Human Molecular Genetics, 2016, Vol. 25, No.

8 1637–1647

doi: 10.1093/hmg/ddw041
Advance Access Publication Date: 11 February 2016
Original Article

Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019

ORIGINAL ARTICLE

Haploinsufficiency of RCBTB1 is associated with Coats

disease and familial exudative vitreoretinopathy
Jeng-Hung Wu1,†, Jorn-Hon Liu4,†, Yu-Chieh Ko3,5, Chi-Tang Wang1, Yu-Chien
Chung5, Kuo-Chang Chu7, Tze-Tze Liu2, Hsiao-Ming Chao4, Yun-Jin Jiang7, *,
Shih-Jen Chen5, * and Ming-Yi Chung1,6, *
1
Department of Life Sciences and Institute of Genome Sciences, 2Genome Research Center, 3Faculty of Medicine,
School of Medicine, National Yang-Ming University, Taipei 11221, Taiwan, ROC, 4Department of Ophthalmology,
Cheng-Hsin General Hospital, Taipei, 11220, Taiwan, ROC, 5Department of Ophthalmology, 6Department of
Medical Research, Taipei Veterans General Hospital, Taipei, 11217, Taiwan, ROC and 7Institute of Molecular and
Genomic Medicine, National Health Research Institutes, Miaoli 35053, Taiwan, ROC
*To whom correspondence should be addressed. Email: mychung@ym.edu.tw (M.-Y.C.); sjchen@vghtpe.gov.tw (S.-J.C.); yjjiang@nhri.org.tw (Y.-J.J.)

Abstract
Familial exudative vitreoretinopathy (FEVR) belongs to a group of genetically and clinically heterogeneous disorders in retinal
vascular development. To date, in approximately 50% of patients with FEVR, pathogenic mutations have been detected in FZD4,
LRP5, TSPAN12, NDP and ZNF408. In this study, we identified two heterozygous frameshift mutations in RCBTB1 from three
Taiwanese cases through exome sequencing. In patient-derived lymphoblastoid cell lines (LCLs), the protein level of RCBTB1 is
approximately half that of unaffected control LCLs, which is indicative of a haploinsufficiency mechanism. By employing transient
transfection and reporter assays for the transcriptional activity of β-catenin, we demonstrated that RCBTB1 participates in the
Norrin/FZD4 signaling pathway and that knockdown of RCBTB1 by shRNA significantly reduced nuclear accumulation of β-catenin
under Norrin and Wnt3a treatments. Furthermore, transgenic fli1:EGFP zebrafish with rcbtb1 knockdown exhibited anomalies in
intersegmental and intraocular vessels. These results strongly support that reduced RCBTB1 expression may lead to defects in
angiogenesis through the Norrin-dependent Wnt pathway, and that RCBTB1 is a putative genetic cause of vitreoretinopathies.

Introduction sporadic retinal telangiectasis, is a rare disorder with an esti-

First described in 1969, familial exudative vitreoretinopathy
(FEVR; [OMIM 133780, 305390, 605750, 601813, 613310, and
616468]) is a rare developmental disorder of the retinal blood ves-
sels characterized by incomplete peripheral vascularization (1,2).
FEVR has two prominent clinical features: intrafamilial variabil-
ity (3–8), in which individuals carrying the same mutation may
present with a wide range of severities, from asymptomatic to
the most complicated retinal detachments (RDs); and disease
asymmetry, with presentations of severity varying between the
two eyes (9,10). Coats disease (OMIM 3 00 216), also known as
mated incidence of 0.09 in 100 000 in UK (11). In addition to pre-
dominantly affecting males and typically affecting only one
eye, Coats disease is characterized by telangiectasia of the retinal
vessels, subretinal lipid exudation, macular edema and RD re-
sulting from defects in retinal vascular development (12–14).
Both FEVR and Coats disease, in addition to other congenital
vitreoretinopathies such as persistent hyperplastic primary
vitreous (OMIM 611308) and Norrie disease (OMIM 310600),
share similar fundus features, including avascularization of the
peripheral retina and subretinal exudation. Therefore, they

†
These authors contributed equally to this work.
Received: December 15, 2015. Revised and Accepted: February 8, 2016
© The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

1637
 1638 | Human Molecular Genetics, 2016, Vol. 25, No. 8

have been proposed to be in a spectrum of vitreoretinopathies
(4,6,9,15–18).
Various Mendelian inheritance patterns of FEVR have been
documented (15,19–21), mainly autosomal dominant with re-
duced penetrance estimated to be less than 50% (22) and thus
may appear as sporadic cases. To date, mutations in five genes,
namely frizzled 4 (FZD4 [OMIM 6 04 579]), low-density lipoprotein
receptor-related protein 5 (LRP5 [OMIM 6 03 506]), tetraspanin-12
(TSPAN12 [OMIM 6 13 138]), Norrin (NDP [OMIM 3 00 658]) and
with informed consent (Fig. 1; Supplementary Material, Fig. S1).
We performed direct sequencing of the exons and exon–intron
boundaries of the five candidate genes, i.e. FDZ4, LRP5, NDP,
TSPAN12 and ZNF408, in the affected participants. We found
two previously identified mutations in FZD4 in two families,
specifically, c.313A>G in family E1 and c.1282_1285delGACA in
family E10; and detected a novel single-nucleotide variant (NM_
000266.3:c.-77A>G) at the 5′UTR of NDP in family E9. This was not
detected in 320 X chromosomes from ethnically matched popula-

Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019

zinc finger protein 408 (ZNF408 [OMIM 6 16 454]), have been iden-
tified to be highly associated with FEVR (6,15,17,23–26). All of
these genes have been found to play a role in normal vascular de-
velopment in animal models, and the first four genes are crucial
components of the Norrin-induced FZD4/β-catenin signaling
pathway (23,27). However, mutations in these genes account for
only approximately 50% of cases of FEVR (6,17,28) and other
vitreoretinopathies such as Coats disease and Norrie disease
have also been demonstrated sharing the same genetic factors
(NDP and/or FZD4) (29,30). Although Coats disease usually ap-
peared sporadic, there are genetic evidences that Coats disease
is linked to the NDP/wnt signaling pathway, one is a somatic mu-
tation in NDP identified in a boy (12) and the other is a germline
mutation also in NDP in an affected female who gave birth to a
boy diagnosed with Norrie disease (31). These findings have sug-
gested that vitreoretinopathies may result from mutations from
the same group of genes and that additional underlying genetic
factors for these disorders may also exist and function in early
retinal vascular development.
tion controls. To evaluate whether this 5′UTR mutation affects
the NDP expression level, we generated constructs with a wild-
type (WT) or mutant 5′UTR upstream of the firefly luciferase cod-
ing sequence. According to normalized luciferase activities, we
estimated the expression level in the mutant 5′UTR to be half
that of the WT 5′UTR (Supplementary Material, Fig. S2). To assess
the effect of this mutation on the Norrin-dependent Wnt signal-
ing pathway, we cotransfected the NDP expression constructs
with a WT or mutant 5′UTR at two different doses with FZD4,
LRP5 expression constructs and a reporter with TCF/LEF-binding
sites into ARPE19 cells. The results revealed a dose-dependent re-
duction of Wnt signaling. A significant reduction of the reporter
was evident only in transfections with a higher dose of NDP con-
structs (150 ng), but not in the group with a lower construct dose
(75 ng) (Supplementary Material, Fig. S2). Because of limited
information regarding the physiological concentration of Norrin
during retinal angiogenesis, we could not reach a definitive
conclusion on whether this variant was the major genetic factor
and a sufficient cause of FEVR in family E9.

Results
Family recruitment and mutation screening for known
FEVR-related genes
Fifteen patients diagnosed with FEVR or Coats disease and their
family members were recruited from nine Taiwanese families
Exome sequencing and identification of potentially
pathogenic variants
To detect disease-associated novel variants, we performed
whole-exome sequencing in affected individuals from families
E5 (II-1), E6 (II-1) and E9 (III-2 and III-4). For each case, the average

Figure 1. Pedigrees of two families with heterozygous mutations in RCBTB1 and the clinical features of affected members. (A) Pedigree structure and partial
chromatograms of Sanger confirmation sequencing for families E5 and E9. Because of the reduced penetrance and phenotypic variability in FEVR, the mothers in
family E9 were assumed to be nonpenetrant carriers. (B) Fundi of three members in family E9. Both eyes were affected in individuals III-2 and III-4. In individual III-2,
disc-dragging with macular ectopia in the right eye and total RD in the left eye were evident. The fundi of individual III-4 exhibited a fibrovascular stalk (arrowhead)
emanating from the disc to the periphery in the right eye, and disc-dragging with macular ectopia in the left eye. The fundi of carrier II-4 appeared unremarkable. (C)
The fundus of individual II-1 of family E5 exhibited marked subretinal lipid exudates (arrowhead), with total exudative detachment in the right eye. The left eye was
unremarkable. The diagnosis was Coats disease on the right eye. The retina was reattached after cryopexy, pars plana vitrectomy and removal of the subretinal
fibrous cord and encircling buckle. However, a massive lipid exudate remained at the posterior pole. OD, right eye; OS, left eye. *Reference sequences for RCBTB1:
NM_018191.3, NC_000013.10.

Table 1. Clinical characterization of subjects
Family ID E9
Individual ID III-2 III-4
Sex M M
Mutation NDP: c.-77A>G
RCBTB1: c.1172+1G>A ( p.Glu349Glyfs*17)
Onset age Congenital Congenital
Clinical features
Anterior segment
OD Unremarkable Status post intraocular lens implantation
OS Cornea opacity Unremarkable
Fundoscopic exam
OD Macular ectopia Fibrovascular stalk
OS Traction RD and Macular ectopia
retinal break
Reference sequences for NDP and RTBCB1 are NM_000266.3 and NM_018191.3, respectively.
+, Present; −, absent; F, female; ID, intellectual disability; M, male; ND, not documented; OD, right eye; OS, left eye.
coverage was at least 90-fold, with more than 90% of the targeted
exons covered at least 20 times. Because of the availability of a
pair of third-degree relatives (i.e. III-2 and III-4 in E9), we first ana-
lyzed their exome data. After conducting variant filtering to fulfill
an autosomal dominant or X-linked inheritance and to exclude
known variants in dbSNP 138, we identified 130 candidate var-
iants in both III-2 and III-4 in family E9 (Supplementary Material,
Table S1), 27 of which passed confirmation based on information
provided by the Ensembl Genome Browser. To further narrow
down the candidate gene list, we included the exome data of II-
1 in E5 and II-1 in E6, and applied the modified overlap strategy
(32) by focusing on novel variants in the same gene in at least
two of the three families. We identified two novel variants with
predicted damaging effects in RCBTB1 in families E5 and E9.
In family E5, we detected a single-nucleotide deletion (NM_
018191.3:c.707delA) in RCBTB1 for individual II-1, who had been
diagnosed with Coats disease, and in his unaffected father (indi-
vidual I-1) (Fig. 1A). In family E9, a canonical splice-site variant
(NM_018191.3:c.1172+1G>A, NC_000013.10:g.50118872C>T) was
found in two cousins diagnosed with FEVR and their asymptom-
atic mothers (Fig. 1A). Neither of these two variants was detected
in 186 unrelated, ethnic-matched population controls and was
not present as rare variants in the Phase 3 1000 Genomes variants
(33). The clinical characteristics of these two families are
summarized in Table 1 and Figure 1. We also performed direct se-
quencing of all the exons and exon–intron boundaries of RCBTB1
in the affected participants of the other recruited families. The
results revealed only common single-nucleotide polymorphisms
(SNPs) rather than the novel damaging SNVs (Supplementary
Material, Table S2).
Effect of novel variants on gene products
The RCBTB1 gene contains 13 exons encoding a 531-amino-acid
protein with two predicted domains, namely RCC1 at the N-ter-
minus and the BTB domain at the C-terminus (Fig. 2A), and it is
ubiquitously expressed in various tissues (Supplementary Mater-
ial, Fig. S3). The single-nucleotide deletion (c.707delA) in family
E5 is located in exon 7, whereas the novel variant (c.1172+1G>A)
in family E9 was located at the splicing donor site of intron 10. To
verify the effect of the splice-site variant on the RCBTB1 tran-
script, we performed RT-PCR followed by amplicon sequencing,
where we used the leukocyte RNA from the participants of family
E9. An aberrant transcript with a skipped exon 10 was found,
Human Molecular Genetics, 2016, Vol. 25, No. 8 | 1639
E5
II-2 II-4 I-1 I-2 II-2
F F M M F
RCBTB1: c.707delA –
( p.Asn236Thrfs*11)
– – 3 y/o – –
Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019
Unremarkable Unremarkable Aphakia ND ND
Unremarkable
Unremarkable Unremarkable Exudative RD ND ND
Unremarkable
and a frameshift with a truncated protein was predicted (NP_
060661.3:p.Glu349Glyfs*17) (Fig. 2A and B). Immunoblot analysis
of RCBTB1 using total proteins from LCLs from carriers of family
E9 revealed an expression level that was approximately half that
of control LCLs without predicted truncated proteins (Fig. 2C),
suggesting the haploinsufficiency of this variant on RCBTB1.
Functional characterization of rcbtb1 in zebrafish
To examine the role of RCBTB1 in angiogenesis in vivo, we con-
ducted morpholino (MO)-mediated knockdown of rcbtb1 in the
Tg(fli1:EGFP) zebrafish line (34) to investigate its effects on embry-
onic blood vessel development. Compared with those injected
with control MOs containing five mismatched nucleotides, mor-
phants with rcbtb1 translation-blocking MOs revealed compar-
able gross development except some anomalies in the patterns
of the vasculatures in the intersegmental vessels (ISVs) and the
intraocular vessels (IOVs). Some ISVs exhibited a smaller average
area and even appeared as a streak of cells without lumen. These
abnormalities resembled truncated ISVs at 3 days post fertiliza-
tion (dpf ) and could be partially rescued through coinjection
with human RCBTB1 mRNA (Fig. 3A and B). In a similar manner,
injections with rcbtb1 splicing MOs resulted in dose-dependent
aberrant splicing of rcbtb1 (Supplementary Material, Fig. S4) as
well as thinner ISVs, suggesting that rcbtb1 plays a role in early
embryonic angiogenesis in zebrafish. To accurately model clinic-
al phenotypes of FEVR, we further investigated the effect of rcbtb1
knockdown on IOVs in zebrafish using the ndp translation-block-
ing MOs as a positive control. As expected, injections with ndp
MOs resulted in narrow IOVs and an increased area of avascular-
ization at 4 dpf, without inducing obvious effects on the ISVs
(Fig. 3C–E). We categorized the IOV phenotypes of the ndp mor-
phants into three classes according to the proportion of the avas-
cular area: class I was the baseline; class II indicated thinner IOVs
and an avascular area range between 25 and 50% and class III
represented thinner IOVs and an avascular area larger than
50% (Fig. 3C). Compared with the IOV phenotypes in the ndp mor-
phants, a milder effect was found in the rcbtb1 morphants, specif-
ically 79 and 87% in classes II to III for rcbtb1 and ndp morphant
groups, respectively. To determine the genetic interactions be-
tween Norrin signaling and rcbtb1 during IOV development in
vivo, we investigated the effect of combined MOs targeting ndp
and rcbtb1. Coinjections of half-dose ndp MOs (3 ng) with rcbtb1
mismatch-control MOs (3 ng) resulted in mild IOV anomalies
 1640 | Human Molecular Genetics, 2016, Vol. 25, No. 8

Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019

Figure 2. Effect of splice-site mutation on mRNA and protein expression. (A) RCBTB1 gene structure and predicted domains. The UTRs and coding sequences are indicated
in the clear and solid boxes, respectively, and are labeled with exon numbers. Domains in RCBTB1 (UniProt Q8NDN9) include RCC1 (blue) and BTB (green). The nucleotide
positions and predicted changes in amino acids of the two heterozygous mutations identified in families E5 and E9 are indicated below the gene structure. The predicted
additional amino acid residues located downstream of the frameshift mutations are in red. RCC1, the regulator of chromosome condensation 1; BTB, BR-C, ttk and bab. (B)
Aberrant RTBCB1 transcripts with skipped exon 10 were identified through RT-PCR by using RNA extracted from peripheral blood leukocytes from the members of family
E9. Direct sequencing of the RT-PCR products revealed the direct joining of exons 9 and 11 of RCBTB1, and a frameshift mutation with premature termination ( p.
Glu349Glyfs*17) was predicted. Messenger RNA without reverse transcription was used as the template for the negative control, RT(–). (C) Immunoblot analysis of
RCBTB1 (apparent mobility at ∼55 kDa) in LCLs derived from the members of family E9 or baseline controls. The predicted truncated form (∼38 kDa) was not detected,
and approximately half the expression level of WT RCBTB1 was noted in all heterozygotes from family E9.

(25% of class II, but 0% of class III), whereas coinjections of half-
dose ndp MOs (3 ng) with rcbtb1 MOs (3 ng) severely impaired the
IOV structure, and resembled those observed in the working-dose
ndp morphants (Fig. 3C and D, respectively). These findings
suggest that rcbtb1 is involved in the Norrin-dependent IOV
development in zebrafish.
RCBTB1 participates in the Norrin/β-catenin signaling
pathway by regulating the nuclear accumulation
of β-catenin
We determined the role of RCBTB1 in the Norrin/β-catenin signal-
ing by performing TCF/LEF reporter assays in ARPE19 cells. Cells
were cotransfected with plasmids expressing FZD4 and LRP5, re-
porter constructs and one of the two RCBTB1-targeting shRNA
plasmids (shRCBTB1-1 or shRCBTB1-2) with different knockdown
efficiency, or the pLKO.1 vector as a sham control. At 24 h after
transfection, the cells were cultured in the presence of 0, 62.5 or
125 ng/mL recombinant human Norrin (rhNorrin) for another
24 h. Compared with no-ligand and mutant reporter controls
(M51), both concentrations of rhNorrin can effectively activate
TCF/LEF-driven expression of luciferase in a dose-dependent
manner (Fig. 4A). In the RCBTB1 knockdown groups, we estimated
the Norrin-induced activation to be approximately 50 and 33% of
that of the vector control under high and low doses of Norrin, re-
spectively, and the reduction of Norrin-induced signaling was
proportional to the knockdown efficiency of the shRNA plasmids
(Fig. 4A; Supplementary Material, Fig. S5). A more pronounced re-
duction of Norrin-induced signaling upon RCBTB1 knockdown at
a lower dose of Norrin may reflect a synergistic effect between
NDP and RCBTB1, indicating that RCBTB1 may be involved in the
Norrin/β-catenin signaling pathway. To further investigate the
ligand-specific response of RCBTB1 in Norrin-dependent signal-
ing, cells cotransfected with FZD4, LRP5, reporter constructs and
RCBTB1-targeting shRNA plasmids or the pLKO.1 vector were in-
cubated in a medium with 100 ng/mL Wnt3a, and we also found a
reduction in reporter activity for the RCBTB1 knockdown group
(Fig. 4A). These results suggest that RCBTB1 may be a common
downstream component of the FZD4/LRP5 signaling pathway.
Because β-catenin is tightly regulated in both cytoplasm and nu-
cleus, the effect of RCBTB1 on β-catenin in different cellular com-
partments in ARPE19 cells with or without Norrin/Wnt3a
activation was analyzed and quantified by subcellular
fractionation and immunoblot analyses. The quality of the frac-
tionation was assessed using Lamin B1 and GAPDH as markers
for nuclear and cytosolic fractions, respectively (Fig. 4B). In
APRE19 cells transfected with FZD4/LRP5, the nonphosphory-
lated β-catenin was upregulated significantly in the nuclear frac-
tion under Norrin/Wnt3a activation for 4 h. However, the
increase of nuclear β-catenin under Norrin/Wnt3a activation
was abolished in RCBTB1 knockdown groups without affecting
the level of β-catenin in the cytosolic fractions (Fig. 4B and C).
This effect was similarly revealed at the single-cell level in im-
munofluorescence analysis using an anti-β-catenin antibody in
ARPE19 cells transfected with FZD4, LRP5 and either RCBTB1-tar-
geting shRNA or the pLKO.1 vector under serum-free media with
250 ng/mL rhNorrin or Wnt3a for 4 h. The cells in RCBTB1 knock-
down groups revealed significantly reduced nuclear accumula-
tion of β-catenin under treatments with either Norrin or Wnt3a
(Fig. 4D), suggesting that RCBTB1 is located upstream of β-catenin
and regulates its nuclear accumulation in the FZD/β-catenin sig-
naling pathway.
Discussion
By employing exome sequencing, bioinformatic analysis and the
modified overlap strategy, we identified two frameshift mutations
in RCBTB1 (c.707delA and c.1172+1G>A) in two unrelated Taiwan-
ese families affected by Coats disease and FEVR. To date, in add-
ition to the five FEVR-associated genes, RCBTB1 was identified as
the sixth putative causative gene in two out of nine families,
reflecting the genetic heterogeneity of FEVR and suggesting that
other genetic factors may also contribute to the development of
vitreoretinopathies.
RCBTB1, also known as CLLD7, is located at chromosome
13q14.3, which is frequently deleted in cases of B-cell chronic
lymphocytic leukemia and other neoplasms (35). Although
RCBTB1 was thought to be a tumor suppressor gene (35), its physio-
logic and pathologic roles remain unclear because of limited ex-
perimental data (36). RCBTB1 is composed of two domains: the
N-terminal RCC1 domain may act as a guanine exchange factor
for Ran (37), a critical protein for nuclear transport and the BTB do-
main is implicated in protein–protein interactions (38). Moreover,
a previous study found that the BTB domain of RCBTB1 can act as a
substrate adaptor for the CUL3-based E3 ligase and can interact
with UbcM2, a highly conserved E2 ubiquitin-conjugating enzyme
 Human Molecular Genetics, 2016, Vol. 25, No. 8 | 1641

Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019

Figure 3. Functional characterization of RCBTB1 through morpholino (MO)-mediated gene knockdown in zebrafish embryos. (A) Morphant rcbtb1 zebrafish showed thinner
and irregular ISVs. Lateral views of trunk vasculatures (dorsal side facing up) in fli1:EGFP transgenic larvae at 3 dpf injected with the control MO, rcbtb1-ATG MO, or
combinations of rcbtb1-ATG MO and mRNA encoding human WT RCBTB1. ISVs project from the dorsal aorta toward the dorsal longitudinal vessel at the top. (B)
Quantitative analysis of the average areas of eight ISVs counted posteriorly from the urogenital pole in different morphant groups normalized to the average of no-
injection controls. The values are represented as the mean ± standard error of the mean (SEM). Asterisks indicate a significant difference, with a P of <0.05. (C)
 1642 | Human Molecular Genetics, 2016, Vol. 25, No. 8

Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019

Figure 4. Knockdown of RCBTB1 significantly reduced the activation of the Norrin- or Wnt3a-mediated Wnt/β-catenin pathway by reducing the nuclear accumulation of β-
catenin. (A) Luciferase assays were conducted using ARPE19 cells. The cells were cotransfected with shRNA targeting RCBTB1 (shRCBTB1-1 and shRCBTB1-2) or the vector
control ( pLKO.1), with expression vectors encoded for human FZD4, LRP5 and pmirGlo-derived dual luciferase constructs with seven human TCF/LEF-binding sequences
(M50) or mutant TCF/LEF-binding sequences (M51) at the firefly luciferase promoter. The transfected cells were treated with 0, 62.5, 125 ng/mL rhNorrin or 100 ng/mL
Wnt3a ligands. Compared with no ligand control and mutant reporter controls (M51), both rhNorrin and Wnt3a can activate TCF/LEF-driven expression of luciferase
and the activation was significantly reduced by the expression of RCBTB1-targeting shRNA. The RLA is the ratio of Firefly and Renilla luciferase activities and is
presented as the mean ± SEM (*P < 0.05, ns, not significant). (B) Subcellular fractionation and immunoblot analysis of ARPE19 cells cotransfected with expression
vectors encoding human FZD4 and LRP5 with or without RCBTB1-targeting shRNA (shRCBTB1-1), in the presence of 250 ng/mL rhNorrin or Wnt3a for 4 h. The
nonphosphorylated β-catenin was upregulated significantly in the nuclear fraction in control groups, which was abolished in RCBTB1 knockdown groups without
affecting the level of β-catenin in the cytosolic fractions. (C) Quantification of (B) in at least triplicate. The non-P-β-catenin levels in each groups were normalized to
control groups without Norrin or Wnt3a treatment and presented as the mean ± SEM (*P < 0.05, ns, not significant). (D) Immunofluorescence with anti-β-catenin
(green) in ARPE19 cells cotransfected with expression vectors encoding human FZD4 and LRP5, shRNA targeting RCBTB1 (shRCBTB1-1) or the vector-only control
( pLKO.1) in the presence of 250 ng/mL rhNorrin or Wnt3a for 4 h. Significant nuclear accumulation of β-catenin was noted in the vector control group rather than in
the RCBTB1 knockdown group. The arrowheads indicate the locations of nuclei in cells.

(39). The abundant expression of UbcM2 in the retina (40) and an-
other E3 ubiquitin ligase, Fbxw7, has been demonstrated to act as a
potent positive regulator in angiogenesis by inhibiting Notch sig-
naling in zebrafish (41). These findings raise the possibility that
RCBTB1-mediated ubiquitination may be involved in the regula-
tion of angiogenic pathways such as Norrin-induced β-catenin sig-
naling. How these multiple roles and interactions of RCBTB1 are
conducted at the cellular level has yet to be investigated.
To link RCBTB1 to vascular development in vivo, knockdown of
rcbtb1 by morpholinos in zebrafish was performed to investigate
the role of rcbtb1 in angiogenesis. Although some poor correlation
between phenotypes in germline mutants and those in
morpholino-mediated gene knockdown were reported (42), injec-
tions with two different rcbtb1 MOs, a mismatch control, the res-
cue experiment using human WT and mutant RCBTB1 mRNA as
well as CRISPR-mediated transcriptional knockdown were
carried out to minimize the possibilities for false-positive pheno-
types and off-target effects of MOs in this study (Fig. 3; Supple-
mentary Material, Figs S6 and S7). In this way, delayed sprouting
of trunk vessels and defects in ISVs and IOVs were revealed in
rcbtb1 morphants, which mimic the avascularization in FEVR
and Coats disease under haploinsufficient RCBTB1 genotypes
and thus support the correlation between the genotypes and phe-
notypes. Moreover, compared with the phenotypes of rcbtb1

Morphant rcbtb1 zebrafish exhibited moderate defects in IOV development. The images depict the IOVs of fli1:EGFP transgenic zebrafish larvae at 4 dpf. Phenotypes of the
IOVs were categorized into three classes: baseline (class I), moderately affected (class II) and severely affected (class III). The IOVs in class I had a normal width and a
regular radial configuration, with an avascular area occupied <25% of the total space. However, narrow and less regular radial vasculatures with an avascular area
ranging between 25 and 50%, or >50%, were classified into classes II and III, respectively. (D) Semiquantitative analyses of IOV phenotypes in morphants injected with
the control MO (6 ng), rcbtb1-ATG MO (6 ng), ndp ATG MO (6 ng), or combinations of 3 ng of the rcbtb1 control or ATG MO with 3 ng of ndp ATG MO. At least 40 larvae per
condition from three independent experiments were evaluated. (E) Comparison of IOV and ISV phenotypes in fli1:EGFP transgenic larvae at 4 dpf, with the injection of 6 ng
ndp ATG MO or rcbtb1-ATG MO. Both morphant groups had class II IOV phenotypes, but the thinner and irregular ISV phenotypes (white arrowhead) were noted only in
rcbtb1-ATG morphants.

knockdown, the effect of reduced ndp is restricted to the IOVs but
not observed in the ISVs. Further, we showed genetic interaction
between NDP and RCBTB1 in vitro and in vivo. These findings sug-
gest that ubiquitously expressed RCBTB1 may act as a common
downstream component of angiogenesis in general, while the tis-
sue- or organ-specific angiogenesis is guided by other specific fac-
tors, e.g. Norrin and TSPAN12.
In the patient cohort, we identified two heterozygous frame-
shift mutations in RCBTB1, one of which is a splice-site variant
(c.1172+1G>A) resulting in the skip of exon 10 in RCBTB1 tran-
scripts, thereby leading to half the amount of normal RCBTB1 in
LCLs. Furthermore, partially reducing RCBTB1 by using shRNA in
the transiently transfected cell model and MOs in zebrafish signifi-
cantly lowered Norrin-induced β-catenin signaling by reduced
nuclear accumulation of β-catenin and led to poorly developed
vasculatures, respectively. These results suggest that RCBTB1 hap-
loinsufficiency may lead to the observed disease phenotypes. In
addition, according to the reporter assay, the novel variant at the
5′UTR of NDP (c.-77A>G) may have resulted in a halved Norrin level
in family E9, in which both children affected were hemizygous for
the mutant allele, whereas their unaffected mothers were hetero-
zygous. On the basis of the Norrin and RCBTB1 levels estimated ac-
cording to the genotypes of the members of family E9 (Figs 1B and
2C) and additional evidence obtained from cell transfection ex-
periments (Fig. 4A; Supplementary Material, Fig. S2B) and zebra-
fish morphant analyses (Fig. 3D), we propose a possible disease
mechanism, in which normal angiogenesis can be achieved as
long as the Norrin-induced signals exceed a threshold. Thus, com-
bined genetic factors, such as mutations in RCBTB1 and NDP, both
influencing Norrin-induced signaling, enhance disease suscepti-
bility in a dynamic microenvironment, leading to defects charac-
terized by a wide spectrum of severity in retinal angiogenesis.
Reduced penetrance and asymmetric retinal phenotypes have
long been noted in vitreoretinopathies (22). In all affected cases
with RCBTB1 mutations, asymmetry in retinal manifestation was
obvious as documented in Table 1. In addition, there are heterozy-
gous nonpenetrating parents with RCBTB1 mutations in both fam-
ilies E5 and E9. These characteristics were also found in family E10
with a reported FZD4 mutation (Supplementary material, Fig. S1A;
clinical feature not shown). These phenomena could also result
from the effect of genetic background in heterozygous individuals
and microenvironmental factors in the eyes. Recently, a rare
variant in RCBTB1 was detected in a consanguineous family with
retinal ciliopathy (43), a disease of photoreceptors. A follow-up
electroretinogram (ERG) was performed in the proband, individual
III-2, of family E9 (Supplementary Material, Fig. S1B). It was
revealed that the rod and cone responses were preserved in his
relatively normal eye with only mild disc dragging, while the
ERG was flat in the other eye with severe RD. Based on his fol-
low-up histories during past 20 years, including the preserved
ERG, lack of night blindness and stable clinical features of FEVR
without bony spicules or sheathing vessels, all suggest that he is
a patient with FEVR without clinical overlap of retinitis pigment-
osa (RP). Besides, the pathophysiologies of vitreoretinopathies
and RP are quite different, where angiogenesis is the primary
defect in vitreoretinopathies and usually asymmetric while RP
affects the photoreceptors and almost always in both eyes. Thus,
homozygous RCBTB1 variants in retinal ciliopathy could be an
example of clinical heterogeneity.
In addition to known FEVR-associated genes, many other
angiogenesis-related genes have been identified in zebrafish
(44), indicating the presence of numerous complex signaling
pathways involved in angiogenesis. On the basis of the findings,
we can speculate the existence of additional unidentified genetic
Human Molecular Genetics, 2016, Vol. 25, No. 8 | 1643
factors associated with FEVR. The frequency of gene mutations
may reflect their roles in angiogenesis, i.e. mutations in crucial
rate-limiting factors such as FZD4 and LRP5 tend to be more fre-
quently identified, whereas fewer mutations occur in the regula-
tory components that modulate the major signaling pathways. A
recent study involving a cohort of 92 FEVR families identified mu-
tations in LRP5 and FZD4 in 19% and 15% of cases, respectively. Of
the families recruited, 48.5% had a confirmed molecular diagno-
sis (28), indicating that the Norrin-induced β-catenin signaling
Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019
pathway plays an essential role in retinal angiogenesis. To date,
mutations have been identified in only approximately 50% of
cases, providing an opportunity to investigate (retinal) angiogen-
esis by identifying additional genetic factors associated with
FEVR and related vitreoretinopathy.
In conclusion, we identified RCBTB1 as a gene associated with
vitreoretinopathy and found that it plays a role in retinal angiogen-
esis through Norrin-induced β-catenin signaling. Further investiga-
tion of its physiological role may elucidate its detailed functions in
retinal angiogenesis.
Subjects, Materials and Methods
Ethics statement for human subject research
This study was approved by the Institutional Review Boards of
Taipei Veterans General Hospital (for FEVR) and Cheng-Hsin Gen-
eral Hospital (for Coats disease). All research studies involving
humans were conducted according to the principles expressed
in the Declaration of Helsinki. Written informed consent was
obtained from all participants.
Patient recruitment
Fifteen patients diagnosed with FEVR or Coats disease and their
family members were recruited from nine Taiwanese families
and provided informed consent (Fig. 1; Supplementary Material,
Fig. S1). The patients provided a detailed history by answering
questions in order to rule out retinopathy of prematurity, and oph-
thalmic examinations included assessments of corrected visual
acuity, slit-lamp examinations, intraocular pressure application
and dilated fundus examination with photographs with or without
fluorescein angiography. The fundus features were grouped into
the following categories for diagnosis: avascular zone only; extra-
retinal neovascularization; exudative RD; tractional RD; rhegmato-
genous RD; retinal breaks without RD; retinoschisis and macular
ectopia. Approximately 20 ml of peripheral venous blood was
drawn, with 10 ml being used for genomic DNA and total RNA iso-
lation conducted according to our established protocol and the
other 10 ml being used for the establishment of LCLs by the Biore-
source Collection and Research Center (BCRC), Hsinchu, Taiwan,
for additional RNA and protein analyses.
Direct sequencing of candidate genes and mutation
analysis
Genomic DNA was extracted from the peripheral blood leuko-
cytes of all participants, according to standard lab protocols. All
exons and exon–intron boundaries of the candidate genes (NDP,
FZD4, LRP5, TSPAN12 and ZNF408) were amplified under opti-
mized PCR conditions. Subsequently, direct sequence analysis
was conducted using the ABI PRISM Big Dye Terminator Cycle Se-
quencing V2.0 Ready Reaction Kit and ABI PRISM 3730 DNA ana-
lyzer (Applied Biosystems). The allele frequencies of all three
novel variants (c.-77A>G of NDP; c.707delA and c.1172+1G>A of
RCBTB1) in at least 150 Taiwanese controls were assessed by
 1644 | Human Molecular Genetics, 2016, Vol. 25, No. 8
conducting direct Sanger sequencing. Reference sequences for
NDP and RTBCB1 are NM_000266.3 and NM_018191.3, respectively.
These variants have been submitted to the ClinVar database
(http://www.ncbi.nlm.nih.gov/clinvar/).
Exome sequencing analysis and variant filtering
Exome sequencing was performed by the Genome Research Center
of National Yang-Ming University for four affected individuals (i.e. II-
1 of family E5, II-1 of family E6, III-2 and III-4 of family E9) after ex-
cluding possible pathogenic mutations in the five candidate genes.
Exon sequences were enriched from genomic DNA by using the Agi-
lent SureSelect All Exon 50 Mb or ROCHE NimbleGen SeqCap EZ
Exome V3+UTR (96 Mb) kits and were paired-end sequenced on an
Illumina HiSeq 2000 or 2500 platform. The CLC Genomics Work-
bench v7.0.4 was used for basic quality assessment and variant call-
ing. For each patient sample, at least 90% of the targeted region was
covered by at least 20 folds, as displayed in Supplementary Material,
Table S1. Variants that were not in the dbSNP138 common-variant
list were filtered for being heterozygous and were present in both
III-2 and III-4 of family E9. Filtering was followed by removing var-
iants listed in the in-house exome database for unrelated pheno-
types, and the remaining variants were analyzed using the
Variant Effect Predictor of the Ensembl Genome Browser. The 130
variants with predicted consequences of in-frame deletion, mis-
sense, stop-gained or splice-site variants were individually verified
using Ensembl (release 75, Feb. 2014). The remaining 27 variants
were then prioritized through segregation according to the results
obtained from Sanger sequencing, pathway analyses with known
candidate genes and the presence of other variants in the same
gene in individuals II-1 of family E5 and/or II-1 of family E6.
Plasmids and constructs
The WT and mutant TCF/LEF-binding sequences were amplified
using M50 Super 8× TOPFlash and M51 Super 8× FOPFlash plas-
mids (Addgene) as the template, respectively, and were cloned up-
stream of the firefly luciferase gene in pmirGlo vectors (Promega).
The expression constructs for human NDP with the 5′UTR region,
FZD4, and LRP5 were generated using pcDNA3.1myc-His vectors
(Invitrogen). Site-directed mutagenesis was performed through
PCR by using Phusion DNA polymerase (New England Biolabs) as
well as the corresponding primers shown in Supplementary Ma-
terial, Table S3, to generate mutant constructs. All DNA constructs
after site-directed mutagenesis were validated through Sanger se-
quencing. Two RCBTB1-targeting shRNA plasmids and the pLKO.1
vector were obtained from the National RNAi Core Facility at the
Institute of Molecular Biology/Genomic Research Center, Aca-
demia Sinica (Taipei, Taiwan), with the following oligo sequences:
shRCBTB1-1 (TRCN0000160987): CCGGGCCAAATTACAAGTGGGT
GAACTCGAGTTCACCCACTTGTAATTTGGCTTTTTTG, shRCBTB1-2
(TRCN0000273669): CCGGCCTTACTGTGAAGGAATAATTCTCGAG
AATTATTCCTTCACAGTAAGGTTTTTG, pLKO.1 empty vector:
CCGGACACTCGAGCACTTTTTG.
Cell culture and transient transfection
ARPE19 cells (ATCC number: CRL-2302) were cultured in DMEM/
F12 (GIBCO®) supplemented with 10% fetal bovine serum (FBS)
in a 5% CO2 incubator. LCLs derived from Epstein-Barr-virus-
transformed lymphocytes (BCRC, Hsinchu, Taiwan) from the
members of family E9 were cultured in RPMI 1640 supplemented
with 20% FBS, -glutamine and penicillin–streptomycin solution
(GIBCO®) in a 5% CO2 incubator standing in the upright position.
Transient transfections of ARPE19 with expression vectors or
shRNA were performed using Lipofectamine® 3000, according
to manufacturer instructions.
RNA extraction and RT-PCR
Total RNA was extracted from peripheral blood leukocytes or LCLs
by using the TRIzol® Reagent (Ambion) according to the manufac-
turer protocol. Reverse transcriptase reactions were performed on
Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019
500 ng of total RNA by using M-MLV Reverse Transcriptase (Life
Technologies), and 1 μl of cDNA was used to conduct PCR. The
PCR products were electrophoresed in a 2% TBE gel, and the pro-
ducts of the aberrant transcripts were excised from the gel and
extracted using the Zymoclean™ Gel DNA Recovery Kit (Zymo Re-
search) prior to sequencing. Details of the primer sequences are
shown in Supplementary Material, Table S3.
Whole cell lysate preparation
The cultured cells were lysed with RIPA buffer (50 m Tris–HCl, pH
8.0, 150 m NaCl, 0.1% SDS, 1% NP-40 and 0.5% sodium deoxycho-
late) supplemented with 1× protease inhibitor cocktail (cOmplete
Protease Inhibitor Cocktail Tablets, Roche). The cell lysates were
cleared through centrifugation at 14 000 × g for 20 min, and the
protein concentration was quantified using the Bradford protein
assay (BioRad).
Nuclear and cytosolic fractionation
The method for subcellular fractionation was based on Dr David
Ron’s Lab’s protocol (http://ron.cimr.cam.ac.uk/protocols.html).
Briefly, cells were washed twice with ice-cold calcium-tris-buffered
saline (CTMS) (10 m Tris–HCl, pH 7.4, 140 m NaCl, 2 m CaCl2).
For one 10-cm dish, cells were scraped from the dish in 1 ml of
CTBS buffer supplemented with 2 m DTT, 5 m EDTA and 1× pro-
tease inhibitor cocktail (Roche). The harvested cells were pelleted,
resuspended in 0.4 ml serum-free media containing with 7.5 m
N-ethylmaleimide (Sigma-Aldrich) (45) and incubated at room
temperature for 10 min. After washed in ice-cold CTBS, cells were
lysed in Harvest buffer (10 m HEPES, pH 7.9, 50 m NaCl, 0.5  su-
crose, 0.1 m EDTA, 0.5% Triton × 100) containing 1× protease in-
hibitor cocktail (ROCHE) and 1× phosphatase inhibitor cocktail
(Sigma). The cleared supernatant is the cytoplasmic/membrane
fraction. The washed nuclear pellets were lysed in buffer 2 × C
(20 m HEPES, pH 7.9, 1  NaCl, 0.2 m EDTA, 0.2 m EGTA, 0.2%
NP40). The cleared supernatant contains the nuclear fraction.
Immunoblot analysis
For immunoblot analysis, protein lysates were electrophoresed on
10% SDS-PAGE gels and transferred to PVDF membranes (Milli-
pore). Antibodies to RCBTB1 (ab154649, Abcam®), active (nonpho-
spho) β-catenin (#8814, Cell Signaling Technology®), Lamin B1
(ab133741, Abcam®), GAPDH (NB300-322, Novus Biologicals) and
β-actin (8H10D10, Cell Signaling Technology®) were used to detect
and quantify the proteins. Chemiluminescent images were cap-
tured using the BioSpectrum Imaging System (UVP), and signal in-
tensities were analyzed using ImageJ (Image Processing and
Analysis in Java, http://imagej.nih.gov/ij/).
Dual luciferase assay
In 24-well plates, 105 ARPE19 cells/well were transfected with
550 ng of DNA by using 1 μl of the Lipofectamine® 3000 Reagent
(Invitrogen). The DNA mixture contained 150 ng each of the

expression constructs for FZD and LRP5, 150 ng of the RCBTB1-
targeting shRNA plasmid or vector control and 100 ng of reporter
constructs (M50) or mutant reporter constructs (M51). The cells
were stimulated 24 h post-transfection with 0, 62.5 or 125 ng/
mL human recombinant Norrin (rhNorrin) or 100 ng/mL Wnt3a
(R&D Systems), or by cotransfecting the indicated amount
of NDP-expressing constructs with WT or mutant alleles for
16–18 h. Firefly and Renilla luciferase activity was measured
using the Dual-Luciferase® Reporter Assay System (Promega)
according to the manufacturer instructions. Relative luciferase
activity (RLA) is the ratio between the Firefly and Renilla lucifer-
ase activities and is used to normalize transfection efficiency and
changes in cell survival and growth.
Immunofluorescence
ARPE19 cells transfected with DNA mixture contained 150 ng each
of the expression constructs for FZD and LRP5, 200 ng of the
RCBTB1-targeting shRNA plasmids or vector controls were cul-
tured in four-well chamber slides (Nunc® Lab-Tek®). Twenty-
four hours after transfection, culture media were replaced with
serum-free only media or media containing 250 ng/ml rhNorrin
or rhWnt3a for another 4 h and then washed with PBS for three
times. The cells were fixed using 4% paraformaldehyde at 37°C
for 15 min and followed by three PBS washes. Then 0.25% Triton
X-100 in PBS was added to permeabilize cells at room temperature
for 5 min and followed by PBST wash for three times. The cells
were incubated in 1% BSA in PBST for 1 h and then incubated in
1:100 diluted anti-β-catenin antibody (NBP1-54467SS, Novus) at
4°C overnight. After washed for three times with PBST, the slides
were incubated in 1:200 diluted AlexaFluor488-conjugated Donkey
anti-Mouse IgG H&L (ab150105, Abcam) for 1 h and afterwards
washed with PBST for three times. After mounted with SlowFade
Gold Antifade Mountant with DAPI (Life Technologies, S36942), the
slides were examined by confocal microscope FV10i and analyzed
by the FV10-ASW 4.0 Viewer (Olympus).
Morpholinos and zebrafish embryo manipulations
The Tg(fli1:EGFP) zebrafish were maintained and mated as de-
scribed (34), and all experiments were conducted with the ap-
proval of the Institutional Animal Care and Use Committee,
National Health Research Institutes (NHRI-IACUC-103003).
Translation-blocking (GAGGCCACTTACTCACATCCACCAT), mis-
matched-control (GAcGCCAaTTACTaACATaCACaAT) and splice
blocking (GTTAAAAAGCATTCCCTCACCTCAC) MOs for the zebra-
fish rcbtb1 ortholog and translation-blocking (GAGCGACCGA
GTTCCTCATAGTGTC) MOs for ndp were designed and synthe-
sized using LLC (Gene Tools) and diluted in nuclease-free, deio-
nized, sterile water supplemented with 0.8% phenol red. To
determine the most effective dose of the MOs, 2.3 nL of diluted
MO (containing 2, 4 and 6 ng) was injected into cells at one- or
two-cell-stage embryos by using an oil-PicoPump pv280 (World
Precision Instruments). For in vivo rescue experiments, human
WT RCBTB1 mRNAs were prepared using the mMESSAGE mMA-
CHINE Kit (Ambion) by following the manufacturer instructions.
The mRNAs (200 pg) were coinjected with MOs as described. After
injection, the embryos were cultured at 28.5°C in the E3 embryo
medium and were subsequently phenotyped at 3 dpf or 4 dpf
through confocal microscopy by using the Leica AF6000 LX. The
average areas of eight ISVs counted posteriorly from the urogeni-
tal pole were analyzed using ImageJ, and thresholds were opti-
mized to enable the imaging signals to cover the ISV area. The
pixels in the covered area were then counted and normalized to
Human Molecular Genetics, 2016, Vol. 25, No. 8 | 1645
those of the control group. For characterizing the intraocular
phenotype at 4 dpf, injected embryos were classified into three
classes of phenotypes according to the relative severity and the
ratio of the avascularization area compared with the MO-injected
(6 ng) control embryos. To determine the efficiency of splice
blocking, the RNA was isolated from 60 control MOs and different
doses of rcbtb1 splice MO-injected embryos at 1 dpf or 2 dpf by
using RNAzol®RT (Molecular Research Center) according to the
manufacturer protocol. Reverse-transcriptase reaction was per-
Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019
formed using 1 μg of RNA and Maxima Reverse Transcriptase
(Thermo Scientific) according to the manufacturer protocol. PCR
was then conducted, as follows: (forward: CGGACCTCATGTT
TTGCTGG and reverse: AACCCCAGCTGGCCATTAC). Fragments
were resolved through electrophoresis, extracted from the gel by
using the Zymoclean™ Gel DNA Recovery Kit (Zymo Research),
and Sanger-sequenced as described.
Statistical analysis
The means and standard error of the mean for all experimental
data were calculated. Comparisons between the experimental
conditions were conducted using a two-tailed Student t-test
for unpaired samples, with α < 0.05 considered to indicate
significance.
Authors’ contributions
Project design: M.-Y.C., J.-H.W., J.-H.L., S.-J.C., Y.-J.J.; manuscript
writing: J.-H.W., M.-Y.C., S.-J.C., Y.-J.J.; project coordination and
senior leaders of the groups: M.-Y.C., S.-J.C., Y.-J.J.; patient recruit-
ment and phenotyping: J.-H.L., H.-M.C., Y.-C.K., Y.-C.C., S.-J.C.;
genetic sequencing and interpretation: J.-H.W., M.-Y.C., C.-T.W.,
T.-T.L.; cell biology experiments: J.-H.W., M.-Y.C., C.T.-W.; and
zebrafish experiments: J.-H.W., K.-C.C., Y.-J.J.
Supplementary Material
Supplementary Material is available at HMG online.
Acknowledgements
We thank all the patients and their family members for participa-
tion; Professors Chen-Kung Chou, Ming-Yuan Cheng and Yann-
Jang Chen for their valuable discussions and comments. We
also thank Dr Didier Y. R. Stainier for dCas9 and gRNA plasmids
and the staff in the Zebrafish Facility of NHRI for their efforts in
maintaining fish stocks. Also, we are grateful to Chien-Ming
Wang and Chih-Hao Tang for their technical help.
Conflict of Interest statement. None declared.
Funding
This study was supported by grants from Ministry of Science
and Technology (MOST) (104-2314-B-010-049) and Cheng-Yang
Collaborative Research Foundation (98F117CY02, 99F167CY05)
to M.-Y.C.; the High-throughput Genome Analysis and RNAi
Core Facilities supported by the National Core Facility Program
for Biotechnology (NSC-103-2319-B-010-001 and NSC100-
2319-B-001-002) for Illumina sequencing and RNAi reagents;
EBV-transformation service of the Resource Center supported
by the National Research Program for Biopharmaceuticals
(SB3, NSC100-2325-B-080-001). The work was also supported
by grants from the National Health Research Institutes, Taiwan
 1646 | Human Molecular Genetics, 2016, Vol. 25, No. 8
(MG-104-PP-12 and MG-104-PP-13) and the Ministry of Science
and Technology, Taiwan (MOST103-2311-B-400-001 and
MOST104-2319-B-400-001) to Y.-J.J.
References
1. Criswick, V.G. and Schepens, C.L. (1969) Familial exudative
vitreoretinopathy. Am. J. Ophthalmol., 68, 578–594.
2. Canny, C.L. and Oliver, G.L. (1976) Fluorescein angiographic
findings in familial exudative vitreoretinopathy. Arch.
Ophthalmol., 94, 1114–1120.
3. Zaremba, J., Feil, S., Juszko, J., Myga, W., van Duijnhoven, G.
and Berger, W. (1998) Intrafamilial variability of the ocular
phenotype in a Polish family with a missense mutation
(A63D) in the Norrie disease gene. Ophthalmic Genet., 19,
157–164.
4. Robitaille, J.M., Wallace, K., Zheng, B., Beis, M.J., Samuels, M.,
Hoskin-Mott, A. and Guernsey, D.L. (2009) Phenotypic overlap
of familial exudative vitreoretinopathy (FEVR) with persistent
fetal vasculature (PFV) caused by FZD4 mutations in two dis-
tinct pedigrees. Ophthalmic Genet., 30, 23–30.
5. Berger, W., Kloeckener-Gruissem, B. and Neidhardt, J. (2010)
The molecular basis of human retinal and vitreoretinal dis-
eases. Prog. Retin. Eye Res., 29, 335–375.
6. Nikopoulos, K., Venselaar, H., Collin, R.W., Riveiro-Alvarez, R.,
Boonstra, F.N., Hooymans, J.M., Mukhopadhyay, A., Shears,
D., van Bers, M., de Wijs, I.J. et al. (2010) Overview of the mu-
tation spectrum in familial exudative vitreoretinopathy and
Norrie disease with identification of 21 novel variants in
FZD4, LRP5, and NDP. Hum. Mutat., 31, 656–666.
7. Robitaille, J.M., Zheng, B., Wallace, K., Beis, M.J., Tatlidil, C.,
Yang, J., Sheidow, T.G., Siebert, L., Levin, A.V., Lam, W.C.
et al. (2011) The role of Frizzled-4 mutations in familial exuda-
tive vitreoretinopathy and Coats disease. Br. J. Ophthalmol., 95,
574–579.
8. Schafer, N.F., Luhmann, U.F., Feil, S. and Berger, W. (2009) Dif-
ferential gene expression in Ndph-knockout mice in retinal
development. Invest. Ophthalmol. Vis. Sci., 50, 906–916.
9. Gilmour, D.F. (2015) Familial exudative vitreoretinopathy and
related retinopathies. Eye (Lond.), 29, 1–14.
10. Gal, M., Levanon, E.Y., Hujeirat, Y., Khayat, M., Pe’er, J. and
Shalev, S. (2014) Novel mutation in TSPAN12 leads to auto-
somal recessive inheritance of congenital vitreoretinal dis-
ease with intra-familial phenotypic variability. Am. J. Med.
Genet. A., 164A, 2996–3002. doi: 2910.1002/ajmg.a.36739.
Epub 32014 Sep 36722.
11. Morris, B., Foot, B. and Mulvihill, A. (2010) A population-based
study of Coats disease in the United Kingdom I: epidemiology
and clinical features at diagnosis. Eye (Lond), 24, 1797–1801.
12. Black, G.C., Perveen, R., Bonshek, R., Cahill, M., Clayton-
Smith, J., Lloyd, I.C. and McLeod, D. (1999) Coats’ disease of
the retina (unilateral retinal telangiectasis) caused by somat-
ic mutation in the NDP gene: a role for norrin in retinal angio-
genesis. Hum. Mol. Genet., 8, 2031–2035.
13. Shields, J.A. and Shields, C.L. (2002) Review: Coats disease: the
2001 LuEsther T. Mertz lecture. Retina, 22, 80–91.
14. Smithen, L.M., Brown, G.C., Brucker, A.J., Yannuzzi, L.A., Klais,
C.M. and Spaide, R.F. (2005) Coats’ disease diagnosed in adult-
hood. Ophthalmology, 112, 1072–1078.
15. Chen, Z.Y., Battinelli, E.M., Fielder, A., Bundey, S., Sims, K.,
Breakefield, X.O. and Craig, I.W. (1993) A mutation in the
Norrie disease gene (NDP) associated with X-linked familial
exudative vitreoretinopathy. Nat. Genet., 5, 180–183.
16. Kashani, A.H., Brown, K.T., Chang, E., Drenser, K.A., Capone,
A. and Trese, M.T. (2014) Diversity of retinal vascular anomal-
ies in patients with familial exudative vitreoretinopathy. Oph-
thalmology, 121, 2220–2227.
17. Poulter, J.A., Ali, M., Gilmour, D.F., Rice, A., Kondo, H., Hayashi,
K., Mackey, D.A., Kearns, L.S., Ruddle, J.B., Craig, J.E. et al. (2010)
Mutations in TSPAN12 cause autosomal-dominant familial
exudative vitreoretinopathy. Am. J. Hum. Genet., 86, 248–253.
18. Simunovic, M.P. and Maberley, D.A. (2014) Familial exudative
Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019
vitreoretinopathy mimicking macular telangiectasia type 1.
Can. J. Ophthalmol., 49, e28–e30.
19. Gow, J. and Oliver, G.L. (1971) Familial exudative vitreoretino-
pathy. An expanded view. Arch. Ophthalmol., 86, 150–155.
20. Jiao, X., Ventruto, V., Trese, M.T., Shastry, B.S. and Hejtman-
cik, J.F. (2004) Autosomal recessive familial exudative vitreor-
etinopathy is associated with mutations in LRP5. Am. J. Hum.
Genet., 75, 878–884.
21. van Nouhuys, C.E. (1982) Dominant exudative vitreoretinopa-
thy and other vascular developmental disorders of the per-
ipheral retina. Doc. Ophthalmol., 54, 1–414.
22. Kashani, A.H., Learned, D., Nudleman, E., Drenser, K.A., Ca-
pone, A. and Trese, M.T. (2014) High prevalence of peripheral
retinal vascular anomalies in family members of patients
with familial exudative vitreoretinopathy. Ophthalmology,
121, 262–268.
23. Collin, R.W., Nikopoulos, K., Dona, M., Gilissen, C., Hoischen,
A., Boonstra, F.N., Poulter, J.A., Kondo, H., Berger, W., Toomes,
C. et al. (2013) ZNF408 is mutated in familial exudative vitreor-
etinopathy and is crucial for the development of zebrafish
retinal vasculature. Proc. Natl. Acad. Sci. USA, 110, 9856–9861.
24. Nikopoulos, K., Gilissen, C., Hoischen, A., van Nouhuys, C.E.,
Boonstra, F.N., Blokland, E.A., Arts, P., Wieskamp, N., Strom,
T.M., Ayuso, C. et al. (2010) Next-generation sequencing of a
40 Mb linkage interval reveals TSPAN12 mutations in patients
with familial exudative vitreoretinopathy. Am. J. Hum. Genet.,
86, 240–247.
25. Robitaille, J., MacDonald, M.L., Kaykas, A., Sheldahl, L.C., Zeis-
ler, J., Dube, M.P., Zhang, L.H., Singaraja, R.R., Guernsey, D.L.,
Zheng, B. et al. (2002) Mutant frizzled-4 disrupts retinal angio-
genesis in familial exudative vitreoretinopathy. Nat. Genet.,
32, 326–330.
26. Toomes, C., Bottomley, H.M., Jackson, R.M., Towns, K.V.,
Scott, S., Mackey, D.A., Craig, J.E., Jiang, L., Yang, Z., Trembath,
R. et al. (2004) Mutations in LRP5 or FZD4 underlie the com-
mon familial exudative vitreoretinopathy locus on chromo-
some 11q. Am. J. Hum. Genet., 74, 721–730.
27. Junge, H.J., Yang, S., Burton, J.B., Paes, K., Shu, X., French, D.M.,
Costa, M., Rice, D.S. and Ye, W. (2009) TSPAN12 regulates ret-
inal vascular development by promoting Norrin- but not
Wnt-induced FZD4/beta-catenin signaling. Cell, 139, 299–311.
28. Salvo, J., Lyubasyuk, V., Xu, M., Wang, H., Wang, F., Nguyen,
D., Wang, K., Luo, H., Wen, C., Shi, C. et al. (2015) Next-gener-
ation sequencing and novel variant determination in a cohort
of 92 familial exudative vitreoretinopathy patients. Invest.
Ophthalmol. Vis. Sci., 56, 1937–1946.
29. Aponte, E.P., Pulido, J.S., Ellison, J.W., Quiram, P.A. and Moh-
ney, B.G. (2009) A novel NDP mutation in an infant with uni-
lateral persistent fetal vasculature and retinal vasculopathy.
Ophthalmic Genet., 30, 99–102.
30. Meindl, A., Berger, W., Meitinger, T., van de Pol, D., Achatz, H.,
Dorner, C., Haasemann, M., Hellebrand, H., Gal, A., Cremers,
F. et al. (1992) Norrie disease is caused by mutations in an
extracellular protein resembling C-terminal globular domain
of mucins. Nat. Genet., 2, 139–143.

31. Lin, P., Shankar, S.P., Duncan, J., Slavotinek, A., Stone, E.M. and
Rutar, T. (2010) Retinal vascular abnormalities and dragged
maculae in a carrier with a new NDP mutation (c.268delC) that
caused severe Norrie disease in the proband. J. AAPOS, 14, 93–96.
32. Ng, S.B., Bigham, A.W., Buckingham, K.J., Hannibal, M.C.,
McMillin, M.J., Gildersleeve, H.I., Beck, A.E., Tabor, H.K., Cooper,
G.M., Mefford, H.C. et al. (2010) Exome sequencing identifies
MLL2 mutations as a cause of Kabuki syndrome. Nat. Genet.,
42, 790–793.
33. Auton, A., Brooks, L.D., Durbin, R.M., Garrison, E.P., Kang, H.M.,
Korbel, J.O., Marchini, J.L., McCarthy, S., McVean, G.A. and
Abecasis, G.R. (2015) A global reference for human genetic
variation. Nature, 526, 68–74. doi: 10.1038/nature15393.
34. Ellertsdottir, E., Lenard, A., Blum, Y., Krudewig, A., Herwig, L.,
Affolter, M. and Belting, H.G. (2010) Vascular morphogenesis
in the zebrafish embryo. Dev. Biol., 341, 56–65.
35. Mabuchi, H., Fujii, H., Calin, G., Alder, H., Negrini, M., Rassen-
ti, L., Kipps, T.J., Bullrich, F. and Croce, C.M. (2001) Cloning and
characterization of CLLD6, CLLD7, and CLLD8, novel candi-
date genes for leukemogenesis at chromosome 13q14, a re-
gion commonly deleted in B-cell chronic lymphocytic
leukemia. Cancer Res., 61, 2870–2877.
36. Zhou, X. and Munger, K. (2010) Clld7, a candidate tumor sup-
pressor on chromosome 13q14, regulates pathways of DNA
damage/repair and apoptosis. Cancer Res., 70, 9434–9443.
37. Bischoff, F.R. and Ponstingl, H. (1991) Catalysis of guanine
nucleotide exchange on Ran by the mitotic regulator RCC1.
Nature, 354, 80–82.
38. Hadjebi, O., Casas-Terradellas, E., Garcia-Gonzalo, F.R. and
Rosa, J.L. (2008) The RCC1 superfamily: from genes, to func-
tion, to disease. Biochim. Biophys. Acta, 1783, 1467–1479.
Human Molecular Genetics, 2016, Vol. 25, No. 8 | 1647
39. Plafker, K.S., Singer, J.D. and Plafker, S.M. (2009) The ubiquitin
conjugating enzyme, UbcM2, engages in novel interactions
with components of cullin-3 based E3 ligases. Biochemistry,
48, 3527–3537.
40. Mirza, S., Plafker, K.S., Aston, C. and Plafker, S.M. (2010)
Expression and distribution of the class III ubiquitin-
conjugating enzymes in the retina. Mol. Vis., 16, 2425–2437.
41. Izumi, N., Helker, C., Ehling, M., Behrens, A., Herzog, W. and
Adams, R.H. (2012) Fbxw7 controls angiogenesis by regulating
Downloaded from https://academic.oup.com/hmg/article-abstract/25/8/1637/2384939 by University of Leeds - Library user on 29 July 2019
endothelial Notch activity. PLoS One, 7, e41116.
42. Kok, F.O., Shin, M., Ni, C.W., Gupta, A., Grosse, A.S., van Impel,
A., Kirchmaier, B.C., Peterson-Maduro, J., Kourkoulis, G.,
Male, I. et al. (2015) Reverse genetic screening reveals poor
correlation between morpholino-induced and mutant phe-
notypes in zebrafish. Dev. Cell, 32, 97–108.
43. Coppieters, F., Ascari, G., Karlstetter, M., Bauwens, M.,
De Rocker, N., Boel, A., Vleminckx, K., Van der Eecken, M.,
Leroy, B.P., Meire, F. et al. (2015) Identification of RCBTB1 as
novel disease gene for retinal ciliopathy (Program number
283). Presented at the 65th Annual Meeting of the American
Society of Human Genetics, October 6–10, 2015, Baltimore,
MD.
44. Alvarez, Y., Cederlund, M.L., Cottell, D.C., Bill, B.R., Ekker, S.C.,
Torres-Vazquez, J., Weinstein, B.M., Hyde, D.R., Vihtelic, T.S.
and Kennedy, B.N. (2007) Genetic determinants of
hyaloid and retinal vasculature in zebrafish. BMC Dev. Biol.,
7, 114.
45. Tinnikov, A.A. and Samuels, H.H. (2013) A novel cell lysis ap-
proach reveals that caspase-2 rapidly translocates from the
nucleus to the cytoplasm in response to apoptotic stimuli.
PLoS One, 8, e61085.