THEJOUHNAI.
OF BlOLOClCAL CHEMISTRY
Vol. 258, No. 19, Issue of October 10, pp. 11974-11980, 1983
Printed in U. S . A.
Characterization of tRNA Precursor Splicing inMammalian Extracts*
Frank A. Laski, Andrew Z. Fire, Uttam L. RajBhandaryS, andPhillip A. Sharp$
From the Center for Cancer Research and the DeDartment of Biology, Massachusetts Institute of Technology,
Cambridge, Massachusetts 02139
Transcription of a Xenopus laevis tRNATYrgene and
splicing of the transcript have been studied in HeLa
cell extracts. This tRNATy’gene has a 13-base inter-
vening sequence and is expressed as mature tRNA
when transfected into mammalian cells. The tRNATYr
gene istranscribed under conditions of low concentra-
tions of magnesium and ATP, but is processed by splic-
ing only when both of these cofactors are added at
higher concentrations. The endonucleolytic activity of
the tRNA-splicing system in the HeLa extract produces
exons with 3’-phosphate and B’-hydroxyl groups. The
3”phosphate is retained during the ligation reaction
and formsthe phosphodiester bond in the mature
tRNA. Retention of the 3”phosphate during tRNA
splicingdiffers from the more extensively studied
process in yeast extracts wherea phosphate group from
an ATP cofactor is used to form the phosphodiester
bond joining the exons.Thus, eucaryotic organisms can
splice tRNA precursors by at least two distinguishable
mechanisms.
Many eucaryotic tRNA genes containinterveningse-
quences (1).These sequences are excised from thetRNA
precursor by the action of two distinct activities, an endonu-
clease activity which cleaves the precursor into three frag-
ments, the5‘ and 3’ exons and the intron, and a ligase activity
which subsequentlyjoinsthe two exons (2,3).In yeast,
endonuclease cleavage of the precursor leaves a cyclic 2’:3‘-
phosphate on the 5’ exon and a 5‘-hydroxyl on the 3’ exon
(4). This 5“hydroxylgroup is then phosphorylatedby transfer
of y-phosphate from ATP and further activatedby transfer
of AMP using a second molecule of ATP (5). Ligation of the
two exons results in t,he formation of a 2‘-phosphomonoes-
(<,I
ter”3’,5‘-phosphodiester bond N . The
phosphate
P (0.3 M Hepes NaOH, pH 7.9, 1.4 M KCl, 30 mM MgCld was added,
forming the phosphodiester bond originatesfrom the y-posi-
tion of ATP, and the 2”phosphate isderived from the cyclic
2’:3’-phosphate. The 2’-phosphate is subsequently removed
by a phosphatase (5).
* This work was supported in part by National Institutes of Health
(Core) GrantPol-CAI4051tothe Center for Cancer Biology at
Massachusetts Institute of Technology. The costs of publication of
this article were defrayed in part by the payment of page charges.
This article must therefore be hereby marked “aduertisement” in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
$ Supported by National Institutes of Health Grant GM17151 and
American Cancer Society Grant NP114.
$Supported by National Institutes of Health ProgramProject
Grant POlCA26717 andNational Science FoundationGrant
PCM823230.
11974
This is an Open Access article under the CC BY license.
(Received for publication, March 14, 1983)
The ligation process for yeast tRNA splicing is similar to
that characterized for RNA ligation in wheat germ extracts
(6, 7). In particular, the novel 2’-phosphomonoester-3’,5’-
phosphodiester linkage product described above as an inter-
mediate in yeast tRNA splicing was previously characterized
in wheat germ.
Splicing of tRNA precursors hasalso been studied in Xen-
opus luevis oocytes. These studies suggested that the endo-
nucleolytic cleavage of the precursorleaves 3”phosphate and
5”hydroxyl termini, and that, in contrast to the observations
in yeast, the 3”phosphate is retained in the phosphodiester
bond formed during ligation (8).
As part of our efforts to generate suppressors which func-
tioninmammalian cells, we haveshown that a X . luevis
tRNATyrgene (Fig. 1) is efficiently expressed in mammalian
cells (9). This gene had been previously sequenced and con-
tains a 13-baseintron (10). Site-specific mutagenesiswas used
to generate an amber suppressor (Su’) tRNA gene which has
been shown to yield active suppressor tRNA in mammalian
cells (11).Here we describe the results of transcription of
both the Su- (wild type tRNATYr) and Su+ tRNAgenes and
splicing of the precursor RNAsin HeLa cell extracts.
MATERIALS AND METHODS
Plasmids-pSV-tT is a recombinant of pBR322, SV40, and a 263-
base pair fragment of X . lueuis DNA which contains the tRNATY’
gene (9). This tRNAgene is substituted between the HhaIrestriction
sites in the late region of SV40 DNA. pBR322-SV40 is the parental
DNA for pSV-tT; the two DNAs are recombined at their BarnHI
sites. pSV-tT-2-Su+ was made by site-directed mutagenesis of pSV-
tT and contains anamber suppressor tRNATYr gene (11).
Preparation of HeLa SI00 Extract-HeLa SlOO extracts (12) were
prepared by a modification of the procedure of Weil et d. (13). All
operations were at 4 “C. Cells were harvested and washed once with
5 packed cell volumes of phosphate-buffered saline and once with 5
packed cell volumes of buffer A (10 mM Hepes’ NaOH, pH 7.9, 10
mM KCI, 1.5 mM MgC12, 0.5 mM dithiothreitol), and resuspended in
3 packed cell volumes of buffer A. After 20 min, cells were lysed with
eight strokes in a Dounce homogenizer (B-type pestle), ’/loth volume
and the material was centrifuged at 36,000 rpm in a SW 41 rotor for
60 min. The supernatantwas dialyzed in Spectrapor D1615-2 tubing
for 3 h against 100 volumes of buffer B (20 mM Hepes NaOH, pH
7.9, 20% glycerol, 0.5 mM EDTA, 0.5 mM dithiothreitol, 100 mM
KCI). The resulting extract transcribed the tyrosine tRNA gene
without additional magnesium as described in the text. Cleavage of
the tRNA at splice junctions was dependent in these extracts on
added MgCI2. Overnight (20 h) dialysis yielded extracts that were
magnesium-dependent both for transcription and splicing (data not
shown).
I n Vitro Transcription and Splicing-A standard transcription
reaction contained 1pg of covalently closed circular DNA as template
in a 20-pI reaction volume that was 50%, by volume, HeLa SlOO
extract. The reactions contained 200 p~ concentration each of the
The abbreviation used is: Hepes, 4-(2-hydroxyethyl)-l-piperazi-
neethanesulfonic acid.
 in HeLa
Transfer RNA SplicingExtracts 11975

A -50 -40 -3: -20 -10 Tyr 10

tha I tRNA- *
~CACCCTCTACCACCTCAACAATTCAA~CCACCAA~CAC~~~CCCATGCCTCCCCCACC~CATACCTCAG
CCCGCTGCCACATCCTCCACTCTAACTTCACCTCCTCACTCCCCCCTACCCACCCCCTCCCC CAACCTATCCACTC

20 3p 3; 3p o; 5p 60 7p 13

Hac11
ACCACACCACACCCCACTCA~-3'
TCCTCTGCTCTCCCCTCACT~CCCCR-5'
mmaI

A 0"
B C
C
A
PC * G
C ' G
U * AT0
U . A
C - G
G - C
A - U 60

D
c G A ,,,ZAu
CUCG, . . ...
C G G C C u
G

A - U

30 G .
G - C
C 40

c
A * *A-A'
GAGc
U
U m'G-G

cs" * A UGUGA
FIG.1. Sequence of X. laevis tRNATYrgene of the tRNA
precursor. A , DNA sequence of the 263-base pair Hhal-HaelI re-
strictionfragment.Thisfragment is substituted for the Hhal B
fragment in the late region of SV40 in the recombinant pSV-tT. The
boxed sequence is the region coding for the mature tRNATy'. The
coding sequences are interrupted by a 13-base pair intervening se-
quence. The arrow signifies the direction of transcription. The se-
quence was determined by Muller and Clarkson (10).R, sequence and
secondary structure of X . laeuis tRNATvr (9), including the 13-base
intron. The tRNATY'(Su') contains a C at position 34.

unlabeled nucleoside triphosphates, 20 p~ a-"'P-labeled nucleoside

triphosphate, and 10 mM creatine phosphate. Between10 and 100
pCi of rzP were used per reaction. Reactions were incubated a t 30 "C
for 90 min.Splicingconditions were identicalwith transcription
conditions except that MgCI, is added to 7 mM and ATP is added to
1 mM.
Electrophoresis and Fingerprint Analysis of tRNA-RNase T 1
digestion, thin layer chromatography, and fingerprint analysis were
performed as describedpreviously (9, 14). SecondaryRNase T2
digestions were resolved in one dimension on precoatedcellulose TLC
plates (Merck 5757) as described previously. The solvent used was
isobutyric acidNH,OH:HZO (15:1:10, v/v).
RESULTS
I n Vitro Transcription
SlOO extracts of mammalian cells contain RNA Pol111 and
factors necessary for transcription of tRNA genes (12, 13). A
recombinant (pSV-tT) containing the X . laeuis tRNATyrgene
generated a RNA product approximately 95 bases long when
incubated in a SlOO extract (Fig. 2, lanes 4 and 5). A similar
recombinant lacking the tRNATy' gene yielded only a slight
background in this region of the gel (Fig. 2, lanes 1 and 2). A
typical reaction containing 1 pg of pSV-tT DNA (about 2 X
10" pmol of template) produced about 6 X pmol of the
95-base product in a 90-min reaction. Fingerprint analysis of
FIG.2. Autoradiogram of [32P]RNA products made by in
vitro transcription in a HeLa SlOO extract using pBR322-
SV40 (lanes I and 2)or pSV-tT (lanes 4 and 5 ) as a template.
Lunes I and 4 contain 1 pg of plasmid DNA that was incubated for
90 min a t 30 'C, and lanes 2 and 5 contain '13 pg of plasmid DNA that
was incubated for 90 min a t 37 'C. Each reaction contained 10 pCi of
[m-"'P]UTP as label. Lune 3 contains ["PIRNA purified from CV-1
cells by hybridization to pSV-tTDNA. This cellular tRNA isidentical
in sequence with the X . laeuis tRNATy' gene (9). Thelocations of the
mature in viuo tRNATyr and the95-base in vitro tRNATY' precursor
are shown.
this RNA has shown that the 95-base RNA is a tRNATyr
precursor that contains flanking sequences and the 13-base
intron (see below).
Splicing of the in Vitro Transcript
The 95-base precursor RNA was the predominant product
synthesized under standardconditions of low Mg' and ATP.
Smaller RNA products were observed if higher concentrations
of M$+ and ATP were used. To test whether these shorter
RNAs resulted from processing of the precursor, the 95-base
11976 Transfer RNA Splicing in HeLa Extracts

A B
1 2 3 1 2 3 4 5 6
tRNA’” (95b)
FIG. 3. In vitro splicing of tRNA
precursor in a HeLa S l O O extract.
4 3 -Precursor
A , 95-base RNA labeledwith [w:”P]
UTP was purified by gel electrophoresis ’RNA
-Precursor (95b)
and incubated under three different con-
ditions. In each lane the RNAwas in- -Spliced tRNA 3’half (45 b)
cubated for 30 min a t 30 “C in a 20-pl (82b)
5’ half (37 b)
reaction that was 50% HeLa SlOO ex-
tract. Lone I , no further additions; fane
2, the reaction alsocontained 7 mM
MgCI?; lane 3, the reaction contained 7
mM MgCI, and 1 mM ATP. RNAs were
resolved by electrophoresis ona 7.5% - 3’ half (45 b)
acrylamide, 8 M urea gel. B, 95-base RNA
labeled with [w”’P]CTP (fanesI and 4 , - 5‘ half (37b) Intron (13b )
[u-:”P]GTP (fanes 2 and 5). or [w:)’P]
UTP (fanes3 and 6 ) was either directly
loaded onto a 15% acrylamide, 8 M urea
gel (fanes 1-3) or firstincubatedin a
standard reaction in the presence of 7
mM MgCI, and then loaded onto the gel
(lanes 4-6).

RNA was isolated from a gel and incubatedin the SlOO extract
under three different conditions. The 95-base transcript re-
mained unprocessed when incubated in the mixture with no i
\
added Mi’+ or ATP (Fig. 3A, lane I). Addition of M$+ (7
mM) to the extract resulted in cleavage of the precursor into
products of about 45 and 37 bases (Fig. 3A, lane 2). When
this RNA was analyzed on a higher percentage acrylamide
gel, a third band of about 13 bases was also seen (Fig. 38).
Addition of both M$+ (7 mM) and ATP (1 mM) led to the
joining of the 45- and 37-base fragments to produce another
product of about 82 bases (Fig. 3A, lane 3 ) . Fingerprint anal-
ysis was used to confirm that the 45-, 37-, 13-, and 82-base
RNAs were the 3’-half, 5’-half, excised intervening sequence,
and spliced product, respectively, of the 95-base precursor
RNA (see below).
Fig. 4 shows a time course of the processing of the 95-base
RNA. Radioactive precursor RNA was synthesized by incu-
bation of pSV-tT DNA in a HeLa SlOO extract with low M&+
for 90min. Under these conditions, only the 95-base precursor
accumulated. After 90 min, Mg+and ATP were added and
aliquots were analyzed by electrophoresis. For quantitationof
the various RNAs produced, bands were excised from the gels
and counted. After an initial sharp rise, radioactivity in the
45- and 37-base bands reached a constant level within 5 min.
The level of this plateau suggests that the rates of cleavage Time, minutes
and ligation are of a similar order. After 60 min, over 90% of
the precursorwas cleaved and over 60%was recovered as the FIG. 4. Time course of in vitro splicing. One pg of pSV-tT was
82-base spliced product. incubated in 30 pl of a HeLa SI00 extract under standard conditions
a t 30 “C. 100 pCi of [a-”PJUTP were used as label. After 90 min of
Fingerprint Analysis of RNA Transcribed and Processed in incubation (defined as time O), MgCI, and ATP were added to 7 and
1 mM, respectively. Cold UTP was also added to 2 mM to prevent
Vitro further [a-”PIUTP incorporation. Three-pl aliquotsof the reaction
Fig. 5 shows a comparison of the RNase T1 fingerprints of were removed at the time points and added to 200 pl of stop buffer
(7 M urea, 0.5% sodium dodecyl sulfate, 10 mM EDTA, 10 mM Tris,
tRNAT”’ labeled i n uiuo (9) and thevarious forms of tRNATy’ pH 7.9, 1 0 0 mM LiCI, 350 pg/ml of tRNA). After phenokchloroform
transcribed and processed in uitro. The differences between extraction and ethanol precipitation, the samples were resolved by
the fingerprintsof RNAs made in uitro and thein vivo RNAs electrophoresis through a 7.5% acrylamide, 8 M urea gel. The bands
can be entirely accounted for by (i) the presence of oligonu- were cut out and counted.
 11978 Transfer RNA
Extracts
Splicing
HeLa in
TABLEI
Sequence of RNase T1 oligonucleotides from tRNATy‘ in vitro transcripts
Oligo- 95-Base’ RNA labeled with 82-Base’ RNA labeled 45-Base’ RNA labeled 37-Base* RNA la-
nucleo- with with beled with
Deduced sequence‘
UTP GTP tide“ CTP
UTP GTP UTP GTP UTP
1 AUCCUUAGp
2’ CCUUCGp
3 CUCAGp
4 AUAGp
5 ACUGp, AUCGp
6‘ AUUCCGp
7 CUCGp
8 AAGp
9 UUCGp, U$CGp
10 UAGp
11 CUGp, UCGp
13 AGP
15 CGP
16 GP
a CAAUCCUUAGp
b CUUUGp
C ACGp
d UGP
e uu
f uuu
e ND‘
a Assigned as in Fig. 5.
* A letter (A, C, U, or G) designates the 32P-labeled3’-monophosphate nucleoside(s) released after RNase T2
digestion of the oligonucleotide.
e The deduced sequences are based on the tRNATY’ DNA sequence and RNA sequence data from the in vivo and
in vitro tRNA”’.
+ designates that the 32P-labeledoligonucleotide was present but its RNase T2 products were not determined.
e - designates that the 32P-labeledoligonucleotide was not present.

’ ND, not determined.

the 5’ end of the 95-base precursor is either theC at position Analysis of the 13-base Intron RNA
1,the G a t position -1, or theC at position -3. The precursor
Thebandmigratingas a 13-base RNAin Fig. 3B was
does not begin with the G at position -2 because no labeled
purified and digested with RNase T2, and the productswere
Gp spot was detected in the T1 digestion of GTP-labeled
analyzed by two-dimensionalthin layer chromatography.
RNA. For similar reasons, the 5’ end cannot extend beyond
These results identify the band as the 13-base excised inter-
the C at -3.
vening sequence. Thus, RNase T2 digestion of the [LY-~’P]
Analysis of 82-base RNA UTP-labeledband released32P-labeled Gpand Ap inan
approximate 3:l ratio (close to the expected 2:l ratio); diges-
The 95- and 82-base RNAs have identical 5’ and 3’ termini. tion of the [a-”PICTP-labeled band released 32P-labeled Gp
The T1 fingerprints of theUTP-labeled 95- and 82-base and Up in approximatelyequalamountsas expected and
RNAs differ in only three oligonucleotides (Fig. 5, C and D). digestion of the [a-32P]GTP-labeled band released 32P-labeled
The 95-base precursorcontains oligonucleotided (UGp), Up, Ap, and Cp in a 2:l:l ratio, again as expected.
which is derived exclusively from withintheintron,and
oligonucleotide a (CAAUCCUUAGp), of which the 5”termi- Phosphate Transfer during Splicing
nal CA comes from within the intron. The absenceof spot d During splicing, a phosphodiester bond is formed between
and replacementof spot a by spot 1(AUCCUUAGp) in digests exons. As discussed in the Introduction, the phosphate found
of the 82-base RNA shows that the 82-base RNA is derived in this 3’,5’-phosphodiester bond in tRNAs spliced in yeast
from the 95-base precursor by splicing. Spot g, which is extracts originates from the y-phosphate of an ATPcofactor.
present in varying submolar quantities in the UTP-labeled Alternatively, the phosphate group in such a newly formed
precursor, has not been identified and may be due to either bond could originate from eitherphosphate group at the
contamination or degradation. boundaries of the excised intervening sequence. The origin of
the phosphate group at the spliced junction of the tRNA (82
Analysis of 37- and 45-base RNAs base) synthesizedin the SlOO extract was analyzed by labeling
All the T1 oligonucleotides found in the spliced (82 base) with [~u-~’P]GTP.
RNA are present in the T1 digest of either the 37-base (5’- Thephosphate from the 5‘ boundary of theintron is
half) or the 45-base (3’-half) RNA (Fig. 5, E and F, and Table retained during splicing in the HeLa extract (shown below).
I). The 5’ end of the 45-base RNA has a 5’-hydroxyl group The T1 oligonucleotide UAGp occurstwice in the tRNA, once
since fingerprintsof both 82- and 45-base RNAs contain spot in the D-loop and once in the anticodon loop where it is
1. (Spot 1 of the 82-base RNA is an RNase T1 product and, immediately adjacent to thesplice junction (Fig. 1).T2 diges-
therefore, contains a 5”hydroxyl group. The co-migration of tion of UAGp obtained from afingerprint of [32P]GTP-labeled
spot 1 from the45-base RNA with that from the 82-base RNA 95-base RNA yielded two labeled3‘-monophosphates, Ap and
shows that the 45-base RNA has a 5”hydroxyl group.) The Gp (Table I). Ap is labeled by transfer of phosphate from the
37-base RNA which is derived from the 5’-half of the tRNA adjacent G residues, whereas label in Gp should only come
has a phosphate on its 3’ terminus(see below). from an adjacent G in the anticodon loop. Digestion of the
 Transfer RNAExtracts
Splicing
HeLa in 11979
UAGp oligonucleotide releasedfrom [:'2P]GTP-labeled 5'-half

*
15 RNA (37 base) also gave both Ap- and Gp-labeled products.
13 This proves that this 5'-half RNA retains its 3"phosphate
II and suggests that the endonuclease activity leaves 3"phos-
C
8 7
?&IOUAGP phate(or possibly cyclic 2':3'-phosphate as seen in yeast
extracts)and5'-hydroxyl groups. Digestion of the UAGp
9 oligonucleotides released from the spliced 82-base [,-:"PI
5 ACUGp
GTP-labeled RNA also yielded radioactive Ap and Gp prod-
4 b
3 ucts(Table I). Thusthephosphate residue atthe splice
junction (connecting theG at position 37 to theA at position
6' 38 in the mature tRNA)originally formed the phosphodiester
2' bondbetween the G at position 37 and the G at the first
+-
position of the intron.
Additional evidence for retention of the 3"phosphate in
the spliced tRNA was obtained from the use of tRNATr' (Su')
gene as a template. The tRNATy'(Su') gene is identical with
A the wild type gene exceptthat theSu' gene has a Cat position
34 instead of a G (Fig. 1).The T1 fingerprints of the 82-base
['"PIGTP-labeled wild type tRNA and Su' RNA are shown
in Fig. 6, A and B, respectively. As expected, the patterns are
identical except for the presence of the oligonucleotide AC-
UCUAGp, the absence of ACUGp, and the reduced molar
yield of UAGp in the Su' transcript. (The anticodon change
C m II
in the Su' RNA eliminates the G residue which is cleaved by
T1 to yield the later two oligonucleotides.)
In the spliced Su' RNA, the 3' end of the oligonucleotide
ACUCUAGp is adjacent to the splice junction. RNase T2
4 digestion of ACUCUAGp derived from [n-"'PIGTP-labeled
3 a
spliced Su' RNA yields two labeled products, Ap and Gp, in
equal molar amounts (seeFig. 6C). Thus, the phosphate3' to
position 37 of the precursor RNA is the phosphate used to
form the splice junction in the mature tRNA.
ACUCUAGp

*
* I
B cleolytic cleavage followed by ligation (1).These two reactions
FIG.6. The RNase T1 fingerprints of the 82-base [a-'*P]
GTP-labeled RNA ( A ) and the 82-base Su+ RNA (B). As ex-
pected, the SU' RNA fingerprint differs from that of wild type RNA
by having a lower molar yield of UAGp, no detectable ACUGp (see
arrow), and an additional oligonucleotide, ACUCUAGp. In C, the
oligonucleotide ACUCUAGp (isolated from a fingerprint as that in
R) was digested with RNase T2 and the products separated by two-
dimensional thin layer chromatography. Dotted circles show locations
of internal nucleoside 3"phosphate markers.
DISCUSSION
The splicing of tRNA precursors is mediated by endonu-
have been partially characterized in extracts of yeast (4, 5).
The cleavage yields three RNA segments, the 5'-half, 3'-half,
and interveningsequence. Both themammalian cell and yeast
endonucleases leave a phosphate group on the 3' terminus
and a hydroxyl groupon the 5' terminus. However, unlike the
yeast endonuclease (4), the mammalianendonuclease requires
Mg'.The ligation reactions in yeast andmammalian extracts
are also different.In yeast extracts,ligation occurs through a
complex series of reactions that transfer the phosphate at the
3' terminus to the Z'-position and then form the new 3',5'-
phosphodiester bondby incorporation of a phosphate donated
from the y-position of a ATP (see Introduction)(5). Charac-
terization of the splicing of tRNATyrprecursors in the HeLa
cell extract shows that the 3"phosphate is retained in for-
mation of the 3',5'-phosphodiester bond between the exons.
This 3"phosphate was specifically labeled with [n-"PIGTP-
labeled precursors and was shown to be quantitatively re-
tained in the spliced product by the relative recovery of
radioactivity atthis position as compared toaninternal
nucleotide also labeled by transfer from an adjacentG residue
(Fig. 6C). Filipowicz and Shatkin (16) have also found that
the 3"phosphate is retained during splicing in mammalian
extracts. Previous studies of Nishikura and De Robertis (8)
using X . laevis oocytes suggested that the 3"phosphates on
cleaved tRNA intermediates were retained information of
the 3',5'-phosphodiester bonds. Thus, there are at least two
processes for ligation of tRNA intermediates.
The tRNA ligation reaction in yeast extracts (4, 5) is very
similar to a RNA ligation reaction in wheat germ extracts (6,
7). However, unlike the wheat germ enzymes which ligate a
11980 Transfer RNA
Extracts
Splicing
HeLa in
wide spectrum of RNA substrates, the yeast activities will scription and splicing of these genes should reveal whether
apparently only ligate the termini of cleaved tRNA interme- changes in thisregion generally reduce the efficiency of splic-
diates.' Perhaps yeast have adopted for specific ligation of ing.
tRNA intermediates a pathway common to plant cells. It is
also possiblethat manyeucaryotic cellscontain two pathways Acknowledgments-We are grateful to Drs. John Abelson, Witold
for ligation of tRNA intermediates, and particularbiochemi- Filipowicz, and Aaron Shatkin for access to unpublished work and to
Mary Esteve and Lynne Corboy for excellent technical assistance.
cal substrates and assays preferentially detectone pathway. We thank MargaritaSiafaca for help in the preparation of this
The X . laevis tRNA gene is an efficient template in mam- manuscript.
malian extracts. Transcription apparently terminates ainT -
rich tract, 9 or 10 bases beyond sequences retained in the REFERENCES
mature tRNA. These additional sequences are not cleaved 1. Abelson, J. (1979) Annu. Reu. Biochern. 4 8 , 1035-1069
from the precursor in the SlOO extract and their presence 2. O'Farrell, P. Z., Cordell, B., Valenzuela, P., Rutter, W. J., and
does notprevent splicing. Standring et al. (15) havealso Goodman, H. M. (1978) Nature (Lond.) 274,438-445
shown that precursorsof yeast t R N A P containing additional 3. Peebles, C. L., Ogden, R. C., Knapp,
.. G., and Abelson, J. (1979)
cell is, 27-35
5' and 3' sequences can be spliced in extracts of mammalian
I

4. Peebles. C. L.. Geeenheimer.. P.,. and Abelson, J. (1983) Cell 32,

cells. Although the mature X . laevis tRNATY'is extensively
, Y

525-536
modified in mammalian cells (9), most of these modifications 5. Greer, C. L., Peebles, C. L., Gegenheimer, P., and Abelson, J .
do not occur in the in vitro system and thus also cannot be (1983) Cell 3 2 , 537-546
necessary for splicing. This suggests that the splicing activi- 6. Konarska, M., Filipowicz, W., Domdey, H., and Gross, H. J.
ties directly recognize sequence and/or conformation rather (1981) Nature (Lond.) 2 9 3 , 112-116
7. Konarska, M., Filipowicz, W., and Gross, H. J . (1982) Proc. Natl.
than particular modifications of tRNA precursors. It is inter- Acad. Sci. U. S. A. 79, 1474-1478
esting in this regard that the anticodon change converting the8. Nishikura, K., and De Robertis, E. M. (1981) J. Mol. Biol. 1 4 5 ,
Su- tRNA gene to Su' reduced the in vivo expression of the 405-420
gene &fold (11).The kinetics of in vitro cleavage of the Su' 9. Laski, F. A., Alzner-DeWeerd, B., RajBhandary, U. L., and Sharp,
precursor in the mammalian extract was 2-fold slower than P. A. (1982) Nucleic Acids Res. 1 0 , 4609-4626
that of the Su- precursor (data not shown). Whether this 10. Muller, F., and Clarkson, S.G. (1980) Cell 1 9 , 345-353
11. Laski, F. A., Belagaje, R., RajBhandary, U. L., and Sharp, P. A.
decrease in the rate of cleavage partially accounts for the (1982) Proc. Natl. Acad. Sci. U. S. A . 7 9 , 5813-5817
reduced level of in vivo synthesis of Su' tRNA is not known. 12. Wu, G.-J. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 2175-2179
Other anticodon changes in the Xenopus tRNATy' gene which 13. Weil, P. A., Segall, J., Harris, B., Ng, S.-Y., and Roeder, R. G.
would generatesuppressors of ocher andopal codons are (1979) J Biol. Chem. 254, 6163-6173
currently being made in this laboratory. Studies on the tran- 14. Silberklang, M., Gillum, A.M., and RajBhandary, U. L. (1979)
Methods Enzymol. 59,58-109
15. Standring, D. N., Venegas, A., and Rutter, W. J. (1981) Proc.
2 P . Gegenheimer,H.-J.Gabius, C.L. Peebles, and J. Abelson, Natl. Acad. Sci. U. S. A . 7 8 , 5963-5967
submitted for publication to Cell. 16. Filipowicz, W., and Shatkin, A. J. (1983) Cell 3 2 , 547-557