OPHTHALMIC MOLECULAR GENETICS

SECTION EDITOR: JANEY L. WIGGS, MD, PhD

Clinical Presentation and Genetic Correlation

of Patients With Mutations Affecting the FZD4 Gene
Kimberly A. Drenser, MD, PhD; Wendelin Dailey, BS; Anand Vinekar, MD;
Kunal Dalal, MD; Antonio Capone Jr, MD; Michael T. Trese, MD

Objective: To correlate the ophthalmic findings of pa-
tients with pediatric vitreoretinopathies with mutations
occurring in the FZD4 gene.
Methods: A total of 123 patients diagnosed with auto-
somal-dominant familial exudative vitreoretinopathy (Ad-
FEVR) or retinopathy of prematurity (ROP) and 42 con-
trol patients were enrolled in the study. Diagnoses were
based on retinal findings at each patient’s first examina-
tion or during ROP screening. Genomic DNA was iso-
lated and polymerase chain reaction and direct sequenc-
ing of the FZD4 gene performed.
Results: FZD4 gene mutations were discovered in 13 of
the 123 (10.6%) patients. Nine of the 63 patients with
AdFEVR (14.3%) has mutations in the FZD4 gene. Four
heterozygous mutations were identified: C117R, C181Y,
Q505X, and P33S/P168S. Four of the 60 patients with
ROP (6.7%) have a double missense mutation P33S/
P168S that was also found in the patients with FEVR. No
other FZD4 mutations were found in the patients with
ROP. Additionally, patients expressing the double mu-
tation had clinical presentations that overlapped, mak-
ing it difficult to assign a definitive diagnosis. None of
the mutations found in the patients with FEVR or ROP
were seen in the control chromosomes.
Conclusion: Mutations occurring in the FZD4 gene affect
patients diagnosed with both FEVR and ROP. The clini-
cal picture often overlaps and may require a detailed birth
and family history for diagnosis. Genetic testing con-
firms inherited vitreoretinopathy and helps direct clini-
cal management.
Clinical Relevance: Patients diagnosed with ROP may
have a mutation in the FZD4 gene and display charac-
teristics consistent with FEVR. Analysis of the FZD4 gene
should be considered.
Arch Ophthalmol. 2009;127(12):1649-1654

Author Affiliations: Associated
Retinal Consultants, William
Beaumont Hospital, Royal Oak,
Michigan (Drs Drenser, Dalal,
Capone, and Trese, and
Ms Dailey); and the Department
of Ophthalmology, Advanced
Eye Center, Postgraduate
Institute of Medical Education
and Research, Chandigarh,
India (Dr Vinekar).
M
UTATIONS IN THE GENE
encoding the frizzled-4
receptor (FZD4)
(gene, FZD4; OMIM
133780) have been de-
scribed in many patients diagnosed with
autosomal-dominant familial exudative
retinopathy (AdFEVR)1 and in a smaller
number of patients with retinopathy of pre-
maturity (ROP).2 In both diseases, the pa-
tient is born with enlarged and tortuous
retinal vessels and an area of avascular pe-
ripheral retina. Additionally, varying de-
grees of subretinal exudation, vitreoreti-
nal traction, and abnormal extraretinal
vessels/neovascularization may occur.
Proper FZD4 signaling is necessary for
normal retinal vascular development.3
Frizzled-4 is a 537–amino acid, 7-trans-
membrane receptor that transduces Wnt
signaling (Figure 1 and Figure 2). Sev-
eral Wnt ligands, Wnt-3a, Wnt-8, Wnt-
5a, and the non-Wnt ligand, Norrin, are
known to activate FZD4. There are 6 in-
tracellular paths of Wnt signaling that can
occur downstream of frizzled receptor ac-
tivation: the canonical Wnt/␤-catenin path-
way, the planar cell polarity pathway, and
the Wnt-Ca2⫹ pathway. In vitro studies
have shown that transduction of the FZD4
signal can occur by any of these path-
ways. Although it was originally thought
that the path taken was determined by the
ligand, it is still unclear how the frizzled
receptor signals are transduced.
The canonical Wnt/␤-catenin pathway is
the most thoroughly studied. Activation is
initiated by ligand binding to both the FZD4
receptor and its coreceptor, the low-density
lipoprotein receptor–related protein 5
(LRP5),ultimatelyresultingindephosphory-
lation of ␤-catenin and translocation to the
nucleus.4 Nuclear ␤-catenin participates as
a transcriptional activator of the transcrip-
tion factor and lymphoid enhancer–binding
factor family of DNA-binding proteins
(Figure 2). Target genes include C-MYC,
CYCLIN D1, and VEGF, presumably regu-
lating cell proliferation in specific tissues.
Similar to the canonical pathway, the pla-
nar cell polarity pathway also involves ac-
tivation of disheveled protein subsequent to
FZD4 activation (Figure 2). Unlike the ca-
nonical pathway, LRP5 is not needed for this
signal transduction. Subsequently, 1 of 2
small guanosine triphosphatases (Rho or

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM
1649

©2009 American Medical Association. All rights reserved.

Downloaded From: https://jamanetwork.com/ by a University of Leeds User on 08/14/2019
 Cysteine-rich
SS domain 7 Transmembrane domains Intracellular C-terminal domain

(K-T-L-H-T-W) (E-T-V-V)

AA No. (1-36) (45-204) (223-498) (499-504) (499-537) (534-537)

(Wnt/Norrin) Canonical Wnt PDZ-1, noncanonical,

Ligand-binding domain signaling motif JNK activation motif

Figure 1. Diagram of frizzled-4 receptor (FZD4) amino acid sequence. AA inidcates amino acid; JNK, c-Jun N-terminal kinase; SS, signal sequence.

β-Catenin Pathway Planar Cell Polarity Pathway Ca2+ Pathway

Wnt/Norrin Wnt/Norrin Wnt/Norrin

FZD4 FZD4 FZD4

LRP5/6
G-proteins

Disheveled Disheveled

Axin P Ca2+
GSK-3 Degradation
APC β-Cat
DAMM 1/2

β-Cat

Rac1 RhoA PKC CamK-II

(PKC pathway)

JNK ROCK2
Nucleus
(Cell survival) (Cytoskeleton Nucleus
rearrangement)
β-Cat
NFAT, CREB
TCF/LEF
(Gene expression)
(Gene expression)

Figure 2. Schematic of frizzled-4 receptor (FZD4)–dependent pathways. APC indicates antigen-presenting cell; ␤-cat, ␤-catechin; Ca2⫹, calcium ion;
CamK-II, calcium-calmodulin kinase 2; CREB, cAMP response element-binding protein; DAMM, death-associated molecule related to Mch2; G-proteins, guanine
nucleotide-binding proteins; GSK, glycogen synthase kinase 3; JNK, c-Jun N-terminal kinase; LRP, low-density lipoprotein receptor–related protein; NFAT, nuclear
factor of activated T cells; P, phosphorylated site; PKC, protein kinase C; ROCK2, Rho-associated, coiled-coil–containing protein kinase 2; TCF/LEF, transcription
factor and lymphoid enhancer–binding factor.

Rac) is activated, which in turn activates an alternative sig-
nal transduction pathway.5 The planar cell polarity path-
way mediates cytoskeletal organization and cell migration.
In the Wnt-Ca2⫹ pathway, FZD receptor activation
stimulates an intracellular Ca2⫹ release, activating calcium-
calmodulin kinase 2 and protein kinase C (Figure 2). This
pathway is important in cell adhesion and cell move-
ment during gastrulation.
In this study, we used direct sequencing to screen for
mutations in the coding sequence of FZD4 in patients with
FEVR and ROP. The possible implications of these se-
quence variations in relation to signal transduction and
disease type will be discussed.
METHOD
PATIENTS
Patients were recruited to the study through a protocol ap-
proved by the internal review board at William Beaumont Hos-
pital and consented to participation. They were diagnosed with
FEVR or ROP based on fundus examination, family history, and

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM
1650

©2009 American Medical Association. All rights reserved.

Downloaded From: https://jamanetwork.com/ by a University of Leeds User on 08/14/2019
 Table 1. Primers Used for Frizzled-4 Sequencing

Primer Sequence (5ⴕ to 3ⴕ) Primer Length Product Length, Bases, No.
FZD4 exon 1 forward CTGCTACCCCCGATGCTG 18
396
FZD4 exon 1 reverse GGATGATCAACTTGGCATGG 20
FZD4 exon 2a forward ATTGCCTGGAAGCATTCAAC 20
570
FZD4 exon 2a reverse CGCTCAGGGTAGGAAAACCT 20
FZD4 exon 2b forward CAGCCTGTGTTTCATCTCCA 20
567
FZD4 exon 2b reverse ATTTTGAACAAGGCCACCAA 20
FZD4 exon 2c forward CTGGCTTGTGCTATGTTGGA 20
515
FZD4 exon 2c reverse AAGCATGGAGGCTGACTAGC 20

Table 2. Diagnosis and Frizzled-4 Mutations

Age at
Patient No. Highest Stage Presentation/ Relative Amino Acid
by Diagnosis of Disease Family History With Mutation Change Base Change Novel
FEVR
1 4b 1 wk NT C117R b349 (TGC⬎CGC) Yes
2 4a; RRD Birth NT
3 4b 4 wk In process C181Y b542 (TGT⬎TAT) Yes
4 4b 1 mo NT Q505X b1513 (CAG⬎TAG) No
5 2; RRD 7y NT P33S/P168S b97 (CCG⬎TCG), b502 No
6 5 ROP screening Father (CCC⬎TCC)
7 5 4 mo Father
8 4b 1y NT
9 4b 7 mo NT
APROP
10 5 ROP screening Mother and twin P33S/P168S b97 (CCG⬎TCG), b502 No
11 5 ROP screening Mother and twin (CCC⬎TCC)
ROP
12 4b ROP screening NT P33S/P168S b97 (CCG⬎TCG), b502 No
13 1 ROP screening NT (CCC⬎TCC)

Abbreviations: APROP, aggressive posterior retinopathy of prematurity; FEVR, familial exudative retinopathy; NT, not tested; ROP, retinopathy of prematurity;
RRD, rhegmatogenous retinal detachment.

gestational age. Participants provided a blood sample from which
genomic DNA was isolated from the leucocytes using the Purgene
GenomicDNAPurificationKit(Qiagen,Valencia,California).When
possible, genomic DNA from the relatives of patients expressing
an FZD4 mutation were tested for sequence variations.
SEQUENCING
The coding sequence and flanking splice sites of FZD4 were
amplified from 100 ng of genomic DNA using Herculase Hot-
start PCR Master Mix (Stratagene, La Jolla, California). Four
sets of primers were used (Table 1). Amplification condi-
tions were as follows: 1 cycle at 98°C for 1 minute, 40 cycles
of 30 seconds at 98°C, 30 seconds at 55°C, and 1 minute at 72°C,
and a final extension for 10 minutes at 72°C. Amplified DNA
was cleaned using the QIAquick Multiwell PCR Purification Kit
(Qiagen). Sequencing reactions were performed using the Beck-
man Dye Terminator Cycle Sequenc Quick Start Kit (Beck-
man Coulter, Inc, Fullerton, California) and a Beckman CEQ
8000 autosequencer.
RESULTS
MUTATION ANALYSIS
FZD4 gene mutations were discovered in 13 of the 123
patients enrolled in this study. Nine of the 63 patients
with AdFEVR (14.3%) were found to have mutations in
the coding sequence of FZD4 (Table 2). Four hetero-
zygous mutations were found: C117R, C181Y, Q505X,
and P33S/P168S (eFigure; www.archophthalmol.com).
In addition, 4 of the 60 patients with ROP (6.7%) had
the double missense mutation P33S/P168S that was found
in the patients with FEVR (Table 2). No other FZD4 mu-
tations were found in the patients with ROP. None of the
mutations found in the patients with FEVR and ROP were
seen in the 84 control chromosomes.
Two novel missense mutations were found in pa-
tients with AdFEVR, C117R (2 patients) and C181Y. Both
occur in 1 of the 13 conserved cysteine residues of FZD4
ligand–binding domain (Figure 1).
One patient with FEVR had a mutation resulting in
early termination of protein translation, Q505X. This mu-
tation has been reported in an Australian family.6 It is
located immediately downstream from the highly con-
served canonical Wnt activation motif (disheveled bind-
ing; KTXXXW) and causes premature termination prior
to the planar cell polarity (c-Jun N-terminal kinase) path-
way, PDZ1 binding motif (KTXV) (Figure 1).
A double missense mutation, P33S/P168S, was found
in patients with both FEVR (5 patients; 7.9%) and ROP (4
patients; 6.7%). The double mutation was previously re-

(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009 WWW.ARCHOPHTHALMOL.COM
1651

©2009 American Medical Association. All rights reserved.

Downloaded From: https://jamanetwork.com/ by a University of Leeds User on 08/14/2019

Figure 3. Mother of patient 11. A peripheral avascular zone can be
appreciated by fluorescein angiography.
ported in a patient with AdFEVR.2 Both P33S and P168S
have been independently reported in patients with Ad-
FEVR.6,7 AA33 is within the signal sequence and AA168
lies downstream of the cysteine-rich domain (CRD), Wnt-
binding domain, and prior to the start of the 7-transmem-
brane domains (Figure 1). The P168S mutation has been
reported in 1 control (of 400) but the P33S and double mu-
tation have not been reported in control patients.
Several relatives of the patients with the double mis-
sense mutation P33S/P168S were screened and found to
express the mutation as well. Asymptomatic family mem-
bers demonstrated retinal peripheral avascularity but no
abnormal extraretinal vessels or exudates (Figure 3).
Interestingly, 1 patient with ROP had a fraternal twin with
the mutation but no apparent manifestation of disease,
although fluorescein angiography was not performed and
retinal avascular zones could not be definitively as-
sessed. The asymptomatic twin is fraternal, had mini-
mal comorbidities, and had much better systemic health,
suggesting a role for epigenetics in the severity of dis-
ease manifestation.
CLINICAL COURSE
The clinical course varied for the individual patients in
which a mutation was identified. Patients presented be-
tween birth (up to 16 weeks premature) and 7 years of age,
although all patients reported poor vision in at least 1 eye
since birth. Four of the 13 patients had ROP, and 2 devel-
oped aggressive posterior ROP (APROP). Nine patients had
phenotypes consistent with FEVR, although 2 of these pa-
tients were initially diagnosed with ROP. One patient had
an initial diagnosis of persistent fetal vasculature syn-
drome due to a posterior lens plaque but surgical inter-
vention demonstrated a temporal retinal fold with a pos-
terior lens attachment consistent with FEVR. A single patient
with the double mutation in FZD4 also expressed a cyste-
ine mutation in the NDP gene, and demonstrated severe
bilateral retinal dysgenesis. This patient was diagnosed with
Norrie disease and excluded from this study.
(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009
1652
©2009 American Medical Association. All rights reserved.
Downloaded From: https://jamanetwork.com/ by a University of Leeds User on 08/14/2019
A
Figure 4. A, Classic retinopathy of prematurity progressed to retinal
detachment despite laser ablation; B, aggressive posterior retinopathy of
prematurity with a total detachment.
All 4 infants with ROP with FZD4 mutations had the
double mutation (Table 2), with various degrees of dis-
ease severity (Figure 4). Three of the 4 had poor out-
comes. Two developed APROP (zone 1, stage 3, Plus)
and developed bilateral stage 5 retinal detachments.
One infant with classic (zone 2, stage 3, Plus) ROP pro-
gressed to bilateral stage 4b despite appropriate and
timely laser ablation. One of the premature infants
demonstrated peripheral avascular retina only and did
not progress to neovascular changes. The infants with
APROP were both products of multiple births, one with
a surviving twin and the other a sole surviving triplet.
The twins were fraternal but both have the FZD4
double mutation. The twins had very different postnatal
courses; the twin with APROP had multiple comorbidi-
ties and poor health, whereas the asymptomatic twin
had an uneventful course with no systemic maladies.
The surviving triplet, similarly, had multiple comor-
bidities and poor systemic health. Both cases suggest a
role for epigenetics in the development and severity of
inherited diseases.
The patients with FEVR generally showed asymme-
try between the eyes and ranged from stage 1 disease to
stage 5 (Table 1 and Table 2; Figure 5). Two patients
also had rhegmatogenous retinal detachments. All pa-
tients had a history of amblyopia or strabismus shortly
after birth (Table 2).
WWW.ARCHOPHTHALMOL.COM
 A B
C D
Figure 5. An example of familial exudative retinopathy (FEVR). A, Fundus photograph and fluorescein angiography of patient 9 demonstrates a peripheral
avascular zone (stage 1). B, The fellow eye had subretinal exudate and retinal detachment involving the fovea (stage 4b). C, Fundus photograph of patient 8 shows
stage 1 FEVR. D, The fellow eye demonstrates stage 4b FEVR.
COMMENT
FZD4 MUTATIONS
The mutations found in this study involve residues that
are located in distinct regions of the FZD4 protein. A novel
mutation (C117R) was found in 2 patients. It is located
in the extracellular Wnt-binding domain. In the wild-
type protein, Cys117 forms a disulfide bond with Cys158
(in the CRD of FZD4).8 Presumably, disruption of this
bond causes a change in the FZD4 conformation, there-
fore affecting its ability to bind ligands. Wu et al9 showed
that similar cysteine mutations in the CRD of Norrin, a
FZD4 ligand, resulted in the most severe phenotype.
The other novel mutation found in this study, C181Y,
is located within the N-terminal extracellular domain of
FZD4 as well. This cysteine residue is not known to form
an intracellular disulfide bond but it is the 11th of 13 cys-
teine residues that are conserved in vertebrate and may
be required for dimerization.10 Dann et al11 observed that
other frizzled receptors can dimerize and proposed that
this may be relevant to the mechanism of Wnt binding
and signaling.
The Q505X mutation falls immediately after the highly
conserved Wnt signaling motif (KTXXXW). Presum-
ably, this early termination results in haploinsufficiency
due to nonsense-mediated mRNA decay. It is possible that
a truncated protein is produced and terminated prior to
the PDZ binding motif (ETXV) of FZD4 (c-Jun N-
terminal kinase pathway) (Figures 1 and 2). Perhaps non-
canonical signal transduction via the c-Jun N-terminal
kinase pathway is necessary for normal angiogenesis and
vascularization of the retina. Alternatively, the mutant
allele may form an oligomer with the wild type, trap-
ping both in the endoplasmic reticulum. Kaykas et al12
demonstrated that a similar FZD4 mutation (L501fsX533)
(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009
1653
©2009 American Medical Association. All rights reserved.
Downloaded From: https://jamanetwork.com/ by a University of Leeds User on 08/14/2019
resulted in this occurrence. Finally, Robitaille et al13 dem-
onstrated that the L501fsX533 mutation decreased acti-
vation of the Wnt-Ca2⫹ pathway. It is therefore difficult
to tell which intracellular Wnt pathway is disrupted by
this mutation.
A double missense mutation, P33S/P168S, was found
in 9 of the screened patients. The P33S mutation is in
the signal sequence portion of the gene and could im-
pair translocation of FZD4 to the plasma membrane. Ad-
ditionally, proline is not a common amino acid and has
the unique characteristic of rigidity that could be essen-
tial to the proper conformation of the protein. Another
possibility is that this mutation affects a second tran-
script of the FZD4 gene, FZD4S. This transcript variant
retains the intron between exon 1 and exon 2 and is 327
amino acids long. Currently, it is unclear whether FZD4S
is an antagonist or agonist of FZD4 signaling.14,15
New blood vessel formation requires the coordina-
tion of endothelial cell division and the morphogenic
movement of vessel expansion,16 and there is evidence
for both canonical and noncanonical signal transduc-
tion in this process. For instance, LRP5 is known only
to participate in canonical signal transduction. Because
mutations in LRP5 have been associated with some cases
of AdFEVR, it is likely that the canonical pathway plays
a role in vascular eye development. Additionally, in vitro
testing in STF cells has shown that mutations in either
FZD4 or LRP5 result in decreased Wnt/␤-catenin signal
compared with wild type.3
There is also evidence to support the noncanonical
transmission of the signal. Zeng et al16 demonstrated that
perpendicular orientation of endothelial cell division is
necessary for elongation of new vessels and suggests that
planar cell polarity is required for this proper orienta-
tion. The FZD4 ligand, Wnt5a, has been shown to acti-
vate signal transduction by a planar cell polarity path-
WWW.ARCHOPHTHALMOL.COM
 way. Wnt5a−/− animals have a disrupted polarization of
sensory hair cell stereocilia in the cochlea of the inner
ear,17 similar to that seen in the FZD4−/− mice, which also
have enlarged and disorganized vessels in both the coch-
lea and retina.3
Perhaps the FZD4 signal transduction, through both
canonical and noncanonical pathways, is necessary for
normal vessel development. One could envision upregu-
lation of endothelial cell growth stimulated by canoni-
cal activated transcription followed by noncanonical
stimulated cytoskeletal rearrangement and subsequent
expansion of cells to form new vessels.
CLINICAL MANIFESTATIONS
This study highlights the complexity of categorizing ge-
netic diseases. There is a clinical diagnosis and a genetic
diagnosis, neither of which alone sufficiently describes
the disease state. Often a diagnosis of ROP or FEVR is
determined by family and birth histories in addition to
clinical findings. This study indicates that the differen-
tiation between these two diseases is not always distinct
because the same FZD4 mutation was highly prevalent
in both types of patients but not in controls.
Both ROP and FEVR share similar clinical pheno-
types such as avascular peripheral retina, neovascular
changes, vascular tortuosity and dilation, exudation, and
vitreoretinal fibrosis. However, the presence of a periph-
eral avascular zone alone does not always lead to sec-
ondary complications in either disease. This is shown in
this study by the fact that the parents of both types of
patients and the twin with ROP who had the double-
missense mutation were asymptomatic despite periph-
eral retinal avascularity (Figure 3). Presumably, many in-
dividuals with a peripheral avascular zone and a FZD4
mutation are never evaluated.
It has long been suspected that genetics plays a role
in ROP, and a recent twin study18 concluded that there
is a 70% genetic predisposition to development of ROP.
Prior to this study, only 1 FZD4 mutation in a patient
with ROP had been described.2 We suggest that the se-
verity of retinal abnormalities is secondary to both ge-
netic predisposition and epigenetics. It is our goal to in-
vestigate this possibility in further studies.
Submitted for Publication: March 13, 2009; final revi-
sion received May 29, 2009; accepted June 6, 2009.
Correspondence: Kimberly A. Drenser, MD, PhD,
Associated Retinal Consultants, William Beaumont
Hospital, 3535 W 13 Mile Rd, No. 344, Royal Oak, MI
48073 (kadrenser@associatedretinalconsultants.com).
(REPRINTED) ARCH OPHTHALMOL / VOL 127 (NO. 12), DEC 2009
1654
©2009 American Medical Association. All rights reserved.
Downloaded From: https://jamanetwork.com/ by a University of Leeds User on 08/14/2019
Financial Disclosure: None reported.
Funding/Support: This study was supported by the Mar-
garet Walters Research Fund; and The Association for
Retinopathy of Prematurity and Related Diseases.
Additional Information: The eFigure is available at http:
//www.archophthalmol.com.
REFERENCES
1. Toomes C, Downey L. GeneReviews: Familial Exudative Vitreoretinopathy, Au-
tosomal Dominant. Seattle, OR: National Center for Biotechnology Information;
2008.
2. MacDonald ML, Goldberg YP, Macfarlane J, Samuels ME, Trese MT, Shastry BS.
Genetic variants of frizzled-4 gene in familial exudative vitreoretinopathy and ad-
vanced retinopathy of prematurity. Clin Genet. 2005;67(4):363-366.
3. Xu Q, Wang Y, Dabdoub A, et al. Vascular development in the retina and inner
ear: control by norrin and frizzled-4, a high-affinity ligand-receptor pair. Cell. 2004;
116(6):883-895.
4. Staal FJT, van Noort M, Strous GJ, Clevers HC. Wnt signals are transmitted through
N-terminally dephosphorylated ␤-Catenin. EMBO Rep. 2002;3(1):63-68.
5. Yao R, Natsume Y, Noda T. MAGI-3 is involved in the regulation of the JNK sig-
naling pathway as a scaffold protein for frizzled and Ltap. Oncogene. 2004;
23(36):6023-6030.
6. Toomes C, Bottomley HM, Scott S, et al. Spectrum and frequency of FZD4 mu-
tations in familial exudative vitreoretinopathy. Invest Ophthalmol Vis Sci. 2004;
45(7):2083-2090.
7. Nallathambi J, Shukla D, Rajendran A, Namperumalsamy P, Muthulakshmi R,
Sundaresan P. Identification of novel FZD4 mutations in Indian patients with fa-
milial exudative vitreoretinopathy. Mol Vis. 2006;12:1086-1092.
8. Smallwood PM, Williams J, Xu Q, Leahy DJ, Nathans J. Mutational analysis of
norrin-frizzled recognition. J Biol Chem. 2007;282(6):4057-4068.
9. Wu W-C, Drenser K, Trese M, Capone A Jr, Dailey W. Retinal phenotype-genotype
correlation of pediatric patients expressing mutations in the Norrie disease gene.
Arch Ophthalmol. 2007;125(2):225-230.
10. Omoto S, Hayashi T, Kitahara K, Takeuchi T, Ueoka Y. Autosomal dominant fa-
milial exudative vitreoretinopathy in two Japanese families with FZD4 mutations
(H69Y and C181R). Ophthalmic Genet. 2004;25(2):81-90.
11. Dann CE, Hsieh JC, Rattner A, Sharma D, Nathans J, Leahy DJ. Insights into Wnt
binding and signalling from the structures of two frizzled cysteine-rich domains.
Nature. 2001;412(6842):86-90.
12. Kaykas A, Yang-Snyder J, Héroux M, Shah KV, Bouvier M, Moon RT. Mutant frizzled
4 associated with vitreoretinopathy traps wild-type frizzled in the endoplasmic
reticulum by oligomerizaton. Nat Cell Biol. 2004;6(1):52-58.
13. Robitaille J, MacDonald ML, Kaykas A, et al. Mutant frizzled-4 disrupts retinal
angiogenesis in familial exudative vitreoretinopathy. Nat Genet. 2002;32(2):
326-330.
14. Sagara N, Kirikoshi H, Terasaki H, et al. FZD4S, a splicing variant of frizzled-4,
encodes a soluble-type positive regulator of the WNT signaling pathway. Bio-
chem Biophys Res Commun. 2001;282(3):750-756.
15. Swain RK. Xenopus frizzled-4S, a splicing variant of Xfzd4 is a context-
dependent activator and inhibitor of Wnt/B-catenin signaling. Cell Commun Signal.
2005;3:1-9.
16. Zeng G, Taylor SM, McColm JR, et al. Orientation of endothelial cell division is
regulated by VEGF signaling during blood vessel formation. Blood. 2007;109
(4):1345-1352.
17. Qian D, Jones C, Rzadzinska A, et al. Wnt5a functions in planar cell polarity regu-
lation in mice. Dev Biol. 2007;306(1):121-133.
18. Bizzarro MJ, Hussain N, Jonsson B, et al. Genetic susceptibility to retinopathy of
prematurity. Pediatrics. 2006;118(5):1858-1863.
WWW.ARCHOPHTHALMOL.COM