See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/351880799

Comparison of the immune response following subcutaneous versus

intranasal modified-live virus booster vaccination against bovine respiratory
disease in pre-weaning beef calves tha...

Article  in  Veterinary Immunology and Immunopathology · May 2021

DOI: 10.1016/j.vetimm.2021.110254

CITATIONS READS

0 17

13 authors, including:

Joao Henrique Jabur Bittar Alejandro Hoyos-Jaramillo

University of Florida University of Georgia
25 PUBLICATIONS   185 CITATIONS    12 PUBLICATIONS   10 CITATIONS   

SEE PROFILE SEE PROFILE

Maria Ferrer
University of Georgia
38 PUBLICATIONS   223 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Optimization of a protocol for cryopreservation of electroejaculated beef bull semen under ambulatory conditions View project

stallion immune mediated infertility View project

All content following this page was uploaded by Joao Henrique Jabur Bittar on 27 May 2021.

The user has requested enhancement of the downloaded file.

 Veterinary Immunology and Immunopathology 237 (2021) 110254

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology

journal homepage: www.elsevier.com/locate/vetimm

Comparison of the immune response following subcutaneous versus

intranasal modified-live virus booster vaccination against bovine
respiratory disease in pre-weaning beef calves that had received primary
vaccination by the intranasal route
Roberto A. Palomares a, b, c, *, João H.J. Bittar a, d, Amelia R. Woolums e,
Alejandro Hoyos-Jaramillo a, b, David J. Hurley b, c, Jeremiah T. Saliki f, Maria S. Ferrer a, c,
Anna C. Bullington c, Adriana Rodriguez a, b, Tyler Murray g, Merrilee Thoresen e, Katie Jones e,
Agne Stoskute a
a
Group for Reproduction in Animals, Vaccinology and Infectious Diseases (GRAVID™), College of Veterinary Medicine, University of Georgia, Athens, GA 30602-2771,
United States
b
Department of Population Health, College of Veterinary Medicine, University of Georgia, Athens, GA 30602, United States
c
Department of Large Animal Medicine, College of Veterinary Medicine, University of Georgia, Athens, GA 30602-2771, United States
d
Department of Large Animal Clinical Sciences, College of Veterinary Medicine, University of Florida, Gainesville, FL 32610, United States
e
Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi State, MS, United States
f
Oklahoma Animal Disease Diagnostic Laboratory, College of Veterinary Medicine, Oklahoma State University, Stillwater, OK 74078, United States
g
Department of Animal and Dairy Sciences, College of Agriculture and Environmental Sciences, University of Georgia, Athens, GA 30602-2771, United States

A R T I C L E I N F O A B S T R A C T

Keywords: This study was performed to elucidate whether the route of booster vaccination affects the immune response
Respiratory disease against respiratory vaccine viruses in pre-weaning beef calves that receive primary intranasal (IN) vaccination
Booster vaccination during the first month of life. The objective was to compare the serum neutralizing antibody (SNA) titers to
Administration route
BHV1, BRSV, and BPI3V, cytokine mRNA expression and mucosal BHV1- and BRSV-specific IgA in nasal se­
Immune response
Beef calves
cretions following administration of IN or subcutaneous (SC) modified-live virus (MLV) booster vaccines 60 days
after primary IN vaccination in young beef calves. Twenty-one beef calves were administered 2 mL of an IN MLV
vaccine containing BHV1, BRSV, and BPI3V (Inforce3®) between one and five weeks of age. Sixty days after
primary vaccination, calves were randomly assigned to one of two groups: IN-MLV (n = 11): Calves received 2
mL of the same IN MLV vaccine used for primary vaccination and 2 mL of a SC MLV vaccine containing BVDV1 &
2 (Bovi- Shield GOLD® BVD). SC-MLV (n = 10): Calves were administered 2 mL of a MLV vaccine containing,
BHV1, BRSV, BPI3V, and BVDV1 & 2 (Bovi-Shield GOLD® 5). Blood and nasal secretion samples were collected
on days -61 (primary vaccination), -28, -14, 0 (booster vaccination), 14, 21, 28, 42 and 60 for determination of
SNA titers, cytokine gene expression analysis and nasal virus-specific IgA concentrations. Statistical analysis was
performed using a repeated measures analysis through PROC GLIMMIX of SAS®. Booster vaccination by neither
IN nor SC routes induced a significant increase in SNA titers against BHV1, BRSV, and BPI3V. Subcutaneous
booster vaccination induced significantly greater BRSV-specific SNA titers (on day 42) and IgA concentration in
nasal secretions (on days 21 and 42) compared to calves receiving IN booster vaccination. Both IN and SC booster
vaccination were able to stimulate the production of BHV1-specific IgA in nasal secretions. In summary, booster
vaccination of young beef calves using either SC or IN route two months after IN MLV primary vaccination
resulted in comparable SNA titers, cytokine gene expression profile and virus-specific IgA concentration in nasal
secretions. Only a few differences in the systemic and mucosal immune response against BHV1 and BRSV were
observed. Subcutaneous booster vaccination induced significantly greater BRSV-specific SNA and secretory IgA
titers compared to IN booster vaccination.

* Corresponding author at: 2200 College Station Road, Athens, GA 30602, United States.
E-mail address: palomnr@uga.edu (R.A. Palomares).

https://doi.org/10.1016/j.vetimm.2021.110254
Received 24 September 2020; Received in revised form 23 April 2021; Accepted 2 May 2021
Available online 24 May 2021
0165-2427/© 2021 Elsevier B.V. All rights reserved.
R.A. Palomares et al.
1. Introduction
Bovine respiratory disease (BRD) is a polymicrobial and multifacto­
rial disease that affects cattle worldwide. It is the most prevalent illness
in stocker and feedlot cattle in North America, in spite of the use of
vaccination, particularly in the feedlot segment. The economic impact of
BRD on the US beef cattle industry involves losses that have been re­
ported to exceed $1 billion annually (Griffin, 1997). The infectious
agents involved in BRD include Bovine viral diarrhea virus (BVDV), Bovine
herpes virus 1 (BHV1), Bovine respiratory syncytial virus (BRSV), Bovine
parainfluenza 3 virus (BPI3V), Bovine coronavirus (BCoV), Pasteurella
multocida, Mannheimia haemolytica, Histophilus somni, and Mycoplasma
bovis. Coinfection with these agents combined with environmental
stressors (e.g., weaning, shipping, crowding, and weather extremes) and
host factors (e.g., susceptibility to specific pathogens, immune sup­
pression, and passive immunity) determine the severity of the clinical
disease.
Effective vaccination to induce protective immunity against BRD in
young calves with maternal antibodies (MA) is a significant goal of herd
health programs for cow-calf operations. Successful vaccination pro­
grams in pre-weaning calves may have a significant impact on the effi­
cacy of the subsequent production stages in beef production systems (e.
g. stocker and feedlot operations). However, a critical review of the
published literature on vaccination of pre-weaning beef calves indicated
that there is limited evidence concerning the efficacy of parenteral or
intranasal (IN) modified-live virus (MLV) vaccines in preventing BRD or
minimizing the impact of naturally occurring or experimentally induced
respiratory illness before age of weaning (Chamorro and Palomares,
2020). The evidence suggests that parenteral vaccination of calves in the
face of MA (IFOMA) may result in limited immune response due to in­
hibition of the vaccine antigens by maternally derived neutralizing an­
tibodies (Endsley et al., 2004; Ellis et al., 2001; Kimman et al., 1989).
Intranasal (IN) vaccination may represent a promising route for immune
priming in young calves IFOMA. As it is delivered intranasally, the
vaccine may circumvent interaction with MA and avoid their suppres­
sive effects on antigen recognition and subsequent steps in the immune
response. Additionally, IN vaccination may provide superior stimulation
of the local mucosal immune response. This is particularly important for
protection against pathogens that infect the animals through the respi­
ratory route. Intranasal vaccination has been associated with rapidly
increased levels of antigen specific IgA in nasal secretions (Hill et al.,
2012). Further, IN vaccination can induce the activation of type I in­
terferons, which provide protective immunity against viral infections
(Kimman et al., 1989; Vangeel et al., 2007 and 2009; Xue et al., 2010).
Therefore, as the MA decay and the calf starts becoming susceptible to
respiratory viruses, the local mucosal immunity induced by IN vacci­
nation should help protect the animal during the susceptibility window.
However, it has been hypothesized that the induced mucosal antibody
response after IN priming with MLV vaccine might limit virus replication
on the nasal mucosa. This is suggested to interfere with the induction of
a secondary immune response following booster IN vaccination, thus
impairing the efficacy of the IN booster (Bittar et al., 2015). Thus, the
route of booster vaccination might be an important factor influencing
the development of protective immunity induced in calves that receive
primary IN vaccination early in life. It has become common practice in
some cattle operations to prime newborn calves with IN vaccine IFOMA
during the first weeks of life and then administer a booster vaccination
around 2–3 months of age. Currently, there is an ongoing debate about
whether IN or subcutaneous (SC) route of booster vaccination is more
effective in calves, being the focus of multiple vaccination studies in
dairy and beef cattle (Hill et al., 2012, 2019; Woolums et al., 2013).
In previous studies, there was no difference in the immune response
following SC booster at weaning for calves primed by the IN or SC route
at 2 or 70 days of age (Woolums et al., 2013). Moreover, a recent trial
investigated the effectiveness of an MLV IN vaccination of young beef
calves on the induction of sufficient anamnestic response to prevent BRD
2
Veterinary Immunology and Immunopathology 237 (2021) 110254
and accelerate the onset of protective immunity after BHV1 experi­
mental challenge five months later (Hill et al., 2019). In that study, IN or
SC booster vaccination at weaning significantly reduced clinical signs of
BRD, but only IN booster vaccination was able to significantly reduce
virus shedding. In addition, only IN booster vaccination significantly
increased BHV1 specific IgA in nasal secretions (Hill et al., 2019).
In the present study, we hypothesized that booster vaccination with
an MLV vaccine by either SC or IN routes during the pre-weaning stage
(around 3 months of age) provides essentially equivalent systemic virus-
specific SNA titers, cytokine gene expression and secretory IgA levels in
beef calves that were prime vaccinated with an IN MLV vaccine at 1–3
weeks of age. The objective of this study was to compare the SNA titers
to BHV1, BRSV and BPI3V, cytokine mRNA expression in peripheral
blood leukocytes and BHV1- and BRSV-specific IgA in nasal secretions
following administration of IN or SC MLV booster vaccines 60 days after
primary IN vaccination in young beef calves.
2. Materials and methods
2.1. Study location and animal husbandry
The study was performed at the University of Georgia Double Bridges
Farm in Clarke County, Athens Georgia. The calves and their dams were
housed in two 12-acre pastures of Bermuda grass (Cynodon dactylon),
Rye grass (Lolium hybridum) and common wheat (Triticum aestivum) with
adequate shade. Additionally, cows received free choice Bermuda grass
hay, mineral supplementation and water ad libitum. The vaccination
program against BRD viruses for this herd was based on the adminis­
tration of an MLV vaccine to the heifers at weaning and 30 days before
first breeding as well as vaccination with SC combination modified-live
and inactivated virus vaccine (CATTLEMASTER GOLD FP-5®, Zoetis
Animal Health®) during pregnancy (at approximately 7 months of
pregnancy). The animals were cared for in accordance with acceptable
practices as outlined in the Guide for the Care and Use of Agricultural
Animals in Agricultural Research and Teaching (FASS, 2010). In addi­
tion, the research protocol was reviewed and approved by the University
of Georgia, Institutional Animal Care and Use Committee (IACUC; pro­
tocol number A2014 07-022-Y3-A2).
2.2. Experimental design, animals and vaccination
Twenty-one Angus and Angus crossbred calves (1–5 weeks of age)
born between September and October 2015 were enrolled in this trial.
Before starting the study, the calves were tested for BVDV persistent
infection status via antigen capture ELISA, using ear notch biopsy
samples. This test was performed at the University of Georgia, Athens
Veterinary Diagnostic Laboratory (Athens, GA).
The calves were administered 2 mL of an intranasal (IN) MLV vaccine
containing BHV1, BRSV, and BPI3V (Inforce 3® Zoetis Animal Health®)
between 1 and 5 weeks of age (mean: 27.3 days; median: 33 days). The
calves were randomly assigned to one of two treatment groups:
1 SC-MLV (n = 10): Sixty days after primary vaccination, the calves
were administered 2 mL of a MLV vaccine containing BVDV1 & 2,
BHV1, BRSV, and PI3V (Bovi- Shield GOLD® 5, Zoetis Animal
Health®) subcutaneously (SC).
2 IN-MLV (n = 11): Sixty days after primary vaccination, the calves
were given 2 mL of the same IN MLV vaccine used for the primary
vaccination. In addition, these calves received 2 mL of a SC MLV
vaccine containing BVDV1 & 2 (Bovi-Shield GOLD® BVD, Zoetis
Animal Health®). The SC BVDV vaccine was administered to these
animals, so that calves in both groups received the same complement
of antigens at boosting, with only the route of administration of the
boosting dose of BHV1, BRSV, and PI3V differing between the two
experimental groups.
R.A. Palomares et al.
Before random assignment and booster vaccination, serum neutral­
izing antibody (SNA) titers against BVDV1 & 2, BHV1, BRSV, and BPI3V
on day -14 (relative to the day of booster) were used to stratify the calves
to assure equivalent aggregate titers in both experimental groups.
Moreover, calves’ age was also evenly distributed between groups.
Following IN MLV vaccination, attenuated viruses can replicate in
the upper respiratory tract and be shed in nasal secretions. Therefore,
calves in IN-MLV and SC-MLV groups were physically separated for two
weeks (with their corresponding dams) in two different pastures
immediately after booster vaccination. This separation was intended to
prevent direct contact (nose to nose) and transmission of vaccine viruses
from the calves in the IN-MLV group to the calves in the SC-MLV group.
2.3. Sample and data collection
From each calf, blood and nasal secretion samples were collected on
days -61 (day of primary vaccination), -28, -14, 0 (day of booster
vaccination), 14, 21, 28, 42, and 60 relative to the day of booster
vaccination. Blood samples were used for determination of serum
neutralizing antibody (SNA) titers against BVDV1 & 2, BHV1, BRSV and
BPI3V, as well as gene expression analysis of stimulatory and regulatory
cytokines. Nasal secretion samples were utilized for assessment of
BHV1- and BRSV-specific IgA concentrations.
Blood samples were collected via jugular venipuncture using a 20
gauge x 1 inch single sample needle (Vacuette®; Nipro Medical In­
dustries Ltd., Gunma, Japan) into three individual 8.5 mL vacuum glass
tubes with anticoagulant for buffy coat separation (BD Vacutainer ACD
Solution A REF364606®; BD Diagnosis, Franklin Lakes, NJ), and two
individual 10 mL glass tubes without anticoagulant (BD Vacutainer
Serum®; BD Diagnosis, Franklin Lakes, NJ) for serum separation and
subsequent SNA titers determination.
Nasal secretions were obtained from each calf using a soft foam
sponge trimmed to an appropriate size to fit within a nostril. A piece of
cotton twine was sewn to the sponge with the free end of the twine
knotted to facilitate sponge removal. The sponge was inserted into a
nostril and left in place for 3 min. After the sponge was removed from
the nostril, it was placed into a 20-mL syringe from which the plunger
was previously removed. The plunger was then inserted into the syringe
and used to squeeze nasal secretions from the sponge into a poly­
propylene tube.
2.4. Sample processing
Within three hours after collection, blood and nasal secretion sam­
ples were transported on ice to the laboratory. The blood samples con­
taining the anticoagulant ACD Solution A were processed for buffy coat
separation, as previously described (Harpin et al., 1999).
Blood samples were incubated at 37 ◦ C for 2 h before centrifugation.
The blood samples in the serum separator tubes were centrifuged at
900×g for 15 min. The serum was then removed and stored in aliquots at
− 80 ◦ C until analyzed for SNA titers against BVDV1 & 2, BHV1, BRSV,
and BPI3V.
The nasal secretion samples were mixed with an equal volume of 0.1
% Tween in PBSS, vortexed briefly, and then centrifuged at 900×g for 10
min. The supernatant was decanted from each sample and stored at − 80
◦
C until the sample was analyzed for BHV1- & BRSV-specific IgA
concentration.
2.5. Serum neutralizing antibody titers against BVDV1 & 2, BHV1, BRSV
and BPI3V
Serum neutralizing antibody (SNA) titers against BVDV1 & 2, BHV1,
BRSV and BPI3V were assessed via a standard virus neutralization test
by the University of Georgia Athens Veterinary Diagnostic Laboratory
(Athens, GA). Briefly, serum samples were thawed and heat-inactivated
in a water bath at 56 ◦ C for 30 min. Heat-inactivated serum samples in
3
Veterinary Immunology and Immunopathology 237 (2021) 110254
duplicate were then diluted using Dulbecco minimum essential medium
(DMEM) into a serial 2-fold dilution series in 96-well cell culture plates,
starting at 1:2 dilution. To each well, 25 μL of DMEM containing about
100 TCID50 of the respective virus (BVDV1 & 2, BHV1, BRSV and BPI3V)
was added. Addition of virus took the initial dilution of serum to 1:4. The
plates were incubated in 5 % CO2 at 37 ◦ C for 1 h. Then 150 μL (approx.
1.8 × 104 cells) of a Madin Darby bovine kidney (MDBK) cell suspension
in DMEM containing 10 % fetal calf serum (FCS) was added to each well.
After that, the plates were incubated in 5 % CO2 at 37 ◦ C for 4 days.
Finally, an inverted microscope was used to examine the cell monolayer
in each well for virus-specific cytopathic effects. The SNA titer for each
sample was reported as the reciprocal of the highest dilution of serum
that completely inhibited virus-induced cytopathic effects in both wells.
2.6. BHV1- & BRSV-specific IgA concentration in nasal secretions
The concentration of BHV1-specific IgA in nasal secretions was
determined at the Department of Large Animal Medicine, College of
Veterinary Medicine, University of Georgia. Before inactivation, BHV1
(Cooper strain) was grown to a viral titer of log10^7.2 TCID50. Each well
of a 96-well plate was coated with 100 μL of a 1:400 dilution of binary
ethyleneimine-inactivated BHV1 in coating buffer (0.01 M sodium car­
bonate buffer at pH 9.7) and incubated at 4 ◦ C for 12–18 hours. This
dilution was determined to yield maximal BHV1-specific signal from the
serum of two vaccinated calves and minimal background signal from the
serum of the same two calves prior to vaccination, and also from fetal
bovine serum. Following incubation, the plates were washed three times
with wash buffer [phosphate buffered saline (PBS) containing 0.05 %
Tween 20 at pH 7.4]. Then, the plates were prepared in large batches,
blotted dry, and stored at − 20 ◦ C until used. On the day the assay was
performed, the required number of plates was removed from the freezer.
Each plate was washed once with wash buffer. To each well, 200 μL of
PBS solution containing 0.5 % bovine serum albumin was added, and the
plates were incubated at room temperature for 1 h. The plates were
washed three times with wash buffer. Nasal secretion samples, which
had been stored frozen at a 1:2 dilution in 0.1 % Tween 20 in PBS, were
thawed and further diluted 1:5 in wash buffer, resulting in a final sample
dilution of 1:10. For each nasal secretion sample, 100 μL of the 1:10
diluted sample was added to each of four wells of the 96-well plate.
Following a preliminary assessment of serial 10-fold dilutions of a
representative set of nasal secretion samples collected, samples were
assessed using serial 2-fold dilutions starting at a 1:100 dilution. Sam­
ples with an endpoint exceeding the range of detection were retested at a
higher starting dilution and samples that were negative at all dilutions
were retested at a lower starting dilution.
The plates were incubated at room temperature for 1 h and then
washed four times with wash buffer. The IgA was detected with com­
mercial HRP conjugated rabbit anti-bovine IgA (Bethyl Laboratories,
Montgomery, TX), and revealed using 2,2-azino-bis-3-ethylbenzothiazo­
line-6-sulphonic acid (ABTS, Sigma, St. Louis). To each well, a 1:50,000
dilution of horseradish peroxidase–conjugated sheep anti-bovine IgA
was added. The plates were incubated at room temperature for 1 h. The
plates were washed four times with wash buffer. Next 100 μL of 0.001 %
2,2′ -azinobis diammonium salt in 0.1 M citric acid (MP, Indianapolis,
IN, at pH 4.35) containing 1% of the substrate volume of 30 % H2O2
(MP) was added to each well. The plates were incubated at room tem­
perature for 30 min or until the expected color intensity was observed
for the positive control samples. The plates were read using an absor­
bance at 405 nm with a microplate reader (Epoch, BioTech, Whiting,
VT). Titers were reported as the inverse of the last dilution yielding
greater than or equal to twice the mean optical density of the negative
control (low IgG FBS, Gibco, ThermoFisher®, Waltham, MA) at a 1:100
dilution.
The concentration of BRSV-specific IgA in nasal secretions was
determined at the Department of Pathobiology and Population Medi­
cine, College of Veterinary Medicine, Mississippi State University.
R.A. Palomares et al.
Briefly, a preparation of 10.5x concentrated supernatant from cells
infected with BRSV strain 375 inactivated with 2 μM binary ethyl­
eneimine followed by neutralization with sodium thiosulfate was
diluted 1:800 in carbonate bicarbonate buffer (pH 9.5) and used to coat
plates incubated overnight at 4 ◦ C. Plates were washed three times with
PBS containing 0.05 % Tween 20. Initial processing of nasal secretions
consisted of diluting them 1:1 with PBS containing 0.1 % Pluronic® F-
127 (Sigma), vortexing thoroughly and storing them at − 80 ◦ C prior to
analysis. After thawing nasal secretions were vortexed again and diluted
1:100 in ELISA wash buffer. From this initial dilution serial 2-fold di­
lutions were prepared out to 1:800 and each dilution was run in tripli­
cate. Samples with an optical density reading that exceeded the
detection range were tested again at a higher dilution and samples with
an optical density reading not greater than twice the negative control
were tested again at a lower dilution. In addition to the samples each
plate also included the following (4 replicates each): 1) a positive control
which consisted of nasal secretions diluted 1:100 that would yield an
average optical density between 0.3− 0.8, 2) a negative control which
was low IgG FBS (Gibco, ThermoFisher®, Waltham, MA) diluted 1:100
and 3) a plate blank which was ELISA wash buffer alone. The IgA was
detected with commercially available HRP-conjugated rabbit anti-
bovine IgA (Bethyl Laboratories) diluted 1:500 and plates were devel­
oped using 2,2′ -azino-bis-3-ethylbenzothiazo-line-6-sulphonic acid
(ABTS, Roche) and were read on a plate reader at a wavelength of 405
nm. Titers were reported as the inverse of last dilution which was greater
than or equal to two times the average optical density of the negative
control.
2.7. Cytokine mRNA expression analysis
Gene expression analysis of pro-inflammatory [interleukin 1 (IL1),
tumor necrosis factor alpha (TNFα), interferon gamma (IFNγ), and IL2]
and regulatory [transforming growth factor beta (TGF-β) and IL10] cy­
tokines was performed on peripheral blood leukocytes. Buffy coat
samples were disrupted and homogenized in buffer containing guani­
dine isothiocyanate utilizing a bullet blender machine and 1 mm glass
beads. Total RNA was extracted and purified from peripheral leukocyte
samples using a commercial RNA extraction kit (RNeasy® Mini kit,
Qiagen Germany), as recommended by the manufacturer.
Then, the cDNA synthesis was done using 100 ng to 1 μg of total RNA
template and a first cDNA strand reverse transcription kit (iScript ™
cDNA Synthesis kit, BIORAD, USA), according to the manufacturer’s
protocol. After reverse transcription, the cDNA products (approx. 1 μg/
μl) were diluted 10-fold with RNase free water to obtain a template
concentration of 100 ng/μl and used for the quantitative Real Time PCR
(qRT-PCR). Quantitative real time PCR was done preparing 20 μL re­
actions to assess the mRNA gene expression using a real time thermo­
cycler (CFX 96 Real - Time system, BIORAD) and a SYBR green DNA
detection system (SsoAdvanced™Universal SYBR Green Supermix,
Table 1
Primers used for quantitative RT-PCR during the mRNA expression analysis of pro-inflammatory and regulatory cytokines after booster MLV vaccination in beef calves.
Genes Gene ID Description
GAPDH 281181 Glyceraldehyde-3-phosphate dehydrogenase (B. taurus)
TNF-α 280943 Tumor necrosis factor alpha (Bos taurus
IL-1β EU438767 Bovine Interleukin 1-beta
IFN-γ EU276066 Bovine Interferon gamma
IL-2 M12791 Bovine interleukin 2
IL-10 U00799 Charolais interleukin-10 (Bos taurus)
TGF-β M36271 Bovine transforming growth factor-beta-1
4
Veterinary Immunology and Immunopathology 237 (2021) 110254
BIORAD USA). The PCR mix (20 μL) was made using 10 μL of the master
mix, 6 μL of dd H2O and 1 μL of each primer in a final concentration of
500 nM. Next, 2 μL of cDNA template (100 ng/ μL) was added to each
reaction. Specific primer sequences for target genes are documented in
Table 1. The PCR reaction was performed at 95º C for 30 s (pre-incu­
bation), followed by 40 cycles of 95º C for 10 s, 60− 71º C (primer
dependent) for 15 s and 72º C for 10 s. After each PCR process, a melting
curve analysis was conducted to evaluate the quality and specificity of
the amplification. Melting curve analysis was done by incubation of the
qRT-PCR products for 60 s at each step with temperature gradually
increasing by 0.1º C/sec from 65 to 95º C. All samples were analyzed in
duplicate to finally calculate the relative amount of mRNA. Non-
template negative controls containing PCR-grade water (instead of the
template cDNA samples) were included in each PCR run.
The threshold cycle (Ct) indicates the PCR cycle that produced an
amount of DNA of the amplified gene generating a fluorescent signal
that is significantly greater than the baseline. Results for gene expression
were analyzed with the comparative Delta Delta Ct method (Livak and
Schmittgen, 2001). Gene expression analysis was carried out by the
relative quantification of the mRNA level of the target genes on days 14,
21 and 28 after booster vaccination normalized to mRNA level of the
housekeeping gene (glyceraldehyde-3-phosphate dehydrogenase,
GAPDH) on the same days and compared to the baseline values (for
target and housekeeping genes) on day 0, before booster vaccination
(Livak and Schmittgen, 2001). The efficiency of the qRT-PCR was
determined for each target gene (>90 %).
2.8. Statistical analysis
All analyses were performed using the Statistical Analysis System
(SAS®, version 9.3, SAS Institute, Cary, NC). Since there was a signifi­
cant departure from normality and constant variability (assessed using
Shapiro Wilk’s and Levene’s tests, respectively), a logarithmic base 2
transformation was applied to the values of SNA titer and BHV1- and
BRSV-specific IgA concentrations. The outcomes produced by the
transformation were carefully examined for possible violations of
parametric assumptions. For calculation and comparison of geometric
mean (GM) antibody titers, back-transformed titers for each virus tested
were calculated for each group at days -61, -28, -14, 0, 14, 21, 28, 42,
and 60 after booster vaccination.
The SNA titers against BVDV1 & 2, BHV1, BRSV and BPI3V, specific
IgA concentration against BHV1 & BRSV in nasal secretions and cyto­
kine mRNA expression were compared between vaccination groups and
over time by using repeated-measures analysis PROC GLIMMIX model
(with the variable time as repeated statement) using calf as random
effect, and group and time as fixed effects. The Tukey-Kramer test was
used to adjust for multiple comparisons. The virus-specific antibody ti­
ters on the day of primary vaccination (day -61) were used as covariate
in the statistical model to minimize the differences between groups at
Primer sequences Reference
Fwd: 5′ GATTGTCAGCAATGCCTCCT 3′
(Smirnova et al., 2008)
Rev: 5′ GGTCATAAGTCCCTCCACGA3′
Fwd : 5′ CCTGGTACGAACCCATCTA3′
(Yamane et al., 2008)
Rev: 5′ ATCCCAAAGTAGACCTGCC3′
Fwd: 5′ AAAGCTTCAGGCAGGTGGTG3′
(Werling et al., 2002)
Rev: 5′ TGCGTAGGCACTGTTCCTCA3′
Fwd: 5′ GTAGCCCTGTGCCTGATTTC3′
(Baldwin, 2008)
Rev: 5′ CACATTGTCCCTTCCCAGAG3′
Fwd:5′ GAAAGTTAAAAATCCTGAGAACCTCAA 3′
(Seo et al., 2007)
Rev: 5′ GCGTTAACCTTGGGCACGTA 3′
Fwd 5’TTCTGCCCTGCGAAAACAA3′
(Seo et al., 2007)
Rev 5’TCTCTTGGAGCTCACTGAAGACTCT3′
Fwd 5’CATCTGGAGCCTGGATACACAGT 3′
(Seo et al., 2007)
Rev 5’GAAGCGCCCGGGTTGT3′
R.A. Palomares et al. Veterinary Immunology and Immunopathology 237 (2021) 110254

the beginning of the study, since it is documented that the level of

maternal antibodies may affect the immune response to vaccination. The
proportion of calves having four-fold increase in antibody titers in nasal
secretions was compared between groups using PROC LOGISTIC and
Fisher’s Exact Test. For all analyses, the alternative hypothesis was
assumed to be two-sided, and values of P < 0.05 were considered sig­
nificant, and 0.05 < P ≤ 0.10 was considered a tendency.

3. Results

Calves had high SNA titers to BVDV1 & 2, BHV1, BRSV and BPI3V
before primary vaccination at 1–5 weeks of age, likely of maternal
origin. There was a notably high variability in the SNA titers to BRSV
and BHV1 before primary vaccination, which decreased by day -14
(Fig. 1A and B).
There was a significant effect of time on the SNA titers against the
studied viruses (P < 0.001). A significant decay in SNA titers to BVDV1
and 2, BHV1, BRSV and BPI3V was observed over time (P < 0.001)
during the 4-month experimental period in a similar manner in both
groups (Figs. 1 and 2). Moreover, booster vaccination (by either IN or SC
route) did not induce a significant increase in SNA titers against BHV1,
BRSV and BPI3V in these beef calves that had previously received a
primary IN MLV vaccine (Fig. 1A–C). Similarly, BVDV primary vacci­
nation on day 0 (around 12 weeks of age) did not affect SNA titers
against BVDV1 and 2 (Fig. 2A and B). Significant differences were not
observed for SNA titers to BVDV1 & 2, BHV1, and BPI3V between groups
at any time point during the experimental period (no significant effects
of group or the interaction group x time). There was a significant effect
of the interaction group x time on the SNA titers against BRSV (P =
0.005). Calves in the SC-MLV group had a significantly greater SNA titer
against BRSV on day 42 following booster vaccination compared to that
of the IN-MLV calves (P < 0.01; Fig. 1A).
Sustained and gradual increase in BHV1- and BRSV-specific IgA titers
in nasal secretions was observed in both groups (IN-MLV and SC-MLV)
in response to primary and booster vaccinations (Fig. 3A and B).
There was a significant effect of time on the BHV1-IgA concentrations in
nasal secretions (P < 0.0001). Primary vaccination induced a significant
increase in secretory IgA titers to BHV1 (on days -14 and 0, P < 0.001).
Further, booster vaccination resulted in a pronounced increase in BHV1-
IgA titers on day 14 in both groups (P = 0.0006). Overall, there were no
significant effects of group (P = 0.29) or the interaction group x time (P Fig. 1. Geometric means (GM) serum neutralizing antibody (SNA) titers to
= 0.06) on the BHV1-IgA titers in nasal secretions. However, a signifi­ BRSV (A), BHV1 (B) and BPI3V (C) in beef calves booster vaccinated with
cant interaction of group x time was observed on days 28 (P = 0.02) and intranasal (IN-MLV) or subcutaneous (SC-MLV) modified-live virus vaccine 60
60 (P = 0.0001) with greater BHV1-IgA titers for the SC-MLV group days after IN primary vaccination. Error bars indicate standard error of the
(Fig. 3A). Although the geometric mean titers and the proportion of means. A high variability in SNA against BRSV and BHV1 was observed on day
calves having a four-fold increase in BHV1-specific IgA titer in nasal -61 before primary IN vaccination. There was a significant effect of time on the
secretions appeared to be numerically greater on day 14 for the IN-MLV SNA titers against the studied viruses (P < 0.001). †Values differed significantly
from values on day -61 (P < 0.001). ‡ Values differed significantly from values
group (GM: 2,320; 4-fold increase: 5/11, 45.5 %;) than the SC-MLV
on day 0 (P < 0.001). There were no significant effects of group or the inter­
group (GM: 940; 4-fold increase: 2/10, 20 %), the values were not
action group x time for SNA titers to BHV1 and BPI3V. * There was a significant
significantly different (P = 0.21). effect of the interaction group x time on the SNA titers against BRSV (P =
There were significant effects of group (P = 0.03), time (P < 0.0001) 0.005). Calves in the SC-MLV group had a significantly greater SNA titer against
and the interaction group x time (P < 0.05) on the BRSV-IgA titers in BRSV on day 42 following booster vaccination compared to that of the IN-MLV
nasal secretions. Primary vaccination induced a significant increase in calves (P < 0.01).
secretory IgA titers to BRSV on day -14 (P < 0.001) in both groups.
Booster vaccination resulted in a significant increase in BRSV-IgA titers mucosal virus-specific antibody responses in conventionally-raised
on day 14 in both groups (P = 0.0001), without significant differences calves vaccinated with commercially available vaccines in protocols
between groups. Thereafter, calves receiving SC MLV booster vaccina­ typical of those used in the field. Moreover, given information regarding
tion had significantly greater IgA titers against BRSV in nasal secretions the merits of priming with one type of vaccine and boosting with another
on days 21 (P < 0.05) and 42 (P < 0.01) than calves in the IN-MLV group (heterologous prime-boost) (Ellis et al., 2018; Kardani et al., 2016),
(Fig. 3B). There were no significant differences in the cytokine mRNA research is needed to assess the effects of different prime-boost combi­
expression between vaccination groups on days 14, 21 and 28 relative to nations in calves. In the present study, booster vaccination of young beef
the day of booster vaccination (Fig. 4). calves (approximately 3 months old) using either the SC or IN route two
months after IN MLV primary vaccination resulted in comparable BHV1,
4. Discussion BRSV and BPI3V SNA titers, cytokine gene expression profile and
virus-specific IgA concentration in nasal secretions. Only a few
Relatively little published research has described both systemic and

5
R.A. Palomares et al. Veterinary Immunology and Immunopathology 237 (2021) 110254

Fig. 2. Geometric means (GM) serum neutralizing antibody (SNA) titers to

BVDV1 (A) and BVDV2 (B) in beef calves booster vaccinated with intranasal
(IN-MLV) or subcutaneous (SC-MLV) modified-live virus vaccine 60 days after Fig. 3. Geometric means (GM) secretory IgA titers to BHV1 (A) and BRSV (B) in
IN primary vaccination. In this study, similar to the SC-MLV group, the vaccine nasal secretions of beef calves booster vaccinated with intranasal (IN-MLV) or
BVDV fraction was administered subcutaneously to the IN-MLV group. Error subcutaneous (SC-MLV) modified-live virus vaccine 60 days after IN primary
bars indicate standard error of the means. There was a significant effect of time vaccination. Error bars indicate standard error of the means.
on the SNA titers against BVDV1 & 2 (P < 0.0001). There was a significant effect of time on the BHV1- and BRSV-IgA concentra­
†
Values differed significantly from values on day -61 (P < 0.001). ‡ Values tions in nasal secretions (P < 0.0001). † Values differed significantly from
differed significantly from values on day 0 (P < 0.0001). There were no sig­ values on day -61 (P < 0.001). ‡ Values differed significantly from values on day
nificant differences in SNA titers to BVDV1 & 2 between vaccination groups at 0 (P < 0.001). There were no significant effects of group (P = 0.29) or the
any time point (no significant effects of group or the interaction group x time). interaction group x time (P = 0.06) on the BHV1-IgA titers in nasal secretions.
However, SC-MLV group had greater BHV1-IgA titers (*significant interaction
differences in the antibody response against BHV1 and BRSV were of group x time) on days 28 (P = 0.02) and 60 (P = 0.0001).
observed between vaccinated groups. Similar to the present study, an There were significant effects of group (P = 0.03), and the interaction group x
time (P < 0.05) on the BRSV-IgA titers in nasal secretions. *Significant differ­
earlier trial did not show significant differences in the humoral and
ence between groups for BRSV- specific IgA titers on days 21 (P < 0.05) and 42
cell-mediated immune responses against BHV1 and BRSV in young beef
(P < 0.01).
calves prime-vaccinated by either SC or IN route IFOMA at 2 or 70 days
of age (Woolums et al., 2013).
two doses of a SC MLV vaccine IFOMA (Palomares et al., 2016).
In the current study, booster vaccination did not induce serocon­
The route of booster vaccination (IN or SC) did not have a significant
version (4-fold increase in SNA titers) against the studied respiratory
effect on the mRNA expression of stimulatory or regulatory cytokines at
viruses. Moreover, SNA titers consistently decayed during the experi­
any time point in beef calves IFOMA. It may be that different results
mental period, regardless of the booster vaccination route. It has been
would have been seen if peripheral blood mononuclear leukocytes had
documented that the presence of maternally derived antibodies may
been re-stimulated in vitro with BHV1 or BRSV prior to measurement of
affect the induction of measurable humoral immune responses following
cytokine expression, as previously reported (Reber et al., 2006; Fig­
vaccination (Muñoz-Zanzi et al., 2002; Fulton et al., 2004; Ellis et al.,
ueiredo et al., 2009; Sun et al., 2010). A prior study led by one of the
2001, 2010; Woolums et al., 2013). However, other studies have
authors of this study (DJH) evaluating different parameters of the im­
revealed that memory humoral and/or cell-mediated immune responses
mune response after vaccination of beef calves did not observe signifi­
can be stimulated when calves are vaccinated IFOMA, in the absence of
cant differences in the cytokine (IL-4, IL-10, IL-12, IFN-γ) gene
seroconversion (Ellis et al., 1996; Endsley et al., 2003, 2004; Patel and
expression analysis among different vaccination protocols. The authors
Didlick, 2004; Platt et al., 2009). Vaccination of calves having MA does
stated that this may have been due to insufficient test sensitivity when
not commonly result in seroconversion, but antibody responses at
using peripheral blood leukocytes for determination of cytokine mRNA
booster have been reported in some studies (Brar et al., 1978; Menan­
transcription in response to vaccination (Reber et al., 2006). Another
teau-Horta et al., 1985). Accordingly, in a recent study we observed a
possible explanation for the lack of a significant cytokine expression
significantly increased leukocyte proliferation recall response to BHV1
may be inadequate time points for sample collection after vaccination
and BRSV without increase in SNA titers in dairy calves that received

6
R.A. Palomares et al.
(days 14, 21 and 28) in relation to the time of cytokine response by
leukocytes in peripheral circulation (Reber et al., 2006).
Vaccination is a key tool for prevention and control of BRD and
reduction of antibiotics use in cattle. However, despite its common use
and multiple reports about the benefits of vaccination on cattle health
and performance, a recent critical review indicated that there is limited
scientific evidence of the efficacy of MLV vaccination in preventing or
minimizing the impact of BRD in beef calves before weaning age (Cha­
morro and Palomares, 2020). Further, there still is a high percentage of
operations that do not use respiratory virus vaccines in the USA (USDA,
APHIS-VS-CEAH, 2010). Beyond this reality, the present study was
developed to answer the practical question of which route of booster
vaccination would induce a stronger and more consistent systemic and
mucosal immune response to vaccine antigens in pre-weaning young
beef calves that were prime-vaccinated with an IN MLV vaccine.
BHV1-specific IgA titers in nasal secretions gradually increased in
both groups with numerically greater (but not significant) figures for the
IN-MLV group on day 14, but more consistent and significantly greater
values in the SC-MLV group on days 28 and 60 following booster
vaccination. Hill et al. (2012) demonstrated that IN vaccination of
newborn calves with high concentrations of SNA induced an increase in
IgA titers in nasal secretions but did not stimulate a rise in SNA titers. In
the same study, revaccination with the IN MLV vaccine on day 35 also
induced additional IgA production. The authors concluded that IN
vaccination with MLV vaccine was effective in calves that had
7
Veterinary Immunology and Immunopathology 237 (2021) 110254
Fig. 4. mRNA gene expression analysis of pro-
inflammatory and anti-inflammatory cytokines
in peripheral blood leukocytes of beef calves
following booster vaccination with intranasal
(IN) or subcutaneous (SC) modified-live virus
(MLV) vaccines. Vaccination groups are repre­
sented by grey (IN-MLV) and white (SC-MLV)
box plots. The graphs include the median values
(horizontal lines within the boxes), the whis­
kers represent the interquartile ranges and the
dots represent the extreme values. Values of the
Y axis represent the fold-change expression of
target genes normalized to the house-keeping
gene (GAPDH), relative to the values on the
day of booster vaccination (day 0). Significant
differences were not observed between groups
for any time point after booster vaccination.
maternally derived antibodies. A more recent study investigated
whether IN MLV vaccination of 3–6 week old beef calves followed by
booster 4.5 months later (a day after weaning) induced adequate
memory immunity to prevent respiratory disease following BHV1
challenge (4 days after booster vaccination) (Hill et al., 2019). In that
study, calves that received booster vaccinations (IN or SC) had signifi­
cantly reduced clinical disease and bacterial pneumonia. Only calves
that were administered IN MLV primary vaccination plus IN MLV
booster vaccination increased BHV1 IgA in nasal secretions and reduced
virus shedding, which might help suppress disease transmission. The
results of that study pointed out that primary MLV IN vaccination in
young beef calves IFOMA was able to induce anamnestic immunity.
Moreover, IN booster vaccination at weaning age was effective to ensure
a rapid onset of protection (with increased IgA levels, decreased viral
shedding and clinical BRD incidence) against BHV1 exposure four days
later. In addition, SC booster vaccination was also able to prevent clin­
ical disease but did not decrease virus shedding (Hill et al., 2019).
In the present study, calves receiving SC booster vaccination had
greater BRSV SNA (on day 42) and BRSV-specific IgA concentration in
nasal secretions (on days 21 and 42) compared to the calves adminis­
tered an IN booster vaccine. Similarly, a field study using 11-week old
beef calves, with low antibody titers to BHV1 and BRSV (<1:6) revealed
that vaccination with an IN MLV vaccine (containing BHV1, BRSV, and
BPI3V) concurrent with administration of a M. haemolytica bacterin-
leukotoxoid induced a significant increase in BRSV antibody response
R.A. Palomares et al.
after revaccination with an injectable MLV vaccine 90 days later (Stol­
tenow et al., 2011). In another trial using suckling beef calves, the
administration of a commercial IN MLV primary vaccine at 55–99 days
of age and subsequently a parenteral MLV booster vaccine concurrent
with M. haemolytica leucotoxoid five months later resulted in a signifi­
cantly increased antibody response to BRSV. In that trial, IN priming
vaccination appeared superior to SC, based on higher antibody titers to
BRSV in IN primed calves (Ellis et al., 2013). Furthermore, Ellis et al.
(2018) demonstrated that primary IN vaccination of young beef heifer
calves IFOMA stimulated an adequate priming mucosal immunity that
supported the induction of protective immune response elicited by
parenteral booster MLV at 2 months of age, leading to protection against
BRSV infection at 6 months of age. In that study, vaccinated calves
developed no or mild respiratory disease. The benefits of this protocol,
referred to as a "IN prime -SC boosting " approach, using different an­
tigen delivery systems (or heterologous boosting) has been commonly
used in the field by practitioners based on the assumption of reduced
interference of maternal antibodies when the prime vaccination is
administered by the IN route.
In the current study, somewhat unexpectedly, the calves boosted SC
had higher BRSV-specific nasal IgA titers following booster, compared to
IN boosted calves. This may have been due to suppression of the booster
IN vaccine by a mucosal memory response initiated by the IN priming
dose, as it has been speculated to occur (Bittar et al., 2015). Alterna­
tively, it is possible that the SC boosted calves also inadvertently
received IN boosting by BRSV shed by the IN boosted calves, contrib­
uting to higher BRSV-specific IgA in the SC boosted calves. The IN-MLV
and SC-MLV groups were physically separated for two weeks immedi­
ately after the booster vaccination and then commingled for the rest of
the experimental period. It is possible that BRSV vaccine virus may have
been shed by some calves in the IN-MLV group beyond the isolation
period, and then transmitted to the SC-MLV group during the time of
direct contact. A previous study indicated that BRSV was detected via
PCR in nasopharyngeal swab samples in 22 % of calves 28 days
following IN MLV vaccination (Walz et al., 2017). It is thus possible that
virus vaccine transmitted from the IN-MLV group may have been an
additional antigenic stimulus to the SC-MLV group, inducing greater
BRSV- SNA titers and -IgA concentration in nasal secretions.
In summary, booster vaccination of pre-weaning beef calves at
approximately 3 months of age, using either the SC or IN route two
months after IN MLV primary vaccination, resulted in comparable
BHV1, BRSV, and BPI3V SNA titers, cytokine gene expression profile and
virus-specific IgA concentration in nasal secretions. This vaccination did
not induce a significant increase in SNA titers against BHV1, BRSV, and
BPI3V during the experimental period (up to 5 months of age) before
weaning. Subcutaneous booster vaccination in young calves induced
significantly greater BRSV-specific SNA titers (on day 42) and IgA con­
centration in nasal secretions (on days 21 and 42) compared to calves
receiving IN booster vaccination. Both IN and SC booster vaccination
stimulated a significant production of BHV1-specific IgA in nasal se­
cretions by day 14 after booster, which was more consistent for the SC-
MLV group during subsequent days. Further studies are needed to
compare the effect IN or SC MLV booster on protection from infection
and clinical disease after exposure to pathogens involved in BRD.
Declaration of Competing Interest
The authors of this article, declare that there are no conflicts of
interest.
Acknowledgements
The authors thank the University of Georgia, Veterinary Medical
Experiment Station Research Grant Program and the United States
Department of Agriculture 1433 Formula funds for the financial support.
Thanks to Double Bridges Farm (Department of Animal and Dairy
8
Veterinary Immunology and Immunopathology 237 (2021) 110254
Science, College of Agriculture and Environmental Science, University
of Georgia) for providing collaboration on experimental units, facilities,
and animal husbandry during this research.
References
Baldwin, C., 2008. U.S veterinary immune reagent network. In: Baldwin, C. (Ed.), Primer
Pairs Used for Cloning Target Sequences. University of Massachusetts, Amherst.
Bittar, J.H.J., Collins, T.A., Hurley, D.J., Woolums, A.R., Palomares, R.A., 2015.
Comparison of the immune response to subcutaneous or intranasal modified-live
virus booster vaccination in young beef calves that were primed with intranasal
vaccine. In: Conference of Research Workers in Animal Diseases (CRWAD), 148,
p. 163.
Brar, J.S., Johnson, D.W., Muscoplat, C.C., Shope Jr., R.E., Meiske, J.C., 1978. Maternal
immunity to infectious bovine rhinotracheitis and bovine viral diarrhea viruses:
duration and effect on vaccination in young calves. Am. J. Vet. Res. 39, 241–244.
Chamorro, M.F., Palomares, R.A., 2020. Bovine respiratory disease vaccination against
viral pathogens: modified-live versus inactivated antigen vaccines, intranasal versus
parenteral, what is the evidence? Vet. Clin. North Am. Food Anim. Pract. 36,
461–472.
Ellis, J.A., Hassard, L.E., Cortese, V.S., Morley, P.S., 1996. Effects of perinatal vaccination
on humoral and cellular immune responses in cows and young calves. J. Am. Vet.
Med. Assoc. 208, 393–400.
Ellis, J., West, K., Cortese, V., Konoby, C., Weigel, D., 2001. Effect of maternal antibodies
on induction and persistence of vaccine-induced immune responses against bovine
viral diarrhea virus type II in young calves. J. Am. Vet. Med. Assoc. 219, 351–356.
Ellis, J.A., Gow, S.P., Goji, N., 2010. Response to experimentally induced infection with
bovine respiratory syncytial virus following intranasal vaccination of seropositive
and seronegative calves. J. Am. Vet. Med. Assoc. 236, 991–999.
Ellis, J.A., Gow, S.P., Mahan, S., Leyh, R., 2013. Duration of immunity to experimental
infection with bovine respiratory syncytial virus following intranasal vaccination of
young passively immune calves. J. Am. Vet. Med. Assoc. 243, 1602–1608.
Ellis, J.A., Chamorro, M.F., Lacoste, S., Gow, S.P., Haines, D.M., 2018. Bovine respiratory
syncytial virus-specific IgG-1 in nasal secretions of colostrum-fed neonatal calves.
Can. Vet. J. 59, 505–508.
Endsley, J.J., Roth, J.A., Ridpath, J., Neill, J., 2003. Maternal antibody blocks humoral
but not T cell responses to BVDV. Biologicals. 31, 123–125.
Endsley, J.J., Ridpath, J.F., Neill, J.D., Sandbulte, M.R., Roth, J.A., 2004. Induction of T
lymphocytes specific for bovine viral diarrhea virus in calves with maternal
antibody. Viral Immunol. 17, 13–23.
FASS, 2010. Guide for the Care and Use of Agricultural Animals in Agricultural Research
and Teaching. FASS Inc., Champaign, IL.
Figueiredo, M.D., Salter, C.E., Andrietti, A.L.P., Vandenplas, M.L., Hurley, D.J., Moore, J.
N., 2009. Validation of a reliable set of primer pairs for measuring gene expression
by real-time quantitative RT-PCR in equine leukocytes. Vet. Immunol.
Immunopathol. 131, 65–72.
Fulton, R.W., Briggs, R.E., Payton, M.E., Confer, A.W., Saliki, J.T., Ridpath, J.F., Burge, L.
J., Duff, G.C., 2004. Maternally derived humoral immunity to bovine viral diarrhea
virus (BVDV) 1a, BVDV1b, BVDV2, bovine herpesvirus-1, parainfluenza-3 virus, bovine
respiratory syncytial virus, Mannheimia haemolytica and Pasteurella multocida in beef
calves, antibody decline by half-life studies and effect on response to vaccination.
Vaccine 22, 643–649.
Griffin, D., 1997. Economic impact associated with respiratory disease in beef cattle. Vet.
Clin. North Am. Food Anim. Pract. 13, 367–377.
Hill, K.L., Hunsaker, B.D., Townsend, H.G., Littel-van den Hurk, S.V.D., Griebel, P.J.,
2012. Mucosal immune response in newborn Holstein calves that had maternally
derived antibodies and were vaccinated with an intranasal multivalent modified-live
virus vaccine. J. Am. Vet. Med. Assoc. 240, 1231–1240.
Hill, K., Natasa, A., Nordstrom, S., Griebel, P.J., 2019. Immune memory induced by
intranasal vaccination with a modified-live viral vaccine delivered to colostrum fed
neonatal calves. Vaccine 37, 7455–7462.
Kardani, K., Bolhassani, A., Shahbazi, S., 2016. Prime-boost vaccine strategy against viral
infections: mechanisms and benefits. Vaccine 34, 413–423.
Kimman, T.G., Westenbrink, F., Straver, P.J., 1989. Priming for local and systemic
antibody memory responses to bovine respiratory syncytial virus: effect of amount of
virus, virus replication, route of administration and maternal antibodies. Vet.
Immunol. Immunopathol. 22, 145–160.
Livak, K., Schmittgen, T., 2001. Analysis of relative gene expression data using qRT-PCR
and the 2DD CT method. Methods 25, 402–428.
Menanteau-Horta, A.M., Ames, T.R., Johnson, D.W., Meiske, J.C., 1985. Effect of
maternal antibody upon vaccination with infectious bovine rhinotracheitis and
bovine virus diarrhea vaccines. Can. J. Comp. Med. 49, 10–14.
Muñoz-Zanzi, C.A., Thurmond, M.C., Johnson, W.O., Hietala, S.K., 2002. Predicted ages
of dairy calves when colostrum-derived bovine viral diarrhea virus antibodies would
no longer offer protection against disease or interfere with vaccination. J. Am. Vet.
Med. Assoc. 221, 678–685.
Palomares, R.A., Hurley, D.J., Bittar, J.H.J., Saliki, J.T., Woolums, A.R., Moliere, F.,
Havenga, L.J., Norton, N.A., Clifton, S.J., Sigmund, A.B., Barber, C.E., Berger, M.L.,
Clark, M.J., Fratto, M.A., 2016. Effects of injectable trace minerals on humoral and
cell-mediated immune responses to Bovine viral diarrhea virus, Bovine herpes virus 1
and Bovine respiratory syncytial virus following administration of a modified-live virus
vaccine in dairy calves. Vet. Immunol. Immunopathol. 178, 88–98.
R.A. Palomares et al.
Patel, J.R., Didlick, S.A., 2004. Evaluation of efficacy of an inactivated vaccine against
bovine respiratory syncytial virus in calves with maternal antibodies. Am. J. Vet.
Res. 65, 417–421.
Platt, R., Widel, P.W., Kesl, L.D., Roth, J.A., 2009. Comparison of humoral and cellular
immune responses to a pentavalent modified live virus vaccine in three age groups of
calves with maternal antibodies, before and after BVDV type 2 challenge. Vaccine
27, 4508–4519.
Reber, A.J., Tanner, M., Okinaga, T., Woolums, A.R., Williams, S., Ensley, D.T.,
Hurley, D.J., 2006. Evaluation of multiple immune parameters after vaccination
with modified live or killed bovine viral diarrhea virus vaccines. Comp. Immunol.
Microbiol. Infect. Dis. 29, 61–77.
Seo, K.S., Lee, S.U., Park, Y.H., Davis, W.C., Fox, L.K., Bohach, G.A., 2007. Long-term
staphylococcal enterotoxin C1 exposure induces soluble factor-mediated
immunosuppression by bovine CD4+ and CD8+ T cells. Infect. Immun. 75, 260–269.
Smirnova, N.P., Bielefeldt-Ohmann, H., Van Campen, H., Austin, K.J., Han, H.,
Montgomery, D.L., Shoemaker, M.L., van Olphen, A.L., Hansen, T.R., 2008. Acute
non-cytopathic bovine viral diarrhea virus infection induces pronounced type I
interferon response in pregnant cows and fetuses. Virus Res. 132, 49–58.
Stoltenow, C., Cortese, V.S., Seeger, J.T., Stokka, G.S., Weigel, D., 2011. Immunologic
responses of beef calves to concurrent application of modified-live viral vaccine
(intranasal and systemic administration) and systemically administered Mannheimia
haemolytica bacterin-leukotoxoid. Bov. Pract. 45, 132–138.
Sun, W.C., Moore, J.N., Hurley, D.J., Vandenplas, M.L., Fortes, B., Thompson, R.,
Linden, J., 2010. Differential modulation of lipopolysaccharide-induced expression
of inflammatory genes in equine monocytes through activation of adenosine A2A
receptors. Vet. Immunol. Immunopathol. 134, 169–177.
United States Department of Agriculture (USDA), 2010. APHIS-Veterinary Services
Centers for Epidemiology and Animal Health (Accessed September 16 2020). https
View publication stats
Veterinary Immunology and Immunopathology 237 (2021) 110254
://www.aphis.usda.gov/animal_health/nahms/beefcowcalf/downloads/beef070
8/Beef0708_is_CalfVacc_1.pdf.
Vangeel, I., Antonis, A.F.G., Fluess, M., Riegler, L., Peters, A.R., Harmeyer, S.S., 2007.
Efficacy of a modified live intranasal bovine respiratory syncytial virus vaccine in 3-
week-old calves experimentally challenged with BRSV. Vet. J. 174, 627–635.
Vangeel, I., Ioannou, F., Riegler, L., Salt, J.S., Harmeyer, S.S., 2009. Efficacy of an
intranasal modified live bovine respiratory syncytial virus and temperature-sensitive
parainfluenza type 3 virus vaccine in 3-week-old calves experimentally challenged
with PI3V. Vet.J. 179, 101–108.
Walz, P.H., Newcomer, B.W., Riddell, K.P., Scruggs, D.W., Cortese, V.S., 2017. Virus
detection by PCR following vaccination of naive calves with intranasal or injectable
multivalent modified-live viral vaccines. J. Vet.y Diagn. Invest. 1–8.
Werling, D., Collins, R.A., Taylor, G., Howard, C.J., 2002. Cytokine responses of bovine
dendritic cells and T cells following exposure to live or inactivated bovine
respiratory syncytial virus. J. Leukoc. Biol. 72, 297–304.
Woolums, A.R., Berghaus, R.D., Berghaus, L.J., Ellis, R.W., Pence, M.E., Saliki, J.T.,
Hurley, K.A.E., Galland, K.L., Burdett, W.W., Nordstrom, S.T., Hurley, D.J., 2013.
Effect of calf age and administration route of initial multivalent modified-live virus
vaccine on humoral and cell-mediated immune responses following subsequent
administration of a booster vaccination at weaning in beef calves. Am. J. Vet. Res.
74, 343–354.
Xue, W., Ellis, J., Mattick, D., Smith, L., Brady, R., Trigo, E., 2010. Immunogenicity of a
modified-live virus vaccine against bovine viral diarrhea virus types 1 and 2,
infectious bovine rhinotracheitis virus, bovine parainfluenza-3 virus, and bovine
respiratory syncytial virus when administered intranasally in young calves. Vaccine
28, 3784–3792.
Yamane, D., Kato, K., Tohya, Y., Akashi, H., 2008. The relationship between the viral
RNA level and upregulation of innate immunity in spleen of cattle persistently
infected with bovine viral diarrhea virus. Vet. Microbiol. 129, 69–79.