ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2011, p. 703–712 Vol. 55, No.

2
0066-4804/11/$12.00 doi:10.1128/AAC.00788-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Molecular Analysis of Antimicrobial Resistance Mechanisms in

Neisseria gonorrhoeae Isolates from Ontario, Canada䌤
Vanessa G. Allen,1,2 David J. Farrell,1,2 Anuradha Rebbapragada,1,2 Jingyuan Tan,1 Nathalie Tijet,1
Stephen J. Perusini,1 Lynn Towns,1 Stephen Lo,1 Donald E. Low,1,2,3 and Roberto G. Melano1,2,3*
Ontario Agency for Health Protection and Promotion, Public Health Laboratory—Toronto,1 Department of Laboratory Medicine and
Pathobiology, University of Toronto,2 and Mount Sinai Hospital,3 Toronto, Ontario, Canada
Received 8 June 2010/Returned for modification 6 August 2010/Accepted 12 November 2010

Downloaded from http://aac.asm.org/ on October 22, 2018 by guest

Surveillance of gonococcal antimicrobial resistance and the molecular characterization of the mechanisms
underlying these resistance phenotypes are essential in order to establish correct empirical therapies, as well
as to describe the emergence of new mechanisms in local bacterial populations. To address these goals, 149
isolates were collected over a 1-month period (October-November 2008) at the Ontario Public Health Labo-
ratory, Toronto, Canada, and susceptibility profiles (8 antibiotics) were examined. Mutations in previously
identified targets or the presence of some enzymes related to resistance (r), nonsusceptibility (ns) (resistant
plus intermediate categories), or reduced susceptibility (rs) to the antibiotics tested were also studied. A
significant proportion of nonsusceptibility to penicillin (PEN) (89.2%), tetracycline (TET) (72.3%), ciprofloxa-
cin (CIP) (29%), and macrolides (erythromycin [ERY] and azithromycin; 22.3%) was found in these strains.
Multidrug resistance was observed in 18.8% of the collection. Although all the strains were susceptible to
spectinomycin and extended-spectrum cephalosporins (ESC) (ceftriaxone and cefixime), 9.4% of them dis-
played reduced susceptibility to extended-spectrum cephalosporins. PBP 2 mosaic structures were found in all
of these ESCrs isolates. Alterations in the mtrR promoter, MtrR repressor (TETr, PENns, ESCrs, and ERYns),
porin PIB (TETr and PENns), and ribosomal protein S10 (TETr) and double mutations in gyrA and parC
quinolone resistance-determining regions (QRDRs) (CIPr) were associated with and presumably responsible
for the resistance phenotypes observed. This is the first description of ESCrs in Canada. The detection of this
phenotype indicates a change in the epidemiology of this resistance and highlights the importance of continued
surveillance to preserve the last antimicrobial options available.

The reported incidence of gonococcal infections has in-
creased in Canada over the last 11 years (1997 to 2008), from
15 cases to 38 cases per 100,000 (41). Coupled with this in-
crease, antimicrobial resistance in Neisseria gonorrhoeae has
continued to emerge worldwide, limiting empirical treatment
regimens for the disease. Since the 1980s, a rapid rise in resis-
tance to penicillin (PEN) and tetracycline (TET) led to the
discontinuation of their use for the treatment of gonococcal
infections. More recently, the emergence of clinical isolates of
N. gonorrhoeae resistant to ciprofloxacin (CIP) has been re-
ported globally (2, 4, 13, 57, 58). During 2006, 28% of N.
gonorrhoeae isolates were resistant to ciprofloxacin in Ontario,
Canada (38). Clinical strains displaying intermediate suscepti-
bility or resistance to azithromycin (AZM) are now emerging
(9, 18, 19, 32, 40, 46, 60).
Extended-spectrum cephalosporins (ESC) (ceftriaxone and
cefixime) are recommended as the first-line treatment of gono-
coccal infections in Canada and the United States; azithromy-
cin, spectinomycin, and the fluoroquinolones are second-line
options (6, 7, 42). While resistance of N. gonorrhoeae to ex-
tended-spectrum cephalosporins has not been described, re-
duced susceptibility (ESCrs) has led to considerable concern,
particularly in Japan (24, 25, 28, 50, 59). Clinical failures as-
* Corresponding author. Mailing address: Ontario Agency for
Health Protection and Promotion, Public Health Laboratory Branch,
81 Resources Road, Toronto, ON, Canada M9P 3T1. Phone: (416)
235-6136. Fax: (416) 235-6281. E-mail: roberto.melano@oahpp.ca.
䌤
Published ahead of print on 22 November 2010.
sociated with reduced susceptibility to the extended-spectrum
cephalosporins have been described (1, 54).
Resistance to penicillin (PENr) in N. gonorrhoeae can be
mediated by the plasmid-encoded TEM-1 ␤-lactamase or by
mutations in chromosomal genes. A recent study summarizes
the stepwise transfer of PENr from a resistant to a susceptible
strain (62). In addition to reduced affinity of PBP 2, increased
efflux pump activity (MtrCDE, by mutations in the promoter
region or in its repressor, MtrR), and impermeability (outer
membrane proteins PIA and PIB), mutations in PBP 1 and
PilQ secretin have also been involved in the acquisition of
high-level chromosomally mediated PENr (44, 61). In addition
to these mutations, ESCrs strains have mosaic structures in the
transpeptidase-encoding domain of PBP 2 (3, 26, 27, 28, 35, 48,
56, 62). Some of these genetic modifications (derepressed ef-
flux and impermeability), as well as target mutations (ribo-
somal protein S10, encoded by the rpsJ gene), reduce the
susceptibility of the bacteria to tetracycline, whereas their com-
bination and/or the expression of the tet(M) gene confer high-
level TETr (21, 22, 33). Ciprofloxacin resistance in gonococci
has been attributed mainly to chromosomal mutations in the
target of the compound, in a region named the quinolone
resistance-determining region (QRDR) of the parC and gyrA
genes, which encode the ParC and GyrA subunits of topoisom-
erase IV and DNA gyrase, respectively (5, 51). Reduced intra-
cellular drug accumulation was also suggested for CIPr isolates
(49, 51). Spectinomycin resistance (SPTr) was associated with
point mutations in the 16S rRNA genes (20). There is limited
information describing the molecular bases of macrolide resis-

703
704 ALLEN ET AL.
tance in gonococci. Although macrolide resistance mediated by
ribosomal methylation or mutations has been described, in-
creased activity of the MtrCDE efflux pump is the most com-
mon mechanism responsible for the phenotype (8, 11, 12, 34,
43, 53, 55, 60).
Although the incidence of gonococcal infections is increas-
ing, the use of nucleic acid amplification testing reduced the
number of samples collected for culture, limiting the availabil-
ity of bacterial isolates for phenotypic studies (e.g., antimicro-
bial resistance testing). However, urgent monitoring of local
resistance patterns in N. gonorrhoeae and the underlying mech-
anisms is required to effectively guide treatment recommenda-
tions. Since there are no updated surveillance data about
antimicrobial resistance in N. gonorrhoeae from Ontario, Can-
ada, the objectives of this study were (i) to determine the
susceptibility profiles to all the relevant antigonococcal anti-
microbial agents in clinical strains isolated across the province
and (ii) to characterize the molecular mechanisms producing
resistance phenotypes. Particular attention was paid to those
conferring reduced susceptibility to extended-spectrum ceph-
alosporins and multidrug resistance (MDR). In addition, the
clonal relationship between these isolates was established.
(Preliminary data were presented in abstract form at the
18th International Society for Sexually Transmitted Diseases
Research/British Association of Sexual Health and HIV, Lon-
don, United Kingdom, 2009; the 26th International Congress
of Chemotherapy and Infection/Association of Medical Micro-
biology and Infectious Disease Canada-Canadian Association
for Clinical Microbiology and Infectious Diseases Annual Con-
ference, Toronto, ON, Canada, 2009; and the 50th Interscience
Conference on Antimicrobial Agents and Chemotherapy, Bos-
ton, MA, 2010.)
MATERIALS AND METHODS
Bacterial strains and antimicrobial susceptibility testing. The Ontario Public
Health Laboratories (PHL) serve as the provincial microbiological reference
service for the province of Ontario, Canada, with a population of 13,210,700 in
2010 (Census Canada [http://www40.statcan.gc.ca/l01/cst01/demo02a-eng.htm]).
PHL is the only laboratory in Ontario that provides routine clinical susceptibility
testing for culture isolates of N. gonorrhoeae. Considering that all private and
hospital laboratories across the province must submit all isolates of N. gonor-
hoeae to PHL for confirmation and susceptibility testing, a collection of clinical
isolates obtained during a 1-month period would be a representative sample of
N. gonorrhoeae cultures in Ontario. To accomplish this, all consecutive, unique
patient N. gonorrhoeae isolates received and confirmed from 15 October to 15
November 2008 at the PHL were included in this study (n ⫽ 149). Patient data
were not included because they are not routinely available at the PHL except on
a case-by-case basis. The collection size was chosen in order to provide a detailed
analysis of the common mechanisms of antibiotic resistance in N. gonorrhoeae
isolates throughout the province. Primary specimens and isolates received for
confirmation of N. gonorrhoeae were subcultured on New York City medium and
incubated for 24 to 72 h in 5% CO2 at 35 to 37°C. Gram stain, oxidase, and
carbohydrate utilization tests (glucose, maltose, sucrose, and O-nitrophenyl-␤-
D-galactopyranoside [ONPG]) were performed. Identification of N. gonorrhoeae
also included testing growth on blood agar at 22°C and on nutrient agar at
35.5°C. A GenProbe Accuprobe N. gonorrhoeae Culture Identification kit was
used as a second confirmatory method for N. gonorrhoeae. All isolates were
cultured on GC agar and 1% defined growth supplement (10) at 37°C in 5% CO2
for 20 to 24 h and stored at ⫺86°C. Each sample was subcultured twice before
antimicrobial testing and DNA extraction were performed. The MICs of peni-
cillin, ceftriaxone, cefixime, ciprofloxacin, tetracycline, erythromycin, and spec-
tinomycin were determined by the agar dilution method and Etest, according to
the Clinical and Laboratory Standards Institute guidelines (10). The MICs of
azithromycin were tested by Etest in all the isolates with reduced susceptibility to
erythromycin (ERYrs) (MICs ⱖ 2 ␮g/ml). N. gonorrhoeae ATCC 49226 and
ANTIMICROB. AGENTS CHEMOTHER.
strains F, G, K, L, N, O, and P of the 2008 WHO N. gonorrhoeae reference strain
panel were used as quality control strains (52). The presence of ␤-lactamase
activity was tested using nitrocefin.
Molecular studies. Previously described targets related to resistance or re-
duced susceptibility to the antimicrobials tested were studied (Table 1). DNA
extracts of each isolate were prepared by boiling a 1-␮l loop of each isolate in
lysis buffer (1% Triton X-100, 0.5% Tween 20, 1 mM EDTA, 10 mM Tris-HCl,
pH 8). After centrifugation, 2 ␮l of these supernatants was used per PCR. The
primers used for PCR amplification are detailed in Table 1. PCRs were per-
formed using standard conditions or conditions previously described (Table 1).
DNA samples were stored at ⫺20°C. All the amplicons were sequenced with the
same specific primers used for PCR under the BigDye terminator methodology
in a model 3130xl DNA sequence analyzer (Applied Biosystem/Perkin-Elmer,
Foster City, CA). The nucleotide and deduced amino acid sequences were
analyzed with the Vector NTI analysis software package (version 10.3.0; Invitro-
gen Corp.). Searches of sequences were performed with the BLAST program,
Downloaded from http://aac.asm.org/ on October 22, 2018 by guest
available at the National Center for Biotechnology Information website (http:
//www.ncbi.nim.nih.gov/). Multiple-sequence alignments were performed with
the ClustalX program, available at the European Bioinformatics Institute web-
site (http://www.ebi.ac.uk/).
N. gonorrhoeae multiantigen sequence typing (NG-MAST) was performed on
all isolates by sequencing internal fragments of two highly polymorphic loci,
porA/B and tbpB (31). The edited and trimmed sequences were uploaded into a
publicly accessible database on the NG-MAST website (http://www.ng-mast.net)
to obtain the allele number and the sequence type (ST).
Nucleotide sequence accession numbers. The PBP 2 nucleotide sequences
associated with reduced susceptibility to extended-spectrum cephalosporins
identified in this study have been deposited in the GenBank database under
accession numbers HQ204552 to HQ204565.
RESULTS AND DISCUSSION
The susceptibility profiles of 149 consecutive, nonduplicate
N. gonorrhoeae isolates, received and confirmed from 15 Oc-
tober to 15 November 2008 at the PHL, Toronto, Canada, are
presented in Table 2. MDR (defined as resistance to 3 or more
different antimicrobials; ERYrs was included in this definition)
was observed in 28 isolates (18.8%): 19 were resistant to 3
antimicrobials, and 9 were resistant to 4 of them (Fig. 1). While
all the strains were susceptible to spectinomycin, ceftriaxone,
and cefixime, 14 isolates demonstrated reduced susceptibility
to extended-spectrum cephalosporins, with MICs from 0.125 to
0.25 ␮g/ml.
Nonsusceptibility to penicillin (PENns) and ESCrs. PENr
was observed in 18 isolates (12.2%; MICs from 2 to 6 ␮g/ml).
However, 115 isolates (77.2%) displayed intermediate resis-
tance (0.12 to 1 ␮g/ml) (Table 2). Only 5 PENr isolates showed
penicillinase activity, and they displayed the highest MICs.
Seventeen out of 18 PENr isolates were also CIPr and TETr,
and 10 of them were also ERYrs. Reduced susceptibility to
extended-spectrum cephalosporins (ESCrs) was observed in 14
isolates (9.4%; MICs, 0.125 to 0.25 ␮g/ml for cefixime and
0.032 to 0.125 ␮g/ml for ceftriaxone); all of them were CIPr,
and most were TETr (13 isolates) and ERYrs (11 isolates), but
only 4 were PENr (9 with intermediate resistance to penicillin
[PENi]).
To characterize the molecular backgrounds of these pheno-
types, all the PENr and 12 PENi isolates (n ⫽ 30), as well as all
the ESCrs isolates (n ⫽ 14), were studied. Amino acid changes
deduced from the nucleotide sequences of ponA (PBP 1), penA
(PBP 2), porA/B (outer membrane proteins PIA and PIB), pilQ
(PilQ, a pilus secretin protein), and mtrR (MtrR, a transcrip-
tional repressor of the operon mtrCDE encoding an efflux
pump), as well as mutations in the mtrR promoter and the
presence of blaTEM-1, were analyzed (Tables 3 and 4).
VOL. 55, 2011 ANTIMICROBIAL RESISTANCE IN N. GONORRHOEAE, ONTARIO 705

TABLE 1. Primers used in this work

ATB affected Gene locus (activity) Primer Sequence (5⬘–3⬘) Reference

␤-Lactams blaTEM-1 (␤-lactamase) Tem1-F ATGAGTATTCAACATTTTCGTG This work

Tem1-R TTACCAATGCTTAATCAGTGAG
penA (PBP 2) penA-f CGTGATTGCGAAGGCATTGG 23
penA-r GTGCGTCAGTGCGGTATAGG
penA Compl-F ATGTTGATTAAAAGCGAATATAAG This work
penA Compl-R TTAAGACGGTGTTTTGACGGC
penA seq1 TCCTCGCATTGGTCAATACG
penA seq2 TAAACGGCTTCATGGCAGAAC
penA seq3 GCAAAGGTCAGGAAGGTTTG
penA seq4 CACATCCAAAGTAGGATAAAC
penA seq5 GTGCGGTAGATGGTTTCGA

Downloaded from http://aac.asm.org/ on October 22, 2018 by guest

penA seq6 CAAAGTTTTCCAAACCCAAG
ponA (PBP 1) PonA1-f GAGAAAATGGGGGAGGACCG
PonA1-r GGCTGCCGCATTGCCTGAAC

␤-Lactams and por IA/IB (outer membrane proteins Por-F CAAGAAGACCTCGGCAA 31

tetracycline PIA and B) Por-R CCGACAACCACTTGGT
pilQ (pilus secretin protein) pilQ-F CAAACAGCATTTCGCTGGTG This work
pilQ-R TCAATAGCGCAGGCTGTTG

␤-Lactams, tetracycline, mtrR-pr (MtrR promoter and ␣-helix MtrAF GCCAATCAACAGGCATTCTTA 23

macrolides encoded region) MtrAR GTTGGAACAACGCGTCAAAC

Tetracycline tet(M) (ribosome-protecting protein) Tet2 CCGAGCAGGGATTTCTCCAC

Tet1 ATCCTTTCTGGGCTTCCATTG
rpsJ (ribosomal protein S10) RPS-for GTGCTGTTGTAAAAGGCCCG
RPS-rev CGGCCGGCAAATCCAGCTTC

Fluoroquinolones gyrA (QRDR, gyrA subunit) Ng-gyrA-F TCCGCCACGACCACAAATTC This work

Ng-gyrA-R CTGCCAGCATTTCATGTGAG
parC (QRDR, parC subunit) Ng-parC-F GCCATGAGCGTGGTCAAAG
Ng-parC-R ACCGTCCCCTGATTGATTTC

Macrolides ereA (erythromycin esterases) ereAF AACACCCTGAACCCAAGGGACG 47

ereAR CTTCACATCCGGATTCGCTCGA
ereB (erythromycin esterases) ereBF AGAAATGGAGGTTCATACTTACCA
ereBR CATATAATCATCACCAATGGCA
mphA (macrolide 2⬘- mphAF AACTGTACGCACTTGC
phosphotransferase) mphAR GGTACTCTTCGTTACC
mefA/E (efflux pump) mefF AGTATCATTAATCACTAGTGC
mefR TTCTTCTGGTACTAAAAGTGG
ermC (ribosomal methylase) ErmCF TCAAAACATAATATAGATAAA
ErmCR GCTAATATTGTTTAAATCGTCAAT
ermA (ribosomal methylase) ErmAF TCTAAAAAGCATGTAAAAGAA
ErmAR CTTCGATAGTTTATTAATATTAGT
ermB (ribosomal methylase) ErmBF GAAAAGGTACTCAACCAAATA
ErmBR AGTAACGGTACTTAAATTGTTTAC
ermF (ribosomal methylase) ermF-F CGGGTCAGCACTTTACTATTG 43
ermF-R GGACCTACCTCATAGACAAG
23S rRNA (external specific NG23S1F GGCTATGAAGGCGGCGA This work
primers) NG23S2F TTCAGATGAGTAATGTACACC
NG23S3F CAATCCGCAAGTCTGCCGA
NG23S4F CTCTCCGATCCCGAACTCG
23S rRNA (internal common NG23SR GAAGATGTGCAAGCATCGGA
primer)
23S rRNA (nested PCR) NG23s1905-F ACGGTCCTAAGGTAGCGA
NG23s2769-R TCTCATCTTCAGGCGAGTT
rplD (riboprotein L4) NGL4-F CAGCGATGTTGTAGTTCGT
NGL4-R ACTCAAGTAATCTTGGCGC
rplV (riboprotein L22) NGL22-F TCAGCGACAATATGGTTGGT
NGL22-R AGCCCAGTCTTTAGTTACC

Molecular typing por IA/IB (outer membrane proteins Por-F CAAGAAGACCTCGGCAA 31

PIA and PIB) Por-R CCGACAACCACTTGGT
tbpB (␤-subunit transferrin-binding TbpB-F CGTTGTCGGCAGCGCGAAAAC
protein) TbpB-R TTCATCGGTGCGCTCGCCTTG
706 ALLEN ET AL. ANTIMICROB. AGENTS CHEMOTHER.

TABLE 2. In vitro activities of 7 antimicrobial agents against N. gonorrhoeae clinical isolates (n ⫽ 149)

Antimicrobial No. (%) of isolates MIC (␮g/ml)

agenta Resistant Intermediate Susceptible MIC50 MIC90 Range

PEN 18 (12.1) 115 (77.2) 16 (10.7) 0.25 2 ⱕ0.06–6

CFM 0 0 149 (100) ⱕ0.03 ⱕ0.03
CRO 0 0 149 (100) ⱕ0.03 ⱕ0.06
SPT 0 0 149 (100) ⱕ32 ⱕ32
CIP 42 (28.2) 2 (1.3) 105 (70.5) ⱕ0.06 ⬎0.5 ⱕ0.06–⬎32
TET 38 (25.5) 70 (47) 41 (27.5) 0.5 2 ⱕ0.25–64
ERYb ⫺b ⫺ 115 (77.2) ⱕ1 2 ⱕ1–2
a
CFM, cefixime; CRO, ceftriaxone.
b
Nonsusceptible, 34 (22.8%). There are no CLSI breakpoints for N. gonorrhoeae and macrolides; the criteria for ERY nonsusceptible include isolates with MICs of
ⱖ2 ␮g/ml.

Downloaded from http://aac.asm.org/ on October 22, 2018 by guest

Between the PENns and ESCrs isolates analyzed, no muta-
tions in the pilQ gene were found. blaTEM-1 was detected in
only 5 PENr isolates, but not in any ESCrs isolates. Most of the
PENns (n ⫽ 23) and 7 of the ESCrs isolates contained a single
amino acid change in PBP 1 (L421P), previously related to 3-
to 4-fold reduction in the rate of acylation of the enzyme to
␤-lactams (44). Single (position A121) and double (positions
G120 and A121) substitutions were observed in porins PIA and
PIB (Tables 3 and 4). Mutations in these two positions in-
creased resistance to penicillin and tetracycline (36). However,
additional mutations affecting the mtrR determinant are re-
quired for full PENr and TETr (37). MtrR represses the ex-
pression of the mtrCDE operon that encodes an efflux pump
member of the resistance-nodulation-division family. Amino
acid changes in MtrR (A39T, G45D, and the double mutant
A39T/R44H) were found in 2, 6, and 3 PENns isolates, respec-
tively, and 1 ESCrs isolate (G45D). These substitutions impede
the binding of MtrR to its DNA target, increasing the expres-
sion of the MtrCDE efflux pump (55). Similar effects (overex-
FIG. 1. Multidrug resistance observed in this study (including
ERYrs isolates).
pression of the efflux pump) were described in strains with
mutations in the mtrR promoter gene (29, 60). Nineteen out of
the 30 PENns and 12/14 ESCrs isolates showed a single adenine
deletion in the 13-bp inverted-repeat located in the mtrR pro-
moter gene; 2 PENi isolates and 1 ESCrs isolate with a single
thymine insertion in the promoter were detected. Mutations
affecting both the MtrR repressor and mtrR promoter were
observed in only 2 PENns and 1 ESCrs isolates.
PBP 2 remained wild type in 29 PENns isolates. A single
PENr isolate with multiple substitutions in penA in a mosaic-
like structure was found, but that isolate did not show ESCrs.
Most of the PENr isolates without penicillinase activity (n ⫽
13/18; MIC ⫽ 2 ␮g/ml) showed substitutions in PIB and PBP
1 and a 1-adenine deletion in the mtrR promoter (Table 3). Six
additional PENi isolates that were not TEM-1 producers har-
bored mutations affecting PBP 1, permeability, and efflux
pump expression, as well, suggesting that the combination of
these different mutations is responsible for the PENns pheno-
type. All isolates with ESCrs displayed a mosaic PBP 2 struc-
ture. Of these, 5 PBP 2 amino acid patterns were found, des-
ignated XXXIV to XXXVIII according to the nomenclature
used previously (Table 4 and Fig. 2) (25, 26, 27, 35, 48, 56).
Two of them were new PBP 2 mosaic types (XXXVII and
XXXVIII). The most common PBP 2 type found in this study
was the sequence pattern XXXVIII (9/13 isolates, 5 of them
belonging to ST3158). This PBP2 type was previously de-
scribed in the United States and is closely related to pattern
XXXII (1 substitution, L551P) (35, 39). The 14 ESCrs isolates
with PBP 2 mosaic structure mostly showed mutations in the
mtrR promoter gene, the porin PIB, and PBP 1 (Table 4),
supporting the association of these mutations with the reduced
susceptibility to cefixime and ceftriaxone previously described
by Lindberg et al. (27).
Resistance to TET. TETr was observed in 38 isolates
(25.5%, MICs from 2 to 64 ␮g/ml). Most of these TETr
isolates were CIPr (n ⫽ 32), and just 17 were PENr. As in the
case of penicillin, a high number of isolates (n ⫽ 70; 47%)
displayed intermediate resistance to the antibiotic (0.5 to 1
␮g/ml) (Table 2).
Seven isolates were positive for the tet(M) gene by PCR
(Table 5). The same mutations affecting PIA/B found in PENns
isolates were observed in TETr isolates (3 single mutants in
position A121 and 29 double mutants in positions G120/A121),
as well as amino acid changes in MtrR (2 A39T and 4 G45D
VOL. 55, 2011 ANTIMICROBIAL RESISTANCE IN N. GONORRHOEAE, ONTARIO 707

TABLE 3. Distribution of PENns N. gonorrhoeae isolates (n ⫽ 30)a

PBP-1 PBP-2 Porin PIB mtrR No. of isolatesc

MtrR PilQ TEM-1b
(ponA) (penA) (por IA/IB) promoter I R

L421P WT d
G120K, A121D Deletion A WT WT ⫺ 0 6
L421P WT A121G Deletion A WT WT ⫺ 2 2
L421P WT G120K, A121N Deletion A WT WT ⫺ 1 3
L421P WT G120K, A121D WT G45D WT ⫺ 3 0
WT WT WT Insertion T WT WT ⫺ 2 0
L421P WT G120D, A121G Deletion A G45D WT ⫹ 0 1
L421P WT G120K, A121G Deletion A WT WT ⫹ 0 1
L421P Mosaic G120K, A121N Deletion A WT WT ⫺ 0 1
L421P WT WT Deletion A G45D WT ⫺ 0 1
L421P WT WT Deletion A WT WT ⫺ 1 0
L421P WT G120D, A121G WT A39T WT ⫹ 0 1
⫹

Downloaded from http://aac.asm.org/ on October 22, 2018 by guest

WT WT A121G WT A39T, R44H WT 0 1
WT WT A121S WT A39T, R44H WT ⫺ 1 0
WT WT A121S WT A39T WT ⫹ 0 1
WT WT WT WT G45D WT ⫺ 1 0
WT WT WT WT A39T, R44H WT ⫺ 1 0

Total 12 18
a nS
PEN , isolates resistant or with intermediate resistance to penicillin based on amino acid alterations in PBP 1 and 2, porins PIA/B, the repressor MtrR, the secretin
PilQ, mutations in the mtrR promoter, and the presence of the ␤-lactamase TEM-1.
b
⫺, absent; ⫹, present.
c
I, intermediate resistance (MIC, 0.12 to 1 ␮g/ml); R, resistant (MIC, ⱖ2 ␮g/ml), according to CLSI breakpoints for PEN.
d
WT,wild type.

single mutants and 1 A39T/R44H double mutant). Twenty-
seven isolates with a single adenine deletion and 3 with a single
thymine insertion in the mtrR promoter gene were also de-
tected. Although mutations in porins PIA/B and the derepres-
sion of the MtrCDE efflux pump are common resistance mech-
anisms for both penicillin and tetracycline, only 17 out of 38
TETr isolates were PENr, as well. Most of these TETr isolates
showed single amino acid mutations in the ribosomal protein
S10 (V57M; n ⫽ 31). This substitution, which can specifically
reduce the affinity of tetracycline for its target, was described as
increasing the MIC of tetracycline 3- to 4-fold independently
of the bacterial genetic background (22). The combination of
mutations affecting the tetracycline target (ribosomal protein
S10), antibiotic influx (porins PIA/B), and efflux (derepression
of the MtrCDE efflux pump) are the most important mecha-
nisms of TETr in this collection.
Resistance to CIP. CIPr was observed in 42 isolates (28.2%,
MICs ranging from 3 to ⬎32 ␮g/ml) (Table 2). Just 2 isolates
presented intermediate MIC values (CIPi). Thirty-two out of
44 isolates (72.7%) were also TETr, and the remaining 12
isolates displayed a TETi phenotype. Just 17 isolates were also
PENr (38.6%), and the remainder were PENi. All 44 of these
isolates were studied at the molecular level.
The CIPr phenotype was mainly due to simultaneous chro-
mosomal mutations in gyrA and parC QRDRs (n ⫽ 39; 92.3%
of them were GyrAS91F-D95G ParCS87R) (Table 6). One CIPr
(MIC, 6 ␮g/ml) and 1 CIPi isolates presented a double muta-
tion in the gyrA QRDR (GyrAS91F-D95G), whereas the other
CIPi isolate was wild type for both genes. Unexpectedly, 2 CIPr
isolates (MICs, 12 and 32 ␮g/ml) were wild type for gyrA and
parC QRDRs, as well as the mtrR gene/promoter and the porin
PIB. These isolates remain under study.

TABLE 4. N. gonorrhoeae isolates with reduced susceptibility to CFM and CRO (n ⫽ 14)a
MIC (␮g/ml) PBP 1 PBP 2 mtrR No. of
Porin PIB (porB) MtrR ST
PEN CFM CRO (ponA) pattern promoter isolates

2 0.25 0.125 G120K, A121D L421P XXXIV Deletion A WT 225 1

2 0.25 0.125 WT L421P XXXVII Deletion A G45D 299 1
1 0.25 0.125 G120K, A121N WT XXXVIII Deletion A WT 3158 3
1 0.125 0.125 WT WT XXXV Deletion A WT 546 1
0.5 0.125 0.125 G120K, A121N WT XXXVI Deletion A WT 3596 1
1 0.125 0.063 G120K, A121N L421P XXXVIII Insertion T WT 3158 1
1 0.125 0.063 G120K, A121N L421P XXXVIII Deletion A WT 3158 1
2 0.125 0.063 G120K, A121N L421P XXXVIII Deletion A WT 3570 1
2 0.125 0.063 A121S L421P XXXVIII Deletion A WT 3116 1
1 0.125 0.063 G120K, A121N L421P XXXVIII Deletion A WT 3563 1
1 0.125 0.063 WT WT XXXIV WT WT 51 1
0.5 0.125 0.032 WT WT XXXVIII Deletion A WT 3553 1
a
Classified by ␤-lactam MICs, amino acid alterations in porin PIB, PBP 1 and 2, repressor MtrR and mutations in the mtrR promoter.
 Downloaded from http://aac.asm.org/ on October 22, 2018 by guest

FIG. 2. Deduced amino acid sequences of PBP 2 from 14 ESCrs N. gonorrhoeae isolates found in this study compared with the sequence from
the wild-type strain LM306 (GenBank accession no. M32091). Active sites are highlighted in gray. The numbers of isolates with each pattern are
shown in parentheses. The periods represent amino acid residues identical to those of LM306; the dashes are blanks. PBP 2 type XXXIV, GenBank
accession number ADE22248; XXXV, ZP_04719537; XXXVI, ZP_04723776.

708
VOL. 55, 2011 ANTIMICROBIAL RESISTANCE IN N. GONORRHOEAE, ONTARIO 709

TABLE 5. TETr N. gonorrhoeae isolates (n ⫽ 38)a

S10 Porins PIA/B mtrR No. of isolates with MIC (␮g/ml) of:
MtrR TetMb
(rpsJ) (por IA/IB) promoter 2 4 16 32 64

V57 M G120K, A121N Deletion A WT ⫺ 13 0 0 0 0

V57 M G120K, A121D Deletion A WT ⫺ 4 0 0 0 0
V57 M G120K, A121N Insertion T WT ⫺ 1 0 0 0 0
V57 M G120K, A121N Insertion T WT ⫹ 1 0 0 0 0
V57 M G120K, A121G Deletion A WT ⫹ 0 0 0 0 1
V57 M G120K, A121D WT G45D ⫺ 1 0 0 0 0
V57 M G120K, A121D Insertion T WT ⫺ 1 0 0 0 0
V57 M G120K, A121D Deletion A WT ⫹ 1 0 0 0 0
V57 M G120D, A121G WT A39T ⫹ 0 0 0 1 0
V57 M G120D, A121G Deletion A G45D ⫹ 0 0 1 0 0
V57 M A121S WT WT ⫺ 0 0 0 1 0
⫺

Downloaded from http://aac.asm.org/ on October 22, 2018 by guest

V57 M A121S Deletion A WT 1 0 0 0 0
V57 M A121G WT A39T ⫹ 0 0 0 1 0
V57 M WT WT A39T, R44H ⫺ 0 0 0 1 0
V57 M WT Deletion A G45D ⫺ 2 0 0 0 0
WT G120K, A121D Deletion A WT ⫺ 2 1 0 0 0
WT G120K, A121N Deletion A WT ⫺ 1 0 0 0 0
WT WT Deletion A WT ⫺ 1 0 0 0 0
WT WT WT WT ⫺ 1 0 0 0 0
WT WT WT WT ⫹ 0 0 1 0 0

Total 30 1 2 4 1
a
Classified by amino acid alterations in riboprotein S10, porins PIA/B, mutations in the mtrR promoter and repressor MtrR, and the presence of TetM. CLSI
breakpoints for TET: susceptible, ⱕ0.25 ␮g/ml; intermediate, 0.5 to 1 ␮g/ml; resistant, ⱖ2 ␮g/ml.
b
⫺, absent; ⫹, present.

Reduced susceptibility to macrolides. Thirty-four isolates
were identified with MICs of ⱖ2 ␮g/ml for ERY (22.8%).
These isolates were designated ERYrs (Table 2). Low azithro-
mycin MIC values (0.25 to 0.5 ␮g/ml) were observed in all the
ERYrs isolates (data not shown). However, considering the
European Committee of Antimicrobial Resistance Testing
breakpoints for azithromycin (susceptible, ⱕ0.25; resistant,
⬎0.5) and previous studies suggesting that MICs for azithro-
mycin of 0.25 to 1 ␮g/ml indicate reduced susceptibility to the
macrolide, all the ERYrs isolates were designated AZMrs, as
well (14, 15, 43, 60).
Three different mechanisms involved in macrolide resistance
were described in N. gonorrhoeae: efflux systems (30, 45), mod-
ification of the ribosomal target by methylases (43), and ribo-
somal modification by point mutations in the macrolide targets
(18, 19, 34). Here, the presence of 23S rRNA methylases
(ermA, ermB, ermC, and ermF genes), a plasmid-mediated ef-
flux pump (mefA/E genes), macrolide 2⬘-phosphotransferase
(mphA gene), ERY esterases (ereA and ereB genes), and pos-
sible mutations in the mtrR gene/promoter and riboproteins L4
and L22 (rplD and rplV genes) were tested in all the isolates
with ERYrs. Moreover, mutations in the 4 copies of the 23S
rRNA genes identified in N. gonorrhoeae were analyzed, as
well, using the strategy described by Farrell and colleagues (16,
17). Briefly, a common primer inside the 4 copies of the 23S
rRNA genes and specific external primers close to each of
them were designed from the complete N. gonorrhoeae
NCCP11945 genome (accession number NC_011035). Using
the amplicons obtained in these first PCRs as DNA templates,
nested PCRs were performed using common primers internal
to the 23S rRNA gene (including the peptidyltransferase loop
in domain V) to identify point mutations associated with mac-
rolide resistance (Table 1).
Of all the genes searched by PCR, only ermB was detected in
1 isolate. PCR and sequencing analyses did not detect muta-
tions in the riboproteins L4 and L22. A unique point mutation
(transition C2403U by N. gonorrhoeae numbering [C2417U by
E. coli numbering]) in domain V of the 23S ribosomal subunit

TABLE 6. CIPr/i N. gonorrhoeae isolates (n ⫽ 44)a

No. of isolates with MIC (␮g/ml) of:
ParC GyrA
0.25 0.5 3 4 6 8 12 16 24 32 ⬎32

S87R S91F, D95G 0 0 1 2 1 2 6 5 3 1 15

S87N, E91Q S91F, D95A/G 0 0 0 0 2 0 0 0 0 0 0
E91G S91F, D95A 0 0 1 0 0 0 0 0 0 0 0
WT S91F, D95A 1 0 0 0 1 0 0 0 0 0 0
WT WT 0 1 0 0 0 0 1 0 0 1 0

Total 1 1 2 2 4 2 7 5 3 2 15
a
Classified by amino acid alteration patterns in the QRDRs of ParC and GyrA subunits. CLSI breakpoints for CIP: susceptible, ⱕ0.6 ␮g/ml; intermediate, 0.12 to
0.5 ␮g/ml; resisstant, ⱖ1 ␮g/ml.
710 ALLEN ET AL.
TABLE 7. Classification of ERYrs N. gonorrhoeae
isolates (n ⫽ 34)a
mtrR
MtrR
promoter
Deletion A WT
Insertion T WT
WT G45D
WT A39T, R44H
WT WT
Total
a
Based on amino acid alterations in the MtrR repressor and mutations in the
mtrR promoter.
b
All isolates displayed MICs ⱖ 2 ␮g/ml.
was found in 6 isolates, 4 of them with the same mutation in 3
of the 4 copies of the 23S rRNA genes. However, this mutation
is located far from the positions where single mutations were
previously associated with macrolide resistance, suggesting
that it is not involved in the development of the ERYrs phe-
notype. Most of the ERYrs isolates had mutations in the mtrR
promoter (n ⫽ 29) or in MtrR (n ⫽ 3), suggesting that the
overexpression of the MtrCDE efflux pump was the most im-
portant macrolide resistance mechanism observed in this study
(Table 7). Two ERYrs isolates were wild type for all the genes
tested and remain under study.
NG-MAST typing. Based on the analysis of porA/B and tbpB
alleles, 98 different STs were obtained for all the isolates in-
cluded in this study, most of them (n ⫽ 73) represented by only
a single isolate. Fifty-six of these 98 STs (57%) were found to
be novel, indicating high genetic variability in the bacterial
collection studied. ST2 was the most prevalent (n ⫽ 12; 8.1%),
followed by ST51 (n ⫽ 6; 4%); ST3158 (n ⫽ 6; 4%); ST1105,
ST3550, and ST3554 (n ⫽ 4; 2.7%); ST25, ST576, and ST865
(n ⫽ 3; 2%); and another 16 different STs with 2 isolates each
(1.3%). However, all the STs represented by 3 or more isolates
(except ST3158 and ST3550 [see below]) were not related to
resistance to any antimicrobial. Thirty-one different STs were
related to MDR: 21 were associated with resistance to 3 anti-
microbials (9 STs were CIPr ERYrs TETr, 7 were PENr CIPr
TETr, and 5 were PENr CIPr ERYrs), and 10 were resistant to
4 antimicrobials (PENr CIPr TETr ERYrs). Because of the
high diversity of STs, no prevalent correlation between STs and
resistance phenotypes was evident. However, some STs were
clearly associated with MDR: 5/6 isolates with ST3158 (all CIPr
TETr ERYrs and ESCrs), 2/2 isolates with ST1407 (1 PENr
CIPr TETr ERYrs and 1 CIPr TETr ERYrs), and 2/4 isolates
with ST3550 (PENr CIPr TETr ERYrs). ST3158 and ST1407
are closely related, sharing the same tbpB allele (allele 110)
and just 2 point mutations of difference between their porA/B
alleles (allele 1914 for ST3158 and allele 908 for ST1407).
ST3550 is not related to ST3158 and ST1407.
Analyzing by alleles inside each ST, all 6 isolates harboring
porB allele 908 (2 isolates with ST1407 and 1 with ST3387,
ST3561, ST3587, and ST3588) were associated with resistance
to 2 or more different antimicrobials (5 of them displaying
MDR). A similar situation was observed in isolates harboring
porB allele 4 (9/11 isolates belonging to 6 different STs), allele
1914 (7/8 isolates from 4 different STs), and allele 1884 (5/6
isolates from 4 different STs). However, the tbpB alleles in
ANTIMICROB. AGENTS CHEMOTHER.
each ST were not related. On the other hand, 4/5 isolates
harboring tbpB allele 35 (1 isolate with ST546, ST1634,
No. of ST3551, and ST3570) were associated with resistance to 2 or
isolatesb more different antimicrobials (ST546 and ST3570 are closely
26 related, with 6 point mutations of difference between their
3 porA/B alleles). Resistance to 2 or more antimicrobials was
2 also observed in isolates harboring tbpB allele 49 (4/8 isolates
1 belonging to ST3550, ST3569, and ST3590; the first 2 are
2
closely related, with just 2 point mutations of difference be-
34 tween their porA/B alleles), allele 110 (8/14 isolates from
ST2569, ST3553, and the previously mentioned ST1407 and
ST3158), and allele 801 (2/2 isolates belonging to ST3561 and
ST3563, both closely related, with just 2 point mutations of
difference between their porA/B alleles).
Downloaded from http://aac.asm.org/ on October 22, 2018 by guest
Concluding remarks. Resistance to first-line antimicrobials
is continuously emerging in N. gonorrhoeae. Resistance to cip-
rofloxacin has been reported in different countries, with rates
leading to its discontinuation as the first-line option in gonor-
rhea therapy (e.g., 28% in Ontario, Canada) (38). This study
demonstrated high genetic variability in the gonococcal popu-
lation studied, with a significant proportion of N. gonorrhoeae
isolates from Ontario with nonsusceptibility (resistant plus in-
termediate categories) to penicillin (89.2%), tetracycline
(72.3%), ciprofloxacin (29%), and macrolides (22.3%). This is
the first description of reduced susceptibility to extended-spec-
trum cephalosporins in Canada, all of them associated with
PBP 2 mosaic structures. Alterations in the mtrR promoter,
MtrR repressor (PENns, TETr, and ERYns), the porin PIB
(PENns and TETr), and ribosomal protein S10 (TETr) and
double mutations in gyrA and parC QRDRs (CIPr) were asso-
ciated with and presumably responsible for the MDR pheno-
types observed. Resistance to extended-spectrum cephalospo-
rins, azithromycin, and spectinomycin were not detected, and
the drugs remain therapeutic options for gonorrhea treatment
in Ontario. However, the detection of reduced susceptibility to
extended-spectrum cephalosporins associated with a multidrug
resistance phenotype indicates a change in the epidemiology of
this resistance and highlights the importance of continued sur-
veillance to preserve the last antimicrobial options currently
available.
REFERENCES
1. Akasaka, S., et al. 2001. Emergence of cephems and aztreonam high-resis-
tant Neisseria gonorrhoeae that does not produce ␤-lactamase. J. Infect.
Chemother. 7:49–50.
2. Alcalá, B., et al. 2003. Molecular characterization of ciprofloxacin resistance
of gonococcal strains in Spain. Sex. Transm. Dis. 30:395–398.
3. Ameyama, S., et al. 2002. Mosaic-like structure of penicillin binding protein
2 gene (penA) in clinical isolates of Neisseria gonorrhoeae with reduced
susceptibility to cefixime. Antimicrob. Agents Chemother. 46:3744–3749.
4. Bala, M., K. Ray, and S. Kumari. 2003. Alarming increase in ciprofloxacin
and penicillin-resistant Neisseria gonorrhoeae isolates in New Delhi, India.
Sex. Transm. Dis. 30:523–525.
5. Belland, R. J., S. G. Morrison, C. Ison, and W. M. Huang. 1994. Neisseria
gonorrhoeae acquires mutations in analogous regions of gyrA and parC in
fluoroquinolone-resistant isolates. Mol. Microbiol. 14:371–380.
6. Centers for Disease Control and Prevention. 2006. Update to CDC’s sexually
transmitted diseases guidelines, 2006. MMWR Morb. Mortal. Wkly. Rep.
55:1–94. http://www.cdc.gov/std/treatment/2006/rr5511.pdf.
7. Centers for Disease Control and Prevention. 2007. Update to CDC’s sexually
transmitted diseases treatment guidelines, 2006: fluoroquinolones no longer
recommended for treatment of gonococcal infections. MMWR Morb.
Mortal. Wkly. Rep. 56:332–336. http://www.cdc.gov/std/treatment/2006
/GonUpdateApril2007.pdf.
8. Chen, P., et al. 2008. High prevalence of mutations in the quinolone resis-
tance-determining region and Mtrr loci in Neisseria gonorrhoeae isolated in a
tertiary hospital in Southern Taiwan, abstr. C2-3905. Abstr. 48th Intersci.
VOL. 55, 2011 ANTIMICROBIAL RESISTANCE IN N. GONORRHOEAE, ONTARIO
Conf. Antimicrob. Agents Chemother. American Society for Microbiology,
Washington, DC.
9. Chisholm, S. A., et al. 2009. Emergence of high-level azithromycin resistance
in Neisseria gonorrhoeae in England and Wales. J. Antimicrob. Chemother.
64:353–358.
10. Clinical and Laboratory Standards Institute. 2008. Performance standards
for antimicrobial susceptibility testing, 18th informational supplement. CLSI
document M100-S18. Clinical and Laboratory Standards Institute,
Wayne, PA.
11. Cousin, S., Jr., W. L. H. Whittington, and M. C. Roberts. 2003. Acquired
macrolide resistance genes in pathogenic Neisseria spp. isolated between
1940 and 1987. Antimicrob. Agents Chemother. 47:3877–3880.
12. Cousin, S., Jr., W. L. H. Whittington, and M. C. Roberts. 2003. Acquired
macrolide resistance genes and the 1 bp deletion in the mtrR promoter in
Neisseria gonorrhoeae. J. Antimicrob. Chemother. 51:131–133.
13. Dan, M., F. Poch, and B. Sheinberg. 2002. High prevalence of high-level
ciprofloxacin resistance in Neisseria gonorrhoeae in Tel Aviv, Israel: correla-
tion with response to therapy. Antimicrob. Agents Chemother. 46:1671–
1673.
14. Dillon, J. A., et al. 2001. Reduced susceptibility to azithromycin and high
percentages of penicillin and tetracycline resistance in Neisseria gonorrhoeae
isolates from Manaus, Brazil, 1998. Sex. Transm. Dis. 28:521–526.
15. European Committee on Antimicrobial Susceptibility Testing. 2009.
EUCAST clinical MIC breakpoints—macrolides (v1.4). http://www.srga.org
/eucastwt/MICTAB/MICmacrolides.html.
16. Farrell, D. J., et al. 2003. Macrolide resistance by ribosomal mutation in
clinical isolates of Streptococcus pneumoniae from the PROTEKT 1999–2000
study. Antimicrob. Agents Chemother. 47:1777–1783.
17. Farrell, D. J., J. Shackcloth, K. A. Barbadora, and M. D. Green. 2006.
Streptococcus pyogenes isolates with high-level macrolide resistance and re-
duced susceptibility to telithromycin associated with 23S rRNA mutations.
Antimicrob. Agents Chemother. 50:817–818.
18. Galarza, P. G., et al. 2009. Emergence of high level azithromycin-resistant
Neisseria gonorrhoeae strain isolated in Argentina. Sex. Transm. Dis. 36:787–
788.
19. Galarza, P. G., et al. 2010. New mutation in 23S rRNA gene associated with
high level of azithromycin resistance in Neisseria gonorrhoeae. Antimicrob.
Agents Chemother. 54:1652–1653.
20. Galimand, M., G. Gerbaud, and P. Courvalin. 2000. Spectinomycin resis-
tance in Neisseria spp. due to mutations in 16S rRNA. Antimicrob. Agents
Chemother. 44:1365–1366.
21. Gill, M. J., et al. 1998. Gonococcal resistance to beta-lactams and tetracy-
cline involves mutation in loop 3 of the porin encoded at the penB locus.
Antimicrob. Agents Chemother. 42:2799–2803.
22. Hu, M., S. Nandi, C. Davies, and R. A. Nicholas. 2005. High-level chromo-
somally mediated tetracycline resistance in Neisseria gonorrhoeae results
from a point mutation in the rpsJ gene encoding ribosomal protein S10 in
combination with the mtrR and penB resistance determinants. Antimicrob.
Agents Chemother. 49:4327–4334.
23. Ilina, E. N., et al. 2008. Relation between genetic markers of drug resistance
and susceptibility profile of clinical Neisseria gonorrhoeae strains. Antimi-
crob. Agents Chemother. 52:2175–2182.
24. Ito, M., et al. 2004. Remarkable increase in central Japan in 2001–2002 of
Neisseria gonorrhoeae isolates with decreased susceptibility to penicillin, tet-
racycline, oral cephalosporins, and fluoroquinolones. Antimicrob. Agents
Chemother. 48:3185–3187.
25. Ito, M., et al. 2005. Emergence and spread of Neisseria gonorrhoeae clinical
isolates harboring mosaic-like structure of penicillin-binding protein 2 in
central Japan. Antimicrob. Agents Chemother. 49:137–143.
26. Lee, S. G., et al. 2010. Various penA mutations together with mtrR, porB and
ponA mutations in Neisseria gonorrhoeae isolates with reduced susceptibility
to cefixime or ceftriaxone. J. Antimicrob. Chemother. 65:669–675.
27. Lindberg, R., H. Fredlund, R. Nicholas, and M. Unemo. 2007. Neisseria
gonorrhoeae isolates with reduced susceptibility to cefixime and ceftriaxone:
association with genetic polymorphisms in penA, mtrR, porB1b, and ponA.
Antimicrob. Agents Chemother. 51:2117–2122.
28. Lo, J. Y., et al. 2008. Ceftibuten resistance and treatment failure of Neisseria
gonorrhoeae infection. Antimicrob. Agents Chemother. 52:3564–3567.
29. Lucas, C. E., J. T. Balthazar, K. E. Hagman, and W. M. Shafer. 1997. The
MtrR repressor binds the DNA sequence between the mtrR and mtrC genes
of Neisseria gonorrhoeae. J. Bacteriol. 179:4123–4128.
30. Luna, V. A., S. Cousin, Jr., W. L. Whittington, and M. C. Roberts. 2000.
Identification of the conjugative mef gene in clinical Acinetobacter junii
and Neisseria gonorrhoeae isolates. Antimicrob. Agents Chemother. 44:2503–
2506.
31. Martin, I. M., C. A. Ison, D. M. Aanensen, K. A. Fenton, and B. G. Spratt.
2004. Rapid sequence-based identification of gonococcal transmission clus-
ters in a large metropolitan area. J. Infect. Dis. 189:1497–1505.
32. McLean, C. A., et al. 2004. The emergence of Neisseria gonorrhoeae with
decreased susceptibility to azithromycin in Kansas City, Missouri, 1999 to
2000. Sex. Transm. Dis. 31:73–78.
33. Morse, S. A., S. R. Johnson, J. W. Biddle, and M. C. Roberts. 1986. High-
711
level tetracycline resistance in Neisseria gonorrhoeae is the result of acquisi-
tion of streptococcal tetM determinant. Antimicrob. Agents Chemother.
30:664–670.
34. Ng, L. K., I. Martin, G. Liu, and L. Bryden. 2002. Mutations in 23S rRNA
associated with macrolide resistance in Neisseria gonorrhoeae. Antimicrob.
Agents Chemother. 46:3020–3025.
35. Ohnishi, M., et al. 2010. Spread of a chromosomal cefixime-resistant penA
gene among different Neisseria gonorrhoeae lineages. Antimicrob. Agents
Chemother. 54:1060–1067.
36. Olesky, M., M. Hobbs, and R. A. Nicholas. 2002. Identification and analysis
of amino acid mutations in porin IB that mediate intermediate-level resis-
tance to penicillin and tetracycline in Neisseria gonorrhoeae. Antimicrob.
Agents Chemother. 46:2811–2820.
37. Olesky, M., R. L. Rosenberg, and R. A. Nicholas. 2006. Porin-mediated antibi-
otic resistance in Neisseria gonorrhoeae: ion, solute, and antibiotic permeation
through PIB proteins with penB mutations. J. Bacteriol. 188:2300–2308.
38. Ota, K. V., et al. 2009. Prevalence of and risk factors for quinolone-resistant
Neisseria gonorrhoeae infection in Ontario. CMAJ 180:287–290.
Downloaded from http://aac.asm.org/ on October 22, 2018 by guest
39. Pandori, M., et al. 2009. Mosaic penicillin-binding protein 2 in Neisseria
gonorrhoeae isolates collected in 2008 in San Francisco, California. Antimi-
crob. Agents Chemother. 53:4032–4034.
40. Palmer, H. M., H. Young, A. Winter, and J. Dave. 2008. Emergence and
spread of azithromycin-resistant Neisseria gonorrhoeae in Scotland. J. Anti-
microb. Chemother. 624:490–494.
41. Public Health Agency of Canada. 2008. Reported cases of notifiable STI from
January 1 to December 31, 2007 and January 1 to December 31, 2008 and
corresponding rates for 2007 and 2008. The Agency, Ottawa, Canada. http:
//origin.qa.phac-aspc.gc.ca/std-mts/stdcases-casmts/cases-cas-08-eng.php.
42. Public Health Agency of Canada. 2008. Gonococcal infections. The
Agency, Ottawa, Canada. http://www.phac-aspc.gc.ca/std-mts/sti_2006
/pdf/506_Gonococcal_Infections.pdf.
43. Roberts, M. C., et al. 1999. Erythromycin-resistant Neisseria gonorrhoeae and
oral commensal Neisseria spp. carry known rRNA methylase genes. Antimi-
crob. Agents Chemother. 43:1367–1372.
44. Ropp, P. A., M. Hu, M. Olesky, and R. A. Nicholas. 2002. Mutations in ponA,
the gene encoding penicillin-binding protein 1, and a novel locus, penC, are
required for high-level chromosomally mediated penicillin resistance in Neis-
seria gonorrhoeae. Antimicrob. Agents Chemother. 46:769–777.
45. Shafer, W. M., et al. 2001. Genetic organization and regulation of antimi-
crobial efflux systems possessed by Neisseria gonorrhoeae and Neisseria men-
ingitidis. J. Mol. Microbiol. Biotechnol. 3:219–224.
46. Starnino, S., and P. Stefanelli on behalf of the Neisseria gonorrhoeae Italian
Study Group. 2009. Azithromycin-resistant Neisseria gonorrhoeae strains re-
cently isolated in Italy. J. Antimicrob. Chemother. 63:1200–1204.
47. Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection
of erythromycin-resistant determinants by PCR. Antimicrob. Agents Che-
mother. 40:2562–2566.
48. Takahata, S., N. Senju, Y. Osaki, T. Yoshida, and T. Ida. 2006. Amino acid
substitutions in mosaic penicillin-binding protein 2 associated with reduced
susceptibility to cefixime in clinical isolates of Neisseria gonorrhoeae. Anti-
microb. Agents Chemother. 50:3638–3645.
49. Tanaka, M., et al. 1998. Analysis of quinolone resistance mechanisms in
Neisseria gonorrhoeae isolates in vitro. Sex. Transm. Dis. 74:59–62.
50. Tapsall, J. W. 2009. Neisseria gonorrhoeae and emerging resistance to ex-
tended spectrum cephalosporins. Curr. Opin. Infect. Dis. 22:87–91.
51. Trees, D. L., et al. 1999. Alterations within the quinolone resistance-deter-
mining regions of GyrA and ParC of Neisseria gonorrhoeae isolated in the Far
East and the United States. Int. J. Antimicrob. Agents 12:325–332.
52. Unemo, M., O. Fasth, H. Fredlund, A. Limnios, and J. Tapsall. 2009. Phenotypic
and genetic characterization of the 2008 WHO Neisseria gonorrhoeae refer-
ence strain panel intended for global quality assurance and quality control of
gonococcal antimicrobial resistance surveillance for public health purposes.
J. Antimicrob. Chemother. 63:1142–1151.
53. Wang, G. E., and D. E. Taylor. 1998. Site-specific mutations in the 23S rRNA
gene of Helicobacter pylori confer two types of resistance to macrolide-
lincosamide-streptogramin B antibiotics. Antimicrob. Agents Chemother.
42:1952–1958.
54. Wang, S. A., et al. 2003. Multidrug-resistant Neisseria gonorrhoeae with de-
creased susceptibility to cefixime—Hawaii, 2001. Clin. Infect. Dis. 15:849–852.
55. Warner, D. M., W. M. Shafer, and A. E. Jerse. 2008. Clinically relevant
mutations that cause derepression of the Neisseria gonorrhoeae MtrC-MtrD-
MtrE efflux pump system confer different levels of antimicrobial resistance
and in vivo fitness. Mol. Microbiol. 70:462–478.
56. Whiley, D. M., E. A. Limnios, S. Ray, T. P. Sloots, and J. W. Tapsall. 2007.
Diversity of penA alterations and subtypes in Neisseria gonorrhoeae strains
from Sydney, Australia, that are less susceptible to ceftriaxone. Antimicrob.
Agents Chemother. 51:3111–3116.
57. World Health Organization. 2003. Surveillance of antibiotic resistance in
Neisseria gonorrhoeae in the WHO Western Pacific Region, 2002. Commun.
Dis. Intell. 27:488–491.
58. World Health Organization. 2004. Increases in fluoroquinolone-resistant
Neisseria gonorrhoeae among men who have sex with men—United States,
712 ALLEN ET AL.
2003, and revised recommendations for gonorrhea treatment. MMWR
Morb. Mortal. Wkly. Rep. 53:335–338.
59. Yokoi, S., et al. 2007. Threat to cefixime treatment for gonorrhea. Emerg.
Infect. Dis. 13:1275–1277.
60. Zarantonelli, L., G. Borthagaray, E. Lee, and W. M. Shafer. 1999. Decreased
azithromycin susceptibility of Neisseria gonorrhoeae due to mtrR mutations.
Antimicrob. Agents Chemother. 43:2468–2472.
ANTIMICROB. AGENTS CHEMOTHER.
61. Zhao, S., D. M. Tabiason, M. Hu, H. S. Seifert, and R. A. Nicholas. 2005. The
penC mutation conferring antibiotic resistance in Neisseria gonorrhoeae arises
from a mutation in the PilQ secretin that interferes with multimer stability.
Mol. Microbiol. 57:1238–1251.
62. Zhao, S., et al. 2009. Genetics of chromosomally mediated intermediate
resistance to ceftriaxone and cefixime in Neisseria gonorrhoeae. Antimicrob.
Agents Chemother. 53:3744–3751.
Downloaded from http://aac.asm.org/ on October 22, 2018 by guest
 ERRATUM
Molecular Analysis of Antimicrobial Resistance Mechanisms in
Neisseria gonorrhoeae Isolates from Ontario, Canada
Vanessa G. Allen, David J. Farrell, Anuradha Rebbapragada, Jingyuan Tan, Nathalie Tijet, Stephen J. Perusini, Lynn Towns,
Stephen Lo, Donald E. Low, and Roberto G. Melano
‹Ontario Agency for Health Protection and Promotion, Public Health Laboratory—Toronto, Department of Laboratory Medicine and Pathobiology, University of Toronto,
and Mount Sinai Hospital, Toronto, Ontario, Canada

Volume 55, no. 2, p 703–712, 2011. Page 707: the “PBP 2 pattern” column of Table 4 is incorrect and should appear as shown below.

TABLE 4 N. gonorrhoeae isolates with reduced susceptibility to CFM and CRO (n ⫽ 14)a
MIC (␮g/ml)
No. of
PEN CFM CRO Porin PIB (porB) PBP 1 (ponA) PBP 2 pattern mtrR promoter MtrR ST isolates
2 0.25 0.125 G120K, A121D L421P XXXVI Deletion A WT 225 1
2 0.25 0.125 WT L421P XXXV Deletion A G45D 299 1
1 0.25 0.125 G120K, A121N WT XXXIV Deletion A WT 3158 3
1 0.125 0.125 WT WT XXXVII Deletion A WT 546 1
0.5 0.125 0.125 G120K, A121N WT XXXVIII Deletion A WT 3596 1
1 0.125 0.063 G120K, A121N L421P XXXIV Insertion T WT 3158 1
1 0.125 0.063 G120K, A121N L421P XXXIV Deletion A WT 3158 1
2 0.125 0.063 G120K, A121N L421P XXXIV Deletion A WT 3570 1
2 0.125 0.063 A121S L421P XXXIV Deletion A WT 3116 1
1 0.125 0.063 G120K, A121N L421P XXXIV Deletion A WT 3563 1
1 0.125 0.063 WT WT XXXVI WT WT 51 1
0.5 0.125 0.032 WT WT XXXIV Deletion A WT 3553 1
a
Classified by ␤-lactam MICs, amino acid alterations in porin PIB, PBP 1 and 2, repressor MtrR and mutations in the mtrR promoter.

Page 706, right column, line 24: “The most common PBP 2 type found in this study was the sequence pattern XXXVIII (9/13 isolates,
5 of them belonging to ST3158)” should read “The most common PBP 2 type found in this study was the sequence pattern XXXIV (9/14
isolates, 5 of them belonging to ST3158).”
Page 708, Figure 2: in the upper left portion of the figure, the PBP 2 patterns and numbers of isolates should be XXXIV (9), XXXV (1),
XXXVI (2), XXXVII (1), and XXXVIII (1).

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AAC.02458-13

632 aac.asm.org Antimicrobial Agents and Chemotherapy p. 632 January 2014 Volume 58 Number 1