr
Copper-based paints are also banned in some parts of Europe. House paints also
typically contain toxic antibacterial or antifungal compounds to inhibit microbial fouling.
Australian scientists are working to develop novel approaches to the control of unwanted
biofouling and corrosion on submerged surfaces and building walls using biotechnology.
These approaches are based on the incorporation of metabolically active bacteria (living
paints) or enzymes into coatings. This technology can also be used to incorporate bacteria into
a ‘biocement’ which inhibits fouling. The bacteria in the paint will release natural products
(enzymes) that prevent the organisms that cause fouling from adhering to the surface.
Enzymes are capable of catalyzing the reaction to degrade any attaching organisms or fouling
species.
Biomining
Scientists are now using bacteria such as Thiobacillus ferroxidans to leach copper
from mine wastes. Using the bacteria to extract the metal has improved recovery rates and
reduced operating costs. It has also allowed extraction from low grade ores. Currently 25% of
all copper worldwide is produced through bioprocessing. Bioprocessing is also being used to
economically extract gold from very low grade, sulphidic gold ores, once thought to be
worthless.
Nuclear site cleanup
A new variety of microbe capable of eating waste materials at nuclear sites and
rendering them less harmful has been developed by scientists in the United States. The
modified microbe, based on Deinococcus radiodurans, can dispose of the toxic heavy metals
and organic chemicals commonly found at weapons production sites where normal bacteria
cannot survive.
III.5. Researching new products

In a world that relies heavily on non-renewable fossil fuel to power industry, scientists
are searching for more environmentally sound alternatives. And one solution could come from
plants. CSIRO scientists have identified two genes from wild plants, which when introduced
into oil seed plants, like linseed, could see those plants producing oil for industry.
Biofuels
Biofuels are designed to be used in place of existing petroleum-based fuels. The main sources
of biofuels are vegetable oils or animal fats. Although diesel engines can operate on straight
vegetable oil as a fuel, biodiesel is cleaner-burning and slightly more efficient. Scientists are
also looking at using other sources for environmentally friendly ways to run cars. For
example, Brazil has experimented with plant-based fuels since the 1970s, when the country
switched its fuel supply to a cheaper home grown product: sugar cane ethanol. At one point,
91% of cars driven in Brazil were running on biofuels. Scientists have also harnessed a group
of naturally occurring bacteria to generate electricity from organic material in mud, whilst
genetically modified giant artichokes are being grown in Spain to produce electricity!
Biodegradable plastics
Did you know that a Melbourne company has developed a biodegradable plastic that
dissolves in water? The plastic is made from corn and with moisture breaks down to water
and carbon dioxide.
Superglue
Did you know that researchers are using mussels to make a superglue? Researchers have
discovered that the key binding agent in the super-strong glues of the common blue mussel,
Mytilus edulis, is iron in seawater. In addition to using the knowledge to develop safer
alternatives for surgical and household glues, the researchers are looking at how to combat the
glue to prevent damage to shipping vessels and the accidental transport of invasive species.
82
Dr. Fahd M. Nasr
The 800 mussels in their laboratory apparently have an uncanny ability to stick to almost
anything, even Teflon®.
Sunscreen lotion
Heat-loving bacteria from the bottom of the ocean are being used to develop a hi-tech
sunscreen. A French cosmetics firm has developed a ‘smart’ sun lotion using bacteria
harvested from deep-sea hydrothermal vents. As a result, the lotion gives increased skin
protection as the temperature rises.
III.5.1. Sugarcane as a biofactory

Sugarcane is a robust and easy-to-grow plant that produces high yields of valuable
products including sucrose (sugar), fiber and waxes. Of all field crops, sugarcane is the most
efficient at converting sunlight and water into plant fiber, making it an ideal biofactory. For
this reason, Australian researchers are working towards producing new sugarcane varieties
that convert excess carbon such as sucrose into other products.
Sugar to replace petroleum
These new carbon building blocks could form the basis of many manufacturing processes and
remove the waste and pollution that result from other manufacturing materials, such as
petroleum. The researchers are aiming to increase the plant’s ability to produce sucrose. This
will allow sugarcane to be used in place of non-renewable resources as an ingredient in
products such as biodegradable plastics and fuels. The possibilities for future uses of
sugarcane are quite exciting. Some scientists have branded sugarcane ‘the oil fields of the
future’.
Sugar by-products for medicine?
In addition to raw sugar, sugarcane produces several other products. Many of these products
are derived from the bagasse or leftover fiber after milling, either in the form of fibrous
material (pulp, paper), chemicals (furfural) or through utilization as a fuel (electricity). Other
products are also available from molasses (cane juice), typically after fermentation, including
rum, ethanol, acetic acid and glycerol. All of these products and processes have been around
for many years. CRC SIIB researchers are studying these extracts from the sugarcane plant
and milling process to seek out potential compounds that may have antioxidant, anti-
inflammatory, anti-cancer or estrogenic activity. While sugar consumption worldwide is high,
Australia competes in the marketplace with countries with lower production costs. For the
industry to survive, it needs to pursue research such as this, aimed at diversifying its products
and finding new markets for them. New technologies always have the potential to transform
industries. Instead of competing with other sugar producers in the future, our sugar industry
might be competing with oil companies.
III.6. Ethics of research involving the environment

Gene technology makes it possible for humans to alter living organisms such as plants,
animals, and bacteria to cater for human needs and wants. Such needs could include increased
crop yields, bigger, leaner, disease-free animals and new drugs or vaccines. Some
biotechnologies are also used for purposes such as veterinary medicine. Genetically modified
organisms (GMOs) can even benefit the environment by cleaning up waste material or
converting oil spills into non-toxic compounds (bioremediation). Although many scientists
and agriculture companies argue that genetically modified crops require less pesticide and
herbicide than other plants, there is still a great deal of debate about the environmental safety
and value of GMOs.
For example, organizations such as the Australian Gene Ethics Network, are
concerned about the following issues with regard to genetic engineering:
83
Dr. Fahd M. Nasr
 Consumer rights and the labeling of GM products

 The ethics of patenting genes and living organisms
 Who benefits from collecting genes from plants, animals, bacteria or even people?
 Eugenics - the idea that humans can be made perfect
 Human rights
 Animal rights and welfare
 The control of genetic engineering
 Environmental impacts of new organisms
Other examples of concerns about GMOs in the environment include:
 Do we know if they are safe?
 Can they be harmful to humans, animals, or plants?
 Are there other, more environmentally responsible, ways of producing the effects of
genetic modification?
 Do GMOs have advantages over natural organisms and farming methods?
 Can GMOs independently survive in nature and disturb ecosystems?
 Can GMOs transfer genetic material to other organisms?
 Are we causing harm to animals or plants by genetically modifying them?
The subject of environmental ethics also raises questions about genetic modification for
human or environmental benefit.
 Do humans have the right to alter the genetic structure of animals and plants?
 How do humans see the environment and their connections to it?
 What sort of connections should humans have with other species and the
environment?
 Do humans have a responsibility to protect other species and the environment?
 Does genetic modification cause suffering for animals or the ecosystem?
 How might releasing GMOs affect the environment in the future?
III.7. Ways of seeing the environment

There are a number of ways of seeing the environment that require different
responsibilities and actions on the part of humans (see below). Although each point of view
supports environmental responsibility in one form or another, the reasons they provide for
being environmentally responsible are very different.
Anthropocentric (human-centered)
Anthropocentrism is the view that we should only protect and replenish the environment, so
that it serves human purposes (such as producing food, drugs etc.). The idea here is that
human beings are morally significant and valued, but animals and plants are not.
Eco-centric (environment-centered)
This approach assumes that the environment deserves direct consideration, and not one that is
just derived from human (and animal) interests. It states that all elements of the environment
have worth, just like humans, and so should be valued and cared for.
Environmental Stewardship
This is a view that suggests that humans have a duty to manage and care for the whole natural
environment. We are responsible for the continued health of the whole ecosystem, not just the
parts that benefit the human race.
Sustainable Development
An approach that seeks to ensure that current development does not alter the environment's
ability to recover from any damage sustained, and which also makes extensive use of
renewable resources.
84
Dr. Fahd M. Nasr
Precautionary principle
When having to make a decision about actions, a cautious approach – or a precautionary
approach – is one that acts to avoid serious or irreversible potential harm even when it is not
certain what the likelihood of the harm occurring is, the degree of harm or what causes the
harm. The ‘precautionary principle’ or ‘precautionary approach’ is a response to uncertainty
when faced with risks to health or the environment. The idea behind the principle is that
appropriate action should be taken to avoid the risk of any serious and irreversible damage to
the environment. The principle does not mean that if there is risk then things should not go
ahead. So far, despite large-scale cultivation of GM crops in some countries such as the US,
there have been no reports of any significant adverse effects on the environment or on human
health arising directly from the GM crops or the food they produce. This is a powerful
argument to suggest that the existing regulatory framework for the licensing of GMOs is
working. In addition, there have been documented examples where environmental impact
from chemical usage has been reduced as a result of the introduction of certain GM crops, for
example GM cotton in Australia. Clearly, each application of gene technology must be
stringently assessed on its relative merits and risks. It is an established principle that can be
used in environmental management, law and even policy making for any area such as
pollution, toxic chemicals, food standards, fisheries management, species introductions and
wildlife trade. The aim is to support ecologically sustainable development - to manage our
natural resources and conserve our biodiversity while continuing to develop as an economy.
This principle, put simply, is that a cautious approach to risk should be adopted where there is
not enough scientific confidence of safety. Successful application of the precautionary
principle will mean that Australia avoids expensive damage (financial or otherwise) to our
environment.
85
Dr. Fahd M. Nasr
IV. Food and agriculture

Humans need food to live. We spend much less time today obtaining and preparing
food than our grandparents and we eat a much greater variety. Over time we have learnt more
about the human body and this has changed the kinds of foods we eat. For example, in 1959
Australians consumed about 117kg of vegetables per person. In 1989, that figure had risen to
162 kg per person. Each year, Australians eat an estimated 35.4 kg of beef per person.
Worldwide, it has been estimated that the demand for cereals will increase to 2,466 million
tons by 2020, for meat 313 million tons and for roots and tubers 864 million tons. As well as
changing the foods we eat, more land and resources have been used to produce it. There is a
desire to make each work harder and more efficiently, and mostly this is achieved through
new agricultural methods.
IV.1. Feed Me
When growing crop plants or breeding animals for food, farmers select the best
animals and crops that suit their needs – this can be the best milking cow, highest-yielding
crop or juiciest fruit. These characteristics are largely controlled by the plant’s or animal’s
genes. Sometimes when you cross two plants you can end up with what you want and the
bonus of something you don’t. For example, you may get a plant that has juicy fruit but is also
susceptible to disease. Sometimes these traits cannot be separated and are said to be linked,
meaning that the genes for these two traits are very close together on the chromosome. Extra
crossbreeding may be able to separate them, but this is not always possible and takes some
time.
Plants and animals with desirable traits can also be bred using modern biotechnology
and gene technology. The process can be more selective by finding the genes that control a
particular characteristic and the plant or animal can be changed one specific characteristic at a
time. Reproductive technologies such as cloning can be used to produce identical organisms,
each with a specific characteristic. This can produce herds of identical animals or fields of
identical crop plants. Although the selected traits may be useful, one drawback of cloning a
whole crop is that the crop or herd of identical organisms risk succumbing to the same disease
or a parasite. Genetic diversity is nature’s way of ensuring that some members of a species
will be immune to a given threat so that the species can survive.
In nature, different species cannot interbreed, so our ancestors selected and bred with
characteristics within the species. One big difference now is that gene technology can be used
to transfer genes from one species to another. This can even be between species that have
been separated for hundreds of millions of years by evolution (for example transfer of a gene
from a bacterium into a plant). A much greater range of traits can, therefore, now be bred into
an agriculturally important species. This has led to a concern that gene technology allows
scientists to ‘play God’. Gene technology can be used in agriculture and food production to:
 increase crop or animal resistance to pests while reducing the use of chemicals,
 increase crop or animal tolerance to chemicals that are used to kill harmful pests,
 create disease resistance in crops and animals,
 improve the food yield per plant or animal,
 make plants and animals more suited to special environmental conditions such as drier
regions or saline water, and
 improve the nutritional quality of the food produced by the plant or animal.
 Gene technology is also being used to deliver benefits in the forestry and fishery
industries.
In Australia there is a lot of research into the agriculture and food applications of gene
technology. So far, commercial use of the products of this Australian research has been
86
Dr. Fahd M. Nasr
limited to Bt cotton, (also called Ingard® or Bollgard®II cotton), and five varieties of
genetically modified (GM) carnation (Florigene Moon series). The most common GM crops
grown overseas are soybeans, corn, cotton, sugar beet, and beet grown for use in processed
foods or in animal feed. Ninety-eight percent of GM crops are grown in four countries:
Canada, the USA, Argentina, and China. Other countries that have approved GM crops are:
South Africa, Australia, Mexico, Bulgaria, Uruguay, Romania, Spain, Indonesia, Germany,
India and the Philippines. Products from these crops may be a part of the food we eat in
Australia, if approved by Australia’s food regulator43.
IV.1.1. A food biotechnology timeline

This timeline includes significant events that have led to the current use of gene
technology in food technology. It also shows some predictions about future developments in
the application of gene technology to food production.
Year Discovery
6000 BC Yeast used by Sumerians and Babylonians to make beer.
Egyptians discover how to make bread using yeast. In China, other fermentation processes are
4000 BC discovered, such as the use of lactic acid bacteria to make yoghurt and moulds to produce cheese,
and the use of fermentation to make vinegar, soy sauce and wine.
1300 AD Aztecs harvest algae from lakes as a food source.
Francesco Redi uses an experiment to compare two competing ideas that sought to explain why
maggots appear on rotting meat. He observes that meat covered to exclude flies does not develop
1673
maggots, while uncovered meat did. This is regarded as one of the first uses of a controlled
experiment.
Anton van Leeuwenhoek uses his microscopes to make discoveries in microbiology. He is the first
1724 scientist to describe protozoa and bacteria and to recognize that micro-organisms might play a role in
fermentation.
1852 Cross-fertilization in corn discovered.
Paris hosts an international ‘Corn Show‘, featuring corn varieties from many countries, including
1863
Syria, Portugal, Hungary and Algeria.
Louis Pasteur invents the process of pasteurization, heating wine sufficiently to inactivate microbes
1871
and prevent spoilage, but not ruining the flavor of the wine.
Ernst Hoppe-Seyler discovers invertase, an enzyme that cuts the disaccharide (sugar made of two
1871 molecules) sucrose into glucose and fructose. The enzyme is still widely used today in making
sweeteners.
In the USA, William James Beal develops the first clinically-controlled crosses of corn in search of
1879
higher yields.
Gregor Mendel dies. Mendel spent 41 years studying the ‘heredity‘ factors of pea plants. Having
1884 received no scientific acclaim during his lifetime, not long before his death he says, “My time will
come”.
Eduard Buchner demonstrates that fermentation could occur with an extract of yeast in the absence
1897
of intact yeast cells. This is a founding moment in biochemistry and enzymology.
1935 Andrei Nikolaevitch Belozersky isolates pure DNA for the first time.
1953 James Watson and Francis Crick propose the double helix structure of DNA and their paper is
43
Fish genes in tomatoes Scientists have tried to transfer a gene from the Arctic flounder fish to tomatoes. It was
hoped that transgenic tomatoes containing this protein could be used to produce products with better freezing
quality, so that they could be frozen and thawed without going mushy. The experiments were stopped because
they failed to work. The antifreeze proteins were present in the tomato, but they did not improve the texture of
the tomato fruit following freezing, so there are no tomatoes with fish genes in existence.
87
Dr. Fahd M. Nasr
published in Nature. They achieve this discovery with the help of Rosalind Franklin and Maurice
Wilkins.
1962 Planting of high-yield wheat varieties (later known as ‘Green Revolution‘ grains) begins in Mexico.
Scientists successfully create a recombinant organism for the first time by transferring viral DNA
1973
into a bacterium. The biotechnology revolution arrives.
First biotechnology patent granted. US researchers awarded a US patent that allows them to make
1980
human insulin from genetically modified bacteria.
Researcher Steven Lindow requests US Government permission to test genetically engineered
1982
bacteria to control frost damage in potatoes and strawberries.
US patents awarded to companies producing genetically engineered plants. Dr Kary Mullis invents
1983
the polymerase chain reaction (PCR), used to multiply DNA sequences.
1984 Dr Alec Jeffries invents the technique of DNA fingerprinting.
The first deliberate release experiment is conducted by the firm Genetic Sciences who inject
1985
genetically engineered microbes into trees growing on the company's roof.
The US Environment Protection Authority approves the release of the first genetically engineered
1986
crop – a GM virus resistant tobacco plant.
Calgene Inc. receives a patent for the tomato polygalacturonase DNA sequence, used to produce an
'anti-sense' RNA to extend the shelf-life of fruit. Advanced Genetic Sciences Inc. conducts field trial
of a recombinant organism, a frost inhibitor, on a strawberry patch in the USA.
At the Waite Institute in Adelaide scientists modify a type of soil bacteria which causes Crown Gall
(a disease that damages the roots of stone fruits) by removing the disease-causing gene and replacing
1987
it with a gene that protects the plant from Crown Gall. The GM bacteria are successfully tested on
almond seedlings.
In the UK, genes are added to potato plants to make them produce more protein and increase their
nutritional value. Research into other foods included removing allergy-causing proteins from
peanuts.
Beginning of Human Genome Project in the UK and the USA with the aim of sequencing the full
1988
DNA of humans.
The first successful field trial of GM herbicide tolerant cotton is conducted in the USA.
The first food products modified by biotechnology, an enzyme for cheese production and a yeast for
1990
baking, are approved in the USA and UK, respectively. GenPharm International creates the first GM
dairy cow for production of human milk proteins for infant formula.
The first genetically engineered food product, the FlavrSavr® tomato, receives US Food and Drug
1994
Administration approval.
Australian Genetic Manipulation Advisory Committee (GMAC) allows unrestricted, commercial
1995
release of a GM blue carnation in Australia.
1996 Ingard® insect resistant (Bt) cotton is grown commercially in Australia.
Researchers at Scotland's Roslin Institute clone a sheep named Dolly, from an udder cell of an adult
1997
ewe.
Scientists in Japan clone eight identical calves using cells from a single adult cow.
1998
40 million hectares of GM crops are planted globally, predominantly soy, cotton, canola and corn.
In response to the exponential growth in discoveries and applications for the use of gene technology,
1999
Australia conducts its first ever Consensus Conference on gene technology in the food chain.
Australia’s first cloned cows – Suzi and Mayzi – are produced
Arabidopsis thaliana becomes the first entire plant genome to be sequenced. ‘Golden rice‘, a
genetically modified variety with genes added which produce a vitamin A precursor, is created.
2000 The genetic code of fruit fly Drosophila is published. Drosophila is the ‘lab rat’ of the genetics
world and is used in experiments to investigate genes and gene function.
The Australian Federal Government passes the Gene Technology Act in December to regulate the
research, use and release of GMOs in Australia.
The human genome is sequenced in draft form and announced jointly by the private company Celera
2001
Genomics and a public consortium comprising the US National Institute of Health, Sanger Institute
88
Dr. Fahd M. Nasr
UK and other international research teams.

A single gene from Arabidopsis is inserted into tomato plants to create the first crop able to grow in
salty water and soil.
The Commonwealth Gene Technology Act 2000 (Cth) takes effect from 21 June. In July GMAC
becomes the Gene Technology Technical Advisory Committee.
First cloned cat, called carbon copy or CC.
Researchers sequence the DNA of rice, the main food source for two-thirds of the world's
population. It is the first crop plant to have its genome decoded.
Dolly is put down on 14 February 2003 after it is determined she is suffering from a progressive lung
disease. She is subsequently prepared and placed on display in the Scottish National Museum.
Office of the Gene Technology Regulator approves commercial release of GM cotton in Australia.
2002 Australia passes two pieces of federal legislation to regulate cloning and embryonic stem cell
research. The first, the Prohibition of Human Cloning Act 2002, (Cth), outlaws any form of human
cloning, whether it be to generate tissues (somatic cell nuclear transfer, or therapeutic cloning) or a
new human being (reproductive cloning). The second, the Research Involving Human Embryos Act
2002 (Cth), allows researchers to access surplus human embryos (to obtain stem cells, under strict
conditions.
Scientists unveil the final draft of the human DNA sequence
Office of the Gene Technology Regulator approves commercial release of herbicide tolerant GM
canola crops.
UK approves its first commercial biotech crop in eight years, a GM herbicide-resistant corn used for
2003 cattle feed.
US Environmental Protection Agency approves the first transgenic rootworm-resistant corn.
The banteng, an endangered species of cattle, is cloned for the first time in the USA. 2003 also
brought several other cloning firsts, including donkeys, horses and deer.
Japanese researchers develop a biotech coffee bean that is naturally decaffeinated.
In Australia, despite regulatory approval for GM canola, most state governments place moratoria on
growing GM canola in response to consumer concerns.
Australian researchers use gene mapping techniques to identify genes for tenderness and toughness
2004
in beef, allowing breeders to select stocks containing the ‘tender‘ gene.
CSIRO develops a test to distinguish between different strains or forms of the avian flu virus, and to
provide early warning of the emergence of potentially lethal strains in chicken farms.
2005 Review of stem cell and cloning legislation and the Gene Technology Act 2000 (Cth)
CSIRO researchers are working on alternatives to antibiotics to protect livestock against bacterial
infections. By selecting animals with genes resistant to infection or using gene therapy, scientists
hope to help producers reduce or eliminate their use of antibiotics.
2005 and Within the next twenty years a second generation of GM crops is expected with properties that have
beyond: more direct consumer benefit such as elimination of allergens in food, increased nutritional content,
and lower fat and oil levels.
Third generation GM crops may have properties like salt tolerance, drought resistance, drugs and
vaccines within them, and plastic starter chemicals to create bioplastics.
Where do you think we will go next? How will scientific, technological and ethical
decision impact on our futures? Discuss this with your class
IV.1.2. Gene technology and crops

Primary producers that produce food off the land compete in the global marketplace
for sales of their produce. Most consumers in that marketplace want products that use
environmentally sustainable practices, are healthy and safe for consumption, satisfy our desire
for quality and novelty but are not too expensive. Off-farm, crop farmers face tough
competition and regulation. On-farm they have to deal with weeds, insects and diseases,
including fungal and viral infections and varying weather and soil conditions. Pesticides,
insecticides, herbicides, fungicides and growth promoters are the main forms of crop
protection currently in use in Australia. The cost of this crop protection went from $1,100
89
Dr. Fahd M. Nasr
million to $1,600 million in the period 1996 to 199944. How might gene technology be used to
help reduce such costs and deliver what the consumers want? Gene technology can be used to
improve crop and food quality not only through transferring or manipulating genes within a
species or between species, but also through the use of DNA markers to speed up plant
breeding and genomics (the discovery of genes and their function).
Australian research is also focusing on finding genes that control flowering in crop
plants. The aim is to allow growers to control the cycle of the plant's growth and harvest time
to match the environment. Genetic modification of a crop plant involves introducing desirable
traits to improve the yield or a desired quality of that crop. It can be done in three ways:
 Input traits – these are commercially available and can be aimed at lowering the cost
of production, improving crop yields, reducing the level of pesticides used to control
insects, diseases and weeds and offering protection from environmental stresses such
as heat, cold, drought and high levels of salt in the soil.
 Output traits – these are aimed at helping consumers by enhancing the quality of the
food, fiber and other products they use. Anti-oxidants may be added to foods to
deliver health benefits, tobacco may be nicotine-free, flowers will come in new colors
or foods will have improved taste, better shelf-life and ripening characteristics.
 Value-added traits – plants may be used to produce textile fibers, biodegradable
plastics, or oils for use in paints, detergents and lubricants. Researchers anticipate gene
technology will produce plants which can detect and/or dispose of environmental
contaminants like mercury, lead and petroleum products.
Not all of these products and crops are currently available. Researchers must fully test
GM crops in the field before they can apply for a license to grown them commercially. You
can see where all GM crops that have been, or are currently being field tested in Australia 45.
Field trials are conducted to test the efficiency of the gm crop. The Office of the Gene Technology
Regulator monitors trial sites across Australia.
44
Did you know grafting fruit or nut trees onto genetically modified rootstocks protects against bacterial
infections but does not produce a genetically modified plant?
45
Orange cauliflower Farmers and scientists have been working together to create new kinds of vegetables.
These vegetables have exotic colors, fewer calories, and added health benefits. For example, the orange
cauliflower has about 25 times more vitamin A than white cauliflower.
90
Dr. Fahd M. Nasr
IV.2. A problem with weeds - the canola story

What is canola?
Canola or rapeseed (Brassica napus) is a bright yellow-flowering member of the
Brassicaceae (also known as the mustard) family. It is cultivated for the production of animal
feed, vegetable oil for human consumption and biodiesel. Worldwide, canola was the third
leading source of vegetable oil in 2000, after soy and palm oils. Canola is also the world's
second leading source of protein meal. Natural rapeseed oil contains erucic acid, which is
mildly toxic to humans in large doses but is used as a food additive in smaller doses. Canola
is a specific variety of rapeseed bred to have a low erucic acid content. Canola was developed
in Canada and its name is a combination of 'Canada' and 'oil' (Canadian oil low acid).
IV.2.1. Why do we grow canola?

Canola is harvested mainly for its oil, which is obtained from its seeds. If you eat
margarine or fish and chips you have probably eaten some canola oil. Canola oil is also used
in many food products and other substances such as soap, creams and lotions. Canola oil has
one of the lowest, if not the lowest, level of saturated fat of all the vegetable oils. Saturated
fats contribute to health problems such as heart disease. In addition, canola oil has higher
levels of the important and beneficial omega-3 fatty acids compared to some other vegetable
oils. The amount of each of these fats produced by an animal or a plant is generally controlled
by its genes. It might be possible in the future for us to change these genes in canola plants so
that they produce less saturated fats and more unsaturated fats, making canola even healthier
to eat.
IV.2.2. What's the problem with weeds?

Weeds are plants that grow where we do not want them. They take up water and food
from the soil so that the plants we want to grow have to compete for nutrients and water.
Weeds can also be noxious to animals that eat the weeds or the insects that are beneficial to
our crops. To get rid of weeds in a small garden is easy – we can pull them out or dig them in.
If the weeds are growing in a path we can use a herbicide, a chemical designed to kill plants
or inhibit their growth. There are selective herbicides that only affect particular types of
plants. Getting rid of weeds in crops is not easy, as they usually grow intermingled with the
crop plants. Most farmers have to remove weeds mechanically but this is not always desirable
because mechanical weeding, called tilling, can degrade soils.
A more convenient method, and less physically damaging to the soil, is to spray weeds
with a herbicide before the crop begins to grow. Spraying continues after the crop has grown
to control weeds that grow at the same time. Usually the spraying is carried out using an
aircraft or a boom sprayer pulled by a tractor. Although spraying is carefully regulated, there
are problems:
If the wind conditions are not right it can be hard to control where the herbicide falls.
The herbicide can drift onto houses, other valuable plants and into dams, creeks and
rivers. This may lead to concerns about the health of people, plants and animals living
close to the sprayed areas. High levels of pesticide use have been linked to severe skin
and eye irritation, and to breathing difficulties in people living in affected areas.
It is often difficult to get the right weather conditions for spraying at exactly the right
stage in the growth of the weeds and crops.
The herbicide must kill the weeds but not harm the crop species.
A single herbicide may not kill all species of weeds and a mixture of chemicals may
be required.
91
Dr. Fahd M. Nasr
Generally a few individual weeds are not killed by a herbicide because they may be
naturally resistant to the herbicide. These individuals may produce offspring that are
also naturally resistant. This means that the number of weeds resistant to the herbicide
used may increase from year to year.
Alternative approaches to the use of herbicides in the control of weeds are being
investigated. One such approach is the idea of biological control; an organism is introduced
into the environment that consumes the weed but does not harm other plant species including
the crop plant.
IV.2.3. Using herbicides to kill weeds

Glyphosate is the main herbicide used to kill almost any plant when it is sprayed onto
the plant's leaves. A major glyphosate herbicide is Roundup® (for commercial and
agricultural use) but there are many other glyphosate products on the market.
Environmental considerations
Glyphosate has some advantages over other herbicides. Although glyphosate dissolves
well in water, it sticks to soil particles. The soil itself could be washed into river systems, but
the glyphosate would end up in the aquatic sediment and not in the water. Because it binds to
soil, glyphosate does not leach into groundwater or poison crops through the roots.
Glyphosate is also much less poisonous to animals (including humans) than many other
herbicides. In addition, microbes break it down relatively quickly, so the herbicide does not
remain in the soil for long periods of time. However, glyphosate can kill all the plants it falls
on – both crops and weeds. A number of other herbicides are also available to farmers, for
example atrazine, glufosinate or bromoxynil. Farmers may spray their crops with at least two
different herbicides because some weeds may be tolerant and survive the spraying with the
first herbicide. Those weeds are often killed by the second or third spraying with a different
herbicide.
IV.2.4. A biotechnology solution to weeds

Plant breeders and researchers are working to produce crops that are resistant or
tolerant to herbicides. This allows herbicides to be sprayed on the field killing the weeds but
not harming the crop. To do this, the genes responsible for herbicide tolerance need to be
transferred into the crop plants. There are four ways to create herbicide tolerant plants.
Herbicide tolerance created by natural selection
If a large population of a plant species is sprayed with herbicide, a few plants will
survive, flower and produce seed. Some of these seeds will contain the genes that allow the
plant to tolerate the herbicide. This herbicide tolerance is passed on through generations of
offspring and an increasing number of these plants will survive being sprayed by the
herbicide. If this process of allowing plants that survive exposure to the herbicide to develop
and produce seed is carried out enough times, most seeds produced will be tolerant to the
herbicide. The herbicide will no longer kill these plants. For example, canola crops grown in
Australia have some natural tolerance to herbicides. This natural tolerance has been enhanced
by the process of selectively breeding herbicide-tolerant canola plants.
Herbicide tolerance created using naturally occurring genes
TT canola – a conventionally bred strain of canola resistant to the herbicide triazine is
grown extensively, for example, in Western Australia where it makes up approximately 90%
of the total canola production in that state. This form of canola was bred by using genes that
were already present in the canola's gene pool.
Herbicide tolerance created using mutagenesis
Mutagenesis is the alteration of genes using a chemical or radiation. Mutagenesis can
be used to create herbicide tolerant plants. Then using traditional cross breeding, crop plants
92
Dr. Fahd M. Nasr
with favorable characteristics and herbicide tolerance can be selected. An example of a crop
made using this technology is Clearfield® canola marketed by BASF. Varieties of
Clearfield® canola have been bred, using traditional methods, to be tolerant to imidazolinone
herbicides, which include the marketed brand On Duty®. Use of such traditionally bred
herbicide tolerant canola varieties is widespread across Australia. Similar herbicide tolerance
systems have also been developed for wheat and maize.
Creating glyphosate tolerance using gene technology
Glyphosate is a very effective herbicide. Only five species of plants worldwide are
known to have developed resistance to glyphosate through natural selection. Developing
herbicide tolerance in a wide variety of crop plants for this herbicide through natural selection
is not likely to be easy. Using specific gene technologies, a gene from a common soil
bacterium, which causes a plant to be tolerant to the herbicide glyphosate, has been inserted
into a line of canola. The so-called Roundup Ready® canola will grow into a crop that will
not be affected when the weeds in the same paddock are killed by spraying with glyphosate.
When using gene technology to modify plants, conventional breeding techniques still have to
be used to breed the new trait into the commercial varieties for crops. Not all herbicide-
tolerant GM plants are resistant to glyphosate. The Bayer variety InVigor® canola has been
created using gene technology, so that it is resistant to Liberty®, the Bayer glufosinate-
ammonium herbicide. Another glufosinate-ammonium resistant crop is rice.
IV.2.5. Concerns about herbicide tolerance

Farmers are concerned that herbicide resistance can emerge in weeds. For example,
extensive use of triazines has led to the natural emergence of triazine resistant ryegrass, which
is a weed of many crops. When resistance emerges, ryegrass becomes a worse weed as it is
more difficult to control. The use of herbicide tolerant crops and their relevant herbicides has
the potential to better control weeds but only if a cautious approach is taken in the
management of herbicide tolerant crops. Care needs to be taken to prevent weedy species
developing resistance to the herbicide46. In 2003, the OGTR approved the commercial release
of the two types of herbicide-resistant canola – Roundup Ready® and InVigor®. In 2005,
neither is currently being grown commercially.
IV.2.6. Concerns about GM herbicide tolerance

People who are concerned about using plants genetically modified for herbicide
tolerance are generally worried that:
 the plants will 'escape' into the natural environment and become a problem,
 the plants will interbreed with other plants in the environment and produce 'super-
weeds' that are resistant to a number of herbicides, and
 there will be a transfer of the gene to non-GM and organic crops.
 Plants may escape if their pollen or seeds are taken or are blown outside the paddock
or farm.
Pollen is carried by the wind, insects or other animals. Farmers have no control over
where the pollen from their plants ends up. However, it is possible to change the pollen-
making genes in a plant so that the plant produces no pollen, or pollen that is not able to
produce seeds - the latter would not work well for crops where we use the seeds, such as
canola. One technique that is being considered is the insertion of genes into the plants'
chloroplasts. Chloroplasts are structures that contain the plants' green pigment, and lie outside
the nucleus. Because chloroplasts are not within the nucleus, they are not passed on in pollen
46
Information on the regulations governing the release of herbicide-resistant crops can be found on the web site
of the Office of the Gene Technology Regulator (OGTR) – www.ogtr.gov.au
93
Dr. Fahd M. Nasr
and, as a result, the GM plants cannot exchange their inserted genes with other plants and
make weeds that are difficult to control with herbicide. The most commonly used crop plants
are hybrids (crossbred). Hybrids generally produce seed that can germinate, but the resulting
plants will not have the same vigor as the parent and so are unlikely to survive for long.
However, if the plants do 'escape', they will only survive and become a potential problem if
they have properties that enable them to compete successfully with plants already in the
natural environment. French researchers have claimed that there is a greater risk of GM plants
escaping into the wild from GM seeds being left in the fields than GM pollen being blown
away from crops.
IV.2.7. Is GM canola good or bad?

Many people say that GM herbicide tolerant canola is a good thing. Others say that
they are worried by this development. People who say that this GM canola is a good thing say
that it: (i) is safe to eat; (ii) is better for the natural environment, because glyphosate is less
toxic than other herbicides and is not washed into waterways; (iii) helps to minimize tilling
and soil degradation; (iv) enables farmers to have a choice on the weed control strategy they
use; (v) saves farmers some of the time and the labor costs of spraying; (vi) improves profits
because farmers get better crop yields, since the crop is not competing with weeds; (vii) is
better for company shareholders, because company profits are increased (although Monsanto
is the company that most people associate with GM food, there are in fact more than 20 other
companies currently producing GM seeds, such as Advanta, Novartis, Dow, Pioneer, Bayer
and Syngenta); and (viii) is better for the seed merchants, because they can sell higher quality
seeds at a higher price
The people who are worried say that GM canola:
 may produce substances in the plants that are harmful to humans and farm animals
 may cause the plant to produce oil that does not have as much food value as
unmodified canola
 the herbicide tolerance gene may cross with other plants including weeds and make
them herbicide resistant
 inserting a new gene may have unpredictable effects on other canola genes and the
way they work
 may not be good for farmers because the seeds tend to be more expensive to purchase
than the traditionally used seed
 may encourage farmers to use more glyphosate and so weeds may be more likely to
develop resistance to this useful chemical
A number of these points of view appear contradictory. One needs to examine the
evidence to decide whether or not each of these views, for or against the use of GM seeds, is
valid. It may be that apparently opposing points of view are valid depending on the
circumstances.
IV.3. A problem with insects - the cotton story

Images of locust plagues have long inspired movies and news items. At their most
extreme, they can destroy an annual crop in hours, taking away a good percentage of a
farmer’s income and increasing costs to consumers. But our past methods of widespread
spraying with insecticides have proven costly both financially and environmentally. Increased
pressure from importing countries and changing Australian regulations covering farm safety,
environmental degradation and pesticide residues are pushing farmers and researchers to find
and adopt more sophisticated integrated pest management practices.
94
Dr. Fahd M. Nasr
IV.3.1. What is cotton?

Cultivated cotton plants grow to about 1 to 2 meters tall, and produce white flowers
from a bud. When the bud has flowered, it turns pink and the petals fall off. Seeds are then
formed in a small green pod called the cotton boll. Huge numbers of seed hairs form around
each seed and these white fibers become packed around the seed inside the boll. When the
boll is mature, it bursts open, showing the soft cotton fibers, which help the cotton seeds
spread. Cotton fibers are about 2 to 4 centimeters in length. They are made up of about 87–90
per cent cellulose. This is a tough carbohydrate molecule that makes up the cell wall of all
plants. The fibers also contain 5–8 per cent water and about 5 per cent other substances. The
length of the cotton fiber determines the quality, and therefore the price, of the cotton
produced. The longest fibers are woven into the highest quality cotton fabric.
IV.3.2. Why do we grow cotton?

While wool continues to be a key export for Australia, cotton remains in high demand.
Cotton is seen as a natural fiber that is versatile, comfortable, desirable and extremely useful.
Cotton can be as fine as a handkerchief or thick like denim, it can be dyed to be any color you
like, easily washed and dried and added to other fibers for functional clothes and other uses.
The Australian cotton industry produced 1.65 million bales of cotton in the 2002/03 season.
This was less than a ‘normal’ cotton season (a reduction of over half) due to the drought. That
year the world cotton industry produced about 84 million bales. Of this, China produced 21.5
million bales and the USA produced 19.5 million bales. Other major producers include India,
Pakistan and Uzbekistan. Australia exports over 96% of its cotton crop. In a normal year, the
value of these exports is in excess of $1.5 billion. The main buyers of Australian cotton are
Indonesia, South Korea, Japan and Thailand. Maintaining our market share means continually
looking for improved farming practices. Managing insect pests is a
IV.3.3. What's the problem with insects?

Cotton has a long growing season as well as extended periods of flowering and fruit
development. This means cotton is susceptible to insect damage over a much longer time than
other crops. From the time the seedlings first appear to defoliation just before harvest, cotton
plants can suffer damage that affects yield or quality. Cotton growers have previously relied
heavily on applications of broad spectrum pesticides to control insect pests. In the past few
years they have moved much more toward integrated pest management where predatory or
‘beneficial’ insects are encouraged onto the farm to provide a level of natural control of the
pest species.
Additional crop areas called trap crops or refuge crops are planted to move pest insects
away from the cotton and to increase the number of beneficial insects in the area. Less
harmful, more selective chemical pesticides are used if necessary and researchers continue to
focus on the management techniques offered by transgenic cotton crops. Australia's worst
cotton pest is Helicoverpa armigera, a type of cotton bollworm. The adult of this pest is a
moth that lays its eggs on cotton plants. When the caterpillar (larvae) hatches, it starts eating
the food around it – the cotton plant. The caterpillar then burrows into the cotton seedpod
(boll) to find more food, and in the process damages the cotton. Because of this it is called the
cotton bollworm or cotton boll weevil. When the larvae have grown, they crawl down the
stem of the plant into the soil. Here they turn into pupae, inside a hard case. The pupae
metamorphose (change) into the adult moth stage in the soil. Four or five generations of these
moths can be produced each year.
Cotton is also attacked by several hundred other species of insects apart from the
bollworm. The cotton leafworm, cotton fleahopper, cotton aphid, rapid plant bug, cochineal
bugs, southern green stinkbug, spider mites, grasshoppers, thrips, and tarnished plant bugs all
95
Dr. Fahd M. Nasr
feed on various parts of cotton plants. Because of the large number of insect cotton pests,
repeated spraying of insecticides are needed throughout the growing season.
IV.3.4. Using insecticides to kill insect pests

Australian cotton farmers spend upwards of $250 million each year on insecticides to
protect their cotton and that figure is expected to grow each year as control becomes more
difficult. This use of insecticides raises a number of concerns:
i. Insects can rapidly become resistant to insecticides.
ii. Insecticides can kill other types of insects as well as the pest species.
iii. Insecticides often kill other beneficial insects that prey on the pest species, thus
destroying a natural way of controlling the pest.
iv. Birds that eat insects killed by the chemicals can become sick, possibly causing some
bird species to become endangered.
v. Some insecticides are dangerous to people living and working in the cotton growing
areas.
vi. Nearby waterways can be contaminated by insecticide run-off.
vii. Although today's chemical insecticides are much safer than in the past, they can still
cause problems for human health.
IV.3.5. Using viruses and venoms to kill insect pests

All living things have to contend with viruses, bacteria and fungi that can cause illness
or death. For example, humans get colds and ‘flus caused by types of viruses that grow in the
cells of the nose and throat. Baculoviruses specialize in infecting the caterpillars of many
moth and butterfly species, and so can be used to control caterpillar pests. Scientists in the
USA have genetically engineered a virus that is intended to control cotton caterpillars.
Scientists in Australia are considering importing these experimental baculoviruses for
laboratory trials. The GM baculoviruses contain a gene for a scorpion venom. When the
baculovirus infects the caterpillar, it invades the caterpillar's cells. The cells take up the gene
for scorpion venom and begin to produce it. The venom paralyses the caterpillar, in the same
way that a scorpion sting would do. As a result the caterpillar dies within 36 hours. Before
considering the release of these baculoviruses in Australia, scientists conducted a trial to see
how the baculovirus behaved in Australian conditions - whether it infected non-target insects
and competed with Australian baculoviruses. Researcher Andy Richards (from CSIRO
Entomology) concluded: “The results show that the question of how a GM virus might
interact with the cotton agro-ecosystem is more complicated than was originally thought.
96
Dr. Fahd M. Nasr
Further research is necessary before GM viruses can be widely used in this country and this
work is important because it provides a focus for future investigations to better judge potential
risks to the Australian environment.”
IV.3.6. A biotechnology solution to insect pests in the case of cotton

The bacterium Bacillus thuringiensis, or Bt, is a naturally occurring soil bacterium,
and produces proteins that kill insects. Sprays containing Bt bacteria have been used as
pesticides on farms, including organic farms, for many years. By the early 1990s the cotton
bollworm had developed resistance to most chemical pesticides. Scientists working for the US
company Monsanto developed a cotton variety called Ingard®, which contains a gene derived
from the Bt bacterium. When the gene is inserted into cotton plants a toxic protein is produced
that kills the bollworm caterpillars. These proteins are known as Bt toxins. The poison stays
in the leaves and does no harm until the bollworm eats the leaf tissue. It is very specific – it
only kills the bollworm caterpillars and very closely related species. It does not affect humans
and other animals.
In the 1990s, CSIRO Plant Industry scientists used licensed Monsanto genes to develop cotton
varieties containing a Bt gene that were suitable for Australian conditions. This variety was
called Ingard® cotton. In 1999 about 40 million hectares of Bt GM cotton were planted
worldwide. In that same year, about one third of Australia’s cotton crop (about 100,000
hectares) was Bt cotton. Some bollworm caterpillars may be resistant to Bt, which means that
Bt cotton crops still need to be sprayed with insecticides to kill any surviving caterpillars.
However, the amount of insecticide spray used on cotton crops was greatly reduced due to the
introduction of Ingard® cotton. The CSIRO has since created a new form of Bt cotton known
as Bollgard®II, also using licensed Monsanto genes. This new cotton is Ingard® cotton plus a
second, different, insecticidal gene from Bacillus thuringiensis. The addition of this second
gene significantly reduces the possibility of the bollworm developing resistance to the Bt
toxins. In 2004, 80% of the Australian cotton crop was Bollgard®II. Several companies, such
as Monsanto, Syngenta, Dow AgroSciences, and Bayer CropScience have developed varieties
of cotton with built-in resistance to the bollworm, and other scientists are researching the use of
viruses and venoms in order to kill cotton pests.
IV.3.7. Concerns about insecticide resistance

Insects become resistant to chemical insecticides very rapidly. This can happen in as
few as five generations – natural selection at work. The problem is that an insecticide never
kills all of its intended victims. If even a few insects survive, they will reproduce. They will
produce two types of young - those that are resistant to the spray and those that are not. The
non-resistant ones will be killed in the next spraying, but those that are left reproduce. At each
generation, the number of naturally resistant insects in the population increases. An individual
insect does not become resistant during its lifetime. It is born either resistant or non-resistant,
and it is the population as a whole that gradually becomes resistant to the pesticide over time.
The Bt toxins become ineffective, and the benefits of using them (less toxicity to non-target
species) disappear. As this occurs a new pesticide must be developed. Over time populations
of insects can become resistant to more and more pesticides, and as a result, humans are
forced to produce different, generally stronger, pesticides. Organic farmers have used Bt on
their crops for a number of years. They are concerned that the increased use of the Bt toxin
could speed up the development of resistant insect populations. Entomologists know that
controlled, laboratory experiments with generations of insects do not reproduce so easily in
the field. How the resistant insects breed with refuge insects, and over what time frames will
determine the success of this technology. These concerns are balanced by concerns that
existing pesticide practices can be much more dangerous for non-target insect species than
97
Dr. Fahd M. Nasr
insect-resistant crops. With conventional non-selective pesticides, many of the non-target

insects in a field being sprayed will be killed. By reducing the number of sprays needed,
insect-resistant crops help to preserve beneficial predator insects and simplify management
decisions.
IV.3.8. Controlling insecticide resistance

One of the problems with any insecticide is that populations of insects soon become
resistant to the insecticide. This applies to artificial and natural insecticides, as well as to those
insecticides inserted into GM plants. Two solutions to this problem are currently being
investigated.
Double the genetic punch
One solution is the 'double and triple whammy'. This method involves genetically
modifying the plant by adding two or three insecticide genes so that two or three toxins are
produced. If an insect becomes resistant to one toxin, the other will still kill them. The
number of bollworms that will be resistant to genetically modified plants with two or three
different insecticide genes will be very small, and arise only rarely. Bollgard®II is an
example of the 'double whammy' principle at work as it uses two different Bt insecticide
genes to deliver insecticides to the insect.
Reduce the chance of finding a resistant mate
The second solution involves refuges. These are areas of land near the crop that are
planted with cotton that is not genetically modified. Farmers are not allowed to spray the
plants in the refuges. The bollworm moths will be able to grow and breed safely in the refuges
and the population of moths that are not resistant to any pesticide will remain high. These
non-resistant moths will be able to breed with the moths that have grown from caterpillars
that have eaten the GM cotton and survived, and are therefore resistant. The eggs and
caterpillars that are produced will probably not all be resistant to the insecticide. These
caterpillars will be killed when they eat the GM cotton. However, there will still be moths
thriving and laying eggs in the refuges. This will ensure that the numbers of moths that are
non-resistant remains high, and that the environmental benefit of using Bt instead of more
toxic synthetic insecticides is not threatened. The current regulations in Australia prescribe
that up to 90 per cent of a cotton crop can be planted with Bollgard®II on any one farm. This
may be lifted to 100 per cent if other crops such as pigeon peas are planted as refuge crops to
slow down the emergence of Bt resistance in cotton bollworms.
IV.4. Other reasons to modify crops - soybeans

Soybeans are used to make soy oil, tofu, soy milk, lecithin, soy flour and soy protein.
In one form or another it is a key ingredient in many foods. In fact, about two-thirds of all
manufactured food products contain a soy-based ingredient. Different varieties of soybeans
are used for different foods. Soy is one of the six main crops used worldwide for oil
production. Others oils include canola, sunflower, palm, cottonseed and peanut. Soy proteins
are thought to be able to reduce cholesterol levels in the body. Soy is also used as an
ingredient in animal feed. Because of its widespread use and nutritional qualities, scientists
are looking at ways to use gene technologies to enhance the plants.
IV.4.1. To suit Australian conditions

Australian farmers need varieties of soybeans that grow well in our conditions and
also have characteristics which appeal to international markets. If this can be achieved, local
producers could supply northern hemisphere producers during their winter off-season. CSIRO
Plant Industry's soybean breeding program has bred a variety that increases the yield and
98
Dr. Fahd M. Nasr
quality of tofu, and produces higher yields of soymilk. Different varieties are bred for regional
applications in consultation with regional soybean associations, grain merchants and
Australian and Japanese food processors. Soybeans are currently grown either under irrigation
for inland areas or on the coast where rainfall is higher. Drought-tolerant soybean could be
grown reliably in more areas if it was less sensitive to fluctuations in rain or irrigation water
availability. Researchers have identified drought tolerance traits in some of Australia’s 20
native soybean species that they hope to incorporate into the cultivated soybean to create new,
hardier varieties. Gene technology speeds up this development process with the use of
'molecular markers' that locate and flag these genes so that individual plants with the drought
tolerance gene will be easily identified without having to grow the plant under drought
conditions.
IV.4.2. Modifying nutritional value

Researchers are looking at improving the nutritional value of soy. Some researchers
are focusing on techniques to produce omega-3 fatty acids as well as other fatty acids and
proteins in soy. Omega-3 fatty acids are known to reduce cholesterol levels in the blood, and
are naturally found in leafy green vegetables, vegetable oils, and fish such as salmon and
mackerel. One goal is to create soy (and canola) with longer-chain unsaturated fatty acids,
which would lower the levels of low-density lipoproteins (LDL) and cholesterol in the blood,
thereby reducing the risk of heart disease. To enhance soy with omega-3 polyunsaturated fatty
acids is desirable not just for health reasons (they have been shown to be important for
prenatal and early childhood brain development), but also for environmental reasons. These
compounds are primarily found in cold-water fish, such as salmon, tuna, halibut and herring.
Given the declining state of marine fisheries and concerns over mercury contamination, GM
plants that supply omega-3 polyunsaturated fatty acids would not only be beneficial for
consumers, but could also ease the pressure on fish stocks. High-protein soy is desirable in
countries where alternative proteins are scarce, for both human and animal foods and is
gaining further acceptance in many parts of the developing world.
IV.4.3. Better cooking oil

Soybeans are a source of polyunsaturated vegetable oils, similar to the types of oils
found in margarine. Some GM soy varieties contain increased amounts of oleic acid (a mono-
unsaturated fatty acid). These GM varieties of soy were created by adding extra copies of a
‘desaturase’ gene - a gene that occurs naturally in soy plants. The extra desaturase genes
result in soy beans with a higher percentage of oleic acid than unmodified soybeans. The extra
genes work by silencing an existing gene, reducing the conversion of mono-unsaturated oleic
acid to polyunsaturated oils. After assessment by Food Standards Australia New Zealand
(FSANZ), Health Ministers approved the sale of foods containing specific varieties of GM
soy, with an altered balance of oils in them. This type of soybean was first produced in the
USA in 1996. High oleic soy oils do not smoke when they are heated to high temperatures,
and are better than unmodified soy for re-frying, and during refining and storage. In addition,
increasing the amount of oleic acid in soy removes the need to hydrogenate (add hydrogen to)
the soy during processing. The hydrogenation process creates unhealthy trans fatty acids. The
change in the balance of the oils in the modified soybeans does not have any significant
impact on the nutritional value of the oil. But if the improved cooking properties means that
soy oil replaced other (saturated) frying fats, this would contribute to improved nutrition 47.
47
Did you know that some fried foods have cancer-causing agents that can damage DNA by causing mutations?
Acrylamides are formed by exposing high-carbohydrate foods to high temperatures in baking and frying; the
chemicals can cause cancer in laboratory animals, but have never been linked to human cancer.
99
Dr. Fahd M. Nasr
IV.4.4. Herbicide tolerance

Soy is an important food ingredient because of its nutritional properties and its
widespread use in processed foods. It is critical that whenever any changes are made to the
plant, as in genetic modification, that the effects on the nutritional value are examined. All
GM foods offered for sale in Australia must first be evaluated to see whether there are any
new toxins, allergens and whether the nutritional quality had changed at all as a result of
adding a new gene. For example, one gene has been added to GM herbicide tolerant soy.
Researchers compared the nutritional composition of conventional soy and GM soy tolerant to
the herbicide glyphosate. They found no difference. Feeding studies in catfish, chickens, rats
and dairy cattle have shown that their body weight and composition did not change when fed
herbicide tolerant soy. In addition, when dairy cattle are fed herbicide tolerant soy, the level
of milk production and the composition of the milk did not change. After a full safety
assessment, FSANZ approved the soy from these herbicide tolerant plants for use in foods for
human consumption 48.
IV.5. The international scene

The UK government's official adviser on GM, the Agriculture and Environment
Biotechnology Commission (AEBC), has said it would “be difficult and in some places
impossible to guarantee” that any British food was GM-free if commercial growing of GM
crops went ahead. In North America, farmers can no longer be certain the seed they plant does
not contain GM genes. In 2004, there was an estimated 81.0 million hectares (or 200 million
acres) of GM crops grown across the world. This involved approximately 8.25 million
farmers in 17 countries. While the majority of GM crops are grown in US and Argentina,
China and India grow a lot of GM cotton, and South Africa and Spain growing a lot of GM
maize (corn). Countries growing 50,000 hectares or more are: USA, Argentina, Canada,
Brazil, China, Paraguay, India, South Africa, Uruguay, Australia, Romania, Mexico, Spain
and the Philippines. The main GM crops grown are: soybean, maize, cotton and canola.
The main traits in GM crop plants are herbicide tolerance and insect resistance.
Herbicide tolerant soybean occupies 60% of the global biotech area and is grown in nine
countries and Bt maize (pest resistant corn) occupies 14% of global biotech area and is also
grown in nine countries. In Australia, three crops are approved and can be grown
commercially. They are:
 four pest resistant cotton varieties: Ingard® and Bollgard®, and Roundup Ready
Ingard® and Roundup Ready Bollgard® cottons. Bollgard®II has two insecticidal
genes from the soil bacterium Bacillus thuringiensis.
 two herbicide tolerant canolas: Monsanto’s Roundup Ready® canola and Bayer’s
InVigor® canola. These have been modified to be tolerant to the herbicides glyphosate
and glufosinate ammonium, respectively, which can then be used to control weeds
while the crop is being grown.
 five varieties of carnations in the Florigene Moondust and Moonshadow varieties.
They are modified for flower color and longer vase life.
The European Union had an unofficial moratorium on the sale and growth of GM
crops in place since 1998. This was lifted in May 2004. In the European Union, food
ingredients from varieties of GM soy, maize and oilseed rape have been approved for food
use although very little is actually used. These include oils and syrups that contain ‘GM-
derived’ material, and flours and starches. In Britain, the first crop to be approved for growing
48
Nothing to sneeze at. In the mid 1990s a form of GM soy was developed that incorporated a protein from the
Brazil nut to enhance the nutritional quality of the soy protein. This was subjected to safety testing and was
found to cause reactions in people who were allergic to the Brazil nut. The research did not proceed and the
product did not go to market.
100
Dr. Fahd M. Nasr
was a maize plant genetically modified to resist the weedkiller glufosinate ammonium and
used for animal feed. It was approved by the regulators in March 2004 but in April, the
company announced that it was abandoning plans to launch the crop as it was not
economically viable because of the uncertainty over issues such as compensation for
contamination. Scotland and Wales both want to establish ‘GM-free’ zones.
Some countries want to remain GM-free while others embrace GM. This makes for
complex debates about what constitutes a GM food or ingredient and makes labeling difficult
when these countries deal with each other in the global marketplace. Each year, a review of
the GM crops being grown around the world is produced by The International Service for the
Acquisition of Agri-biotech Applications (ISAAA). This is a not-for-profit organization that
aims to deliver the benefits of new agricultural biotechnologies to the poor in developing
countries.
IV.6. Genetically modified food labeling

The FLAVR SAVR® tomato was the first GM food to be approved for sale anywhere
in the world. This occurred in the USA in 1994. Australia’s Gene Technology Act 2000 (GT
Act) makes a distinction between genetically modified organisms (GMOs) and genetically
modified (GM) products.
Genetically modified organisms
Definition: The full definition of a GMO appears under section 10 of the GT Act. In essence,
a GMO means:
o an organism that has been modified by gene technology; or
o an organism that has inherited particular traits from an organism (the initial organism),
being traits that occurred in the initial organism because of gene technology.
Genetically modified products
Definition: A genetically modified product (GM product) means a thing (other than a GMO)
derived or produced from a GMO (section 10 of the GT Act). Food made from gene
technology is either defined as substantially different or is essentially the same (substantially
equivalent) in composition, nutrition, taste, smell, texture and functional characteristics, to
conventional foods.
IV.6.1. Safety of genetically modified foods

In Australia, Food Standards Australia New Zealand (FSANZ) is responsible for
developing, varying and reviewing, as well as approving food standards that apply to both
Australia and New Zealand. All GM food sold in Australia must pass a thorough and rigorous
safety assessment by FSANZ to gain approval for use. The safety assessments are based on all
currently available data and if any safety concerns arise, the food will not be permitted in the
food supply. FSANZ will only approve genetically modified foods if they are as safe as their
conventional counterparts, with no change in nutritional value. To date, 24 GM foods have
been approved for use in Australia and New Zealand. A GM food can only be permitted for
use in Australia if: (i) it has been assessed by FSANZ; (ii) is found to be safe; and (iii) has
been approved by FSANZ. FSANZ's safety assessment process for genetically modified foods
is based on concepts and principles developed by the World Health Organization (WHO), the
Food and Agriculture Organization (FAO) of the United Nations, and the Organization for
Economic Co-operation and Development (OECD).
These principles require the cautious use of scientific, risk-based assessment methods
and assessments on a case-by-case basis. The principles also require consideration of the
genetic material and proteins introduced to the food and the intended and unintended effects
of the genetic modification, such as changes to levels of nutrients. They also require
comparisons with any conventionally produced, unmodified version of an individual GM
101
Dr. Fahd M. Nasr
food, to look for changed characteristics. FSANZ's safety guidelines are based on world best-
practice standards49.
IV.6.2. Assessing the safety of genetically modified foods

Producers of all future GM foods – both domestically produced and imported – must
apply to FSANZ to seek approval for the food enter the food supply or be sold in Australia
and New Zealand. In applying, the producer provides information on what the genetic
modification is, where the new genetic material came from, how the gene was inserted into
the plant, nutritional values to ensure the nutritional value of the food has not changed and
tests for toxicity. As a result a large amount of scientific information is supplied with every
application for food safety assessment by FSANZ. All scientific data obtained from the
applicant must be generated according to international standards of Good Laboratory Practice
in laboratories that are independently audited. FSANZ supplements this data with information
obtained from a variety of other sources, such as peer-reviewed scientific literature, general
technical information, independent scientists, other regulator agencies, international bodies
and the general community. To make a safety assessment on GM foods FSANZ requires
specific information on:
1. The identity of host and donor organisms.
2. Any known pathogenicity in host or donor organisms.
3. The previous use of host and donor organisms in food production.
4. The new genetic material that has been introduced through genetic modification:
o origin, nature, purpose, function
o method of introduction into the host organism.
5. The new genetic material in the GM organism:
o number of complete or incomplete copies present
o stability.
6. The new protein in the GM organism:
o purpose, physical and biological characteristics
o expression profile (which tissues the protein is found in and when the protein
is present).
7. Potential adverse effects of the new protein, such as allergenicity and toxicity:
o similarity of new protein to known allergens or toxins
o physical features that are characteristic of allergens
o acute toxicity (animal studies).
8. Composition compared to conventional counterpart - levels of nutrients, anti-nutrients,
natural allergens and toxins.
9. Impact on human health from potential transfer of new genetic material to cells in the
human digestive tract.
49
All companies, both from Australia and overseas, must, by law, comply with Australian regulations before
they can sell genetically modified products in Australia. Using FSANZ guidelines, information supplied by
companies, and world scientific literature, FSANZ's experts assess the characteristics of GM foods to determine
if they have been changed in any way that might make them unsafe. There are seven steps in the approval
process for GM food. An initial safety assessment report is prepared by FSANZ experts and approved by the
FSANZ Board. First round of public comment follows. All submissions are collated and analyzed. A Draft
Assessment Report is prepared and approved by FSANZ Board. A second round of public comment follows. All
submissions are collated and analyzed and a Final Assessment Report is prepared. FSANZ Board approves the
GM food and notifies the Australia and New Zealand Food Regulation Ministerial Council (ANZFRMC) of its
decision prior to its gazettal. ANZFRMC can then request a review or allow it to be gazetted. The assessment
process to final assessment can take approximately 12 months but is subject to decision or review by the
Ministerial Council. Each State and Territory Government is responsible for administering the enforcement of
the food standards.
102
Dr. Fahd M. Nasr
10. End uses of the food, including any requirement for processing prior to consumption.
11. If required, ability of the food to promote typical growth and well being (animal
feeding studies).
12. Any other relevant information.
IV.6.3. Is it a food or food ingredient?

Foods or food ingredients produced using gene technology can generally be divided
into five classes for the purpose of safety assessment. Each class possesses distinctive
properties allowing a separate safety assessment approach. This assessment scheme provides
a general guide only. In practice, the type and extent of the safety assessment will largely
depend on the nature of the food being considered in an application.
Group A consists of chemically defined substances such as food additives, processing aids,
and agricultural and veterinary chemicals. Examples: enzymes such as α-amylase (breaks
down starches), chymosin (used in cheese); and veterinary chemicals such as porcine
somatotropin (pig growth hormone), bovine somatotropin (beef growth hormone).
Group B consists of less well defined substances such as oils, fats, starch and protein where
the composition may or may not be slightly altered. Examples: vegetable oil from pesticide-
resistant seed plants; sugar from insect-resistant sugar cane; starch from insect-resistant
maize; vegetable oils with a modified fat composition from modified seed plants; and
mycoprotein (fungal protein) from genetically modified yeast.
Group C consists of foods produced using GMOs (generally micro-organisms) where the
GMO has been removed from the final product, such as beer and wine. Examples: beer
produced using yeast modified to ferment at a colder temperature; and wine or beer produced
using yeast modified to result in an altered flavor profile.
Group D consists of transgenic plants or animals, i.e. plants or animals that contain new or
altered genetic material. Examples: tomatoes or cotton plants containing the gene for Bt toxin;
soybeans containing a gene which confers herbicide resistance; potatoes in which genes have
been altered to result in higher protein content; pigs with altered growth characteristics; and
sheep resistant to blowfly strike.
Group E consists of foods such as yoghurt where the genetically modified fermentation
micro-organism remains in the food. Examples: yoghurt containing a fermentation organism
with increased phage (bacterial virus) resistance; and yoghurt containing a modified
fermentation organism which leads to increased vitamin content.
IV.6.4. Concerns about safety

Concerns about the safety of GM foods are driving a worldwide debate about the
safety of foods derived from GM plant or animal sources and about the labeling of foods that
may contain GM ingredients. The approval procedures of FSANZ ensure that any new foods
released onto the market are assessed for safety by answering questions such as:
 Is the genetic material transferred unchanged from its source and does it work in the
same way in its new location?
 Is any of this genetic material present in the food product derived from the genetically
modified plant or animal?
 Could any of this genetic material cause harm if it was transferred to human cells?
 Are new proteins produced in the plant or animal as a result of genetic modification?
 Are these proteins present in the food product derived from the genetically modified
plant or animal?
 Are any new proteins in the food product likely to be poisonous or cause allergies?
 Is the composition of the food product derived from the genetically modified plant or
animal different from the non-GM form of the food?
103
Dr. Fahd M. Nasr
The safety assessment process undertaken for GM foods is a more thorough process than that
undertaken for all other foods, and the level of safety associated with GM foods is at least as
high as that of all other available foods 50.
IV.6.5. Labeling of genetically modified foods

There is constant debate about the safety of GM food products and about ethical issues
related to the use of gene technology. Some people would like to know if any food product
they are purchasing is from a GM source. New labeling rules for genetically modified foods
or food containing GM ingredients were introduced in December 2001. The new food
labeling standard required the labeling of GM food and food ingredients – additive or
processing aid - where new DNA and/or new protein is present in the final food or where the
food has altered characteristics51. Certain GM foods are exempt from labeling as a GM
product:
 highly refined foods where the effect of the refining process is to remove novel DNA
and/or novel protein;
 processing aids or food additives where novel DNA and/or novel protein is not present
in the final food;
 flavors which are present in the food in a concentration of no more than 1g/kg (0.1%);
 foods, ingredients or processing aids in which the genetically modified food is
unintentionally present in a quantity of no more than 10g/kg (1%) per ingredient. This
tolerance level only applies where the manufacturer has sought to source non-
genetically modified foods or ingredients;
 food intended for immediate consumption that is prepared and sold from food
premises and vending vehicles, including restaurants, take away outlets, caterers or
self-catering institutions. In these situations, consumers have the right to ask the
proprietor what is in the food being purchased and whether it is from a GM source.
Some manufacturers have decided to introduce negative labeling, indicating that food
ingredients have been obtained from non-GM sources. For example, certain brands of soy
products like soy milk or tofu include the words 'GM Free' on their packaging as a selling
point.
IV.6.6. Concerns about labeling of genetically modified food

Some people feel that the labeling system is not enough. Rather than label according
to whether there is any new genetic material in the end product of the food, they want it
labeled according to origin. For example, with canola oil, the refining process removes all
DNA and protein meaning that the end result does not contain any genetic material and does
not require labeling. Labeling according to process would state that canola oil came from a
plant that had been genetically modified.
50
Tempting debate with beer. A Swedish brewer has created a new light lager that’s produced with the usual
hops and barley — and a touch of genetically engineered corn. The purpose of this beer is to encourage the
public to become more involved in the biotech debate. Apart from protests by Greenpeace, the beer is being
fairly well accepted across the country.
51
Example for processed meat product: Ingredients: meat (60%), reconstituted textured soy protein*, water,
wheat flour, soy protein*, dehydrated potato, salt, beetroot powder, onion powder, mineral salts (450), black
pepper, soy lecithin* [*Genetically modified]. Another example of a food containing a GM ingredient could be:
Ingredients: wheat flour, water added, yeast, soy flour (genetically modified), vegetable oil, sugar, emulsifiers
(471, 472E), preservative (282), enzyme amylase.
104
Dr. Fahd M. Nasr
IV.7. Ethics for Food and Agriculture research

Many people feel that corporate, government and expert opinions often drown out
those of people who are personally affected by current technological developments. Such
people include, for example, people with a disability, people conceived through reproductive
technologies (e.g. 'test-tube' babies), people who use reproductive technologies to conceive,
farmers, scientists, and people who feel they have much to contribute to the debate. As
everybody is a consumer of food or agricultural products, discussions involving these issues
should take ethical principles into consideration. These principles may include: informed
consent, individual rights and freedom of choice. At a deeper level, every discussion on food
and agriculture must touch upon the distribution of decision-making power between
governments, the corporations who manufacture and sell GM foods, and the consumers, that
is, us.
105
Dr. Fahd M. Nasr
V. Glossary
adult stem cells Undifferentiated cells in a tissue. These cells can grow into any of the types of
specialized cells in that tissue.
allele One of two or more alternative forms of a gene. A person may have two copies of the same
allele which would be called homozygous or two different forms which is heterozygous. Different
alleles arise from changes in the base sequence of that gene through mutations. For example, the
gene for eye color has different alleles resulting in blue or brown eyes.
allergen An allergen is a substance from outside the body that triggers an allergic reaction. Common
allergens include grass, pollen and components of dust. Some proteins in foods may also cause
allergic reactions in sensitive individuals.
allergic reaction An allergic reaction is what results when a person’s immune system reacts adversely
to an allergen (see allergen). People react differently to various allergens and some do not
experience any noticeable effect at all. Most allergic reactions involve the allergen entering the
body (breathed in, through the skin or via food) and latching on to special immune system cells.
The allergens cause these cells to release chemicals that give rise to the symptoms of the allergy.
animal model A laboratory animal with a specific disease that researchers can experiment with to find
out more about that disease and how it occurs in humans. Animal models are used to learn more
about the causes of a disease, its diagnosis in humans, and to investigate or trial new treatments or
preventative actions. Animal models of disease may occur naturally in an animal population, or
may be created using techniques such as genetic engineering, or by exposing animals to
environments that induce that disease to develop.
amino acids Amino acids are the building blocks of proteins. There are 20 known amino acids found
in living organisms. The sequence of amino acids in a protein determines its function. This
sequence of amino acids is determined by the sequence of bases found in the gene coding for that
protein.
amniocentesis A procedure by which a small amount of amniotic fluid (the fluid surrounding a baby
in the womb) is drawn out using a needle inserted in to the mother's abdomen. This fluid contains
cells from the baby and can be used to test for chromosomal and genetic disorders, as well as
certain birth defects before the baby is born.
anemia A condition that is due to a reduced number of red blood cells or reduced amounts of
hemoglobin within them. This results in reduced oxygen carrying capacity and reduced aerobic
activity in body cells.
antibiotic Chemical that can be used to kill or inactivate bacteria within a person or animal.
Antibiotics are widely used in medicine to treat diseases caused by bacteria. The first antibiotic
discovered – penicillin – is produced naturally by some types of mould. Today there are many
different types of antibiotic, many produced using the techniques of modern biotechnology.
antibiotic resistance The ability of bacteria to tolerate antibiotics and remain unaffected by them.
Resistance may evolve naturally in bacteria after years of exposure to antibiotics. It is controlled
by genes and can be spread between bacteria. Many medically important bacteria have become
resistant to one or more antibiotic drugs. Bacteria that have resistance to many different antibiotics
are a major medical worry as they may result in infections that are untreatable.
antibodies Proteins produced by the immune system of humans and other vertebrates in response to
the presence of a specific antigen. A protein produced by the immune system which attaches to an
antigen. (The antigen is usually a complex biochemical compound that is from outside the
organism. Usually antigens are present on infectious pathogens, although they may also be on
non-infectious substances such as pollen.) When an antigen from outside is present in the body, it
stimulates the production of a specific antibody that will combine with it, usually enabling it to be
eliminated. There are many thousands of different types of antibodies.
anticoagulant Substance that prevents blood from clotting.
anticodon A sequence of three bases in a molecule of transfer RNA (tRNA) that binds to a
complementary codon in messenger RNA (mRNA). Each anticodon designates a specific amino
acid to be added to a growing polypeptide.
antigen Any substance that stimulates the production of antibodies in the body. For example, pollen
grains, dust, bacteria and viruses are recognized by the body as being foreign and it responds by
producing specific antibodies to the antigen.
106
Dr. Fahd M. Nasr
anthropocentrism Anthropocentrism is a view that regards humans as the central element of the
universe. Proponents of this believe that we should only protect and replenish the environment so
that it serves human purposes such as producing food and drugs; and that the fate of animals and
plants are not morally significant except in terms of sustaining human well being.
artificial insemination The placement of sperm inside the female reproductive tract to improve the
chances of fertilization and pregnancy occurring. Artificial insemination is also called intrauterine
insemination.
assisted reproductive technologies Assisted reproductive technologies (ART) refer to advanced
fertility techniques such as in vitro fertilization (IVF) which are used to bring eggs and sperm
together to help achieve pregnancy.
autosomal dominant 'Autosomal' refers to a non-sex chromosome. Autosomal dominance is when
one particular form of a gene, one allele, dominates over other alleles and is always expressed
when present in an individual whether they are homozygous for that allele or heterozygous.
avian influenza Referred to as the "bird flu", this is a highly contagious influenza virus that can infect
any bird.
Bacillus thuringiensis A species of soil bacterium that possess genes for a group of insecticides, the
Bt toxins. Different strains of the bacterium produce different Bt toxins. Some organic farmers use
this bacterium as an alternative to using chemicals to control pest insects. The genes for Bt toxins
have been genetically engineered into cotton plants so that the plants produce the insecticides.
bacteria A large group of single-celled organisms that do not have organelles enclosed in membranes
and have most of their DNA in a chromosome and the remainder in small circular plasmids. They
have a cell wall composed of protein and complex carbohydrate over a plasma membrane.
baculovirus A type of virus that specifically infects insect cells.
bagasse The dry, fibrous residue that remains after the stalks of sugar cane have been crushed and all
the juice extracted. It can be used as a source of cellulose for some paper products.
base Part of four types of simple molecules or nucleotides (adenine, thymine, cytosine and guanine)
that are the sub-units (building blocks) of DNA and RNA.
base pairs Pairs of complementary bases that form each rung of the DNA double helix: adenine pairs
with thymine and cytosine pairs with guanine.
base sequence The order of the chemical units (bases) adenine, thymine, cytosine and guanine in
DNA that forms the genetic code. The sequence of the bases will determine what protein is
produced.
biocide Any chemical agent that can kill a living organism. For example, pesticides kill insects.
biocontainment A process aimed at keeping biological organisms within a limited space or area. For
example, if an outbreak of a cow disease is found on one farm, a biocontainment process would
aim at stopping the disease from spreading to other farms.
biodiesel An alternative fuel for use in diesel engines that is made from natural renewable sources
such animal fats or vegetable oils and does not contain petroleum. It has similar properties to
petroleum but releases fewer environmental pollutants in its emissions. Biodiesel can be used in
diesel engines with little or no modifications, either as a diesel fuel substitute, or added to
petroleum-based fuels to reduce their polluting effect. Examples include oils such as soybeans,
rapeseed, sunflowers or animal tallow.
bioethics The study of the ethical and moral implications of applications of biomedical research and
biotechnology.
biological control The control of a population of one organism by another organism. Generally the
controlling organism is a predator or disease-causing organism of the species being controlled.
biofouling When living organisms attach to and start living on any object that is submerged in the sea.
This is commonly seen as barnacles attached to the hulls of ships or the bodies of whales.
bioremediation The use of plants and micro-organisms to consume or otherwise help remove
materials (such as toxic chemical wastes and metals) from contaminated sites (especially from soil
and water). A natural process in which environmental problems are treated by the use of bacteria
or other micro-organisms that break down a problem substance, such as oil, into less harmful
molecules.
biotechnologists Scientists who use biological processes to develop novel products.
107
Dr. Fahd M. Nasr
biotechnology (i) A broad term generally used to describe the use of biology in industrial processes
such as agriculture, brewing and drug development. The term also refers to the production of
genetically modified organisms or the manufacture of products from genetically modified
organisms. (ii) The use of plants, animals and micro-organisms to create products or processes.
Traditional applications include animal breeding, brewing beer with yeast, and cheese making
with bacteria. Recent developments include the use of enzymes or bacteria in a wide range of
applications, including waste management, industrial production, food production and remediation
of contaminated land. Modern biotechnology also includes the use of gene technology, which
allows us to move genetic material from one species to another. (iii) A broad term originally used
to describe the application of biology in the creation of helpful products (for example, agriculture,
brewing and baking were all considered types of biotechnology). Recently, the word has come to
refer more to modern methods of using organisms and biological processes to create either
genetically modified organisms or products (such as insulin and many pharmaceuticals)
manufactured using the techniques of genetic engineering.
biotreatment The treatment of a waste or hazardous substance using organisms such as bacteria, fungi
and protozoa (see bioremediation).
blastocyst After a mammalian ovum is fertilized it begins to divide. The blastocyst is an early stage of
this process which consists of a sphere that is fluid-filled and surrounded by a layer of cells,
surrounding a fluid-filled cavity. There is a mass of cells at one side which will become the
embryo. The blastocyst is formed before implantation into the uterus.
blastomere Any of the cells in the early embryo produced as the results of cell division in the
fertilized egg. A blastocyst is made up of many blastomeres.
Bt toxins Insecticidal proteins produced by the soil micro-organism called Bacillus thuringiensis. Bt is
an abbreviation of the name Bacillus thuringiensis. It produces a protein (Bt toxin) which is
naturally toxic to some insects. Different Bt toxins (from different strains) affect different insect
types.
Bt crops Crop plants that contain genes for Bt toxins. Examples are Bollgard® cotton and Ingard®
cotton.
calicivirus The virus that causes Rabbit Calicivirus Disease (RCD) in rabbits. It is spread by
mosquitoes and fleas.
cancer Cancer is an abnormal, uncontrolled and rapid growth of cells that invade and destroy
surrounding tissues. It is a broad term for more than 100 diseases characterized by this growth.
Cells from the tumor can break away (metastasis) and spread through the bloodstream or lymph
system to other parts of the body creating new tumors.
carbohydrate A chemical compound which contains only carbon (C), hydrogen (H), and oxygen (O)
and has the general formula Cx (H2O)y. Examples include sugars, starches and cellulose. Plant
carbohydrates constitute a major food class and are a basic source of energy for all animals.
carriers Substances or particles that can transfer genes into a cell. These include viruses, liposomes
(fat globules) and artificial chromosomes (sequences of DNA created in a laboratory) that can
transport large amounts of DNA.
cell A cell is the basic unit of life in all organisms which can reproduce itself. It is a small, water-filled
compartment filled with chemicals and small structures called organelles. It also contains a
complete copy of the organism's genome in the organelle called the nucleus.
cell-based therapies Therapies involving the transplantation of stem cells into damaged tissues to
regenerate the various cell types of that tissue. For example, bone marrow transplants are a form
of cell-based therapy that has been used for over 30 years to treat leukemia. New stem cell
research may lead to cell-based therapies to treat a range of conditions, including heart disease,
spinal injuries, diabetes and Parkinson disease.
cell division The process by which cells split into two copies of the original. The DNA of the original
cell is copied and one copy sent to each cell, ensuring that both have the correct amount of DNA.
cell line Cells that grow and divide indefinitely outside the body, and are originally derived from one
specific cell.
cellulose A long-chain, branched polysaccharide that forms the cell walls of plants.
108
Dr. Fahd M. Nasr
centromere The most condensed and constricted region of a chromosome which joins the two
chromatids of the chromosome together. It is also the attachment point of spindle fibers during cell
division when the two chromatids separate.
chemotherapy The application of chemicals (drugs) to control the growth of cells that form a cancer.
cholesterol A long chain molecule that is absorbed from food in the intestine or produced in the liver.
It is needed as a part of blood plasma and of cell membranes.
chromosome A threadlike component in cells that consists of a single long molecule of DNA coated
with proteins. Genes are carried on the chromosomes.
clone A group of genes, cells or organisms derived from a common ancestor. Each clone is genetically
identical.
cloning The process of producing a genetically identical copy. Genes can be cloned, as well as cells
and whole organisms. A clone is produced from one individual cell through an asexual process.
codon A specific sequence of three adjacent bases on a strand of DNA or RNA that provides the
genetic code for a particular amino acid.
congenital hypothyroidism An inherited trait that results in reduced activity of the thyroid gland,
generally due to reduced production of thyroid stimulating hormone. The trait results in a reduced
base rate of the body's chemical reactions, tissue swelling and weight gain. It can cause
neurological and development problems in affected children.
conventional breeding The techniques of animal or plant breeding that have been carried out for
thousands of years. Conventional breeding usually involves choosing the individual plants or
animals which possess the features closest to the desired ideal, and then breeding these individuals
together. Conventional breeding is an approximate way of controlling gene combinations, and of
ensuring that a gene or genes for a desirable trait are passed on or deliberately mixed with other
desirable genes.
coronavirus A single-stranded RNA virus that resembles a crown when viewed under an electron
microscope because of its petal-shaped projections. Of the more than 30 isolated strains of
coronavirus, three or four infect humans and may cause respiratory diseases such as SARS and
gastroenteritis. They are believed to cause a large percentage of all common cold cases in humans.
CSIRO Acronym for the Commonwealth Scientific and Industrial Research Organization. This is a
government-funded organization that carries out research in science, for the benefit of the
community and industry.
cystic fibrosis An inherited disease that results in abnormal mucus secretion that produces severe
respiratory problems, incomplete digestion and increased salt secretion in sweat.
daughterless carp Carp which only produce male fish. This slows the growth of the population with
the aim of reducing overall carp numbers. Since all fish embryos start life as males, the technology
works by silencing or switching off the gene responsible for stimulating the development of
female embryos.
degradation A gradual wearing down or away. Also with regard to soil a lowering of the nutrient
content and associated ability to support continuing crop growth.
diabetes A grouping of diseases in which either the body does not synthesize (manufacture) insulin, or
else its tissues are insensitive to the insulin that it does synthesize.
differentiation The process by which cells and tissues undergo a series of changes resulting in their
specialization to a specific form or function. A differentiated cell such as a muscle cell or a skin
cell contains a full set of genes of that organism, but only expresses the genes necessary for its
specific function. In animals, stem cells (both embryonic and adult) are the only cells capable of
undergoing differentiation to form more specialized cell types found in the body.
DNA Acronym for deoxyribonucleic acid. A molecule of DNA consists of a long chain of nucleotides
that are composed of deoxyribose, a 5-carbon sugar, a phosphate group linked to the bases
(nucleotides) adenine, thymine, cytosine and guanine. DNA contains the genetic code that controls
the production of proteins in living organisms.
DNA carriers (i) Substances or particles that can transfer genes into a cell. These include viruses,
liposomes (fat globules) and artificial chromosomes (sequences of DNA created in a laboratory)
that can transport large amounts of DNA (see vectors). (ii) An individual who carries one copy of
a recessive gene for a hereditary condition.
109
Dr. Fahd M. Nasr
DNA fingerprinting / profiling A genetic tool used to compare and contrast DNA sequences using
electrophoresis. Profiling is used in forensic science and to help in establishing parentage.
DNA polymerase An enzyme that helps in the replication of DNA molecules.
DNA probes To find the location of a gene along a stretch of DNA, scientists may construct a DNA
probe. This consists of a strand of DNA that is complementary to a portion of the DNA in the gene
being sought. The probe DNA can be labeled for easy detection, for example with radioactive
atoms (emitting radiation) or with a fluorescent dye. The target DNA is first separated into two
strands, then the probe DNA is added. It will bind to a strand at the point where it recognizes a
sequence of bases. It can then be detected either by its emitted radioactivity or by its fluorescence.
dominant When referring to genes, a dominant gene is one that almost always will be expressed and
lead to a specific physical characteristic. A dominant trait is the one that will be expressed in
individuals that are either homozygous or heterozygous.
double helix Twin, parallel spirals which form the backbone of DNA. This backbone is formed from
alternating sugar and phosphate groups.
Down syndrome An inherited condition due to an extra chromosome 21, either as a third chromosome
21 or attached to chromosome 13, 14 or 15. Also called trisomy 21.
eco-centrism A view that considers the whole environment or ecosphere as being important and
deserving of consideration, without preference to organisms such as animals and humans. It states
that all elements of the environment have worth and should be valued and cared for.
E-coli A species of bacterium that lives naturally in human and other mammal intestines, and which is
widely used in studies of molecular biology and for research into genetic engineering.
electrophoresis The process whereby an electric charge is used to separate molecules in a solution or
gel according to electrical charge and size. It is routinely used to separate fragments of DNA.
embryo The stage of an organism’s development from the first division of the zygote (to give two
cells) until the development of organs.
embryonic stem cells Undifferentiated cells in an embryo that are able to multiply and become
differentiated into any type of cell in the body.
endangered A species with such a low population number, that the population is in danger of
extinction.
environmental stewardship This is a view that humans have a duty to manage and care for the whole
natural environment. That we are responsible for the continued health of the whole ecosystem, not
just the parts that benefit the human race. It involves integrating and applying environmental
values into a process.
enzyme A protein that acts as a catalyst, affecting the rate at which a chemical reaction occurs within
a cell, without being changed or used up in the reaction.
erythropoietin A hormone released from the kidneys and the liver in response to low oxygen
concentrations in the blood. It controls the rate of red blood cell production.
ethics Ethics is a branch of philosophy that deals with morality. It is concerned with distinguishing
between right and wrong human actions, both at an individual and societal level. Ethics may also
apply to the rules or standards that specify how particular members of an organization should
conduct themselves.
eutrophication The dying off of organisms in a lake or pond due to an overabundance of algae which
consume all of the dissolved oxygen in the water. This usually happens when the water becomes
rich in mineral and organic nutrients, often due to run off of fertilizers from farms.
factor VIII and IX Soluble blood proteins that form part of the cascade of the 12 reactions of blood
clotting. Factor VIII deficiency is associated with hemophilia A while factor IX deficiency is
associated with hemophilia B.
feral A term used to describe domestic or introduced animals living in wild conditions or plants that
have become wild.
fertilization The union of male and female reproductive cells (gametes), during the process of sexual
reproduction, to form a cell called a zygote.
fetus The embryo is referred to as a fetus after it has reached a certain stage of organ development (in
humans this is eight weeks after conception).
fungicide A substance or chemical that destroys or inhibits the growth of a fungus.
110
Dr. Fahd M. Nasr
gene (i) A sequence of DNA which codes for the synthesis of a specific protein or has a specific
regulatory function. (ii) A portion of DNA carrying instructions. Genes usually code for the
production of a protein molecule, but some are the blueprint for the formation of other molecules.
Some sections do not code for anything. Genes are said to be active or ‘expressed’ when they are
being ‘read’ and used for the production of something.
gene bank A collection of cells or artificial chromosomes containing known genetic information.
gene expression The process by which the information coded within a gene is converted into proteins
that ultimately control all the operations in a cell.
gene mapping The process of determining where genes are located on individual chromosomes, their
position in relation to other genes and the distance between them.
gene markers Landmarks for a target gene - either detectable traits that are inherited along with the
gene, or distinctive segments of DNA.
gene pool All of the genetic information, including all variations, contained within a population of a
particular species at a particular time.
gene silencing Genes can be switched off by activating a gene switch that codes for a repressor. The
repressor molecule will prevent the activity of the target gene. Genes can also be silenced if the
DNA of which they are made is subjected to special chemical changes that may prevent it from
being read. A new process called RNA interference is also now known to silence or block
individual genes.
gene splicing A technique used to join segments of DNA to form a new genetic combination.
gene technology The technology to take a single gene from a plant or animal cell and insert it into
another plant or animal cell of a different species.
gene testing Methods that identify the presence, absence or mutation of a particular gene in an
individual.
gene therapy The addition of a functional gene or groups of genes to a cell using recombinant DNA
techniques (see gene splicing) to correct a hereditary disease.
genetic code The code in which the instructions of life are written. The genetic code refers to the
sequence of bases in a DNA molecule. There are four possible bases, and their sequence spells out
how to build proteins. In turn, the proteins are responsible for constructing and operating the
features of the organism.
genetic counseling The counseling of individuals and prospective parents who are at risk of a
particular genetic disease, either themselves or their potential child. It provides them and their
families with education and information about genetic-related conditions such as the probabilities,
dangers, diagnosis and treatment, and helps them make informed decisions.
genetic disorder A hereditary condition that results from a defective gene or chromosome.
genetic diversity The variety of different genes occurring within a population or species. In most
species, many different versions or "alleles" of a gene will exist in a population of different
individuals. For example, in humans, everybody has a gene affecting eye color, but the different
versions of these genes give rise to variety in eye color in the population.
genetic engineering A term used to cover all laboratory or industrial techniques used to alter the
genetic material of organisms. These techniques assist organisms to produce new substances or
perform new functions, for example increase yields of compounds already produced by the
organism, form new compounds, or allow organisms to adapt to drastically altered environments.
genetic modification The deliberate changing of the genetic material in an organism. Scientists can
determine whether or not the change will be passed onto offspring. Usually in GMOs, the
modification is passed on. Genetic modification is a general term that can cover many processes.
(It is possible to modify genes and not have the modification passed on to offspring.)
genetic marker A sequence of DNA that has a known location on a chromosome and is known to be
associated with a particular gene or trait. Some genetic markers are associated with certain
diseases. Detecting these genetic markers in the blood can be used to determine whether an
individual is at risk of developing the disease. They are also used as a reference point for mapping
other genes.
genetic modification (GM) Any process that alters the genetic material of living organism. This
includes duplicating, deleting or inserting one or more new genes or altering the activities of an
111
Dr. Fahd M. Nasr
existing gene. It can be performed on microbes, plants or animals (humans included). Where this
is done in humans, it is gene therapy, and only human genes are used.
genetically modified organism(s) (GMO) An organism (plant, animal, bacteria, or virus) that has had
its genetic material altered, either by the duplication, insertion or deletion of one or more new
genes, or by changing the activities of an existing gene.
genetic screening The testing of a population for alterations in the activity (i.e. mutations) of
particular genes.
genetic switches Genes can be ‘switched’ on or off (activated or inactivated). Certain regions of DNA
control the activation of genes. These regions – or the protein molecules they produce - are
sometimes referred to as genetic switches.
genetics The study of heredity and variations in living organisms. The term ’molecular’ genetics is
used to describe the study of genes and their function (i.e. genetics at a molecular level).
genome All of the genetic information or hereditary material possessed by an organism. The entire
genetic complement of an organism.
genomics The study of the DNA sequence in the chromosomes of an organism. This includes the
genes that code for proteins, the regulatory sequences that control the genes and the non-coding
DNA segments.
genotype The genetic makeup of an organism. The combination of genes will interact with the
environment to affect the physical appearance of the organism - its phenotype.
germinate When seeds start to grow by putting out shoots and roots (can also apply to fungi).
germline Usually referred to in the context of germline cells which are reproductive cells - the egg
and the sperm. Any changes to the germline - the genetic material - will be passed on to offspring.
germ cells The gametes or reproductive cells which are ovum and sperm, or one of the precursor cells
that will develop into ovum or sperm.
GMAC (Genetic Manipulation Advisory Committee) A government expert advisory committee that
provided guidance to the government and industry on the safe and responsible development and
use of gene technology in Australia prior to the commencement of the Gene Technology Act 2000
in June 2001.
gonad ridge The area of cells within an embryo which will develop into the gonads of fetus. This
usually develops around 32 days after fertilization.
haematopoietic stem cells Stem cells that make all the blood cells in the body. They are found in the
bone marrow - the tissue that fills most bone cavities.
hemoglobin The protein found in the blood of most vertebrates and some invertebrates that carries
oxygen to the organs and tissues of the body.
hemophilia An inherited disease that is due to a deficiency or lack of certain compounds in the blood
such as factor VIII or IX. This results in excessive internal or external bleeding due to impaired
blood clotting.
hepatitis Liver inflammation usually caused by a virus.
herbicide A substance that kills plants. Herbicides are used in agriculture, horticulture and gardening
to control unwanted plants. Herbicides can be selective (kill selected species) or non-selective
(broad spectrum - kill all plants).
hereditary disorders A pathological condition due to changes in individual genes, or groups of genes
or in sections of chromosomes or whole chromosomes. These changes may be passed from parents
to offspring.
heterozygous Having two different forms of a particular gene, one inherited from each parent. For
example, a person with brown eyes may also carry a gene for blue eyes - two different forms of
the eye color gene.
homozygous Having two forms of a particular gene that are the same, one inherited from each parent.
For example, a person with brown eyes who carries another gene for brown eyes - two of the same
forms of the eye color gene.
hormones Chemicals in the blood which have a messenger function within the body. They are
produced by cells of an endocrine gland or by nerve cells in response to a specific nervous or
chemical stimulus. They affect the metabolic function of those cells that have the appropriate
receptor for the hormone.
112
Dr. Fahd M. Nasr
host An animal or plant on which, or in which, a parasite lives. While the parasite receives
nourishment and support from the host, the host does not benefit and is often harmed by the
association.
Human Genome Project The project that has identified and located all of the genes in human DNA,
and determined the sequences of the chemical bases that make up human DNA. This information
is stored in databases.
human serum albumin Soluble blood proteins that make up about 55% of plasma proteins. They are
involved in maintaining fluid balance in the blood.
Huntington disease An inherited disease due to a defective gene on the short arm of chromosome 4. It
results in loss of motor control and mental deterioration. Symptoms frequently do not appear until
after reproductive age, meaning the defective gene may already have been passed on to offspring
when symptoms develop.
hybrid (i) Something of mixed origin or composition. In the case of a plant or animal, a hybrid is
produced by breeding together plants or animals of different varieties, species or race. It is the
offspring of genetically dissimilar parents. (ii) Offspring resulting from the cross of two different
varieties or species. The greater the genetic distance between the parents (that is, the more
different the parents are), the more likely the hybrid is to be sterile. A mule is an example of a
hybrid, and results from the cross of a donkey and horse. Hybrids, especially fertile hybrids, occur
much more readily in plants than in animals. An example of a commonly used hybrid plant is
wheat, which contains the genes of three closely-related plants.
hydrophilic Literally means "water-loving". This can describe a molecule or part of a molecule that
has an affinity for water, or a substance that readily absorbs or dissolves in water.
hydrophobic Literally means "water hating". This describes a molecule or part of a molecule that
prefers to be in an environment where there is no water. It means repelling, tending not to combine
with, or incapable of dissolving in water.
immune response The immune response is the reaction of the body to substances that are foreign or
treated as foreign. The response is in a variety of forms from the recognition of antigens in the
body, the production of antibodies against the foreign substance and the response of lymphocytes
(white blood cells, T cells and B cells).
immune system The cells, proteins (such as antibodies) and cellular activities that work together to
fight off infection and provide resistance to subsequent infection.
immunocontraception A method of reducing fertility of a pest species by controlling or preventing
conception and pregnancy. For example, when used in rabbits, it depends on the insertion of genes
using the myxoma virus.
imprinting This is when genes are suppressed or silenced depending on which parent they were
received from. When DNA is passed to daughter cells after fertilization of an egg by a sperm,
certain alleles can become active only if they were received from the mother, others only if they
came from the father. If a gene is suppressed through imprinting from one parent, and the allele
from the other parent is not expressed because of mutation, neither can act and the child will be
deficient. A healthy child cannot be produced when both sets of chromosomes come from the
same parent. Imprinting of the same areas will occur and all these genes will be suppressed.
infertile Incapable of initiating, sustaining, or supporting reproduction, alternatively: not fertilized and
therefore incapable of growing and developing.
informed consent A term used to describe the responsibility of doctors or researchers to ensure that
patients or people being researched have an understanding of the relevant facts regarding their care
or participation in research. We can also say that consumers have a right to practice informed
consent when they buy particular foods. Informed consent relies on our having access to reliable,
truthful, and complete information.
inherited Traits or characteristics that come from one's ancestors and are transmitted from parents to
offspring through genes. The traits will therefore be present at birth.
inner cell mass Within a blastocyst - the hollow ball of cells that forms soon after an egg is fertilized -
there is a mass of cells on one side which will form the body of the embryo. This is referred to as
the inner cell mass. This is where embryonic stem cells are taken from.
inorganic This term has several meanings, including: (i) chemicals which are not organic, that is, not
manufactured within living organisms. (ii) any chemical compound which is not based on carbon
113
Dr. Fahd M. Nasr
chains or rings (except oxides, sulphides of carbon and metallic carbides which are also
inorganic).
insecticide A chemical that kills insects.
input traits Traits introduced into crop plants with the aim of lowering the cost of production and
improving the performance of the crop in the field. For example: pesticide resistance, herbicide
tolerance and disease resistance. This is in comparison to traits introduced into the crop to produce
products with enhanced value. These are referred to as output traits.
insulin A hormone that promotes the conversion of glucose to glycogen. It is present in vertebrates
and invertebrates.
intellectual property (IP) A term that refers to the content of the human intellect, or the result of
intellectual effort, which is considered to be unique and original and have value in the
marketplace, and therefore requires legal protection and ownership. This includes copyrighted
material such as literary or artistic works, industrial processes, and trademarks and patents.
intron A sequence of DNA within a gene that is initially copied into messenger RNA, but is cut out
before the messenger RNA is translated and does not have a function in coding for proteins.
in vitro fertilization (IVF) Methods of carrying out fertilization outside the body, frequently used to
assist couples unable to conceive naturally.
karyotype An organized profile of an individual's chromosomes. A description or display of the
number and types of chromosomes of an individual.
lactoferrin A protein in breast milk that promotes infant growth.
leukemia An increase in the number of ineffective and immature white blood cells causing a
weakened immune system which leaves the body susceptible to infection.
ligase An enzyme that is used to join fragments of DNA together, for example in gene splicing. Ligase
is used in recombinant technology.
major histocompatibility complex A group of genes that control several aspects of the immune
response. They code for markers which go on the surface of all body cells and are recognized by
the body as 'self', belonging to the body. These genes define a person's tissue type and are used to
determine whether a transplant would be compatible or not.
mammalian Pertaining to the group of vertebrates that have: (i) internal development of the embryo;
(ii) mammary glands that can produce milk; (iii) live-born young, a body covering of hair or fur;
(iv) a four-chambered heart; (v) a well developed cerebral cortex; (vi) the ability to maintain a
constant body temperature; and (vii) a permanent set of teeth.
marker A gene or DNA sequence with a known physical location on a chromosome and is associated
with a certain trait or characteristic. It can be used as a point of reference when looking for other
genes.
marsupial A mammal whose distinguishing features include the birth of young at an early fetal stage
of development, and generally, a pouch (marsupium) in which further development of the fetus
occurs.
melanoma A type of cancer that begins in the melanocytes - the skin cells that produce pigments. It
can spread to other areas of the body if not detected and treated early.
Mendelian inheritance A hereditary process where genetic traits are passed from parents to offspring
and are explained in terms of chromosomes separating, independent assortment of genes and the
homologous exchange of segments of DNA. There are three modes of Mendelian inheritance:
autosomal dominant, autosomal recessive and X-linked inheritance. Named after Gregor Mendel,
who first studied and recognized the existence of genes and this method of inheritance by
experimenting with and breeding different varieties of peas.
messenger RNA (mRNA) An RNA molecule that specifies the amino acid sequence of a protein. It is
the intermediary molecule between DNA and ribosomes. mRNA takes encoded specifications
from the cell's DNA and processes the message to the ribosomes which make the coded-for
proteins.
micro-organisms Organisms that can be seen only with the aid of a microscope. They are also known
as microbes.
mitochondrial DNA The genetic material of the mitochondria - the organelle that generates energy
for the cell. The DNA in mitochondria is different from that in the nucleus. Many scientists
believe that this DNA is the remnant of a bacterium that invaded the cell in very early evolution.
114
Dr. Fahd M. Nasr
Mitochondrial DNA (mtDNA) is typically passed on only from the mother during sexual
reproduction as it is only the nucleus of the sperm that enters the egg upon fertilization. This
means there is little change in the mtDNA from generation to generation.
monoculture Usually used in connection with crops, monoculture means the growing of identical
plants in a large area, with no diversity. Natural meadows contain a mix of plant species, whereas
a modern farmer’s field is often a monoculture of just one species – and probably just one cultivar
or variety of that species – grown at a high density.
monosomy The presence of only one chromosome of a pair.
mono-unsaturated Refers to molecules, such as fats, that have only one double bond in their
chemical structure. Some plant oils and margarines, avocados, olives, nuts and seeds contain
mostly mono-unsaturated fats.
moral standing To say that a group of organisms has moral standing is to say that their wellbeing
must be given some consideration. It does not decide the question of whether they have the same
moral standing as people (and thus have 'human' rights).
multipotent The potential to make a few cell types in the body. Usually in reference to adult stem
cells.
muscular dystrophy A group of hereditary diseases that cause progressive muscle wastage due to
defects in the biochemistry of a muscle tissue. The most common type is Duchenne muscular
dystrophy, which is due to a defective gene on the X chromosome. Because the condition is sex-
linked, it usually only affect males. It is usually lethal by the early 20's.
mutation The process by which a gene undergoes a change in the base sequence. Some mutations
result in the gene no longer coding for the correct protein, or producing a reduced amount of the
protein.
myxoma A virus that causes myxomatosis in rabbits. It is carried by mosquitos and fleas.
myxomatosis A disease of rabbits caused by the myxoma virus. It is an early form of biological
control.
native Refers to organisms that have not been recently introduced into an ecosystem.
nuclear transfer technology (cloning) Nuclear transfer is a method of cloning a living organism. The
process involves removing the nucleus of an egg cell and replacing it with a nucleus from any cell
of the organism being cloned.
nucleus The structure within the cell that contains the chromosomes. Nuclei is the plural of nucleus.
nucleic acid DNA (deoxyribonucleic acid) or RNA (ribonucleic acid).
nucleotide The sub-unit of nucleic acids, DNA and RNA, that consists of a 5-carbon sugar, a
phosphate group and a nitrogenous base. The bases are adenine, thymine, guanine and cytosine in
DNA and adenine, uracil, guanine and cytosine in RNA.
Office of the Gene Technology Regulator (OGTR) A part of the Australian Department of Health
and Ageing that assists the Gene Technology Regulator, a statutory office holder, to administer the
Gene Technology Act 2000 (the Act). The objective of the Act is to protect the health and safety
of people and to protect the environment by identifying risks posed by, or resulting from, gene
technology and by managing those risks through regulating certain dealings with genetically
modified organisms.
oncogene A gene which normally directs cell growth, but when it becomes mutated, has the ability to
transform a normal cell into a tumor cell through uncontrolled growth.
oncovirus A virus associated with cancer.
oocyte The egg cell in a female. In nature, an oocyte will not divide or develop until it is fertilized by
a sperm cell and the nuclei of the two cells have fused
organelle An organelle is a structure within a cell that performs a particular function, for example,
mitochondria, the endoplasmic reticulum, vacuoles, chloroplasts and lysosomes. Organelles are
like smaller versions of the organs in your body, each performing a particular function to keep the
whole cell alive.
organism A living thing which contains DNA and is capable of cell replication by itself, for example,
bacteria, plants and animals.
output traits Traits produced in genetically modified crops that are beneficial or of direct value to the
consumer. For example, enhancing the quality of food and fiber, lowering the fat content or
increasing anti-oxidant levels.
115
Dr. Fahd M. Nasr
parasite An organism that lives in or on a host organism and uses it as a source of food and shelter, to
the detriment of the host.
patent A grant made by a government that allows the creator of an invention the sole right to make,
use, and sell that invention for a set period of time.
pathogen An organism or agent that causes disease. For example, bacteria, viruses, parasites and
fungi.
pathogenicity The ability to cause disease.
peptide An organic compound composed of two or more amino acids linked together chemically by
peptide bonds. A component of a polypeptide.
pesticide A chemical that kills pests. Some pesticides are more selective than others. A non-selective
pesticide tends to kill many animals apart from the pest it is aimed at (referred to as the target
species).
pharming The process of farming genetically engineered plants or animals to be used as living
pharmaceutical factories. The practice has used cows, sheep, pigs, goats, rabbits and mice to
produce large amounts of human proteins in their milk. Plants are being used to produce vaccines
and diagnostic reagents.
phenomics Phenomics is the study of an overall organism and how the characteristics or traits of an
organism that we can see (its phenotype) fits with the information we know about its genes
(genomics) and proteins (proteomics).
phenotype The visible characteristics or traits of an organism. Phenotypic traits are not necessarily
entirely genetic and are produced by its genotype interacting with the environment.
phenylketonuria (PKU) A hereditary disorder that results in reduced production of the liver enzyme
phenylalanine hydroxylase. This substance is involved in the breakdown of phenylalanine in food
to tyrosine. Without a modified diet, affected infants will develop severe, irreversible brain
damage.
pigments Chemicals that are colored. For example, the pigment melanin determines skin coloration.
plasmid A small, circular piece of DNA found in bacteria and yeasts that is able to replicate
independently of the chromosome. Plasmids are usually circular molecules of DNA.
plasticity The ability to be flexible. The ability of cells or tissue and their function to be influenced by
an activity and how they respond to distinct environmental conditions.
pluralism The belief that there are multiple opinions about an issue, each of which contains part of the
truth but none contain the whole truth.
pluripotent The ability to be able to produce any cell in the body. Usually used when referring to
embryonic stem cells.
polymerase chain reaction (PCR) (i) The process whereby a segment of DNA is copied or cloned,
using DNA polymerase so that its sequence is multiplied many times in a laboratory. (ii) The
polymerase chain reaction is a technique for quickly "amplifying" a particular piece of DNA in the
test tube (rather than in living cells). Thanks to this procedure, it’s possible to make virtually
unlimited copies of a single DNA molecule even though this molecule may be present in a mixture
containing many other different DNA molecules. In order to perform PCR, you must know at least
a portion of the sequence of the DNA molecule that you wish to replicate.
polypeptide A peptide containing anywhere between 10 and 100 molecules of amino acids.
Synonymous with protein. Peptides can either be small proteins or part of a protein. Each
polypeptide is the ultimate expression product of a gene.
polyunsaturated fat A fat that has more than one double bond in the molecule.
polymorphism Variation in DNA sequence among individuals.
post-transcriptional processing The alteration of the RNA transcript of the DNA. This may
involving cutting and splicing RNA, or modifying it in other ways.
power The term power has quite a few different meanings. For Biotechnology Online, we are
referring to an organization or individual's ability to act effectively according to their intentions,
needs, or values.
predator Animal that kills another animal for food.
primer A defined, short length of DNA used to start the copying process in PCR.
primordial germ cells The precursors of reproductive cells within the embryo. They are detectable in
an embryo after four weeks of development and will develop into either sperm or eggs.
116
Dr. Fahd M. Nasr
processed food Any food product that has undergone physical or chemical treatment resulting in a
substantial change in the original state of the food.
protein A long-chain molecule consisting of amino acids. The function of a protein is determined by
the sequence of amino acids. This sequence of amino acids is determined by the sequence of DNA
bases found in the gene coding for that protein.
proteomics/proteome All the protein products produced by an organism’s genes are referred to as the
proteome (by analogy with the genome). Proteomics is the study of these proteins and how they
interact to affect the life of the organism.
protozoa Any of a large group of single-celled, usually microscopic, organisms such as amoeba.
pseudogenes A sequence of DNA that resembles a gene but is non functional and cannot be
transcribed. It could be the remnant of a once-functional gene that has accumulated mutations.
rabies A viral disease of wild animals that can be transmitted to humans through the bite of an
infected animal. The disease has not yet been detected in Australia.
rapeseed (Brassica napus) The seed of the rape plant which is a source of edible oil. The rape plant is
a bright yellow flowering member of the Brassicaceae (mustard) family and a specific variety is
known as canola. It is generally grown and cultivated for animal feed, vegetable oil and biodiesel.
recessive Refers to the member of a pair of alleles that fails to be expressed in the phenotype of the
organism when the dominant member is present. Also refers to the phenotype when an individual
has only the recessive allele.
recombinant DNA The DNA formed by combining segments of DNA from different genes or
different types of organisms.
regenerative medicine A term applied to new medical advances in which damaged body parts or
body tissue is replaced or the body is encouraged to heal itself. From our understanding of our
genes and how they work to control the growth, building and repair of our body, regenerative
medicine is studying how to create new tissues for transplant, transplant stem cells into the body
or how to induce the body to regenerate from the body's own cells.
reproductive cloning Making a full living copy of an organism. Currently illegal in Australia and
many other countries around the world.
restriction enzymes An enzyme (normally derived from bacteria) that cuts strands of DNA, at
particular points along its length into shorter fragments.
retrovirus A type of virus that contains RNA as its genetic material. Once in a host cell they perform
a "backwards" conversion of RNA to DNA, which inserts itself into an infected cell's own DNA.
Retroviruses can cause many diseases, including some cancers and AIDS.
ribosome/s Molecules in the cytoplasm of cells that coordinate the interactions between tRNAs,
mRNA and proteins in the complex process of protein synthesis. They are like factories where
proteins are synthesized.
rights These are entitlements. Some rights (human rights) belong to everyone by virtue of being
human; some rights (legal rights) belong to people by virtue of their belonging to a particular
political state.
risk Used as a term for a danger that arises unpredictably, such as being struck by a car.
RNA Ribonucleic acid, a single-stranded nucleic acid that transmits genetic information from DNA to
the cytoplasm and controls certain chemical processes in the cell, such as the synthesis of proteins.
RNA polymerase The enzyme that catalyses the synthesis of a complementary strand of RNA from
either a DNA strand or an RNA strand in some viruses.
SARS Severe Acute Respiratory Syndrome. It is caused by a virus thought to be a combination of the
Coronavirus family, a virus that is often a cause of the common cold, and the paramyxovirus
family which causes measles and mumps. The syndrome includes fever and coughing or difficulty
breathing and can be fatal. It is thought to have originated in mainland China in 2003 and has
spread to other countries.
saturated fat A fat that has only single bonds in the molecule.
selective breeding A process in which new or improved strains of plants or animals are developed,
mainly through controlled mating or crossing and selection of progeny for desired traits.
self-renewal The ability of stem cells to continue to divide and replenish themselves indefinitely.
sequencing In terms of genetics, it is determining the order of bases as you read along a length of
DNA. Having the order of the bases provides information on where genes start and stop and where
117
Dr. Fahd M. Nasr
mutations or changes have occurred. It also allows you to translate the sequence of bases within a
gene into what amino acids it codes for, and therefore what protein is produced.
sex chromosomes One of the two chromosomes that specify the sex of an organism. Humans have
two kinds of sex chromosomes, one called the X and the other Y. Normal females possess two X
chromosomes and normal males possess one X and one Y.
silencing A technique to stop or interrupt the expression of a particular gene, most commonly by the
insertion of a reverse copy of all or part of that gene.
single nucleotide polymorphisms (SNP) A change in a single nucleotide (A, T, C, or G) in a gene
sequence causing a change in expression of the gene in the individual's phenotype.
social hierarchy An arrangement within a group of animals, such as rabbits, where some individuals
are dominant over others. The more dominant an animal, the more likely it is to have preferred
access to mates and sources of food.
somatic cells Any cell in a body other than a germ cell (a reproductive cell such as sperm or egg). In
animals and many plants all somatic cells have two copies of each gene, whereas a gamete only
has a single copy of each gene.
species Living things of the same kind that are potentially able to breed together and produce fertile
offspring (i.e., offspring that themselves can reproduce). Usually, different species cannot
interbreed but this rule is not absolute (for example, a horse and donkey can interbreed to produce
a mule, although this animal cannot reproduce, see hybrid). Even within one species, interbreeding
may not always occur because of natural barriers. Among some plants and many micro-organisms,
the concept of a species does not always work. In these groups, species that appear different may
be able to successfully create offspring under certain circumstances.
species specific Pertaining to individuals of only one species. For example, a pesticide that is species
specific affects only one species.
staple length The length of the individual fibers of cotton. The length of the fibers affects the quality
of the fabric that is made from it.
stem cells (adult) Undifferentiated cells in a tissue. These cells can grow into any of the types of
specialized cells in that tissue.
sterile Incapable of reproduction. Not able to germinate or bear fruit.
STR (short tandem repeats) STRs are short DNA sequences that are repeated in a head-tail manner.
They are useful in DNA profiling.
surrogate A person or animal that functions as a substitute for another. In the case of a surrogate
mother, it is where a woman or female animal carries an embryo and ultimately gives birth to a
baby that was formed from the egg of another female.
sustainable development An approach to development that meets the needs of the present without
compromising the ability of future generations to meet their own needs. It seeks to ensure that
current development does not alter the environment's ability to recover from any damage
sustained, and which also makes use of renewable resources.
Tay-Sachs disease A lethal hereditary disease. The progressive accumulation of a substance called
ganglioside in the brain causes paralysis, mental deterioration and blindness. Death usually occurs
before the age of four.
thalassaemia A hereditary anemia resulting from reduced production of either alpha or beta
hemoglobin. Depending on the type, the condition can be fatal before or just after birth, or can
result in varying levels of anemia and development difficulties.
therapeutic cloning Generally referred to as somatic cell nuclear transfer technology. It involves
replacing the nucleus of an egg cell with the nucleus from a cell from a patient's body and
allowing it to develop to form a blastocyst. The embryonic stem cells from the inner cell mass are
then harvested and used to establish a cell line that has the same genetic makeup of the patient.
These cells can then be directed to develop into the tissue needed for transplant.
tissue culture A process involving the separation of cells from each other and their growth in a
container of liquid nutrients .
totipotent Cells capable of forming a completely new embryo that can develop into a new organism.
For example, a fertilized egg is totipotent.
trait A feature that is genetically controlled.
118
Dr. Fahd M. Nasr
transcription The process of copying information from DNA into new strands of messenger RNA
(mRNA). The mRNA then carries this information to the cytoplasm, where it serves as the
blueprint for the manufacture of a specific protein.
transgenic Refers to an organism with one or more genes that have been transferred to it from another
organism using recombinant DNA techniques. An organism whose gamete cells contain genetic
material from another organism, or contain genetic material that has been altered in some other
way for example using gene silencing techniques.
trisomy Having three copies of a particular chromosome in each somatic (body) cell instead of the
normal two copies. This leads to certain conditions for example Down syndrome (trisomy 21) or
Edwards syndrome (trisomy 18)
unspecialized Having no specific function.
vaccine A preparation that contains either whole disease-causing organisms such as viruses which
have been killed or weakened, or parts of such organisms, used to confer immunity against the
disease that the organisms cause. Vaccine preparations can be natural, synthetic or derived by
recombinant DNA technology.
value-added traits Modified crops produced with traits such as improved taste, nutritional value, or
utility to provide value for the consumer.
vector Something used as a vehicle for transfer. A bacteriophage, plasmid, or other agent that transfers
genetic material from one cell to another. It can often be used carry foreign DNA into a host cell.
A disease vector is an agent that transfers a pathogen from one organism to another, for example,
an insect.
virus A group of particles that do not have a cellular structure and cannot replicate outside of a host
cell. They consist of a molecule of DNA or RNA surrounded by a protein coat. Viruses can only
reproduce in living cells.
xenotransplantation The term used to describe any procedure that involves the transplantation of live
cells, tissues, or organs from one species to another, including animal-to-human transplantation.
zygote The cell resulting after an egg cell (oocyte) has been fertilized by a viable sperm cell and their
nuclei have fused. The zygote is the start of a new organism, genetically different from either
parent
119

What Is Biotechnology An Overview

Uploaded by

Copyright:

Available Formats

You might also like

What Is Biotechnology An Overview

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

What Is Biotechnology An Overview

Uploaded by

Copyright:

Available Formats

Dr. Fahd M.

II. Human uses 28

II.5.2. Who owns it? 39

III.2.3. The Bilby: a case study 76

IV. Food and agriculture 86

I.1. Then and now

I.1.3. Hearing recent history

I.1.4. Gene technology

I.2. DNA and genes

I.2.1. What is DNA?

I.2.2. Where is DNA?

I.2.3. The full set

I.2.4. What does DNA look like?

I.2.5. How does DNA work?

I.2.6. What is a gene2?

not automatically work if it is placed in a different organism. To make a gene work in a

I.2.7. Genes code for proteins

One gene being translated to a protein.

I.2.8. DNA unknown

I.3. Why do we do biotechnology?

I.3.1. For ourselves

I.3.2. For the environment

I.3.3. For food and agriculture

I.4. How do you do biotechnology?

I.4.1. Finding the gene you want

I.4.2. Cutting and pasting genes

I.4.3. Moving genes

I.4.3.a. Transferring genes to bacteria

I.4.3.b. Transferring genes to plant, animal and yeast cells

I.4.3.c. Transferring genes to egg cells

I.4.3.d. Other transformation methods

I.4.4. Reading and interpreting genes

I.4.5. Cloning a gene (polymerase chain reaction)

A photograph of DNA amplified using PCR.

I.4.6. Cloning plants

I.4.7. Cloning animals

Scientists at the Monash Institute of Reproduction and Development in Melbourne believe

A cutting or a plant clone grown in a tissue culture tube.

a. Somatic cell nuclear transfer

Dolly, the world famous sheep - the first animal to be cloned.

I.5. Regulation of gene technology in Australia

I.6. Ethics of biotechnology

II. Human uses

II.1. Fighting infectious diseases

II.1.1. Severe Acute Respiratory Syndrome (SARS)

II.1.2. Bird flu (Avian influenza)

A few antibiotics used to fight infections include:

II.2.a. Antibiotic resistance

II.3. Producing human products

II.3.1. Insulin for diabetes

II.3.3. ‘Pharming’ proteins

II.3.3.b. Pharming with animals

II.3.3.c. Pharming with plants

II.4. Reproductive technologies

II.4.1. Pre-implantation genetic diagnosis

II.5. The human genome project

II.5.1. What have we found?

The number of genes in humans