Endocrine

DOI 10.1007/s12020-016-1028-0

ORIGINAL ARTICLE

The changing faces of corticotroph cell adenomas: the role of

prohormone convertase 1/3
Alberto Righi1 Marco Faustini-Fustini2 Luca Morandi3 Valentina Monti3
● ● ● ●

Sofia Asioli3 Diego Mazzatenta4 Antonella Bacci5 Maria Pia Foschini3

● ● ●

Received: 9 March 2016 / Accepted: 18 June 2016

© Springer Science+Business Media New York 2016

Abstract The spectrum of corticotroph cell adenomas is
very wide. Though rarely, silent corticotroph cell adenomas
(SCA) may transform into corticotroph cell adenomas
associated with Cushing’s disease (CD). The aim of the
study was to investigate the role of prohormone convertase
1/3 (PC1/3) in the transformation of SCA into CD.
We reviewed the records of 1259 consecutive endoscopic
endonasal procedures for pituitary adenomas from 1998 to
2013. Of these, 132 were CD and 44 were SCA. During
the follow-up, three patients with SCA showed a clear
transformation from SCA into CD and underwent surgery
once again to remove the recurrent tumour. The PC1/3
expression was analysed by both immunohistochemistry
expression was observed in the majority of neoplastic cells in
tissue specimens obtained from the same three patients at the
time of recurrence as CD. The immunohistochemical PC1/3
expression showed a strict correlation with the PC1/3 levels
obtained by qRT-PCR. In 14 cases of SCA with no change of
phenotype during the follow-up, the immunohistochemical
PC1/3 expression was low and strictly associated with the
level of PC1/3 obtained by qRT-PCR both in primary (14/14
cases) and in recurrent tumours (4/4 cases). Our study pro-
vides insight into the crucial role of the PC1/3 protein in the
transformation of phenotype from SCA to CD.
Keywords Prohormone convertase Cushing’s disease
● ●

and quantitative real time-polymerase chain reaction Pituitary adenoma Metamorphosis

●

(qRT-PCR) in primary and recurrent tumours. The immu-

nohistochemical PC1/3 expression was negative or weak in
the three patients in the initial phase of SCA, while a strong

Introduction
Alberto Righi and Marco Faustini-Fustini contributed equally to the
study. More than 35 years have passed since the Kovacs’ group
* Marco Faustini-Fustini proposed the silent corticotroph cell adenoma (SCA) as a
marcoff196@gmail.com distinct clinicopathologic entity with positive immunor-
marco.faustini@ausl.bologna.it eactivity for adrenocorticotropic hormone (ACTH) without
1 any clinical and biochemical evidence of Cushing’s syn-
Department of Pathology, Rizzoli Institute, Bologna, Italy
2
drome [1, 2]. It has been known for many years that SCAs
IRCCS Institute of Neurological Sciences of Bologna (ISNB),
are usually large tumours, which present signs and symp-
Bellaria Hospital, Via Altura, 3, Bologna 40139, Italy
3
toms due to the tumour mass and sometimes show more
Department of Biomedical and Neuro-Muscular Sciences, Section
aggressive behaviour than other clinically non-functioning
of Anatomic Pathology ‘M.Malpighi’ at Bellaria Hospital,
University of Bologna, Bologna, Italy pituitary adenomas [1, 3]. However, there has been very
4 little progress in understanding the mechanism(s) by which
Department of Neurosurgery, Center of Pituitary Tumors and
Endoscopic Skull Base Surgery, IRCCS Institute of Neurological the hormonal secretion of neoplastic corticotroph cells is not
Sciences of Bologna (ISNB), Bellaria Hospital, Bologna, Italy associated with Cushing’s disease (CD). Only recently,
5
Department of Neuroradiology, IRCCS Institute of Neurological focused laboratory research has resulted in a surge of
Sciences of Bologna (ISNB), Bologna, Italy interest in this field [4]. However, the distinction between

hormonally active and SCAs is not as clear as expected. The
transformation of a SCA into a corticotroph cell adenoma
associated with CD has been sporadically reported in the
medical literature [5–13], and adenoma cells of the primary
tumour were positive for ACTH to a variable degree in
these cases. This phenomenon is of great interest and
remains to be elucidated. Baldeweg et al. report that, after a
long natural history, a proportion of SCA might show their
full potential for secreting molecules of ACTH that appear
qualitatively and quantitatively sufficient to lead to CD [9].
While this observation may be pertinent, the mechanism
underlying this transformation in the pattern of hormonal
secretion has not yet been clarified and it is not currently
possible to predict in which patients with SCA the meta-
morphosis to CD will occur.
It is tempting to postulate that this transformation can
result from the involvement of one or more steps in the
processing of pro-opiomelanocortin (POMC) [14, 15]. Pro-
hormone convertase 1/3 (PC1/3) belongs to the large family
of proprotein convertases and is distributed in secretory
granules of neural and neuroendocrine tissues [16]. In cor-
ticotrophs, PC1/3 is involved in the post-translational pro-
cessing of POMC into mature and biologically active ACTH
[14–16]. Previous immunohistochemical and RT-PCR stu-
dies have demonstrated a decrease in PC1/3 expression
associated with a downregulation of POMC and PC1/3 genes
in SCA with respect to corticotroph adenomas associated
with CD [14, 15, 17]. Therefore, PC1/3 expression has been
proposed as having a central role in POMC processing
impairment in SCA [14, 17, 18]. Positive PC1/3 immunos-
taining has been observed in normal pituitary gland speci-
mens and in all types of pituitary adenomas, although a more
intense immunoreactivity to PC1/3 has been observed in
corticotroph cell adenomas associated with CD [17–20].
In this paper we present the results of immunohistochem-
ical and molecular expression of PC1/3 in tissue specimens
obtained from three patients with SCA who underwent surgery
once again because of the development of clinical and
laboratory features of CD during the follow-up period.
Materials and methods
Human subjects and tissues
All 1259 consecutive cases of pituitary adenoma surgically
treated with endoscopic endonasal procedures present in the
files of the Section of Anatomic Pathology of the Department
of Biomedical and Neuromotor Sciences of the University of
Bologna at Bellaria Hospital from January 1998 to December
2013 were retrieved. Of these, 132 were ACTH-secreting
adenomas associated with CD and 44 were SCAs. All patients
with ACTH-secreting adenomas associated with CD had signs
Endocrine
and symptoms of hypercortisolism at presentation, whereas
those with SCA presented to us with symptoms related to
tumour mass. As recently reported by our group [21, 22], the
immunohistochemical expression of galectin-3 protein was
also evaluated for all cases to differentiate SCA from
ACTH-secreting adenomas associated with CD. SCAs were
classified as densely granulated (type 1) and sparsely granu-
lated (type 2) according to the recent criteria [23–26]. The
cases meeting the following criteria were selected: (a) the
availability of enough material to allow morphological and
immunohistochemical characterisation of the patients who
were re-operated on during the transformation phase from
SCA to CD, (b) no radiation therapy before surgery and (c) the
availability of clinical information, including endocrinological
evaluation and neuroimaging data. The clinical, neuror-
adiological and pathological features of the first five patients
with SCA that changed their phenotype from SCA to CD
(nos. 1–5, Table 2) have been recently reported by our group
[27]. Both 14 cases of SCA (7 densely granulated, type 1 and
7 sparsely granulated, type 2) and 5 cases of ACTH-secreting
adenomas associated with CD (all of them with no change of
phenotype during the follow-up) were used as control cases.
Consent was obtained from each patient after full
explanation of the purpose and nature of all the procedures
used and the investigation was approved by the local ethical
committee (Protocol no. 14120). Follow-up monitoring
included postoperative MRI scans obtained 3–6 months
after surgery and then at variable intervals, depending on
clinical and neuroradiological findings and results of bio-
chemical analysis.
Immunohistochemistry
Four-micrometre thick sections were immunohistochemi-
cally stained with monoclonal antibody to anti-PC1/3
(PCSK1) clone 3D2 (diluted 1:80; Sigma-Aldrich). Immu-
nohistochemical reactions were performed using the Ultra-
Vision LP Large Volume Detection System HRP Polymer
(Thermo Fisher Scientific, Fremont, CA) as follows:
dewaxing and antigen retrieval were achieved by pretreat-
ment with W-CAP TEC buffer solution pH6 (Bio-Optica,
Milan, Italy) at 98 °C for 35 min, and inhibition of the
endogenous peroxidases was obtained in 3 % H2O2. After
rinsing the slides in distilled water and in buffer solution
(PBS-Tween 20, 1×; Bio-Optica), the sections were incu-
bated in a humid chamber at room temperature (RT) for
5 min with Ultra V Block solution (Ultravision LP; Lab
Vision Corp, Thermo Fisher Scientific). The sections were
then washed in buffer solution three times for 2 min each
and incubated with primary antibody for 1 h at RT in a
humid chamber. The sections were then washed in buffer
solution and incubated with Primary Antibody Enhancer
solution (Ultravision LP; Lab Vision Corp) for 20 min at
Endocrine

Fig. 1 Case 2. a, b Reticulin stain showed the normal acinar architecture
in non-tumorous adenohypophysial parenchyma associated with the loss
of this acinar architecture in the SCA, inside the circle (a, 50× magnifi-
cation; b, 200× magnification). c On hematoxylin and eosin stain, the
normal pituitary exhibited acinar architecture, and manifest cellular
heterogeneity as variation in cytoplasmic granularity and staining asso-
ciated with the capillary-rich stromal network surrounding pituitary acini.
(200× magnification). d–f The non-tumorous adenohypophysial par-
enchyma evidenced the expression of PC1/3 (d, 400× magnification),
ACTH (e, 400× magnification) and PRL (f, 400× magnification)

Table 1 The PCR primers used in this study

Gene name Primer forward Primer reverse Slope Efficiency R square
(%) value

B2M ATGAGTATGCCTGCCGTGTGA GGCATCTTCAAACCTCCATG −3.051 112.7 0.992

ACTB TTGCCGACAGGATGCAGAAGGA AGGTGGACAGCGAGGCCAGGAT −3.116 109.4 0.998
PCSK1 GGAGTGCCTTTCATATCACTA GAGCTGAACGTTACTTCTTTCTT −3.101 110.1 0.991

RT in a humid chamber. After several washes in buffer
solution, the sections were incubated for 10 min with HRP-
polymer solution (horseradish peroxidase polymer; Ultra-
vision LP, Lab Vision Corp). Reaction was revealed with
3.3′-diaminobenzidine solution for 5 min and counter-
stained with hematoxylin. Duodenal tissue fragments
were used as a positive control and the non-tumorous ade-
nohypophysial parenchyma was used as an internal positive
control when it was present in the sample [18–20]
(Fig. 1a–f). The absence of a primary antibody was used as
a negative control. The PC1/3 immunohistochemical
expression was scored using the semiquantitative scale
reported by Lloyd RV et al. [19]. In particular, the immu-
nostaining results were expressed as a percentage of posi-
tive tumours and the staining intensity was graded as
follows: 0, negative; 1+, weakly positive; 2+, moderately
positive; and 3+, strongly positive. The immunocytochemical
staining for PC1/3 was evaluated by three of us (S.A., A.R.
and M.P.F.) who were blinded to clinical and pathological
data.
RNA extraction and RT qPCR analysis
Paraffin-embedded tumour material obtained from the
20-μm-thick sections was de-paraffinized in xilene at 50 °C
for 3 min and rinsed twice in absolute ethanol at RT. Total
RNA was extracted using a Recover All kit (Ambion, Austin,
TX, USA), including a DNase step according to the manu-
facturer’s recommended protocol. RNA concentration was
measured with a Quant-iT™ RNA kit (Invitrogen, Carlsbad,

CA, USA). Primers were designed using Primer3 software
(http://simgene.com/Primer3) and are described in Table 1.
ACTB and B2M served as reference housekeeping genes for
normalisation. Amplicons were tested with MFOLD
(http://mfold.rna.albany.edu/?q=mfold) in order to avoid
secondary structures within primer positions and were
tested using repeatmasker (http://www.repeatmasker.org) and
primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-
blast) for primer specificity.
Seven microlitres of total RNA was subjected to
reverse transcription using a SuperScript® VILO™
cDNA Synthesis kit (Invitrogen, Carlsbad, CA, USA)
according to the manufacturer’s recommended protocol.
One microlitre of cDNA was amplified in duplicate
adding 10 pmol of each primer by the 1× FastStart Taq
Reagents Kit (Roche, Mannheim, Germany), with the
following programme: 2 min at 50 °C, 4 min at 95 °C and
38 cycles with annealing at 60 °C for 30 s. GelStar stain
(Lonza Bioscience, Rockland, ME, USA) was used as an
intercalating dye. No template control for each marker
was included in the reaction plate. One case of ACTH-
secreting adenomas associated with CD with no change
of phenotype during the follow-up was used as a strong
positive internal control for PC1/3 for relative quantifi-
cation and fold-change calculation.
All of the reactions were performed in duplicate and
amplicons run on a 3 % agarose gel [28].
Statistical analysis
Expression values and fold change were obtained with
relative quantification of ACTB and B2M as reference
mRNA and the 2−ΔΔCt method [29], using the DataAssist
2.0 Tool (Applied Biosystem, Foster City, CA, USA).
Results
Clinical data
During the follow-up period (ranging from 18 to
180 months), 7 (3.9 %) of the 176 patients with corticotroph
cell adenoma that underwent pituitary surgery over the last
15 years showed a clear transformation of the phenotype,
changing their clinical expression from SCA to ACTH-
secreting adenomas associated with CD in 5 cases and from
CD to SCA in 2 cases (Table 2). Of these, three patients
with SCA were re-operated on after the transformation
phase to CD, thus allowing us to obtain tissue specimens
both in the phase of SCA and in the phase of CD in the
same patient.
Two cases (cases 1 and 2, see Tables 2 and 3) that
showed a clear transformation of the phenotype,
Endocrine
changing their clinical expression from SCA to ACTH-
secreting adenomas associated with CD, were sparsely
granulated silent corticotroph adenomas with an expres-
sion of 10 % (case 1) and 20 % (case 2) of neoplastic
cells. The recurrences of typical corticotroph adenoma
with CD showed an ACTH immunohistochemical
expression of 80 % and of 70 % of neoplastic cells,
respectively. On the other hand, the diagnosis in other
two cases (cases 3 and 4) of SCA was densely granulated
corticotroph adenomas. In particular, the pituitary tumour
of patient no. 3 was a densely granulated SCA, composed
of basophilic cells that were strongly positive for ACTH
(90 % of neoplastic cells); the recurrence of corticotroph
adenoma associated with CD showed an ACTH
immunohistochemical expression of 75 % (Table 2).
Neoplastic cells of patient no. 4 showed a similar ACTH
immunohistochemical both in the phase of CD (first
operation) and in the phase of SCA (90 and 80 %,
respectively).
Clinical and neuroradiological data of the seven
patients whose phenotype changed during the follow-up
are summarised in Table 2. The transformation time
varied from 1 to 7 years. A more detailed clinical history
of the first five patients has been reported in a previous
study [27]. A low dose dexamethasone suppresion test
(LDDST) was carried out in all these patients in order to
confirm the suspicion of Cushing’s syndrome. It is of
note that patient no. 3 showed very high serum ACTH
levels (386 pg/ml) despite no evidence of clinical features
of Cushing’s syndrome together with normal morning
serum cortisol.
Immunohistochemical analysis
Table 3 summarises the results of immunohistochemical
and molecular studies on PC1/3 expression in these three
patients. With respect to immunohistochemistry, the dis-
tribution of PC1/3 protein was cytoplasmic with a granular
immunoreactive pattern and focally nuclear. In all cases,
PC1/3 immunoreactivity indicated the non-tumorous ade-
nohypophysial parenchyma, which served as an internal
positive control when it was present in the sample.
The immunohistochemical PC1/3 expression was nega-
tive or weak and focally positive (0/1+) in the neoplastic
cells in the phase of SCA, whereas a moderate/strong
expression (2+/3+) was observed in the majority of the
neoplastic cells in the same three patients that developed an
ACTH-secreting adenoma associated with CD (Fig. 2a–d).
In 14 cases of SCA with no change of phenotype during the
follow-up, used as control cases (four of whom showed a
recurrence and underwent pituitary surgery once again), the
immunohistochemical PC1/3 expression was absent or
weak in scattered neoplastic cells (0/1+). Conversely, in five
Table 2 Clinical, radiological and pathological features of the seven patients with corticotroph cell adenoma that changed their phenotype during the follow-up period
No. Age/ Symptoms at presentation and laboratory tests Neuroradiological classification Diagnosisb at the Diagnosis at the time Transformation
Endocrine

gender on MRI Hardy-Wilsona time of presentation of transformation time (years)

(first operation) (% of ACTH (% of ACTH
(trasformation) positive cells) positive cells)
Before the After the
transformation transformation

1 47/F Pituitary incidentaloma. No sign of Serum ACTH Serum ACTH Cystic adenoma with suprasellar SCA CD 7
hypercortisolism extension
Normal urinary free cortisol 87.1 pg/ml 61 pg/ml — — — —
(320 nmol/day)
Serum cortisol below 50 nmol/L after Serum cortisol Serum cortisol (2-A) (1-0) (10 %) (80 %)
LDDST
— 763.2 nmol/L 804.5 nmol/L — — — —
2 18/F Primary amenohrroea. No sign of Serum ACTH Serum ACTH Invasive cystic tumour with SCA CD 6
hypercortisolism suprasellar and parasellar extension
Serum cortisol below 50 nmol/L after 40 pg/ml 21.51 pg/ml — — — —
LDDST
— Serum cortisol Serum cortisol (2-D) (2-A) (20 %) (70 %)
— 699.6 nmol/L 1310.2 nmol/L — — — —
3 37/F Visual loss. No sign of hypercortisolism. Serum ACTH Serum ACTH Invasive solid large tumour with SCA CD 2
BMI: 20 kg/m2 asynìmettric suprasellar and
parasellar bilateral extension
— 386 pg/ml. 150 pg/ml — (90 %) (75 %) —
— Serum cortisol Serum cortisol — — — —
— 286,2 nmol/L 20,4 nmol/L (2-E) (2-D) — — —
4 51/M Visual loss. Diabetes mellitus Serum ACTH Serum ACTH Invasive solid large tumour with CD SCA 1
suprasellar and parasellar extension
Clinical features of CD 130 pg/ml 48.6 pg/ml — — — —
Urinary free cortisol. 403 nmol/day. Low Serum cortisol Serum cortisol (2-C) (2-A) (90 %) (80 %) —
serum LH, FSH and total testosterone
— 985.8 nmol/L 225.7 nmol/L — — — —
5 48/M Pituitary incidentaloma Serum ACTH Serum ACTH Solid large tumour with suprasellar SCA CD 2
extension
Normal urinary free cortisol 48.8 pg/ml 127.9 pg/ml — (no surgery) (80 %) —
(847 nmol/day)
Serum cortisol below 50 nmol/L after Serum cortisol Serum cortisol (2-A) (no recurrence) — — —
LDDST
— 422.9 nmol/L 973 nmol/L — — — —
6* 50/M Visual loss. High-normal arterial Serum ACTH Serum ACTH Tumour with suprasellar extension SCA CD 4
pressure. No hormonal abnormalities
Serum cortisol below 50 nmol/L after 32 pg/ml 17 pg/ml (2-A) (2-B) — — —
LDDST
— Serum cortisol Serum cortisol — (70 % atypical adenoma) (data not available) —
— 534.24 nmol/L 79.5 nmol/L — — — —
Table 2 continued
No. Age/ Symptoms at presentation and laboratory tests Neuroradiological classification Diagnosisb at the Diagnosis at the time Transformation
gender on MRI Hardy-Wilsona time of presentation of transformation time (years)
(first operation) (% of ACTH (% of ACTH
(trasformation) positive cells) positive cells)
Before the After the
transformation transformation

7* 69/M Severe hypokalaemia (1.8 mmol/L) Serum ACTH Serum ACTH Large invasive tumour with CD SCA 1
suprasellar and infrasellar extension
Upper body obesity and fatigue, without 69 pg/ml 33.9 pg/ml — — — —
other signs of CD (no red, round face, no
thin skin and bruising, no purple striae)
High serum cortisol after LDDST (488 Serum cortisol Serum cortisol (2-D) (no recurrence) (90 % atypical adenoma) (no surgery) —
nmol/L).
High urinary free cortisol (1738 nmol/ 1176.6 nmol/L 286.2 nmol/L — — — —
day)

Only patients nos. 1, 2 and 3 were re-operated at the time of transformation

Asterisk (*) indicates patients who were treated also by radiotherapy. Patient no. 6 underwent radiotherapy after surgery (one year before the transformation from SCA to CD), medical treatment
with pasireotide and chemotherapy with temozolomide and finally (6 years after presentation) developed distant spread of the tumour (liver metastases). Patient no. 7 underwent radiotherapy after
surgery, but when the transformation from CD to SCA had been occurred yet
All the patients except no. 5 underwent surgery before transformation. Clinical, radiological and pathological features of patients nos. 1–5 have been previously reported [27]. Patients nos. 1, 2 and
3 underwent surgery both before and after transformation; they correspond to patient nos. 1, 3 and 4, respectively, in Ref. [27]. Patient nos. 2 and 5 correspond to patient nos. 2 and 5, respectively,
in Ref. [27]
ACTH reference ranges were: 5–60 pg/ml for cases 1 and 4, <46 pg/ml for cases 2, 6 and 7, 9–52 pg/ml for case 3, 5–52 pg/ml for case 5.
Serum cortisol reference ranges were: 222.6–667.8 nmol/L for cases 1, , 6 and 7, 178–731.4 nmol/L for case 2, 197.2–616.9 nmol/L for case 3, 222.6–795 nmol/L for case 5.
Urinary free cortisol reference ranges were: 96.5–377.9 nmol/day for cases 1, 6 and 7, 55.18–248.31 nmol/day for cases 2 and 4, 99.2–377.9 nmol/day for case 3, and 160–1103.6 nmol/day for
case 5.
MRI magnetic resonance imaging, LDDST low dose dexamethasone suppression test (Liddle I) (footnote b below), SCA silent corticotroph cell adenoma, CD Cushing’s disease
a
Neuroradiological classification according to Hardy-Wilson criteria [44, 45]
b
Diagnosis according to WHO criteria [46]
Endocrine
Endocrine

(fold-change values)
ACTH-secreting adenomas associated with CD, used as

PC1/3 qRT-PCR
control cases, the immunohistochemical PC1/3 expression

Table 3 Molecular data and correlation with immunohistochemical results; relative quantification and fold-change values are calculated respect to one case of ACTH-secreting adenomas
was strong in the majority of neoplastic cells (2+/3+,
Fig. 3a, b).

0.7423
0.3265
0.0983
Molecular analysis

ACTH IHC (% of positive PC1/3 IHC (% of positive

neoplastic cells, intensity)
The molecular data and their correlation with the immu-
nohistochemical results are summarised in Table 3 and in
ACTH-secreting adenomas associated with CD

Fig. 4. The PC1/3 mRNA quantitative analyses were

90 % (3+) informative in all samples, and one case of ACTH-secreting
50 % (2+)
40 % (2+)
adenomas associated with CD with no change of phenotype
during the follow-up was used as an internal control refer-
ence for relative quantification and fold-change calculation
for PC1/3.
The immunohistochemical PC1/3 expression showed a
correlation with the PC1/3 levels obtained by quantitative
neoplastic cells) (%)

real time-polymerase chain reaction (qRT-PCR), in asses-

sing the increase of PC1/3 expression from silent to ACTH-
secreting adenomas associated with CD. The PC1/3 levels
of mRNA transcripts were at least doubled during the
tumour transformation of SCA evolving into ACTH-
80
70
75

secreting adenomas associated with CD.

In particular, the average fold-change value in SCA
was 0.149 (range 0.0489–0.2667) for PC1/3 mRNA tran-
transformation

scripts, whereas the average fold-change value was 0.389

(range 0.0983–0.7423) in the same three patients after the
Time of

7 years
6 years
2 years

transformation into ACTH-secreting adenomas associated

with CD.
(fold-change values)

In 10 cases of SCA without a change of phenotype

PC1/3 qRT-PCR

during the follow-up, used as control cases, where the

immunohistochemical PC1/3 expression was absent or
weak in scattered neoplastic cells (0/1+), either an absence
0.2667

0.0489
associated with CD with no change of phenotype during the follow-up

or very low levels of PC1/3 was obtained by qRT-PCR with

0.134

an average fold-change value of 0.11 (range 0–0.186) for

PC1/3 mRNA transcripts. Similar results were obtained in
ACTH IHC (% of positive PC1/3 IHC (% of positive
neoplastic cells, intensity)

4 cases of SCA that showed a recurrence during the follow-

up without changing their phenotype: we identified very
similar levels of PC1/3 obtained by qRT-PCR, with an
average fold-change value of 0.277 (range 0–0.79) in pri-
mary tumour and an average fold-change value of 0.279
20 % (1+)
No. Silent corticotroph pituitary adenomas

(range 0–0.99) in the recurrent tumour for PC1/3 mRNA

transcripts.
0
0

Discussion
neoplastic cells) (%)

Our study showed that in all the three patients with SCA
who changed their phenotype during the follow-up period
the PC1/3 expression – analysed by both immunohis-
tochemistry and qRT-PCR – was scant in the phase of silent
10
20
90

corticotroph adenoma, while it became strong in the sub-

sequent phase of CD, thus providing insight into the crucial
1
2
3
 Endocrine

Fig. 2 Case 2 (Table 2). a The

immunohistochemical PC1/3
expression was negative
(a, 200× magnification) in the
SCA; b the same case showing a
strong ACTH immunoreactivity
(b, 200× magnification);
c a moderate/strong expression
(2+/3+) for PC1/3 antibody
(c, 200× magnification) was
observed in the majority of the
neoplastic cells in the recurrence
of the same patient that
developed an ACTH-secreting
adenoma associated with CD;
d ACTH immunohistochemical
expression in the recurrent
adenoma (d, 200×
magnification)

Fig. 3 a, b Positive
immunohistochemical case
control of ACTH-secreting
adenoma associated with CD
showing a strong (3+)
expression for PC1/3 antibody
in the majority of the neoplastic
cells (a: ACTH
immunoreactivity, 200×
magnification; b: PC1/3
expression, 200× magnification)

role of PC1/3 protein in the mechanism of such an unusual
transformation. Our findings about the fold-change values
indicated that both in cases 1 and 2 the mRNA levels had
gone up threefold in the phase of CD with respect to the
phase of SCA. This change was less evident in case 3,
which exhibited twice the RNA levels of PC1/3 in the phase
of CD. We did not see any evident variation in mRNA
expression for the two housekeeping genes for all the three
cases, indicating that possible variations during the fixation
process were minimal and they probably did not affect the
experimental conditions. Furthermore, our data did not
completely confirm the idea that only a long follow-up period
enables the full potential for secreting a biologically active
molecule of ACTH by neoplastic cells in the SCA setting to
be shown [9]. In fact, in our series the period for transfor-
mation from SCA to CD was not particularly long, ranging
from 1 to 7 years (Table 2). Conversely, in sporadic cases
reported in the medical literature this transformation occurred
up to 15 years from the initial presentation (Table 4).
To the best of our knowledge, our series is the largest
published to date. To be sure, more questions remain. The
transformation of an SCA into a corticotroph cell adenoma
associated with CD remains a challenge, not only because
of its rarity [5–13], but also in terms of understanding the
Endocrine
Fig. 4 Comparison between PC1/3 immunohistochemical expression
and PC1/3 expression levels using qRT-PCR in cases 1, 2 and 3,
before transformation (on the left) and after transformation (on the
right)
mechanism(s) underlying such a metamorphosis. In patients
with macroadenoma associated with CD, impaired proces-
sing of POMC has been advocated to understand the poor
response to the high-dose dexamethasone suppression test
compared to the response that is usually recorded in patients
with microadenomas [30]. Again, the secretion of high
molecular weight adrenocorticotropin in a patient with SCA
was reported several years ago [31]. More recently, Raverot
and colleagues analysed a number of molecular character-
istics of SCA and CD, differentiating between micro-
adenomas and macroadenomas associated with CD [4].
In their work, the authors identified a lower expression of
PC1/3 in SCA and in macroadenomas associated with CD
than in microadenomas associated with CD. However, in
their cohort, no patients with SCA developed CD during the
follow-up, although two patients harboured hormonal
abnormalities with no clinical signs of CD. Interestingly,
one of their patients affected with SCA had very high
plasma ACTH levels (899 pg/ml) in spite of no features of
Cushing’s syndrome. Our patient no. 3 (Table 2) showed
similar biochemical data, together with patient no. 10 [6]
and patient no. 11 [5] reported in Table 4. This rare phe-
nomenon is well known, even though the explanation is far
from being a simple issue.
In addition to studying tissue specimens in both the SCA
and CD phases in three patients, we also described two
patients (Table 2) who underwent the opposite metamor-
phosis (from CD to SCA), which is even more unusual than
the transformation from SCA to CD [12, 32]. In these two
patients, however, we were unable to evaluate PC1/3
expression in tissue specimens in the two different phases of
their clinical course, because they were operated on only
during the CD phase.
Another important challenge in analysing the results of
studies on patients affected with corticotroph cell adenoma
is the possibility of a cyclic or periodic hypersecretion of
cortisol with intermittent periods of normal secretion [33–38].
However, almost all cases of cyclic Cushing’s disease
reported to date were microadenomas, while the cases that
we report in the present study relate to large macro-
adenomas. Clinical, pathological, and laboratory data
accumulated over the last three decades suggest that just
corticotroph cell macroadenomas represent a heterogeneous
group of pituitary tumours and that, in particular, the
spectrum of clinical behaviour can range from overt
Cushing’s syndrome to silent corticotroph adenomas.
Between these two opposite points of the spectrum, subclinical
Cushing’s syndrome does exist, and this represents a further
matter of debate. In fact, while a cyclic form of CD seems to
be quite unlike the one observed in our series, the possibility
that some cases of SCA may gradually develop into CD
through a subclinical intermediate form of hypercortisolism
could not be completely excluded. Furthermore, the data
obtained from previous studies sometimes were lacking in
details about endocrinological investigations (Table 4).
In general, how SCA can progress to develop florid
Cushing’s syndrome after years of silence remains an
enigma. Usually, a change in the immunophenotype of a
tumour is a phenomenon seen in malignant tumours and,
theoretically, can be caused by irradiation or haemorrhage [39].
A number of hypotheses have been proposed to explain the
progression from SCA to CD. Kojima et al. stated that the
percentage of immunoreactive ACTH-secreting cells and
the amount of hormone secreted by a single cell are too low
in SCA in comparison with CD [40]. Matsuno and coll.
reported the secretion of a high molecular weight adreno-
corticotropin competing with the normal adrenocortico-
tropin for its receptor [41]. An increase in intracellular
degradation of ACTH has also been postulated. If there is a
decrease in this cellular degradation during tumour pro-
gression, ACTH synthesis may become clinically sig-
nificant. Thus, the tumour very often produces neurological
and ophthalmological symptoms before the onset of the
hormonal syndrome, or produces the syndrome when it
reaches a considerable volume [1,12,42]. Another hypoth-
esis is that the clinical manifestations of CD are critically
dependent on prohormone processing in corticotrophs and
the regrowth of the tumour changes the processing of the
POMC molecule, thus causing the overproduction of bio-
active ACTH. This phenomenon may be due to alterations
in PC1/3, which is known to be involved in the post-
translational processing of POMC into ACTH [14–16].
The data obtained in our study indicates the crucial role of
PC1/3 in these patients. In particular, the immunohisto-
chemical PC1/3 expression was negative or weak positive
in the three patients in the initial phase SCA, whereas we
Table 4 Summary of previous cases of SCA adenomas transforming into ACTH-secreting adenoma associated with CD (see references)
No. Age/ Presentation Diagnosis at first operation Recurrence as CD Postoperative radiotherapy/ References
gender (years) Outcome

1 14/F Ophthalmoplegia, obesity, hypertension, abdominal striae Non-functioning chromophobe adenoma 5 Yes/Progression [13]
(several cells immunopositive for ACTH)
— Serum basal cortisol 16 µg/dl — — — —
— Normal suppression at overnight 1 mg dexamethasone test — — — —
2 44/F Amenorrhoea-galactorrhoea. Basal serum ACTH 27 pg/ml (normal, Silent ACTH adenoma 3 Yes/Cured [11]
9–52), basal serum cortisol 527 nmol/L (normal, 160–690), free
urinary cortisol 296 mmol/24 h (normal, 90–370), serum PRL 76–84
ng/ml (normal, 2.5–26)
3 49/F No hormonal abnormalities Non-functioning pituitary adenoma (few 1 Yes/Cured [10]
cells immunopositive for ACTH)
4 — None of the patients had symptoms or signs suggestive of Silent ACTH adenoma ? — [9]
5 — hypercortisolism at the time of presentation Silent ACTH adenoma ? — —
6 — Silent ACTH adenoma ? — —
7 — Silent ACTH adenoma ? — —
8 49/F Visual loss and galactorrhea–amenorrhoea Non-functioning atypical adenoma 2 Yes/Controlled [8]
— Morning serum cortisol levels: 24 μg/dL, ACTH: 36 ng/L — — — —
9 58/M No stigmata of hypercortisolism Type II silent ACTH adenoma 15 No/Controlled [7]
— Partial hypopituitarism (hydrocortisone, levothyroxine and — — — —
testosterone replacement therapy)
10 45/M No sign of hypercortisolism. Headache, visual defects. Plasma Silent ACTH adenoma 6 Yes/Progression (ACTH- [6]
ACTH: 192 pg/ml secreting carcinoma)
11 52/M No sign of hypercortisolism Silent ACTH adenoma 2 Yes/Progression [5]
— ACTH 168 pg/ml (normal, 10–60), serum cortisol: 433 nmol/L — — — —
(normal, 160–690)
Endocrine
Endocrine
observed a strong expression in the majority of the neo-
plastic cells in the recurrent tumours of these patients,
when they developed an ACTH-secreting adenoma asso-
ciated with CD. Data obtained with qRT-PCR supports the
immunohistochemical findings in this setting.
Finally, it is important to underline that the changing
pattern of hormonal secretion is not a unique feature of
corticotroph cell adenomas. Lania and coll. described a
case of aggressive atypical prolactinoma that evolved into a
growth hormone secreting adenoma associated with acro-
megaly during the follow-up because of a point mutation of
the GNAS gene, which was absent in the tissue specimens
obtained from the first operation [43]. This observation
indicates that mutational genetic events can occur in
pituitary adenomas, leading to a transition in hormonal
secretion.
In conclusion, although there is still a great deal of work
ahead to understand in detail the mechanism(s) responsible
for the transformation of phenotype from silent to ACTH-
secreting adenomas associated with CD, our retrospective
study provides insight into the crucial role of the PC1/3
protein in this setting.
Acknowledgments The authors thank the following members of the
team for their contributions to patient care and data collection:
Dr. Giorgio Frank for his skilful contribution as project manager of the
Centre of Pituitary and Endoscopic Skullbase Surgery, IRCCS Insti-
tute of Neurological Sciences of Bologna (ISNB); Dr. Carmelo Stur-
iale, chief of the Neurosurgery Unit, IRCCS Institute of Neurological
Sciences of Bologna (ISNB).
Funding This research was supported with grants from Department
of Biomedical and Neuromotor Sciences (DIBINEM) of the University
of Bologna (Fund for Fundamentally Oriented Research).
Compliance with ethical standards
Conflict of interest The authors declare that they have no conflict of
interest.
References
1. K. Kovacs, E. Horvath, T.A. Bayley, S.T. Hassaram, C. Ezrin,
Silent corticotroph cell adenoma with lysosomal accumulation and
crinophagy. A distinct clinicopathologic entity. Am. J. Med.
64(3), 492–499 (1978). doi:0002-9343(78)90236-X
2. E. Horvath, K. Kovacs, D.W. Killinger, H.S. Smyth, M.E. Platts,
W. Singer, Silent corticotropic adenomas of the human pituitary
gland: a histologic, immunocytologic, and ultrastructural study.
Am. J. Pathol. 98(3), 617–638 (1980)
3. B.W. Scheithauer, A.J. Jaap, E. Horvath, K. Kovacs, R.V. Lloyd,
F.B. Meyer, E.R. Laws Jr., W.F. Young Jr., Clinically silent
corticotroph tumors of the pituitary gland. Neurosurgery 47(3),
723–729 (2000). discussion 729–730
4. G. Raverot, A. Wierinckx, E. Jouanneau, C. Auger, F. Borson-
Chazot, J. Lachuer, M. Pugeat, J. Trouillas, Clinical, hormonal and
molecular characterization of pituitary ACTH adenomas without
(silent corticotroph adenomas) and with Cushing’s disease. Eur. J.
Endocrinol. 163(1), 35–43 (2010). doi:10.1530/EJE-10-0076
5. E. Melcescu, A.W. Gannon, A.D. Parent, J.F. Fratkin, W.C.
Nicholas, C.A. Koch, A. Galhom, Silent or subclinical cortico-
troph pituitary macroadenoma transforming into cushing disease:
11-year follow-up. Neurosurgery 72(1), E144–E146 (2013).
doi:10.1227/NEU.0b013e3182750850
6. E. Jouanneau, A. Wierinckx, F. Ducray, V. Favrel, F. Borson-
Chazot, J. Honnorat, J. Trouillas, G. Raverot, New targeted
therapies in pituitary carcinoma resistant to temozolomide. Pitui-
tary 15(1), 37–43 (2012). doi:10.1007/s11102-011-0341-0
7. T. Psaras, J. Honegger, R. Buslei, W. Saeger, D. Klein, D. Capper,
R. Meyermann, M. Mittelbronn, Atypical type II silent cortico-
trophic adenoma developing into Cushing’s disease upon second
recurrence. Exp. Clin. Endocrinol. Diabetes 115(9), 610–615
(2007). doi:10.1055/s-2007-984437
8. L.R. Salgado, M.C. Machado, A. Cukiert, B. Liberman, C.T.
Kanamura, V.A. Alves, Cushing’s disease arising from a clini-
cally nonfunctioning pituitary adenoma. Endocr. Pathol. 17(2),
191–199 (2006). doi:EP:17:2:191
9. S.E. Baldeweg, J.R. Pollock, M. Powell, J. Ahlquist, A spectrum
of behaviour in silent corticotroph pituitary adenomas. Br. J.
Neurosurg. 19(1), 38–42 (2005). doi:X6718802643691M6
10. T. Sano, K. Kovacs, S.L. Asa, S. Yamada, N. Sanno, S.
Yokoyama, H. Takami, Pituitary adenoma with ‘honeycomb
Golgi’ appearance showing a phenotypic change at recurrence
from clinically nonfunctioning to typical Cushing disease. Endocr.
Pathol. 13(2), 125–130 (2002). doi:EP:13:2:125
11. R.G. Gheri, W. Boddi, F. Ammannati, J. Olivotto, C. Nozzoli, A.
Franchi, L. Bordi, M.L. Luisi, P. Mennonna, Two-step develop-
ment of a pituitary adenoma: from hyperprolactinemic syndrome
to Cushing’s disease. J. Endocrinol. Invest. 20(4), 240–244 (1997)
12. T. Mindermann, K. Kovacs, C.B. Wilson, Changes in the
immunophenotype of recurrent pituitary adenomas. Neurosurgery
35(1), 39–44 (1994)
13. R.A. Bonner, K. Mukai, J.H. Oppenheimer, Two unusual variants
of Nelson’s syndrome. J. Clin. Endocrinol. Metab. 49(1), 23–29
(1979). doi:10.1210/jcem-49-1-23
14. S. Ohta, S. Nishizawa, Y. Oki, T. Yokoyama, H. Namba,
Significance of absent prohormone convertase 1/3 in inducing
clinically silent corticotroph pituitary adenoma of subtype I—
immunohistochemical study. Pituitary 5(4), 221–223 (2002)
15. V. Hook, L. Funkelstein, T. Toneff, C. Mosier, S.R. Hwang,
Human pituitary contains dual cathepsin L and prohormone con-
vertase processing pathway components involved in converting
POMC into the peptide hormones ACTH, alpha-MSH, and beta-
endorphin. Endocrine 35(3), 429–437 (2009). doi:10.1007/
s12020-009-9163-5
16. A.W. Artenstein, S.M. Opal, Proprotein convertases in health and
disease. N. Engl. J. Med. 365(26), 2507–2518 (2011).
doi:10.1056/NEJMra1106700
17. T. Tateno, H. Izumiyama, M. Doi, T. Yoshimoto, M. Shichiri, N.
Inoshita, K. Oyama, S. Yamada, Y. Hirata, Differential gene
expression in ACTH-secreting and non-functioning pituitary
tumors. Eur. J. Endocrinol. 157(6), 717–724 (2007). doi:157/6/717
18. I. Takumi, D.F. Steiner, N. Sanno, A. Teramoto, R.Y. Osamura,
Localization of prohormone convertases 1/3 and 2 in the human
pituitary gland and pituitary adenomas: analysis by immunohis-
tochemistry, immunoelectron microscopy, and laser scanning
microscopy. Mod. Pathol. 11(3), 232–238 (1998)
19. R.V. Lloyd, L. Jin, X. Qian, B.W. Scheithauer, W.F. Young Jr.,
D.H. Davis, Analysis of the chromogranin A post-translational
cleavage product pancreastatin and the prohormone convertases
PC2 and PC3 in normal and neoplastic human pituitaries. Am. J.
Pathol. 146(5), 1188–1198 (1995)

20. L. Scopsi, M. Gullo, F. Rilke, S. Martin, D.F. Steiner, Proprotein
convertases (PC1/PC3 and PC2) in normal and neoplastic human
tissues: their use as markers of neuroendocrine differentiation. J.
Clin. Endocrinol. Metab 80(1), 294–301 (1995). doi:10.1210/
jcem.80.1.7829629
21. A. Righi, L. Morandi, E. Leonardi, A. Farnedi, G. Marucci, A.
Sisto, G. Frank, M. Faustini-Fustini, M. Zoli, D. Mazzatenta, R.
Agati, M.P. Foschini, Galectin-3 expression in pituitary adenomas
as a marker of aggressive behavior. Hum. Pathol. 44(11),
2400–2409 (2013). doi:10.1016/j.humpath.2013.05.020
22. A. Righi, L. Jin, S. Zhang, G. Stilling, B.W. Scheithauer, K.
Kovacs, R.V. Lloyd, Identification and consequences of galectin-3
expression in pituitary tumors. Mol. Cell. Endocrinol. 326(1-2),
8–14 (2010). doi:10.1016/j.mce.2010.04.026
23. O. Mete, S.L. Asa, Clinicopathological correlations in pituitary
adenomas. Brain Pathol. 22(4), 443–453 (2012). doi:10.1111/
j.1750-3639.2012.00599.x
24. O. Mete, S.L. Asa, Therapeutic implications of accurate classifi-
cation of pituitary adenomas. Semin. Diagn. Pathol. 30(3),
158–164 (2013). doi:10.1053/j.semdp.2013.06.002
25. H. Nishioka, N. Inoshita, O. Mete, S.L. Asa, K. Hayashi,
A. Takeshita, N. Fukuhara, M. Yamaguchi-Okada, Y. Takeuchi,
S. Yamada, The complementary role of transcription factors in the
accurate diagnosis of clinically nonfunctioning pituitary adeno-
mas. Endocr. Pathol. 26(4), 349–355 (2015). doi:10.1007/s12022-
015-9398-z
26. H. Alahmadi, D. Lee, J.R. Wilson, C. Hayhurst, O. Mete, F.
Gentili, S.L. Asa, G. Zadeh, Clinical features of silent corticotroph
adenomas. Acta. Neurochir. (Wien.) 154(8), 1493–1498 (2012).
doi:10.1007/s00701-012-1378-1
27. M. Zoli, M. Faustini-Fustini, D. Mazzatenta, G. Marucci, E. De
Carlo, A. Bacci, E. Pasquini, G. Lanzino, G. Frank, ACTH ade-
nomas transforming their clinical expression: report of 5 cases.
Neurosurg. Focus 38(2), E15 (2015). doi:10.3171/2014.11.
FOCUS14679
28. G. Mustacchi, M.P. Sormani, P. Bruzzi, A. Gennari, F. Zanconati,
D. Bonifacio, A. Monzoni, L. Morandi, Identification and vali-
dation of a new set of five genes for prediction of risk in early
breast cancer. Int. J. Mol. Sci. 14(5), 9686–9702 (2013).
doi:10.3390/ijms14059686
29. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods 25(4), 402–408 (2001). doi:10.1006/meth.
2001.1262
30. S. Gibson, D.W. Ray, S.R. Crosby, T.L. Dornan, A.M. Jennings, J.S.
Bevan, J.R. Davis, A. White, Impaired processing of proopiomela-
nocortin in corticotroph macroadenomas. J. Clin. Endocrinol. Metab.
81(2), 497–502 (1996). doi:10.1210/jcem.81.2.8636257
31. M. Reincke, B. Allolio, W. Saeger, D. Kaulen, W. Winkelmann,
A pituitary adenoma secreting high molecular weight adreno-
corticotropin without evidence of Cushing’s disease. J. Clin.
Endocrinol. Metab. 65(6), 1296–1300 (1987). doi:10.1210/jcem-
65-6-1296
32. Lila, A.R., Sarathi, V., Bandgar, T.R., Shah, N.S.: Paradoxical
response to dexamethasone and spontaneous hypocortisolism in
Cushing’s disease. BMJ Case Rep. 2013 (2013). doi:10.1136/bcr-
2012-008035
33. R.D. Brown, G.R. Van Loon, D.N. Orth, G.W. Liddle, Cushing’s
disease with periodic hormonogenesis: one explanation for
Endocrine
paradoxical response to dexamethasone. J. Clin. Endocrinol.
Metab. 36(3), 445–451 (1973). doi:10.1210/jcem-36-3-445
34. V. Popovic, D. Micic, M. Nesovic, T. Howlett, I. Doniach, A.
Kendereski, P. Djordjevic, D. Manojlovic, J. Micic, M. Besser,
Cushing’s disease cycling over ten years. Exp. Clin. Endocrinol.
96(2), 143–148 (1990). doi:10.1055/s-0029-1211003
35. T. Miyoshi, F. Otsuka, J. Suzuki, K. Inagaki, M. Takeda, Y. Kano,
T. Yamashita, T. Ogura, I. Date, Y. Tanaka, K. Hashimoto, H.
Makino, Periodic secretion of adrenocorticotropin in a patient with
Cushing’s disease manifested during pregnancy. Endocr. J. 52(3),
287–292 (2005). doi:JST.JSTAGE/endocrj/52.287
36. S. Asano, H. Ooka, R. Okazaki, T. Ishikawa, H. Ochiai, M.
Nakashima, F. Ide, I. Hasegawa, S. Miyawaki, H. Nakaguchi, M.
Murakami, Y. Ogino, K. Takano, A. Matsuno, Long-term
remission of cyclic Cushing’s disease that was diagnosed and
treated surgically in non-active phase. Endocr. J. 54(3), 407–412
(2007). doi:JST.JSTAGE/endocrj/K06-218
37. V. Bonert, N. Bose, J.D. Carmichael, Cyclic Cushing’s disease
with misleading inferior petrosal sinus sampling results during a
trough phase. Neurosurg. Focus 38(2), E7 (2015). doi:10.3171/
2014.12.FOCUS14780
38. K.I. Alexandraki, G.A. Kaltsas, A.M. Isidori, S.A. Akker, W.M.
Drake, S.L. Chew, J.P. Monson, G.M. Besser, A.B. Grossman,
The prevalence and characteristic features of cyclicity and varia-
bility in Cushing’s disease. Eur. J. Endocrinol. 160(6), 1011–1018
(2009). doi:10.1530/EJE-09-0046
39. N.J. Vaughan, C.M. Laroche, I. Goodman, M.J. Davies, J.S.
Jenkins, Pituitary Cushing’s disease arising from a previously
non-functional corticotrophic chromophobe adenoma. Clin.
Endocrinol. (Oxf.) 22(2), 147–153 (1985)
40. Y. Kojima, S. Suzuki, K. Yamamura, G. Ohhashi, I. Yamamoto,
Comparison of ACTH secretion in Cushing’s adenoma and
clinically silent corticotroph adenoma by cell immunoblot assay.
Endocr. J. 49(3), 285–292 (2002)
41. A. Matsuno, R. Okazaki, Y. Oki, T. Nagashima, Secretion of
high-molecular-weight adrenocorticotropic hormone from a
pituitary adenoma in a patient without Cushing stigmata. J.
Neurosurg. 101(5), 874–877 (2004). doi:10.3171/jns.2004.
101.5.0874 Case report
42. M.E. Cooper, R.M. Murray, R. Kalnins, J. Woodward,
G. Jerums, The development of Cushing’s syndrome from a
previously silent pituitary tumour. Aust. N.Z. J. Med. 17(2),
249–251 (1987)
43. A.G. Lania, S. Ferrero, R. Pivonello, G. Mantovani, E. Peverelli,
A. Di Sarno, P. Beck-Peccoz, A. Spada, A. Colao, Evolution of an
aggressive prolactinoma into a growth hormone secreting pituitary
tumor coincident with GNAS gene mutation. J. Clin. Endocrinol.
Metab. 95(1), 13–17 (2010). doi:10.1210/jc.2009-1360
44. J. Hardy, M. Somma (eds.) Acromegaly. Surgical Treatment by
Transsphenoidal Microsurgical Removal of the Pituitary Ade-
noma. (Raven Press, New York), 1979) 209–217
45. C.B. Wilson, A decade of pituitary microsurgery. The Herbert
Olivecrona lecture. J. Neurosurg. 61(5), 814–833 (1984).
doi:10.3171/jns.1984.61.5.0814
46. DeLellis R.A., Lloyd R.V., Heitz P.U., Eng C. (eds.) World
Health Organization Classification of Tumors: Pathology and
Genetics: Tumors of Endocrine Organs. (2004)Please provide
name of publisher and place of publication in DeLellis et al.
(2004).