Mycopathologia (2020) 185:113–122

https://doi.org/10.1007/s11046-019-00344-9 (0123456789().,-volV)
( 01234567
89().,-volV)

ORIGINAL PAPER

Polyphasic Discrimination of Trichophyton tonsurans

and T. equinum from Humans and Horses
Hazal Kandemir . Karolina Dukik . Ferry Hagen . Macit Ilkit .
Yvonne Gräser . G. Sybren de Hoog

Received: 19 February 2019 / Accepted: 30 May 2019 / Published online: 5 July 2019
Ó Springer Nature B.V. 2019

Abstract The anthropophilic dermatophyte Tri-
chophyton tonsurans and its zoophilic counterpart
T. equinum are phylogenetically closely related. The
barcoding marker rDNA internal transcribed spacer
(ITS) shows limited variation between these two
species. In the current study, we combined molecular
approaches with phenotypic data to determine the
species boundaries between T. tonsurans (n = 52) and
The findings of the study were presented at the ISHAM
Workshop Onygenales, 28–29 June 2018, Amsterdam, The
Netherlands.
Handling Editor: Vishnu Chaturvedi.
Electronic supplementary material The online version of
this article (https://doi.org/10.1007/s11046-019-00344-9) con-
tains supplementary material, which is available to authorized
users.
T. equinum (n = 15) strains originating from humans
(n = 40), horses (n = 26), and a mouse (n = 1).
Culture characteristics and physiology on Trichophy-
ton agar media 1 and 5 were evaluated. Multi-locus
sequencing involving ITS, partial large rDNA subunit
(LSU), b-tubulin (TUB), 60S ribosomal protein (RPB),
and translation elongation factor-3 (TEF3) genes, and
the mating-type (MAT) locus was performed. Ampli-
fied fragment length polymorphism data were added.
None of the test results showed complete mutual
correspondence. With the exception of strains from
New Zealand, strains of equine origin required niacin
for growth, whereas most strains from human origin
did not show this dependence. It is concluded that
T. tonsurans and T. equinum incompletely diverged
from a common lineage relatively recently. MAT1-1

H. Kandemir  M. Ilkit (&) F. Hagen

Division of Mycology, Department of Microbiology, Department of Medical Microbiology, University Medical
Faculty of Medicine, University of Çukurova, Adana, Center Utrecht, Utrecht, The Netherlands
Turkey
e-mail: milkit@cu.edu.tr F. Hagen
Laboratory of Medical Mycology, Jining No. 1 People’s
H. Kandemir  G. S. de Hoog Hospital, Jining, Shandong, People’s Republic of China
Centre of Expertise in Mycology, Radboud University
Medical Centre/Canisius Wilhelmina Hospital, Nijmegen, Y. Gräser
The Netherlands Institute für Hygiene und Mikrobiologie der Charité,
Berlin, Germany
K. Dukik  F. Hagen  G. S. de Hoog (&)
Westerdijk Fungal Biodiversity Institute, Utrecht, The
Netherlands
e-mail: s.hoog@westerdijkinstitute.nl

123
114
and MAT1-2 are the main distinguishing genes
between the two species.
Keywords Amplified fragment length
polymorphism  Multi-locus sequencing 
Biodiversity  Mating type  Physiology  Trichophyton
Introduction
The taxonomy of dermatophytes has been dynami-
cally changing since 1841, when Robert Remak and
David Gruby initiated studies in this field [1, 2]. When
Raymond Sabouraud published the first comprehen-
sive work on dermatophytes and dermatophytosis, Les
teignes in 1910, clinical classification of dermato-
phytes was supplemented with culture and micro-
scopic characteristics. Later studies described the
nutritional and mating abilities of dermatophytes
[3–6]. Finally, recent molecular techniques have
provided a new framework for dermatophyte classi-
fication [7]. The molecular approach revealed that
anthropophilic dermatophytes are evolutionarily
recent, adapted to humans and domesticated animals,
and are highly similar. Consequently, some ambiguity
is associated with the taxonomic borders of anthro-
pophilic species and their counterparts in domesti-
cated hosts.
Trichophyton tonsurans Malmsten 1845 is an
anthropophilic dermatophyte that mainly causes tinea
capitis and, occasionally, tinea corporis. Outbreaks
with human-to-human transmission are observed, but
infection may also be asymptomatic with chronic and
minimal inflammation [8–10]. By contrast, the
zoophilic fungus Trichophyton equinum, first
described by Matruchot and Dassonville in 1898,
and by Louis Gedoelst in 1902, causes dermatophy-
tosis in horses [11, 12]. Human infections caused by
the zoophilic dermatophyte T. equinum tend to be
acute and inflammatory [13]. Many cases of
T. equinum show horse-to-horse [14, 15] or horse-to-
human transmission, the latter leading to an inflam-
matory response with kerion celsi [11, 16, 17]. How-
ever, no proven case of human-to-human transmission
of T. equinum has been documented. Likewise, the
incidence of human-to-horse transmission by either
dermatophyte species is not known.
123
Mycopathologia (2020) 185:113–122
Traditionally, clinical characteristics and nicotinic
acid (niacin) requirements have been used to differ-
entiate between T. tonsurans and T. equinum [18].
More recently, sequencing of the rDNA internal
transcribed spacer (ITS) was proposed as an additional
differentiating parameter [19, 20]. Since the virulence
of anthropophilic and zoophilic species is believed to
be different, species recognition at the molecular level
is essential. In the current study, we combined
molecular and phenotypic characteristics with the
detection of mating type to determine the taxonomic
boundaries between T. tonsurans that causes tinea
capitis in humans and T. equinum that inhabits the
horse skin. We also speculated on the evolutionary
fate of the dermatophyte after domestication of its
host.
Materials and Methods
Isolates
In the current study, 67 isolates from the reference
collection of the Centraalbureau voor Schimmelcul-
tures (CBS; housed at Westerdijk Fungal Biodiversity
Institute, Utrecht, The Netherlands) were analyzed.
They were originally identified as T. equinum (n = 15)
or T. tonsurans (n = 52); 26 strains carrying either of
the two Trichophyton species names were originated
from horse skin. All isolates were inoculated onto a
Sabouraud glucose agar (SGA; Merck, Darmstadt,
Germany) and incubated at 24 °C for 14 d before
further examination.
Physiology
Trichophyton agar media 1 and 5 (Thermo Fisher
Scientific, Waltham, MA) were used to evaluate
nicotinic acid requirement [3], and SGA was used as
a control medium. The plates were incubated at 24 °C
and dermatophyte growth monitored on days 7 and 14.
Cell growth rate and colony morphology (pigmenta-
tion) were recorded.
Mating
Mating was assayed in vitro on Medium E (12 g of
oatmeal agar, 1 g of MgSO47H2O, 1 g of KH2PO4,
1 g of NaNO3, and 16 g of agar/L) [21] and SGA
Mycopathologia (2020) 185:113–122
plates containing blond prepubertal hair [6]. Strains
were inoculated in pairs and incubated in the dark at
24 °C, unsealed, for 6 weeks. The presence of sexual
structures was then examined using light microscopy.
DNA Extraction and PCR
DNA was extracted using the cetyltrimethylammo-
nium bromide protocol [22]. The quantity and quality
of the isolated DNA were evaluated using a NanoDrop
ND-1000 spectrophotometer with the ND-1000 v3.3.0
software (Coleman Technologies, Wilmington, NC,
USA). Gene regions of interest were amplified as
follows: rDNA ITS was amplified using primers ITS4
and ITS5; the D1–D2 region of rDNA large subunit
(LSU) was amplified using primers LR0R and LR5;
partial b-tubulin gene (TUB) was amplified using
primers TUB2Fd and TUB4Fd; the 60S ribosomal
protein gene (RPB) was amplified using primers
AlGr52_412-433_F1 and Algr52_1102_1084_R1;
the translation elongation factor 3 gene (TEF3) was
amplified using primers Al50 ? 51_EF3_2900_F and
Al50 ? 51_EF3_3300_R [7, 23].
All PCR amplifications were performed in 12.5 lL
reaction volumes following a modified protocol by
Stielow et al. [24]. The reaction mixtures contained
1.5 lL of fungal DNA, 1.25 lL of PCR buffer (Takara,
Shiga, Japan), 1 lL of dNTP mix (1 mM stock;
Takara), 1 lL of dimethyl sulfoxide (Sigma-Aldrich,
Zwijndrecht, The Netherlands), 0.25 lL each of the
forward and reverse primers (10 mM stock), 0.06 lL
(5 U) of Taq polymerase (Takara), and 7.19 lL of
sterile distilled water. PCR products were visualized
on 1.5% agarose gels and cycle-sequenced using
Applied Biosystems BigDye Terminator version 3.1
(Thermo Fisher Scientific) [24] after purification from
the gel. Bidirectional sequencing was performed using
a capillary electrophoresis system (3730 9 l DNA
analyzer; Life Technologies, Carlsbad, CA, USA), and
the obtained sequences were manually edited and
deposited in the BioloMICS database [25]. The
obtained sequences were aligned using MAFFT
v6.850b [26]. Phylogenetic trees were generated using
MEGA6 software, employing the T92?G model for
LSU, K2 model for TUB and RPB, T92?I model for
ITS, and the K2?G?I model for TEF3.
The mating-type (MAT) locus was amplified using
the primers listed in Table 1. PCR amplification was
performed in a final 25 lL reaction volume, with 1 lL
115
of fungal DNA, 2.5 lL of 10 9 NH4 reaction buffer
(Bioline, London, United Kingdom), 1 lL of MgCl2
(50 mM; Bioline), 2.5 lL of dNTPs (1 mM; Bioline),
1.5 lL of dimethyl sulfoxide (Sigma-Aldrich), 1 lL
each of the forward and reverse primers (10 pmol), 1
lL of DNA polymerase (0.7 U/lL; Takara), and 13.5
lL of sterile distilled water. PCR products were
visualized on a 1.5% agarose gel.
Amplified Fragment Length Polymorphism
(AFLP)
AFLP analysis was performed using HpyCH4IV-C
(50 -FLU-GTAGACTGCGTACCCGTC-30 ) and MseI-
TGAG (50 -GATGAGTCCTGACTAATGAT-30 ) pri-
mers (New England Biolabs, Beverly, MA, USA) and
complementary adaptors as described previously [27].
One microliter of the 10 9 diluted amplicon was
added to a mixture of 8.9 lL water and 0.1 lL LIZ600
internal size marker (Promega, Leiden, The Nether-
lands). After the heating step for 1 min at 95 °C, raw
data were analyzed using Bionumerics v7.5 (Applied
Maths, Sint-Martens Latem, Belgium) and a dendro-
gram was generated using Arthroderma melis CBS
120.30 as an outgroup and by a UPGMA algorithm.
Statistics
All analyses were performed using the SPSS Statistics
version 20.0 statistical software package (IBM,
Armonk, NY, USA). Categorical variables were
expressed as numbers and percentages. A v2 test was
used to compare categorical variables between the
groups. The statistical level of significance for all tests
was set at 0.05.
Results
The current study included 40 strains from humans, 26
strains from horses, and one strain from a mouse. In
the CBS collection, 52 strains were identified as
T. tonsurans and 15 as T. equinum. Only two of the
T. equinum strains were isolated from humans, and 13
strains identified as T. tonsurans were isolated from
horses. According to the available geographical data,
the strains were mostly from Europe (n = 34), fol-
lowed by North America (n = 8), the Middle East
(n = 4), Asia (n = 3), and Australia (n = 3).
123
116 Mycopathologia (2020) 185:113–122

Table 1 MTL primers Primer name Primer sequence (50 –30 ) Size (bp) References
used in the study
MAT1-1F GCGAAGTCCAGGGTTGAATAG
MAT1-1R CGTCCACTACTGCTACCAAATC 460 This study
MAT1-2F GAGTGTGTGATCCCAGTCATAAT
MAT1-2R AAAGTTAGCGGAGAGTGGATAAG 413 This study
JOHE20887 CCTCTTCTACTGCCATGACA
JOHE20888 CCATGGGATTGATGTGTGCA 452 [28]
JOHE20893 GGATGAGTCCTGATATGTCA
JOHE20894 CCTATGGGTTTAGCTTCTGA 502 [28]
TmMATa1S CTCCCAGCCATCAACAAAAC
TmMATa1R GTTCACGCTGTCCTCGAATG 471 [29]
TmHMG1S CCTCTTGATATCTGATAAAC
TmHMG1R CAGATGGTTTTCTGGGAGCA 497 [29]

The reverse sides of colonies on SGA plates were
off-white (n = 20), pale yellow (n = 7), bright yellow
(n = 4), brown with yellow edges (n = 23), or brown
(n = 13) (Table 2). Twenty isolates from humans
formed pigmented colonies and 20 were unpigmented.
All horse isolates were pigmented, with the color
ranging from pale yellow to brown.
Twenty-five strains isolated from humans grew on
Trichophyton agars 1 and 5, whereas 11 strains grew
only on Trichophyton agar 5. All horse isolates grew
only on Trichophyton agar 5, except for three strains
from New Zealand, which grew on both the Tri-
chophyton media. The remaining four isolates did not
grow on the tested media.
Phylogenetic trees were constructed based on ITS
and partial LSU, TUB, RPB, and TEF3 sequences.
None of the five phylogenetic trees based on single
loci nor the multi-locus tree (Fig S1) unambiguously
separated T. tonsurans and T. equinum. In the ITS
region, 40 isolates (26 from horses and 14 from
humans) harbored a T single nucleotide polymorphism
(SNP) at position 18; all strains with a C-SNP at this
position were human isolates (n = 27) or the single
mouse isolate (Table 2).
PCR analysis of the MAT locus produced inconsis-
tent results in repeated amplifications using previously
published primer sets [28, 29]. Therefore, new primer
pairs were designed using the whole-genome data of
T. tonsurans CBS 112818 and T. equinum CBS 127.97
(http://www.broad.mit.edu/science/data). MAT1-2
was identified in 35 isolates and MAT1-1 in 32 isolates.
After 6 weeks of in vitro incubation, no sexual struc-
tures were observed on either of the two media
(Medium E or SGA). The AFLP analysis, alone or in
combination with the SNP and mating-type data, did
not unambiguously discriminate groups of strains with
different profiles (Fig. 1). The results are summarized
in Table 2.
When all parameters tested were compared, human
isolates harboring the ITS C-SNP exhibited the MAT1-
1 mating type and grew on both Trichophyton agar
media. The horse isolates harbored only the T-SNP,
exhibited the MAT1-2 mating type, and grew only on
Trichophyton agar 5. The three New Zealand isolates
were exceptional, as they grew on both Trichophyton
agars 1 and 5. Although none of the parameters was
diagnostic, statistically significant differences were
observed between strain origin and physiology on
Trichophyton agar, the SNP type, and mating type
(p \ 0.001). Similarly, the mating type and origin of
strains harboring different SNPs were significantly
different (p \ 0.001).
Discussion
The aim of the current study was to differentiate
between T. tonsurans and T. equinum using a
polyphasic approach. We show that the morphological
and physiological characteristics of strains conven-
tionally identified as T. tonsurans and T. equinum may
be identical and that the amplification of different loci
that are widely used to distinguish species is also
insufficient for unambiguous differentiation between
the two species. Nevertheless, the mating types were
found to correlate significantly with physiology and

123
Mycopathologia (2020) 185:113–122 117

Table 2 Strain data and combined results of the current study

Accession Original ID Final ID Origin SNP Physiology MAT Morphology Country
CBS 561.50 T. tonsurans T. tonsurans Human C - 1 Canada
CBS 112818 T. tonsurans T. tonsurans Human C - 1 Canada
CBS 112817 T. tonsurans T. tonsurans Human C - 1 Canada
CBS 130800 T. tonsurans T. tonsurans Human C - 1 Iran
CBS 498.48 T. tonsurans T. tonsurans Human C T1&T5 1 France
CBS 729.88 T. tonsurans T. tonsurans Human C T1&T5 1 France
CBS 120134 T. tonsurans T. tonsurans Human C T1&T5 1 Greece
CBS 120.65 T. tonsurans T. tonsurans Human C T1&T5 1 -
CBS 318.31 T. tonsurans T. tonsurans Human C T1&T5 1 -
CBS 130941 T. tonsurans T. tonsurans Human C T1&T5 1 -
CBS 171.65 T. tonsurans T. tonsurans Human C T1&T5 1 India
CBS 419.52 T. tonsurans T. tonsurans Human C T1&T5 1 Switzerland
CBS 120323 T. tonsurans T. tonsurans Human C T1&T5 1 Switzerland
CBS 164.45 T. tonsurans T. tonsurans Human C T1&T5 1 The Netherlands
CBS 385.68 T. tonsurans T. tonsurans Human C T1&T5 1 The Netherlands
CBS 455.61 T. tonsurans T. tonsurans Human C T1&T5 1 The Netherlands
CBS 459.59 T. tonsurans T. tonsurans Human C T1&T5 1 The Netherlands
CBS 375.49 T. tonsurans T. tonsurans Human C T1&T5 1 France
CBS 496.48 NT T. tonsurans T. tonsurans Human C T1&T5 1 France
CBS 132349 T. tonsurans T. tonsurans Human C T1&T5 1 Turkey
CBS 334.32 T. tonsurans T. tonsurans Human C T1&T5 1 -
CBS 118.65 T. tonsurans T. tonsurans Human C T1&T5 1 -

CBS 219.32 T. tonsurans T. tonsurans Human C T1&T5 1 -

CBS 238.33 T. tonsurans T. tonsurans Mouse C T1&T5 1 -
1410291240 T. tonsurans T. tonsurans Human C T1&T5 1 -
CBS 130924 T. tonsurans T. tonsurans Human C T5 1 Iran
CBS 132348 T. tonsurans T. tonsurans Human C T5 1 Turkey
CBS 141827 T. tonsurans T. tonsurans Human T T1&T5 1 China
CBS 131552 T. tonsurans T. tonsurans Human T T1&T5 1 -
CBS 129.35 T. tonsurans T. tonsurans Human T T1&T5 1 Japan
CBS 131549 T. tonsurans T. tonsurans Human T T1&T5 1 -
CBS 131557 T. tonsurans T. tonsurans Human T T1&T5 1 -
CBS 100080 T. equinum T. equinum Horse T T1&T5 2 New Zealand
CBS 634.82 T. equinum T. equinum Horse T T1&T5 2 New Zealand
CBS 635.82 T. equinum T. equinum Horse T T1&T5 2 New Zealand
CBS 112199 T. tonsurans T. equinum Horse T T5 2 United Kingdom
CBS 112200 T. tonsurans T. equinum Horse T T5 2 United Kingdom
CBS 112198 T. equinum T. equinum Human T T5 2 United Kingdom
CBS 112188 T. equinum T. equinum Horse T T5 2 United Kingdom
CBS 112194 T. tonsurans T. equinum Horse T T5 2 United Kingdom
CBS 112195 T. tonsurans T. equinum Horse T T5 2 United Kingdom
CBS 112192 T. tonsurans T. equinum Horse T T5 2 United Kingdom

123
118 Mycopathologia (2020) 185:113–122

Table 2 continued

Accession Original ID Final ID Origin SNP Physiology MAT Morphology Country

CBS 112197 T. tonsurans T. equinum Horse T T5 2 United Kingdom

CBS 112187 T. tonsurans T. equinum Human T T5 2 United Kingdom
CBS 112189 T. tonsurans T. equinum Human T T5 2 United Kingdom
CBS 112196 T. tonsurans T. equinum Human T T5 2 United Kingdom
CBS 112191 T. tonsurans T . equinum Human T T5 2 United Kingdom
CBS 112190 T. tonsurans T . equinum Horse T T5 2 United Kingdom
CBS 112193 T. equinum T . equinum Horse T T5 2 United Kingdom
CBS 112186 T. tonsurans T . equinum Human T T5 2 United Kingdom
CBS 112201 T. tonsurans T . equinum Human T T5 2 United Kingdom
CBS 182.76 T. tonsurans T . equinum Horse T T5 2 The Netherlands
CBS 244.84 T. tonsurans T . equinum Horse T T5 2 The Netherlands
CBS 292.81 T. equinum T . equinum Horse T T5 2 The Netherlands
CBS 856.71 T. tonsurans T . equinum Horse T T5 2 The Netherlands
CBS 127.97 T. tonsurans T . equinum Human T T5 2 The Netherlands
CBS 109035 T. equinum T . equinum Horse T T5 2 Canada
CBS 109033 T. tonsurans T . equinum Horse T T5 2 Canada
CBS 109034 T. tonsurans T . equinum Horse T T5 2 Canada
CBS 109036 T. equinum T. equinum Human T T5 2 Canada
CBS 295.76 T. tonsurans T . equinum Horse T T5 2 Croatia
IHEM15219 T. equinum T . equinum Horse T T5 2 Switzerland
CBS 270.66 NT T. equinum T . equinum Horse T T5 2 U.S.A.
IHEM20668 T. equinum T . equinum Horse T T5 2 -
IHEM20669 T. equinum T. equinum Horse T T5 2 -
IHEM15220 T. equinum T. equinum Horse T T5 2 -
1014897 T. equinum T. equinum Horse T T5 2 -
CBS, Centraalbureau voor Schimmelcultures at Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; IHEM; Institute for Hygiene and
Microbiology, Brussels, Belgium; NT, neotype.

ITS SNPs, suggesting that indeed two different species
are concerned.
Although morphological characteristics are a clas-
sical key parameter for identifying dermatophytes,
their diversity greatly exceeds the molecular genetic
diversity, as revealed in the present study. Colony
morphology and pigmentation may differ after serial
inoculation, and the physiological characteristics of
the same strain may vary. For example, T. tonsurans
CBS 318.31 analyzed in the present study grew on
Trichophyton agar media 1 and 5, whereas Gräser
et al. [30] reported that the same strain did not grow on
either medium after 4 weeks of incubation. One
possible reason for this difference could be the long-
term maintenance and repeated transfer of isolates in
culture collections, which might lead to degeneration
and pleomorphy.
Trichophyton agar media 1 and 5 test the assimi-
lation of casein and the requirement of niacin (nico-
tinic acid) for growth [3]. Horse hair contains niacin
and its precursors. Consequently, strains naturally
colonizing horse hair lack mechanisms for niacin
synthesis; these strains require exogenous niacin to
degrade the casein basal medium (Trichophyton agar
1). Conversely, niacin is absent from human hair, and
anthropophilic strains are autotrophic for this

123
Mycopathologia (2020) 185:113–122
Fig. 1 AFLP profiles of the strains together with the mating type, physiology, SNP, and origin data
compound [31]. Indeed, in the current study, all strains
isolated from horses required niacin, with the excep-
tion of three isolates from New Zealand (CBS 634.82,
CBS 635.82, and CBS 100080). The New Zealand
isolates have been described as a regional variant
autotrophicum of T. equinum [32]. Conversely, two
T. tonsurans showed Trichophyton agar 5
assimilation.
Nearly all strains with the MAT1-2 profile (97%)
formed pigmented colonies on SGA, whereas only
53% of strains with the MAT1-1 profile showed
pigmentation. In vitro mating experiments with
T. tonsurans and T. equinum strains, however, were
inconclusive. It is generally accepted that conven-
tional analyses, including colony morphology and
pigmentation, and physiological tests on Trichophyton
agars provide ecologically relevant data about strains
that cannot be unambiguously identified using molec-
ular markers alone [33]. In the present study, the
mating types within the T. tonsurans/T. equinum group
mostly showed phenotypic differences. The inability
to produce ascomata suggests that they have drifted
119
further away from each other than the T. benhamiae
mating types which are still able to produce ascomata
in vitro. The absence of full correspondence between
molecular and conventional markers of the T. ton-
surans and T. equinum strains demonstrates incom-
plete lineage sorting.
The current study indicates that differentiation of
T. tonsurans and T. equinum is not possible with 100%
confidence. Based on the findings of Summerbell et al.
[19], T. tonsurans harbors a C-SNP at ITS position 18
and 9 adenine bases starting at position 201, and
T. equinum harbors a T-SNP at position 18 and a series
of 9 adenine bases starting at position 201. The
researchers also suggested a third type as ‘‘T.
tonsurans DNA type 2’’ which shows T-SNP at ITS
position 18 and 11 adenine bases at starting position
201 [19]. In the present study, we showed that 48% of
strains originally identified as T. tonsurans harbor the
T-SNP at the same ITS position, but none of these
strains showed 11 adenine bases starting at position
201 except CBS 131557 (data not shown). The name
for these strains was kept as T. tonsurans according to
123
120
their physiology and mating-type profiles, and they
were thought to be isolated from humans in contact
with horses. Conversely, in addition to the SNPs,
insertions and/or repeats in the variable internal repeat
region of the non-transcribed spacer of rRNA could
provide clues to understand the inter- and intra-species
differences, and even the host preferences of T. ton-
surans and T. equinum strains, as suggested by Abdel-
Rahman et al. [34]. Indeed, the (GAT)n repeat in
T. equinum is highly variable but is fixed in T. ton-
surans, which suggests that a unique host niche may
exert a different selective pressure on this locus [34].
Strains from United Kingdom analyzed in the
current study were phenotypically and genetically
identical (i.e., the presence of T-SNP, MAT1-2 profile,
and niacin requirement) and matched with T. equinum.
This suggests a horse-associated phenotype; however,
these strains were derived from both humans and
horses. Hence, it may be concluded that human
patients were infected by strains of horse origin. The
strains were all MAT1-2 and otherwise corresponded
with T. equinum characteristics. Precise clinical data
are unfortunately not available, and the degree of
inflammation could not be verified. Human-to-human
transmission, particularly between wrestlers
[9, 10, 35], may lead to tinea capitis, erythematous-
scaly lesions, alopecia, black dots, and/or pustules or
present as a ‘‘carrier state,’’ here matching with
T. tonsurans (MAT1-1). The anthropophilic species
T. tonsurans triggers limited cytokine secretion that
leads to minimal inflammation, whereas the zoophilic
T. equinum is prone to causing inflammatory infection
in humans because it induces a broad spectrum of
cytokines [36]. Preuett et al. [37] reported that
T. tonsurans and T. equinum have different profiles
of secreted enzyme gene expression in vitro despite
their genetic similarity.
Geographically similar strains might be very
different [34]. For instance, in the current study,
strains from The Netherlands had different character-
istics: (1) strains from humans harbored the C-SNP,
MAT1-1 profile, and no niacin requirement (T. ton-
surans), whereas (2) strains from horses harbored the
T-SNP, MAT1-2 profile, and niacin requirement
(T. equinum; Table 2). Strains from Turkey showed
a similar diversity. Therefore, strains from a single
country can have different origins and transmission
routes, suggesting that two different species are
concerned.
123
Mycopathologia (2020) 185:113–122
The mating-type distribution in the analyzed set of
strains was almost even (MAT1-1, n = 32; MAT1-2,
n = 35). The tested characteristics overlapped
between the species identified as T. tonsurans and
T. equinum, and no clear border could be determined
using AFLP in the current study. Consistent with our
findings, a previous study showed that proteomic
differences between strains were greater than those
between species [38]. On the other hand, no successful
in vitro mating between opposite mating types was
observed in the current study to confirm conspeci-
ficity. One possible explanation is that the mating
conditions used were not optimal. Alternatively, one
could propose that the species are in an early state of
sympatric speciation, with incomplete lineage sorting
and a loss of ascoma formation. Of note, MAT1-1 was
almost always (97%) human-associated (T. tonsurans)
and MAT1-2 was always (100%) horse-associated
(T. equinum). The groups contain the neotypes of the
two species, CBS 496.48 and CBS 270.66, respec-
tively. The two mating types seem to drift toward
clonality as individual species, i.e., ‘‘clonal off-
shoots,’’ as defined by Gräser et al. [39].
Considering the lack of unambiguous differences
between the two species, it would be logical to regard
the MAT loci for defining the clonal species, with the
MAT1-1 profile referring to T. tonsurans and the
MAT1-2 profile referring to T. equinum, as also
suggested by earlier studies [21, 40]. The ITS profiles
in terms of the C/T SNPs at position 18 overlapped
with their respective mating profiles; consequently,
ITS diagnosis correctly identified the strains with 91%
confidence. Strains that require niacin, harbor the
T-SNP, and have the MAT1-2 profile can unambigu-
ously be classified as T. equinum, and strains that do
not require niacin, harbor the C-SNP, and have the
MAT1-1 profile should be classified as T. tonsurans.
The presented data support the hypothesis proposed by
Summerbell et al. [41] that T. tonsurans and T.
equinum might have evolved from a geophilic sexual
ancestor that might have switched host preference
such that one mating type adapted to humans and the
other mating type on horses at some point in evolu-
tionary history, and since the new hosts did not support
mating, is in the process of becoming asexual. Humans
as well as horses provide a smaller environmental
habitat than, for example, that available in the rodent-
associated terrestrial geophiles. During the adaptation
to larger hosts, phenotypic and genetic characteristics
Mycopathologia (2020) 185:113–122
can change, such that each lineage continues its own
evolutionary journey.
In conclusion, the evolution of T. tonsurans and
T. equinum must be relatively recent and the specia-
tion process might not yet be complete. The mating
types can be considered separate, clonal species
defined by combined characteristics and the preferred
host. Detecting the MAT loci by PCR is useful for the
unambiguous differentiation of T. tonsurans and
T. equinum, with ITS providing 91% confidence.
Acknowledgements HK was supported by a Grant from the
Federation of European Microbiological Societies (FEMS-RG-
2016-0067). The funders had no influence on the study design;
on the collection, analysis, and interpretation of data; on the
preparation of the manuscript; or the decision to publish.
Conflict of interest The authors report no conflicts of interest.
The authors alone are responsible for the content and the writing
of this paper.
Ethical Approval This article does not contain any studies
with human participants or animals performed by any of the
authors.
References
1. Gruby D. Mémoire sur une végétation qui constitue la vraie
teigne. C R Acad Sci. 1841;13:72–5.
2. Grzybowski A, Pietrzak K. Robert Remak (1815–1865):
discoverer of the fungal character of dermatophytoses. Clin
Dermatol. 2013;31(6):802–5.
3. Georg LK, Camp LB. Routine nutritional tests for the
identification of dermatophytes. J Bacteriol.
1957;74(2):113–21.
4. Dawson CO, Gentles JC. The perfect states of Keratino-
myces ajelloi Vanbreuseghem, Trichophyton terrestre
Durie and Frey and Microsporum nanum Fuentes.
Sabouraudia. 1961;1(1):49–57.
5. Stockdale PM. Nannizzia incurvata gen. nov., sp. nov., A
perfect state of Microsporum gypseum (Bodin) Guiart et
Grigorakis. Sabouraudia. 1961;1(1):41–8.
6. Ates A, Ozcan K, Ilkit M. Diagnostic value of morpholog-
ical, physiological and biochemical tests in distinguishing
Trichophyton rubrum from Trichophyton mentagrophytes
complex. Med Mycol. 2008;46(8):811–22.
7. de Hoog GS, Dukik K, Monod M, et al. Toward a novel
multilocus phylogenetic taxonomy for the dermatophytes.
Mycopathologia. 2017;182(1–2):5–31.
8. Gray RM, Champagne C, Waghorn D, Ong E, Grabczynska
SA, Morris J. Management of a Trichophyton tonsurans
outbreak in a day-care center. Pediatr Dermatol.
2015;32(1):91–6.
121
9. Ilkit M, Saracli MA, Kurdak H, et al. Clonal outbreak of
Trichophyton tonsurans tinea capitis gladiatorum among
wrestlers in Adana, Turkey. Med Mycol. 2010;48(3):480–5.
10. Ilkit M, Gümral R, Saraçlı MA, Burgut R. Trichophyton
tonsurans scalp carriage among wrestlers in a national
competition in Turkey. Mycopathologia.
2011;172(3):215–22.
11. Veraldi S, Genovese G, Peano A. Tinea corporis caused by
Trichophyton equinum in a rider and review of the literature.
Infection. 2018;46(1):135–7.
12. Gedoelst L. Les champignons parasites de l’homme et des
animaux domestiques. Lierre & Brussels: H. Lamertin,
1902:88–9.
13. Gräser Y, Monod M, Bouchara JP, et al. New insights in
dermatophyte research. Med Mycol. 2018;56(suppl. 1):2–9.
14. de Vries GA, Jitta CR. An epizootic in horses in the
Netherlands caused by Trichophyton equinum var. equinum.
Sabouraudia. 1973;11(2):137–9.
15. Stros K, Krivanec K, Komárek J, Malinský B. Occurrence of
an outbreak of horse dermatophytosis caused by the fungus
Trichophyton equinum. Vet Med (Praha).
1978;23(3):175–84.
16. Walker J. The dermatophytoses of Great Britain report of a
three years’ survey. Br J Dermatol Syph.
1950;62(6):239–51.
17. Shwayder T, Andreae M, Babel D. Trichophyton equinum
from riding bareback: first reported US case. J Am Acad
Dermatol. 1994;30(5 Pt. 1):785–7.
18. Woodgyer A. The curious adventures of Trichophyton
equinum in the realm of molecular biology: a modern fairy
tale. Med Mycol. 2004;42(5):397–403.
19. Summerbell RC, Moore MK, Starink-Willemse M, van
Iperen A. ITS barcodes for Trichophyton tonsurans and T.
equinum. Med Mycol. 2007;45(3):193–200.
20. Gräser Y, Scott J, Summerbell R. The new species concept
in dermatophytes-a polyphasic approach. Mycopathologia.
2008;166(5–6):239–56.
21. Weitzman I, Silva-Hutner M. Non-keratinous agar media as
substrates for the ascigerous state in certain members of the
Gymnoascaceae pathogenic for man and animals.
Sabouraudia. 1967;5(4):335–40.
22. Gerrits van den Ende AHG, de Hoog GS. Variability and
molecular diagnostics of the neurotropic species Clado-
phialophora bantiana. Stud Mycol. 1999;43:151–62.
23. Dukik K, Muñoz JF, Jiang Y, et al. Novel taxa of thermally
dimorphic systemic pathogens in the Ajellomycetaceae
(Onygenales). Mycoses. 2017;60(5):296–309.
24. Stielow JB, Levesque CA, Seifert KA, et al. One fungus,
which genes? Development and assessment of universal
primers for potential secondary fungal DNA barcodes.
Persoonia. 2015;35:242–63.
25. Vu TD, Eberhardt U, Szöke S, Groenewald M, Robert V. A
laboratory information management system for DNA bar-
coding workflows. Integr Biol (Camb). 2012;4(7):744–55.
26. Katoh K, Kuma K, Toh H, Miyata T. MAFFT version 5:
improvement in accuracy of multiple sequence alignment.
Nucleic Acids Res. 2005;33(2):511–8.
27. Kathuria S, Sharma C, Singh PK, et al. Molecular epi-
demiology and in vitro antifungal susceptibility of Asper-
gillus terreus species complex isolates in Delhi, India:
evidence of genetic diversity by amplified fragment length
123
122
polymorphism and microsatellite typing. PLoS ONE.
2015;10(3):e0118997.
28. Li W, Metin B, White TC, Heitman J. Organization and
evolutionary trajectory of the mating type (MAT) locus in
dermatophyte and dimorphic fungal pathogens. Eukaryot
Cell. 2010;9(1):46–58.
29. Kano R, Kawasaki M, Mochizuki T, Hiruma M, Hasegawa
A. Mating genes of the Trichophyton mentagrophytes
complex. Mycopathologia. 2012;173(2–3):103–12.
30. Gräser Y, Kuijpers AFA, Presber W, de Hoog GS. Molec-
ular taxonomy of Trichophyton mentagrophytes and T.
tonsurans. Med Mycol. 1999;37(5):315–30.
31. Georg LK, Kaplan W, Camp LB. Trichophyton equinum; a
re-evaluation of its taxonomic status. J Invest Dermatol.
1957;29(1):27–37.
32. Rebell G, Taplin D. Dermatophytes: their recognition and
identification. Coral Gables, FL; University of Miami Press:
1979. pp. 45–6;52–3.
33. Symoens F, Jousson O, Packeu A, et al. The dermatophyte
species Arthroderma benhamiae: intraspecies variability
and mating behaviour. J Med Microbiol. 2013;62(Pt
3):377–85.
34. Abdel-Rahman SM, Sugita T, González GM, et al. Diver-
gence among an international population of Trichophyton
tonsurans isolates. Mycopathologia. 2010;169(1):1–13.
35. Ergin S, Ergin C, Erdoğan BS, Kaleli I, Evliyaoğlu D. An
experience from an outbreak of tinea capitis gladiatorum
due to Trichophyton tonsurans. Clin Exp Dermatol.
2006;31(2):212–4.
123
Mycopathologia (2020) 185:113–122
36. Shiraki Y, Ishibashi Y, Hiruma M, Nishikawa A, Ikeda S.
Cytokine secretion profiles of human keratinocytes during
Trichophyton tonsurans and Arthroderma benhamiae
infections. J Med Microbiol. 2006;55(Pt 9):1175–85.
37. Preuett BL, Schuenemann E, Brown JT, Kovac ME,
Krishnan SK, Abdel-Rahman SM. Comparative analysis of
secreted enzymes between the anthropophilic-zoophilic
sister species Trichophyton tonsurans and Trichophyton
equinum. Fungal Biol. 2010;114(5–6):429–37.
38. Dukik K, Freeke J, Jamalian A, et al. Ultra-High-Resolution
Mass Spectrometry for identification of closely related
dermatophytes with different clinical predilections. J Clin
Microbiol. 2018;56(7):pii:e00102–18.
39. Gräser Y, de Hoog S, Summerbell RC. Dermatophytes:
recognizing species of clonal fungi. Med Mycol.
2006;44(3):199–209.
40. Hiruma J, Okubo M, Kano R, et al. Mating type gene (MAT)
and itraconazole susceptibility of Trichophyton tonsurans
strains isolated in Japan. Mycopathologia.
2016;181(5–6):441–4.
41. Summerbell R. Trichophyton, Microsporum, Epidermo-
phyton, and agents of superficial mycoses. In: Versalovic J,
Carroll K, Funke G, Jorgensen J, Landry M, Warnock D,
editors. Manual of Clinical Microbiology. 10th ed. Wash-
ington DC: ASM Press; 2011. p. 1919–42.
Publisher’s Note Springer Nature remains neutral with
regard to jurisdictional claims in published maps and
institutional affiliations.