YOUR ARTICLE

Please review the proof* of your article carefully, checking for any final typographical errors or
minor necessary updates. Please address and answer in full any queries which the copyeditor
may have raised on the Author Query sheet accompanying your proofs.

Please make clear any necessary corrections, within 3 working days, using one of the following
methods:
ƒ Use Adobe's Comments and/or Editing Tools to indicate changes directly onto
the PDF and return via email. Please request guidelines if required.
ƒ Email the necessary corrections as a list citing the page and line number
where a correction needs to be made, how the text currently appears, and
what it should be changed to.
ƒ Use the British Standard Institution’s proof marks to indicate changes on a
paper printout of the PDF and email, fax or post the pages (contact details
below).

Production Editor, HEM, Maney Publishing, 1 Carlton House Terrace, London, SW1Y 5AF,
United Kingdom. Fax: +44 (0) 2074517307 hem@maneypublishing.com

VIEWING YOUR ARTICLE’S PRODUCTION STATUS AND PLACING ORDERS USING

MANEYTRACK
http://maneytrack.maney.co.uk

Approximately three weeks ago, you will have received an email detailing your log-in details for
Maney Publishing’s web-based production tracking system, ManeyTrack. Via ManeyTrack you
can:

- View the production status of your article at any time.

- Place orders for printed colour, offprints, issue copies, or to make your article open
access.

Please log in using the web address, above. If you have misplaced your log-in details please
check your spam/junk folder. If you are still unable to find them please click on the above url and
click on ‘Forgot Password’ and follow instructions. If you require further technical assistance,
please contact the Administrator: ManeyTrackAdmin@maneypublishing.com

ADDITIONAL INFORMATION

This journal is hosted online at www.maneyonline.com/hem

ADVANCE ARTICLES: Your article has been published online as an Advance Article, ahead of
publication in an issue. It is now fully citable using its unique Digital Object Identifier (DOI). Any
corrections which you make to your proof will be applied when the article is published in an issue.
Corrections will be made prior to this only if the managing editor deems the error to be so serious
as to affect the scientific validity.

OPEN ACCESS (MORE OpenChoice): Should you wish to make your article freely available
online (open access) please log in to ManeyTrack to view prices and to place your order – see
details for ManeyTrack above. For more information regarding Maney’s open access product,
MORE OpenChoice, please see: www.maneyonline.com/openaccess

OFFPRINTS: You will receive a complimentary PDF eprint of your final article. If you wish to
purchase traditional hardcopy offprints please log in to ManeyTrack to view prices and to place
your order – see details for ManeyTrack above.

ISSUE COPIES: You will have the opportunity to purchase a copy or copies of the issue your
article will be published in at the time you receive the final PDF (eprint) of your article. Details
stating how to order will be included in the eprint email.

PRINTED COLOUR: All figures supplied as such will be reproduced online in colour free of
charge. If you would like colour figures reproduced in the printed version please log in to
ManeyTrack to view prices and to place your order – see details for ManeyTrack above.

GET FOUND, GET READ, GET CITED

As part of our commitment to making the content we publish as visible as possible, Maney
offers its authors use of the Kudos service which is designed to help you increase article
readership and citations by enabling you to explain, enrich and share your articles.
Corresponding authors will receive a registration email regarding the service once the article
is published. To find out more visit www.growkudos.com.

FEEDBACK

Tell us about your publishing experience at: https://www.surveymonkey.com/s/stm_authorsurvey

*Please note this PDF file may not be offered for commercial sale or for any systematic
external distribution by a third party.

Kind regards,
Production Editor
The association of cytokine genes
polymorphisms and susceptibility to aplastic
anemia in Egyptian patients
Rania A. Zayed1, Samah M. Abdel-Hamid 1, Hend El-Lithy 2
1
Clinical and Chemical Pathology Department, Kasralainy Faculty of Medicine, Cairo University, Egypt, 2Internal
Medicine Department, Kasralainy Faculty of Medicine, Cairo University, Egypt

Background and objective: Aplastic anemia (AA) remains a rare disease, with very interesting
pathophysiology that is being investigated for years now. The present study aimed to determine the
association between cytokine gene polymorphisms (TGF-β1 −509 C/T, TNF-α −308 G/A, IFN-γ +874 A/
T) and susceptibility to AA in Egyptian patients.
Methods: The study included 80 participants subjected to determination of gene polymorphisms on genomic
DNA using polymerase chain reaction-restriction fragment length polymorphism assay.
Results: It was found that IFN-γ +874 A/T gene polymorphism is associated with three-fold increased risk of
development of AA (odds ratio (OR) 3.116, P = 0.019), while TNF-α −308 G/A gene polymorphism is
associated with decreased risk (OR 0.318, P = 0.026). TGF-β1 −509 C/T gene polymorphism showed
comparable risk between patients and controls (P = 0.263).
Conclusion: IFN-γ +874 A/T gene polymorphism is associated with the etiology of AA in Egyptian patients.
Keywords: Aplastic anemia, Cytokine gene polymorphism, TGF-β1 −509 C/T, TNF-α −308 G/A, IFN-γ +874 A/T

Introduction Hematopoietic stem cells (HSCs) rely on cytokines

Aplastic anemia (AA) or bone marrow (BM) failure is
a rare disease in which patients have essentially empty
BM accompanied by severe anemia, neutropenia, and
thrombocytopenia.1 AA has an annual incidence of
2–6 per million in the USA and Europe. The incidence
of the disease is higher in India and Japan, resulting
from differences in population immunogenetics and
environmental factors.2 No accurate prospective data
are available regarding the incidence of AA in
Egypt. Some acquired AA cases are secondary to the
exposure to toxic chemicals, drugs, radiation, or infec-
tious agents.3 However, the majority of cases remain
idiopathic. The immune system has been recognized
to mediate organ-specific destruction of BM cells.4
The first evidence for immune system involvement
came from the work of Mathe et al.5 which was sup-
ported by the fact that about 50–80% of patients
respond to immunosuppressive therapy to ameliorate
pancytopenia and restore hematopoiesis.
Genetic factors also contribute to the pathogenesis
of AA and it is believed that a predisposing genetics
factor with certain environmental factors lead to
lymphocyte activation and immune reaction.
Correspondence to: Samah M. Abdel-Hamid, Clinical and Chemical
Pathology Department, Kasralainy Faculty of Medicine, Cairo University,
Cairo, Egypt. Email: samah_cpath@yahoo.com
for survival, proliferation, and differentiation. A
variety of cytokines are involved in the pathogenesis
of acquired AA. Interferon-gamma (IFN-gamma)
and tumor necrosis factor-alpha (TNF-alpha) have
been identified as essential mediators of hematopoietic
suppression and immunosuppressive therapy may
induce hematological remission by suppressing IFN-
gamma and TNF-alpha. Also, transforming growth
factor (TGF) may play an important role during the
development of acquired AA.6
Polymorphisms located within regulatory regions of
cytokine genes have been identified to affect gene tran-
scription, causing inter-individual variations of cyto-
kine production in vivo.7,8
We studied the association between cytokine gene
polymorphisms (TGF-β1 −509 C/T, TNF-α −308
G/A, and IFN-γ +874 A/T) and susceptibility to
AA in Egyptian patients.
Subjects and methods
This study included 80 participants, 40 patients were
diagnosed as acquired AA at Cairo University
Hospitals. All patients were under immune-suppres-
sive therapy. They received, initially, immunosuppres-
sive regimen in the form of: cyclosporine 6 mg/kg/d
PO and glucocorticoids 0.25 g/kg/d PO. Out of the

© W. S. Maney & Son Ltd 2015

DOI 10.1179/1607845415Y.0000000038 Hematology 2015 VOL. 0 NO. 0 1
Zayed et al. Susceptibility to aplastic anemia in Egyptian patients
Table 1 Summary of PCR-PFLP assay
Polymorphism Primer sequence (5′ –3′ )
IFN-γ +874 A/T F:gattttattcttacaacacaaaatcaagac
R: gcaaagccaccccactataa
TNF-α –308 G/A F: aggcaataggttttgagggccat
R: tcctccctgctccgattccg
TGF-β1 –509 C/T F: ggatggcacagtggtcaag
R: gtcaccagagaaagaggac
40 patients, 7 patients (17.5%) show complete response
to immunosuppressive regimen with total correction
of blood counts, 20 patients (50%) show partial
response in the form of decrease the frequency of
packed red cells and platelets transfusion with
improvement of blood counts. However, 13 patients
(32.5%) did not show any response to immunosuppres-
sive regimen. Patients who fail to show any response
and those with partial response were transferred to
BM transplantation center. They were 20 males and
20 females with age range from 2 to 50 years. Forty
age- and sex-matched normal healthy persons not suf-
fering from any clinical diseases were included in the
study as a control group. The study was performed
in accordance with the Helsinki Declaration, and the
protocols were approved by the ethics committee of
Cairo University. All participants and/or their guar-
dians provided informed consent before enrollment
into the study.
The diagnosis of AA was based on BM biopsy and
peripheral blood cell counts according to the criteria
of the International Aplastic Anemia
Agranulocytosis Study Group.9 Severe AA was
defined as a BM cellularity of less than 30% and
severe pancytopenia with at least two of the following
peripheral blood count criteria: (1) absolute neutrophil
count <0.5 × 109/l; (2) absolute reticulocyte count
<20 × 109/l; and (3) platelet count <20 × 109/l.
Paroxysmal nocturnal hemoglobinuria (PNH) clone
was assessed in all patients by immunophenotypical
analysis of CD55 and CD59 to evaluate concurrent
or ongoing PNH.
DNA extraction and analysis
Genomic DNA was extracted from peripheral blood
samples by AXY Prep Blood Genomic DNA
Miniprep Kit (Axygen, Biosciences, CA, USA).
Isolated DNA was stored at −20 °C until used for
polymerase chain reaction (PCR) amplification.
PCR amplification
PCR amplification was performed in a final volume of
25 μl (5 μl DNA, 12.5 μl Taq PCR Green Master Mix,
2 Hematology 2015 VOL. 0 NO. 0
Restriction
Length (bp) enzyme Fragments size (bp) Reference
331 HinfI AA: 176 Zambon et al.10
AT: 176, 148, 28
TT: 148, 28
107 NcoI GG: 87, 20 Schaaf et al.11
GA: 107, 87, 20
AA: 107
441 Eco81I CC: 252, 189 Caserta et al.12
CT: 441, 252, 189
TT: 441
1 μl primer; each sense and antisense, and 5.5 μl dis-
tilled water).
The PCR reaction was carried out in the DNA
thermal cycler (PTC programmable thermal control-
ler, MJ Research, Watertown, MA, USA). The com-
puterized thermal cycler was programed for the
following conditions:
IFN-γ +874 A/T gene polymorphism: initial dena-
turation at 95 °C for 5 minutes, then 45 cycles at
95 °C for 30 seconds, 53 °C for 1 minute, 72 °C for
1.5 minutes, and finally 72 °C for 7 minutes. TNF-α
–308 G/A gene polymorphism: 38 cycles of 1 minute
at 94 °C, 1 minute at 60 °C, and 1.5 minutes at
72 °C. TGF-β1 −509 C/T gene polymorphism: 35
cycles at 95 °C for 45 seconds, 58 °C for 30 seconds,
and 72 °C for 30 seconds.
Primer sequence used for each polymorphism analy-
sis are shown in Table 1.
Digestion of the amplified product by specific
restriction enzyme for each polymorphism
Ten microliters of the amplified product were mixed
with 1 μl restriction enzyme (Fermentas, St. Leon-
Rot, Germany) and the mixture was incubated at
37 °C for 1 hour. The product was analyzed by gel
electrophoresis using 3% agarose gel (Promega,
Madison, WI, USA). The separated fragments were
stained with ethidium bromide and visualized along
with 50 bp ladder (MBI Fermentas, Vilnius,
Lithuania, Germany) as a size marker using transillu-
minator (Bio-Rad, Hercules, CA, USA). Restriction
enzyme used and the resulting bp length are shown
in Table 1.
Statistical analysis
Data were statistically described in terms of range,
mean, standard deviation (SD), frequencies, percen-
tages, and odds ratio (OR) with 95% confidence inter-
val (CI) when appropriate. Comparison of
quantitative variables between the study groups was
done using Student’s t-test for independent samples
in comparing two groups normally distributed and
Mann–Whitney U test for independent samples when
not normally distributed. For comparing categorical
 Zayed et al. Susceptibility to aplastic anemia in Egyptian patients 1

data, the Chi square (χ2) test was performed, but 17/40 expressed heterozygous AT allele and 14/40
Fisher’s exact test was used instead when the expected expressed homozygous TT allele, while in the control
frequency is less than 5. A probability value (P-value) group, 19/40 expressed the wild allele, 12/40
less than 0.05 was considered statistically significant. expressed heterozygous AT allele, and 9/40 expressed
All statistical calculations were done using computer homozygous TT allele.
programs Microsoft Excel 2003 (Microsoft Regarding TNF-α −308 G/A gene expression; 16
Corporation, New York, NY, USA) and SPSS out of 40 patients expressed the wild allele (homozy-
(Statistical Package for the Social Science; SPSS, gous GG), 2 out of 40 patients expressed heterozygous
Inc., Chicago, IL, USA) version 15 for Microsoft GA allele, and 22 out of 40 patients expressed homo-
Windows. zygous AA allele. Meanwhile, in the control group; 7
out of 40 subjects expressed the wild allele, 6 out of
Results 40 subjects expressed heterozygous GA allele, and 27
The baseline characteristics of the patients and the out of 40 subjects expressed homozygous AA allele.
control groups are shown in Table 2. Mutant allele (GA, AA) expression in the patients
Study of the association between TGF-β1 −509 C/ was significantly lower than in the controls (P =
T, TNF-α −308 G/A, and IFN-γ +874 A/T gene 0.026).
polymorphisms and the risk of AA showed that Concerning TGF-β1 −509 C/T gene polymorph-
IFN-γ +874 A/T gene polymorphism is associated ism, 22 out of 40 patients expressed wild allele (homo-
with three-fold increased risk of development of AA zygous CC), 11 out of 40 patients expressed
(OR 3.116, P = 0.019), while TNF-α −308 G/A heterozygous CT allele, and 7 out of 40 patients
gene polymorphism is associated with decreased risk expressed homozygous TT allele. While in the
(OR 0.318, P = 0.026). TGF-β1 −509 C/T gene poly- control group, 17 out of 40 subjects expressed wild
morphism showed comparable expression in both allele (homozygous CC), 18 out of 40 subjects
patients and controls (P = 0.263). expressed heterozygous CT allele, and 5 out of 40 sub-
Study of IFN-γ +874 A/T gene polymorphism jects expressed homozygous TT allele, with no statisti-
showed higher expression of the mutant T-allele in cally significant difference between patients and
the patients compared to the control group (P = controls (P = 0.263).
0.019), 9/40 patients expressed the wild allele (homo-
zygous AA) and 31/40 expressed the A/T mutation; Discussion
Regulatory cytokines play a role in conditioning the
Table 2 Baseline characteristics of patients and controls
BM microenvironment and in stem cell growth.
Previous studies mentioned the role of T lymphocytes
Patients Controls P-value in the pathogenesis of AA,13 oligoclonally expanded
Age (years) self-reactive T cells can induce immune-mediated
Range 2–50 2–50 NS apoptosis of blood-forming stem progenitor cells
Median 11 12
Gender (number/%)
through either interaction via the Fas/Fas-ligand
Male 20 (50%) 21 (52.5%) NS (FasL) pathway or the production of proinflammatory
Female 20 (50%) 19 (47.5%) and growth inhibitory cytokines such as TNF-alpha
Severity (number/%)
Non-severe AA 17 (42.5%) and IFN-gamma, thus leading to depletion of the
Severe AA 23 (57.5%) HSC pool in the BM.14
Total leucocytic count (×109/l) IFN-gamma can significantly up-regulate IL-15
Range 0.6–7.8 4–15.7 <0.001
Mean ± SD 2.5 ± 1.4 8.1 ± 2.6 expression on the surface of BM fibroblast-like
Hemogblobin (g/dl) stromal cells in AA patients, IL-15 stimulates the pro-
Range 3.8–9.7 9.2–16.4 <0.001
liferation of T lymphocytes and participates in the
Mean ± SD 6.3 ± 1.3 13 ± 1.7
Platelet count (×109/l) T-cell-mediated destruction of hematopoietic progeni-
Range 3–68 150–412 <0.001 tors.15 TNF-alpha acts in synergy with IFN-gamma
Mean ± SD 19.8 ± 16 240 ± 72
Reticulocytic count (%)
on the suppression of hematopoiesis in patients with
Range 0.1–0.9 acquired AA.16 TNF-alpha and IFN-gamma suppress
Mean ± SD 0.5 ± 0.2 hematopoiesis through Fas/FasL, TRAIL, and
PNH markers (%)
CD55 p38MAPKsignaling pathway inducing apoptosis in
Range 94–99 early and late hematopoietic progenitors.17
Mean ± SD 93 ± 5.2 TGF-beta1 has been known to induce cell cycle
CD59
Range 92–98 retardation or arrest.18 Ball et al.19 described acceler-
Mean ± SD 95 ± 3.8 ated telomere loss in AA, probably at the stem cell
NS: non-significant. stage, indicating that active cell cycling is relevant to
P-value <0.05 is considered significant. the pathogenesis of AA, and so, suppression of

Hematology 2015 VOL. 0 NO. 0 3

Zayed et al. Susceptibility to aplastic anemia in Egyptian patients
Table 3 Cytokine gene polymorphisms and risk of development of AA
Gene polymorphism Patients
IFN-γ +874 A/T
Wild (AA) 9 (22.5%)
Mutant (AT/TT) 17/14 (42.5/35%)
TNF-α −308 G/A
Wild (GG) 16 (40%)
Mutant (GA/AA) 2/22 (5/55%)
TGF-β1 −509 C/T
Wild (CC) 22 (55%)
Mutant (CT/TT) 11/7 (27.5/17.5%)
CI: confidence interval.
P-value <0.05 is considered significant.
TGF-beta1 is needed to permit stem cell cycling. Also,
the abrogation of Fas-induced apoptosis of progenitor
cells by TGF-beta1 has been described.20 Therefore,
the reduction of TGF-beta1 contribute to the patho-
physiology of AA by allowing accelerated stem cell
cycling and increased apoptosis, therefore exacer-
bating the primary stem cell defect.21
BM cells of the AA patients failed to produce
detectable amounts of TGF-beta1.22 Thus, dysregula-
tion of TGF-beta1 in combination with TNF-alpha
and IFN-gamma may contribute significantly to the
pathophysiology of AA.
We hypothesized that the genotypes associated with
disturbed production of inflammatory (IFN-gamma,
TNF-alpha) or inhibitory (TGF-beta1) cytokines,
may be overrepresented in our studied group of AA
patients.
In our study, comparison between homozygous wild
(AA) and T allele (TA and TT) genotypes of IFN-γ
+874 A/T polymorphism in AA patients and
control subjects revealed statistically significant differ-
ence between the two groups with more frequent T
allele among AA patients than controls (P = 0.009).
Come in parallel with our findings Chang et al. 23
who reported that the frequencies of IFN-γ/+874
TT genotype in patients with AA were significantly
higher than the corresponding frequencies in the
healthy adults (42.6 versus 17.6%, χ2 = 13.780, P =
0.01). Also they stated that IFN-γ/+874 A/T gene
polymorphism is correlated with the susceptibility of
AA, but not significantly correlated with the severity
of AA. Additionally, El Mahgoub et al.24 who ana-
lyzed a different group of Egyptian AA patients
found statistically significant difference between the
patients and normal controls as regards IFN-γ +874
A/T hypersecretory (TT) genotype that was more fre-
quent in AA patients than the controls. This also
comes in match with Sloand et al.25 and Dufour
et al.26 who agreed increased IFN-γ/+874 T allele
expression during the pathogenesis of AA.
Our work reported that IFN-γ +874 A/T gene
polymorphism is associated with 3.116-fold increased
risk of development of AA which reinforces the
4 Hematology 2015 VOL. 0 NO. 0
3
Controls OR CI P-value
19 (47.5%)
12/9 (30/22.5%) 3.116 1.184–8.200 0.019
7 (17.5%)
6/27 (15/67.5%) 0.318 0.113–0.893 0.026
17 (42.5%)
18/5 (45/12.5%) 0.605 0.250–1.463 0.263
results of El Mahgoub et al.24 who found 3.467-fold
increased risk for AA in individuals with hypersecre-
tory IFN-γ +874A/T genotype comparing to those
possessing the hyposecretory genotype.
IFN-γ +874 A/T gene polymorphism was found to
be associated with the level of IFN-gamma pro-
duction.26 Most of the AA patients showed excessive
production of IFN-gamma and IFN-gamma gene
expression is specifically prevalent in the BM of
patients with acquired AA, and disappears with
response to immunosuppression, also circulating
IFN-gamma containing T cells responded to immuno-
suppressive therapy and declined after immunosup-
pressive treatment.27,28
Regarding TNF-alpha gene −308 polymorphism,
our study revealed that comparison between homozy-
gous wild (GG) and A allele (GA and AA) genotypes
of in AA patients and control subjects revealed statisti-
cally significant difference between the patients and
controls with more frequent wild GG genotype
among AA patients than controls (P = 0.05).
Furthermore, our study revealed that TNF-α −308
G/A polymorphism was not associated with increased
risk of development of AA (OR 0.318, 95% CI
0.113–0.893, P = 0.026). Discordance with our find-
ings, El Mahgoub et al.24 revealed statistically signifi-
cant difference between the patients and normal
controls as regards TNF-α/ −308 G/A, gene poly-
morphisms, with hypersecretory genotype (A alleles)
were higher in AA patients than controls. This differ-
ent outcome of the studies might be attributed to the
variations due to a non-homogenous population with
AA of varying degree. The results of several previous
studies regarding the association of TNF-α −308 G/
A polymorphism and the susceptibility to AA are
not consistent. Several studies reported that TNF-α
−308 G/A was significantly related to AA suscepti-
bility,29,30 on the other hand, some groups reported
that TNF-α −308 G/A did not show any association
with AA susceptibility with no difference in allele fre-
quency between AA patients and controls.31 This
inconsistency in results may be related to different
response to cytokines levels in different ethnic
 Zayed et al. Susceptibility to aplastic anemia in Egyptian patients 1

Figure 1 RFLP analysis of TGF-βl 509 C/T polymorphism PCR products; Lane-1: DNA molecular weight marker (Fermentas AM
Egypt), (100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 bps). Lanes 2, 3, 5, 6, 7, 9 : show wild variant CC (252 and 189bps). Lanes 4,
8, 11, 12: show heterozygous CT genotype (441, 252 and 189 bps). Lane- 10: shows homozygous variant TT (441 bps). 2

Figure 2 RFLP analysis of TNF-α 308 G/Λ polymorphism PCR products; Lane-1: DNA molecular weight marker (Fermentas AM
Egypt), (100. 200, 300, 400, 500, 600, 700, 800, 900, 1000 bps). Lanes 2, 4,5, 6.7,8.9,10,11: show wild variant GG (87.20 bps). Lanes 3,
12: show heterozygous GA genotype (107,87,20bps).

populations. Also, Peng et al.32 stated that no suscep-
tibility was demonstrated in milder forms of AA which
may explain our data as about half of our patients had
a non-severe form of AA. It was shown that TNF-α
−308 G/A polymorphism was associated with elev-
ated TNF-alpha level. Several studies demonstrated
that BM lymphocytes produced significantly higher
amounts of TNF-alpha in patients with AA.33,34
Concerning TGF-β1 −509 C/T gene polymorphism
comparison between wild homozygous (CC) and T
allele (T/C and T/T) genotypes in AA patients and
control subjects revealed no statistically significant
difference between the two groups (P = 0.263).
Additionally, no association was found between
TGF-β1 −509 C/T gene polymorphism and risk of
development of AA. In agreement to our study, Lee
et al.28 stated that TGF-β1 −509 C/T polymorphism
is not related to AA susceptibility, although, they are
associated with response to IST. Contrary to our find-
ings El Mahgoub et al.24 found that T alleles of TGF-
β1 −509C/T gene polymorphism were more frequent
in patients than in control, no association was found

Figure 3 RFLP analysis of IFN-γ 874 A/T gene polymorphism PCR products; Lane-1: DNA molecular weight marker (Fermentas
AM Egpt). (100, 200, 300,. 400, 500. 600, 700, 800, 900, 1000 bps). Lane- 8: show homozygous variant TT (148 and 28bps). Lanes
3,4,6,10,11: show heterozygous ΤA genotype (176, 148 and 20 bps). Lanes 2,5,7,9: shows wild variantAA ( 176 bps)

Hematology 2015 VOL. 0 NO. 0 5

Zayed et al. Susceptibility to aplastic anemia in Egyptian patients
between the presence of hypersecretory genotypes and
the disease severity.
It has been proposed that decreased levels of circu-
lating TGF-beta1 may predispose certain individuals
to become more susceptible to immune-mediated dis-
eases. A number of polymorphic sites in the TGF-
beta1 gene have been identified,35,36 but only the
509C/T polymorphism in the TGF-beta1 promoter
has been shown to be significantly associated with
high plasma concentrations of TGF-beta1.37
The lymphocytes of AA patients were found to
produce markedly reduced amounts of TGF-beta1,
where upon stimulation by PHA, increased production
of TGF-beta1 by lymphocytes was observed.
Successful response to treatment correlated with
increased levels of TGF-beta1.38
Several studies stated that genotypes associated with
high TGF-beta1 production were more frequent in AA
patients than in controls.35,36 This is in contrast to the
fact that lower levels of TGF-beta1 have been
described in the serum and in vitro cultures of AA
patients. However, the expression levels in the periph-
ery do not always reflect the levels of locally expressed
cytokines in the BM.22
In conclusion, our study concurred with prior
studies indicates that polymorphisms in IFN-γ +874
A/T are related to AA susceptibility but TGF-β1
−509 C/T and TNF-α −308 G/A gene polymorph-
isms are not related to AA susceptibility. Future
studies in larger patients groups are needed to
confirm these preliminary results and to further evalu-
ate the relative significance of these cytokines geno-
types in the development of AA and also to study
the association of these polymorphisms to disease
severity and the responsiveness to the IST.
Disclaimer statements
Contributors R.Z.: conceiving and designing the study,
analysing the data, interpreting the data, revising the
article. S.A.E.: interpreting the data, writing the
article, revising the article. H.E.: collecting the data.
Funding None.
Conflicts of interest The author declare no conflict of
interest.
Ethics approval Informed consent was obtained from
all patients.
References
1 Young NS. Aplastic anemia, myelodysplasia, and related bone
marrow failure syndromes. In: Kasper DL, Braunwald E,
Fauci AS, Hauser SL, Longo DL, Jameson JL, (eds.)
Harrison’s principles of internal medicine. New York, NY:
McGraw-Hill; 2005. pp. 617–26.
2 Kojima S. Aplastic anemia in the orient. Int J Hematol. 2002;
76(2):173–74.
3 Guinan EC. Diagnosis and management of aplastic anemia.
Hematology 2011;1:76–81.
6 Hematology 2015 VOL. 0 NO. 0
4 Risitano AM, Maciejewski JP, Green S, et al. In-vivo dominant
immune responses in aplastic anaemia: molecular tracking of
putatively pathogenetic T-cell clones by TCR beta-CDR3
sequencing. Lancet 2004;364:355–64. 4
5 Mathe G, Amiel JL, Schwarzenberg L, et al. Bone marrow graft
in man after conditioning by antilymphocytic serum. Br Med J.
1970;2:131–6.
6 Li JP, Zheng CL, Han ZC. Abnormal immunity and stem/pro-
genitor cells in acquired aplastic anemia. Crit Rev Oncol
Hematol. 2010;75(2):79–93.
7 Feng X, Scheinberg PH, Wu CO, Samsel L, Nunez O, Prince C.
Cytokine signature profiles in acquired aplastic anemia and mye-
lodysplastic syndromes. Haematologica 2011;96(4):602–6.
8 Serio B, Selleri C, Maciejewski JP. Impact of immunogenetic
polymorphisms in bone marrow failure syndromes. Mini Rev
Med Chem. 2011;11(6):544–52.
9 International agranulocytosis and aplastic anemia study group.
Incidence of aplastic anemia: the relevance of diagnostic criteria.
Blood 1987;70:1718–21.
10 Schaaf BM, Seitzer U, Pravica V, et al. Tumor necrosis factor-
α − 308 promoter gene polymorphism and increased tumor
necrosis factor serum bioactivity in Farmer’s Lung patients.
Am J Respir Crit Care Med. 2001;163(2):379–82.
11 Caserta TM, Knisley AA, Tan FK, et al. Genotypic analysis of
the TGF beta- 509 allele in patients with systemic lupus erythe-
matosus and Sjogren’s syndrome. Ann Genet. 2004;47(4):
359–63.
12 Risitano AM, Kook H, Zeng W, et al. Oligoclonal and polyclo-
nal CD 4 and CD 8 lymphocytes in aplastic anemia and parox-
ysmal nocturnal hemoglobinuria measured by V beta CDR 3
spectratyping and flow cytometry. Blood 2002;100(1):178–83.
13 Zeng W, Kajigaya S, Chen G, et al. Transcript profile of CD4+
and CD8+ T cells from the bone marrow of acquired aplastic
anemia patients. Exp Hematol. 2004;32:806–14.
14 Kakagianni T, Giannakoulas NC, Thanopoulou E, et al. A
probable role for trail-induced apoptosis in the pathogenesis of
marrow failure. Implications from an in vitro model and from
marrow of aplastic anemia patients. Leuk Res. 2006;30:713–21.
15 Wenxin L, Jinxiang F, Yong W, et al. Expression of membrane-
bound IL-15 by bone marrowfibroblast-like stromal cells in
aplastic anemia. Int Immunol. 2005;17:429–37.
16 Dubey S, Shukla P, Nityanand S. Expression of interferon-
gamma and tumor necrosis factor-alpha in bone marrow T
cells and their levels in bone marrow plasma in patients with
aplastic anemia. Ann Hematol. 2005;84:572–7.
17 Verma A, Deb DK, Sassano A, et al. Cutting edge: activation of
the p38 mitogen-activated protein kinase signaling pathway med-
iates cytokine-induced hemopoietic suppression in aplastic
anemia. J Immunol. 2002;168:5984–8.
18 Lardon F, Snoeck HW, Nijs G, et al. Transforming growth
factor-beta regulates the cell cycle status of interleukin-3 (IL-3)
plus IL-1, stem cell factor, or IL-6 stimulated CD34. human
hematopoietic progenitor cells through different cell kinetic
mechanisms depending on the applied stimulus. Exp Hematol.
1994;22:903–9.
19 Ball SE, Gibson FM, Rizzo S, et al. Progressive telomere short-
ening in aplastic anemia. Blood 1998;91:3582–92.
20 Dybedal I, Guan F, Borge OJ, et al. Transforming growth factor-
beta1abrogates Fas-induced growth suppression and apoptosis
of murine bone marrow progenitor cells. Blood 1997;90:
3395–403.
21 Rizzo S, Killick SB, Patel S, et al. Reduced TGF-b1 in patients
with aplastic anaemia in vivo and in vitro. Br J Haematol.
1999;107:797–803.
22 Taketazu F, Miyagawa K, Ichijo H, et al. Decreased level of
transforming growth factor-beta in blood lymphocytes of
patients with aplastic anemia. Growth Factors 1992;6:85–90.
23 Chang H, Zhang JY, Meng WT. Single nucleotide polymorph-
ism of interferon-gamma gene +874 T/A in patients with aplas-
tic anemia. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2008;16(2):
325–7.
24 El Mahgoub IR, Afify RA, Botros SK, et al. Immunoregulatory
cytokines gene polymorphisms in Egyptian patients affected with
acquired aplastic anemia. Ann Hematol. 2014;93(6):923–9.
25 Sloand E, Kim S, Maciejewski JP, et al. Intracellular interferon-
gamma in circulating and marrow T cells detected by flow cyto-
metry and the response to immunosuppressive therapy in
patients with aplastic anemia. Blood 2002;100:1185–91.
26 Dufour C, Corcione A, Svahn J, et al. Interferon gamma and
tumour necrosis factor alpha are overexpressed in bone

marrow T lymphocytes from paediatric patients with aplastic
anaemia. Br J Haematol. 2001;115:1023–31.
27 Pravica V, Perrey C, Stevens A, et al. A single nucleotide poly-
morphism in the first intron of the human IFN-gamma gene:
absolute correlation with a polymorphic CA microsatellite
marker of high IFN-gamma production. Hum Immunol. 2000;
61:863–6.
28 Chang H, Zeng F, Zhang JY, et al. Association of the interferon-
gamma single nucleotide polymorphism +874(T/A) with
response to immunosuppressive therapy in patients with severe
aplastic anemia. Blood Cell Mol Dis. 2010;45(4):313–6.
29 Lee YG, Kim I, Kim JH, et al. Impact of cytokine gene poly-
morphisms on risk and treatment outcomes of aplastic anemia.
Ann Hematol. 2011;90:515–21.
30 Abraham LJ, Kroeger KM. Impact of the −308 TNF promoter
polymorphism on the transcriptional regulation of the
TNF gene: relevance to disease. J Leukocyte Biol. 1999;66(4):
562–6.
31 Demeter J, Messer G, Schrezenmeier H. Clinical relevance of the
TNF-alpha promoter/enhancer polymorphism in patients with
aplastic anemia. Ann Hematol. 2002;81(10):566–9.
32 Peng J, Liu C, Zhu K, et al. The TNF2 allele is a risk factor to
severe aplastic anemia independent of HLA-DR. Hum
Immunol. 2003;64:896–901.
Zayed et al. Susceptibility to aplastic anemia in Egyptian patients 1
33 Dufour C, Corcione A, Svahn J, et al. Interferon gamma and
tumour necrosis factor alpha are overexpressed in bone
marrow T lymphocytes from paediatric patients with aplastic
anaemia. Br J Haematol. 2001;115:1023–31.
34 Hara T, Ando K, Tsurumi H, et al. Excessive production of
tumor necrosis factor-alpha by bone marrow T lymphocytes is
essential in causing bone marrow failure in patients with aplastic
anemia. Eur J Haematol. 2004;73:10–6.
35 Zhou X, Tan FK, Stivers DN, et al. Microsatellites and intra-
genic polymorphisms of transforming growth factor beta and
platelet-derived growth factor and their receptor genes in
Native Americans with systemic sclerosis (scleroderma): a pre-
liminary analysis showing no genetic association. Arthritis
Rheum. 2000;43(5):1068–73.
36 Wood NA, Thomson SC, Smith RM, et al. Identification of
human TGF-beta1 signal (leader) sequence polymorphisms by
PCR-RFLP. J Immunol Meth. 2000;234(1–2):117–22.
37 Grainger DJ, Heathcote K, Chiano M, et al. Genetic control of
the circulating concentration of transforming growth factor type
beta1. Hum Mol Genet. 1999;8(1):93–7.
38 Fermo E, Bianchi P, Barcellini W, et al. Immunoregulatory cyto-
kine polymorphisms in Italian patients affected by paroxysmal
nocturnal haemoglobinuria and aplastic anaemia. Eur J
Immunogenet. 2004;31:267–9.
Hematology 2015 VOL. 0 NO. 0 7
Authors Queries
Journal: Hematology
Paper: HEM825
Article title: The association of cytokine genes polymorphisms and susceptibility to aplastic anemia in
Egyptian patients

Dear Author
During the preparation of your manuscript for publication, the questions listed below have arisen.
Please attend to these matters and return this form with your proof. Many thanks for your assistance

Query
Reference Query Remarks

1 Please check the suggested running title.

Please provide citation for Figs. 1–3 and

2 check the placement of Figures.

Table 3 is not cited in the main text. Please

3 check

If references [4, 5, 10, 11–15, 17–22, 24–29,

32–38] has more than six authors, then list
the names of first six authors followed by et
al.; otherwise, provide the names of all the
4 authors.