Journal of Infection and Public Health 11 (2018) 314–320

Contents lists available at ScienceDirect

Journal of Infection and Public Health

journal homepage: http://www.elsevier.com/locate/jiph

Molecular characterization of lower vaginal swabs for Human

papilloma virus in association with Chlamydia trachomatis infection in
Cameroonian Women
Pythagore Fogue a,1 , Geraldo Djeudong b,1 , George Bouting b , Elom Aglago c ,
Gustave Simo a,∗ , Smiths Lueong a,∗
a
Molecular Parasitology and Entomology Unit (MPEU), Department of Biochemistry, University of Dschang, BP 67, Dschang, Cameroon
b
Biochemistry Laboratory, Dschang District Hospital, P.O Box 43, Dschang, Cameroon
c
Joint Unit of Research URAC 39, Ibn Tofail University—CNESTEN, Rabat, Morocco

a r t i c l e i n f o a b s t r a c t

Article history: Human papilloma virus (HPV) infection is an etiological factor for cervical cancer development and
Received 10 November 2016 Chlamydia trachomatis (Ct) is considered as a cofactor. Understanding the dynamics of HPV and Ct
Received in revised form 10 August 2017 infection could help to explain the incidence of early onset of cervical cancer (CC) observed in Cameroon.
Accepted 14 August 2017
Lower vaginal swabs and sera from sexually active women were analyzed for HPV and Ct infection in
association with risk factors. Questionnaires were used to document patients’ lifestyle and risk factors.
Keywords:
A total of 206 women participated in the study average 28.1 ± 8 years (16–50 years). HPV prevalence
HPV
was 23.3% with subtypes 16 and 18 at respectively 2.9% and 1%. Ct infection totalised 40.8%, of which
Chlamydia trachomatis
Risk factor
23.8% were HPV- Ct co-infections. HPV infection was inversely associated with age (p = 0.028). We found
Co-infection a positive association between Ct infection and the number of sex partners (p = 0.012) and a negative
Cervical cancer association with parity (p = 0.032). There was no significant association between HPV and Ct infections.
Cameroon High rates of HPV and Ct infections could be an indicator of cervical cancer risk in the near future.
There is therefore an urgent need for sensitization as well as implementation of appropriate preventive
measures.
© 2017 The Authors. Published by Elsevier Limited on behalf of King Saud Bin Abdulaziz University
for Health Sciences. This is an open access article under the CC BY-NC-ND license (http://
creativecommons.org/licenses/by-nc-nd/4.0/).

Introduction
Human papilloma viruses (HPV) infections are among the most
prevalent sexually transmitted infections in men and women in
developing countries [1]. Meanwhile several HPV subtypes are
known, a subset is highly associated with risk of cervical cancer
development [2,3]. Recent estimates indicate that worldwide bur-
den of HPV infections stands between 11% and 12% with large
geographical differences. The highest incidence rates are observed
in sub-Saharan Africa (24%), Eastern Europe (21%) and Latin Amer-
ica (16%) [4]. Of all HPV subtypes, HPV 16 and 18 are the most
prevalent high risk subtypes with global incidence rates of 3.2% and
1.4% respectively [5]. The carcinogenicity of HPV has been defini-
tively established for six human cancers (cervical, penis, vulva,
∗ Corresponding authors.
E-mail addresses: gsimoca@yahoo.fr (G. Simo), lueong@live.fr (S. Lueong).
1
These authors contributed equally and should be considered as first authors.
vagina, anus and oropharynx), and of the 12.7 million human
cancers reported in 2012, some 610,000 cases could clearly be
attributed to HPV infection [4]. The numbers differ for different geo-
graphical regions, and are directly related to development index.
For example, the HPV-attributable fraction of human cancers in
sub-Saharan Africa is estimated to be around 14.2%, 15.4% in India
and about 1.6% in North America [4]. Considering the lack of ade-
quate and systematic HPV screening and vaccination programs in
most less developed regions, the numbers could be even higher.
HPV is therefore a clear public health problem in most develop-
ing regions and despite the lack of reliable epidemiological data, its
health impact is by no means minimised.
Chlamydia trachomatis (Ct) on the other hand, is a major
co-factor for HPV-driven cervical cancer and is known to be respon-
sible for other diseases such as chronic inflammatory diseases
[6]. According to recent reports, the global burden of CT infec-
tion is about 4.2% in women and 2.7% in men, representing some
130 million annual new cases [7]. Of the world Ct burden, more
than two thirds occur in developing countries, with above 80%

https://doi.org/10.1016/j.jiph.2017.08.010
1876-0341/© 2017 The Authors. Published by Elsevier Limited on behalf of King Saud Bin Abdulaziz University for Health Sciences. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320
of cases remaining asymptomatic. Based on available data, inci-
dence may go from 8% to more than 37% in some instances [8].
Besides rare and sporadic Chlamydia testing implemented in some
countries, such high prevalence rates of asymptomatic infection
lay firm grounds for proper transmission and does in no way min-
imise the role of Ct as a risk factor for HPV and HIV infections
[9,10]. As a result of conflicting reports, the role of Ct infection
in the development of HPV-driven cervical cancer still needs to
clearly be elucidated. Some studies have reported independent
association of Ct with squamous cell carcinoma [11] while others
report no significant association [12]. Nonetheless, Ct implication
in cancer development is much more established. Moreover, apart
from its potential implication in cervical cancer development, Ct
has been shown to have several reproductive health implications
such as neonatal morbidity, pelvic inflammatory disease, infertility
and ectopic pregnancies as well as other genital cancers [13]. HPV
and Ct coinfections would therefore form a perfect lethal cocktail
with unprecedented potentials of driving cervical cancer and other
health-related problems. It is therefore evident, that such coinfec-
tions represent major public health issues, especially in low income
settings thereby increasing the risk of cervical cancer development.
The global burden of cancer is being shifted to less developed
countries [14] with about 57% of cancer cases registered in these
regions and 65% of cancer-related deaths. Cervical cancer is the
second most diagnosed and third leading cause of female cancer-
related deaths in developing countries. The highest incidence
rates occur in sub-Saharan Africa, Latin America, and Melanesia
accounting for 90% of the World’s cervical cancer deaths [14]. The
geographical disparities in CC incidence could be explained by dif-
ferences in the implementation of screening programs for early
detection of precancerous lesions and HPV infections. In countries
where systematic screening programs have been implemented, CC
incidence has reduced by up to 65% as it is the case in Norway [14].
CC is one of the most prevalent female cancers world-wide and
representing about 23% of all preventable cancer-related deaths
in low and middle income countries [15]. Despite the fact that CC
can be prevented by vaccination, no systematic vaccination pro-
grams have been implemented in Cameroon, as it is the case in
many developing countries worldwide. In this context, cervical
cancer prevention through behavior change remains the only alter-
native. Pushing for more investigation on infection risk factors in
the Cameroonian population would provide alternative measures
to reduce disease burden.
The present study evaluates the prevalence of HPV and Ct infec-
tions among sexually active women attending the Dschang district
hospital, in Cameroon. The study evaluates the risk of infection-
related cervical cancer and report the incidence rate of Chlamydia
and HPV infections among sexually active women in the popula-
tion.
Study site and population
The study was performed in Dschang, the divisional headquarter
of the Menoua division of the west region of Cameroon. Dschang is
a University town with several colleges and higher education insti-
tutes that cohabit in the city, making it an attractive commercial
centre and constituting a very dynamic and active population. With
a total area of 450 km2 it has a total population of about 102,000
inhabitants involved in different works of life. Most inhabitants
can be categorized under one of the following professional cate-
gories: house wives, students, traders and employees of the public
sector. The transmission of sexually transmitted infections (STIs)
could be high within such a population. Participants were randomly
recruited during visits to the hospital for routine gynaecological
check-ups. All participants consented to participate in the study by
signing an informed consent form. Ethical clearance was obtained
315
from the Dschang district hospital review board and the Cameroon
Bioethics Initiative (CAMBIN).
Methods
Sampling
Participants were recruited between June 2015 and April 2016.
Prior to that, the goal of the study was clearly explained to partic-
ipants, and when consent was given, subjects were included into
the study. A detailed questionnaire was administered to all par-
ticipants to document their lifestyle patterns. All participants who
could not read or write were assisted by the medical personnel,
and the questions in some cases were well explained in the local
languages. Low vaginal swabs were collected from participants
for the molecular detection of HPV and the blood samples were
used for the detection of Chlamydia infection by enzyme-linked
immunosorbent assay (ELISA). Biological material from all swabs
were immediately collected into a tube containing 1 ml of sterile
saline (0.9% NaCl) and kept frozen at −20 ◦ C until they were used
for DNA extraction. Serum samples were prepared from the blood
and aliquoted before being stored at −20 ◦ C. The swab samples were
transferred from the biochemistry laboratory of the Dschang dis-
trict Hospital, to the Molecular parasitology and entomology Unit at
the University of Dschang for molecular analyses. Chlamydia infec-
tion test was performed at the district hospital
Primer sequences used in the study.
Primer name Sequence 5 → 3 Tm (◦ C) Amplicon size (bp)
My09 cgtccmarrggawactgatc 52.5 450
My11 gcmcagggwcataayaatgg 55.8
HPV16F ttaggcagcacttggccaacca 62 207
HPV16R taatccgtcctttgtgtgagct 67
HPV18F tcgcgtcctttatcacagggcga 63 274
HPV18R tgcccaggtacaggagactgtg 66
DNA extraction
For molecular diagnosis of HPV infections, DNA was extracted
following the hexadecyltrimethylammonium bromide (CTAB)
based method previously described [16] with some modifications.
Briefly, frozen samples were thawed and 200 ␮l were pipetted into
a new Eppendorf tube. The samples were centrifuged at 10,000 rpm
on a benchtop centrifuge. The resulting pellet was washed twice
in 500 ␮l of deionized water and re-suspended in 500 ␮l of CTAB
buffer (CTAB 2%; 0.1 M Tris, pH 8; 0.02 M EDTA pH 8; 1.4 M NaCl).
Samples were then incubated at 60 ◦ C for 30 min for complete
lysis and DNA was isolated from the lysate by means of a mixture
of chloroform/isoamyl alcohol (24/1; V/V) extraction followed by
precipitation with sodium acetate in isopropanol (V/V). After cen-
trifugation at 13000 rpm for 15 min, the pellet was rinsed with 70%
ethanol, air-dried, and re-suspended in 25 ␮l distilled sterile water.
The DNA samples were diluted 25 folds and stored at −20 ◦ C until
PCR amplification.
Detection of HPV by PCR
Molecular identification of HPV was achieved by polymerase
chain reaction (PCR) using the MY09/MY11 consensus L1 primers
for all HPV subtypes [17] with some modifications. Briefly, a PCR
master mix comprising of 1× Q5 high fidelityTM reaction buffer
(New England Biolabs), 0.4 ␮M of each primer, 400 ␮M dNTPs and
0.5U of Q5 high fidelity DNA polymerase were prepared and dis-
tributed into PCR tubes. DNA samples (2.5 ␮l) were then added to
the tubes and placed onto a Prime thermocycler (TECHE). Ampli-
fication was performed using the following conditions; initial
denaturation at 98 ◦ C for 2 min, followed by 40 cycles each com-
316 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320

prised of a denaturation step at 98 ◦ C for 30 s, primer annealing at Table 1

General characteristics of the studied population.
57 ◦ C, an extension at 72 ◦ C for 1 min and a final extension at 72 ◦ C
for 10 min. Variables Mean ± SD, frequency or median (25–75 IQ)
For the identification of high risk HPV subtypes (HPV16 and HPV Age 28.1 ± 8.0
18), subtype specific primers in a similar PCR mix was prepared. Partnership status
The cycling conditions for the amplification of HPV 18 DNA were: Yes 160 (77.6%)
initial denaturation at 98 ◦ C for 2 min, followed by 40 cycles each No 46 (22.4%)

comprising of a denaturation step at 98 ◦ C for 30 s, primer annealing Education level

at 64 ◦ C, an extension at 72 ◦ C for 1 min and a final extension at 72 ◦ C Primary 62 (30%)
Secondary 98 (47.6%)
for 10 min. Amplification using the HPV 16 primers was done using
Tertiary 46 (22.3%)
a touch down approach with an upper temperature of 53 ◦ C and
lower temperature of 50 ◦ C. The human ␤-globin gene was used Occupation
Housewives & others 53 (24.7%)
as internal control using the GH20/PC04 primer pair as described
Students 61 (30%)
previously [18]. Amplicons were resolved on a 2% agarose gel and Traders 49 (23.8%)
documented on a UVITEC Cambridge gel documentation system. Public employees 43 (20%)
Age at first sex 17.9 ± 2.9
Diagnosis of Chlamydia trachomatis infection Contraception
Internal devices and injectable 70 (34.0%)
Serological diagnosis was used to assess Ct infection status of Condom 127 (61.7%)
each participant. Blood samples collected from participants were Sexual activity
used for serum preparation, and the Calbiotech CT IgG or IgM test kit Yes 200 (97.08%)
was used to identify Ct infections following manufacturer’s instruc- No 6 (2.9%)

tions. Briefly, serum samples were diluted 21 fold in sample diluent Chlamydia infection
and 100 ␮l of diluted serum was coated onto ELISA strips at room Positive 84 (40.8%)
temperature for 30 min. Samples were then discarded and strips Negative 122 (59.2%)

washed three times in 300 ␮l of 1× wash buffer, followed by incu- HPV infection
bation with the enzyme conjugate at room temperature for 10 min. Positive 48 (23.3%)
Negative 158 (76.7%)
The strips were again washed as described above and incubated
with 100 ␮l of TMB substrate for 10 min at room temperature. The HPV 16
reaction was then terminated by the addition of 100 ␮l of stop solu- Positive 6 (2.9%)
Negative 200 (97.1%)
tion and the optical density was read in a DIALAB ELx800 plate
reader. HPV 18
Positive 2 (1.0%)
Negative 204 (99.0%)
Statistical analysis

Mean ± standard deviation, frequencies and percentages were

used respectively for continuous and variables categorical. Logis-
tic regression at a univariate level was performed to determine the
association between HPV or Ct and the risk factors. HPV and Ct pos-
itivity were considered as dependent variables. The independent
variables were age (<24, >30 and in-between), pregnancy status,
partnership status, education level (primary, secondary, univer-
sity), income (low, medium, and high), age at first sexual activity
(<16, >18, and in-between), number of partners (< = 1, >3, and in-
between), use of condom as contraceptive, and number of children.
The results were reported as prevalence of cases and controls, odds
ratio, and the corresponding p-value. Logistic regression was also
used to assess the association between the infection by Chlamydia
and the HPV. Because of the small number of HPV16 and HPV18
cases, we did not investigate separate risk factors. A p-value <0.05
was considered for significance. All the analyses were performed
using STATA 14 (StataCorp LP, College Station, TX).
Results
Population characteristics
For all study participants (n = 206), the age range was between
16–50 years and the mean age was 28 ± 8 years with more than
97% (200/206) of whom declared having regular sexual activity
(Table 1). About 77.6% (160/206) of women had stable sexual
partner(s) while 22.3% (46/206) of them did not. The number of
partners varied considerably, with 25% (52/206) having a single
partner and 34.9% (72/206) reporting more than 4 sex partners.
All women knew about condoms as a contraceptive method and
61.7% (127/206) made use of it while about a third (34%) of them
were aware of the protection provided by condoms but did not
report their use. Those who reported not using condoms were
married and 4.3% (9/206) of the participants provided no infor-
mation on condom awareness and/or use (Table 1). The level of
education of the study population ranged from primary education
(30%) through secondary education (47.6%) to tertiary education
(22.4%). The socioeconomic status of the participants was assessed
by means of self-reported activities. About 20% (43/206) of the par-
ticipants were employees of the public service, 23.8% (49/206) were
traders (high income group), 30% (61/206) were students (medium
income group) and about 24.7% (51/206) were house wives or
unemployed.
Chlamydia trachomatis infection
For the 206 women enrolled in this study, 84 (40.8%) were
infected by Ct. Logistic regression showed that only the number of
sex partners was positively associated with Ct infections (p = 0.01)
(Tables 2 and 3). The risk to be infected by Ct increased with the
number of sexual partners. For instance, the value of OR was 1 for
< = 1 sexual partner and 2.31(1.09–4.92) for 2 and 3 sex partners
(Table 2). In a multivariable logistic regression, parity appeared to
be negatively associated with Chlamydia especially when number
of partner was not included in the analysis (p = 0,032, not showed in
the results). Although not statistically significant (p = 0.14), the age
at first sexual intercourse was negatively correlated with risk of Ct
infection (OR = 1 for sex before or at the age of 16 years and OR = 0.52
for first sex after 18 years). Both educational status and the use of
condoms were not significantly associated with Ct infection.
 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320 317

Table 2
Odds ratio for Chlamydia trachomatis and HPV infections.

Chlamydia HPV
Cases Controls ORa (95%CI) p Value Cases Controls ORa (95%CI) p Value

N 84 122 – – 48 158 – –
Age
Between 16–24 35 48 1 0.92 26 57 1 0.028
Between 25–29 21 33 0.87 (0.43–1.76) 13 41 0.70 (0.32–1.51)
Superior to 30 27 41 0.90 (0.47–1.73) 9 59 0.33 (0.14–0.78)

Partnership status
Yes 67 93 1.22 (0.63–2.42) 0.55 15 127 1 0.10
No 17 29 1 33 31 1.86

Education level
Primary 11 12 1 0.74 4 19 1 0.71
Secondary 36 52 0.76 (0.30–1.90) 20 68 1.39 (0.43–4.58)
University 37 58 0.70 (0.28–1.74) 24 71 1.61 (0.50–5.19)

Occupation
Housewives 16 34 1 0.33 8 42 1 0.35
Students 44 59 1.58 (0.78–3.23) 26 77 1.77 (0.73–4.26)
Others 24 29 1.75 (0.79–3.93) 14 39 1.88 (0.71–4.98)

Age at first sex

Inferior to 16 41 51 1 0.14 25 67 1 0.45
Between 16 and 18 27 32 1.05 (0.54–2.02) 11 48 0.61 (0.28–1.37)
Superior to 18 15 36 0.52 (0.25–1.07) 11 40 0.74 (0.33–1.66)

Number of partners
Inferior < = 1 14 42 1 0.012 13 43 1 0.70
Between 2 and 3 34 44 2.31 (1.09–4.92) 16 62 0.85 (0.37–1.95)
Superior to 3 36 36 3.0 (1.40–6.42) 19 53 1.18 (0.53–2.67)

Contraceptive condom
Yes 49 78 0.78 (0.44–1.39) 0.42 35 92 1 0.062
No 35 44 1 13 66 0.52 (0.25–1.05)

Number of children
No child 44 56 1 0.36 31 69 1 0.36
Child = 1 17 21 1.03 (0.48–2.18) 7 31 1.03 (0.49–2.18)
Child > = 2 23 25 0.65 (0.34–1.23) 10 58 0.65 (0.34–1.23)

HPV
Yes 20 28 1 0.89 – – – –
No 64 94 0.95 (0.49–1.84) – – – –

HPV infection
Molecular detection of HPV infections revealed that 23.3%
(48/206) of all women were positive for HPV infections (Table 2).
The incidence of HPV 16 and HPV 18 subtypes were 2.9% and
1% respectively and did occur predominantly in young women.
Of all seven risk factors assessed (Table 2), there was a signifi-
cant (p = 0.028) inverse relation between age and HPV infection.
Unexpectedly, there was a positive, but statistically not significant
(p = 0.062) increased risk of HPV infection in subjects who used con-
doms for contraception than those who do not. Moreover, there was
an increased risk of HPV infection in women who declared having
no stable sex partner as opposed to those who had stable sex part-
ners. For the 84 (40.8%) Ct positive women, 20 (23.8%) were positive
for HPV infection. There was however no statistically significant
association between HPV and Ct infections as well as educational
and socioeconomic status.
Infection risk factors
Age and infection
To further understand the role of population strata on infection
status, we stratified the study population into three age groups:
16–24 years, 25–30 years and above 30 years (Table 3). For the
first age subgroup (16–24 years), a significant positive associa-
tion was observed between the number of sex partners and Ct
infections (p = 0.01). For women above 30 years, an inverse cor-
relation between Ct infections and Age at first sex was still found
without significant association (p = 0.065). Among women in the
age group of 25–30 years, students and unemployed participants
were at higher risk of Ct infections with OR (95%CI) values of 3.27
(0.55–19.5) and 5.14 (0.82–32.3) respectively Table 3 Parity on the
other hand, showed a negative correlation with Ct infection and
participants having more than 2 children were least likely to be
infected by Ct with an OR (95%CI) value of 0.04 (0.06–2.70).
Education and sexual behavior
Although 61.7% (127/206) of participants reported the use of
condoms during sexual intercourse, the use of condoms was only
as a means of contraception. Those who did not use condoms used
either oral or injectable contraceptives. When those who reported
the use of condoms were asked if they had unique sex partners, it
turned out, that of all those who did use condoms, 25.6%, 22.4%,
19.2%, 11.2% and 21.6% had one, two, three, four and more than
four sex partners respectively. On the other hand, for those who
reported not using condoms, 27.3%, 14.3%, 16.7%, 10.7% and 31.0%
had one two, three, four and more than four sex partners respec-
tively. This indicates that stability in number of sex partners cannot
explain the decision of whether or not to use condoms. For all those
who declared using condoms, only 5.6% of them had only been to
primary school, while 41.6% and 52.8% had attended secondary and
tertiary education respectively. However, of all those who did not
use condoms but other contraceptives, up to 20% attended only
318 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320

Table 3
Odds ratio for Chlamydia trachomatis and HPV infections stratified by age.

Chlamydia HPV

16–24 25–29 More than 30 16–24 25–29 More than 30

a b
OR pVal OR pVal OR pVal OR pVal OR pVal OR pVal

Partnership status
Yes 1 (*Ref) 0.34 1 (Ref) 0.78 1 (Ref) 0.99 1 (Ref) 0.35 1 (Ref) 0.65 1 (Ref) 0.66
No 0.63 (0.24–1.65) 0.83 (0.24–2.95) 1.01 (0.16–6.50) 1.60 (0.60–4.26) 1.38 (0.35–5.46) 1.72 (0.17–17.4)

Education level
Primary 1 (Ref) 0.68 1 (Ref) 0.44 1 (Ref) 0.76 1 (Ref) 0.92 1 (Ref) 0.76 1 (Ref) 0.49
Secondary 0.34 (0.03–4.18) 0.91 (0.11–7.72) 0.70 (0.21–2.36) 0.95 (0.35–2.56) 0.82 (0.22–2.99) 3.21 (0.35–29.2)
University 0.36 (0.03–4.21) 0.45 (0.05–3.72) 1.03 (0.26–4.0) 1 (Ref) 1 (Ref) 1.88 (0.15–22.9)

Occupation
Housewives 1 (Ref) 0.44 1 (Ref) 0.17 1 (Ref) 0.93 1 (Ref) 0.25 1 (Ref) 0.53 1 (Ref) 0.10
Students 1.97 (0.62–6.29) 3.27 (0.55–19.5) 0.83 (0.24–2.78) 0.24 (0.14–1.285) 1.60 (0.37–7.02) 0.24 (0.04–1.44)
Others 2.18 (0.57–8.41) 5.14 (0.82–32.3) 0.79 (0.21–2.92) 0.35 (0.09–1.40) 1 (–) 1 (–)

Age at first sex

12–16 years 1 (Ref) 0.38 1 (Ref) 0.75 1 (Ref) 0.065 1 (Ref) 0.22 1 (Ref) 0.80 1 (Ref) 0.13
16–18 years 0.81 (0.28–2.35) 0.71 (0.16–3.23) 0.24 (0.06–0.86) 0.36 (0.11–1.17) 1.78 (0.32–10.0) 0.14 (0.01–1.29)
Above 18 years 0.47 (0.16-1.43) 0.61 (0.17–2.21) 0.38 (0.11–1.26) 0.65 (0.21–1.96) 1.20 (0.25–5.71) 0.41 (0.08–1.98)

Number of partners
Inferior < = 1 1 (Ref) <0.01 1 (Ref) 0.76 1 (Ref) 0.27 1 (Ref) 0.63 1 (Ref) 0.60 1 (Ref) 0.69
Between 2 and 3 3.05 (1.06–8.80) 1.50 (0.24–9.42) 2.80 (0.62–12.9) 0.73 (0.25–2.14) 1.58 (0.15–16.3) 1.95 (0.18–20.8)
Superior to 3 6.5 (1.84–22.9) 1.92 (0.31–12.1) 3.02 (0.70–13.0) 1.33 (0.41–4.37) 2.63 (0.26–26.1) 2.50 (0.26–23.7)

Contraceptive condom
Yes 1 (Ref) 0.77 1 (Ref) 0.18 1 (Ref) 0.78 1 (Ref) 0.69 1 (Ref) 0.23 1 (Ref) 0.18
No 1.16 (0.42–3.21) 2.28 (0.68–7.70) 1.15 (0.42–3.20) 1.25 (0.43–3.62) 0.39 (0.08–2.03) 0.38 (0.09–1.58)

Number of children
No child 1 (Ref) 0.95 1 (Ref) 0.27 1 (Ref) 0.37 1 (Ref) 0.63 1 (Ref) 0.60 1 (Ref) 0.69
Child = 1 1.05 (0.33–3.39) 1.11 (0.31–4.03) 0.35 (0.08–1.56) 0.73 (0.24–2.14) 1.58 (0.15–16.3) 1.95 (0.18–20.8)
Child > = 2 1.41 (0.19–10.6) 0.04 (0.06–2.70 0.38 (0.09–1.51) 1.33 (0.41–4.37) 2.63 (0.26–26.1) 2.5 (0.26–23.7)

HPV
Positive 1 (Ref) 0.64 1 (Ref) 0.97 1 (Ref)
Negative 1.25 (0.48–3.22) 1.02 (0.28–3.69) 0.48 (0.12–1.96)
a
OR = odds ratio.
b
pVal = p value.

primary education while 46.25% and 33.75% attended secondary
and tertiary education respectively. We later assessed if any rela-
tionship did exist between the number of sex partners and the
level of education. We found, that although there was no differ-
ence in the percentage of women who had one, two, three, or
four sex partners for all educational levels considered, the per-
centage of women with more than four sex partners and who
attended only primary education was twice that of those who
attended tertiary education. Similarly, age at first sexual inter-
course was lower for women who attended only primary education
(16.5 ± 2.2 years) compared to those who attended tertiary educa-
tion (18.1 ± 4.4 years).
Discussion
Cervical Cancer is one of the leading causes of cancer-related
deaths and is among the most preventable cancers [20]. In this
study, the incidence of HPV and Chlamydia infections were evalu-
ated among sexually active women attending the Dschang district
hospital. The study population had an average age of 28.1 ± 8 years;
reflecting the highly active nature of the population characterized
by multiple secondary and high schools cohabiting with one state
University and a few other private higher institutes of learning. We
observed an infection rate of 40.8% for Ct, which was positively
correlated with number of sex partners and showed a negative
correlation with age at first sexual intercourse. In a similar study
performed in Nigeria among undergraduate students, the preva-
lence rate was about 30% [22]. Another study in India reported 23%
prevalence [23] in a similar study population. Other studies have
reported varying prevalence rates in other developing nations; 9.6%
in Kano Nigeria [24], 5.5% in Qatar [25] and 10.7% in Brazil [26]. With
an estimated global prevalence of 4.2% [7], the prevalence of Ct in
the study population was more than 10 folds higher. In Nigeria,
multiple sex partners among university students was the prevail-
ing risk factor associated with Ct infection as it is the case in our
study. The low infection rate of Ct in some Countries like Qatar could
be explained by some socio-cultural factors such as sexual activity
which is tightly controlled and multiple sex partners considered as
a taboo. Compared with other areas of high STI prevalence such as
rural Kwazulu-natal in South Africa, Ct prevalence is more than 3
times higher. However, similar associated risk factors (early onset
of sexual activity and multiple partners) were found to be asso-
ciated with high risk of Ct infection [27]. Behavioral factors, most
importantly high risk sexual behaviors could explain the observed
Ct incidence rates. The impact of behavioral factors is further exem-
plified, by the fact that age at first sex was inversely correlated with
in infection.
We observed a prevalence rate of 23, 3% HPV, of which HPV
16 and HPV 18 represented 2.9% and 1% respectively. Globally, a
prevalence rate of between 11 and 12% has been reported with
geographical discrepancies that are inversely related with develop-
mental index [35]. Sub-Saharan African, Eastern Europe and Latin
America are the most affected, with prevalence rates of 24% for the
former and 16% for the latter [35]. An observed prevalence of 23.3%
is therefore similar to the regional mean and has been observed
in some areas of Brazil and South Africa. In fact, among University
students in Brazil a prevalence of 25.3% was reported [28]. In India,
prevalence rates of 9.9% and 12.6% have been observed in sepa-
 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320
rate studies, with HPV 16 and HPV 18 representing 0.6% and 1.4%
respectively [29,30]. In Nigeria and Ghana, the prevalence rates of
HPV were 37% and 10.7% respectively [31,32]. The prevalence of
HPV in the study population is therefore among the highest inci-
dence rates reported in different populations, and two fold higher
than global rates but close to regional rates (24%) except in some
areas of rural South Africa with up to 76% incidence rates [33,21].
This high prevalence could be explained by behavioral and lifestyle
factors. Indeed, several studies have reported high HPV prevalence
rates young women [28–32,34–36] and this could reflect sexual
behaviors. In a recent report in South Africa, stability of sex part-
ners and risk behaviors have been associated with extreme risk of
HPV infections [34]. Considering high risk HPV subtypes, the inci-
dence rates of HPV 16 and HPV 18 in our study were similar to global
reports [21]. Despite this, some regional studies have pointed to a
higher prevalence of other high risk HPV subtypes such as HPV 18,
HPV 45 and HPV 35 [43]. It is therefore probable, that the incidence
of other high risk HPV subtypes is higher in the study population
either as unique infections or mixed infections.
Co-infections with HPV and Ct were found in 20 (23.8%) of Ct
infected individuals. In Italy, coinfection rates of 2.7% and 60.4%
were reported in different population groups [34,37]. In both cases,
majority of the infections were asymptomatic Ct infections and
sexual behaviors were strongly associated with infection. Using
logistic regression models, we found a significant positive corre-
lation between number of sex partners and Ct infection, as well
as a negative correlation between age at first sex with HPV and
Chlamydia infections. This can be explained by the fact that most
of those who attain higher education are aware of sex transmitted
infections and the risks resulting from such diseases. The signifi-
cant high infection rate of HPV in younger adolescents and inverse
correlation between the use of condoms and the risk of Ct infections
in this group of women corroborate with results observed in India
[30,38]. There was a significant negative correlation between parity
and Ct infection especially when the number of partners was not
considered. This could be explained in part by the fact that most
of those who had children were married and in most cases, may
have a unique sex partner. The increased rate of Ct infection among
women with multiple sex partners could be expected, and is further
enhanced by the fact that most of them do not used condoms. As
previously reported [39], the use of condoms is perceived as a bar-
rier to full sexual pleasure and may discourage adepts of this theory
from using condoms thereby increasing risk of Ct infection. Besides,
although the use of condoms was high in our cohort, they are used
for contraception and not for the prevention of STI. In cases where
there is no clear risk of pregnancy, most women would therefore
prefer not to use them thereby increasing risk of infection.
Considering the impact of HPV and Ct coinfection on the devel-
opment of cervical cancer, coupled with inexistence of systematic
screening, high rates of HPV and Ct infections could be sugges-
tive of urgent need for action. Given that most participants were
aged below 30 (the HPV vulnerable group), the observation of
high cervical cancer incidence among women in Cameroon could
be explained by early infection with HPV and/or Ct. This in turn
results from an arsenal of different factors including, but not lim-
ited to early onset of sexual intercourse, multiple sex partners, low
educational standards and high risk behavioral factors. There is
therefore an urgent need to put in place screening programs, but
most importantly population sensitization if the current trends of
cervical cancer in Cameroon need to be reversed. These sugges-
tions are strengthened by the fact that cervical cancer is the second
most diagnosed female cancer in Cameroon with an incidence rate
of about 13.8%. Moreover, cervical cancer constitute the most pre-
dominant genital cancers (86%) [40,41] and more than half of the
cases occur among sexually active women [33]
319
Conclusion
We investigated the incidence of HPV and Ct infections in associ-
ation with risk factors among sexually active Cameroonian women.
Our study showed that there is a very high prevalence of Ct and HPV
single infections as well as co-infections in the study population and
sexual behaviors seem to partly explain the observed trends. Such
high rates of co-infections suggest significant risk of cervical neo-
plasia or precancerous lesions which would represent an important
public health issue in the near future. This study presents compre-
hensive analysis of HPV and Ct infection in Cameroon and highlights
the possible implication of these infections in the development
of cervical cancer. The results generated here open the doors for
further investigations on HPV and Ct infections in other parts of
Cameroon.
Funding
No funding sources.
Competing interests
None declared.
Ethical approval
Not required.
Acknowledgments
This study was supported by the University of Dschang and
Dschang District Hospital, the Molecular Parasitology and Entomol-
ogy Unit: University of Dschang.
References
[1] Giuliano AR, et al. High HIV, HPV, and STI prevalence among young Western
Cape, South African women: EVRI HIV prevention preparedness trial. J Acquir
Immune Defic Syndr 2015;68(2):227–35.
[2] Kim MJ, Kim JJ, Kim S. Type-specific prevalence of high-risk human papillo-
mavirus by cervical cytology and age: data from the health check-ups of 7014
Korean women. Obstet Gynecol Sci 2013;56(2):110–20.
[3] Mazanowska N, et al. Prevalence of cervical high-risk human papillomavirus
infections in kidney graft recipients. Ann Transplant 2013;18:656–60.
[4] Forman D, et al. Global burden of human papillomavirus and related diseases.
Vaccine 2012;30(Suppl. 5):F12–23.
[5] Bruni L, et al. Cervical human papillomavirus prevalence in 5 continents: meta-
analysis of 1 million women with normal cytological findings. J Infect Dis
2010;202(12):1789–99.
[6] Bellaminutti S, et al. HPV and Chlamydia trachomatis co-detection in young
asymptomatic women from high incidence area for cervical cancer. J Med Virol
2014;86(11):1920–5.
[7] Newman L, et al. Global estimates of the prevalence and incidence of four cur-
able sexually transmitted infections in 2012 based on systematic review and
global reporting. PLoS One 2015;10(12):e0143304.
[8] Patel AL, et al. Prevalence of Chlamydia infection among women visiting a
gynaecology outpatient department: evaluation of an in-house PCR assay for
detection of Chlamydia trachomatis. Ann Clin Microbiol Antimicrob 2010;9.
[9] Sturm-Ramirez K, et al. Molecular epidemiology of genital Chlamydia tra-
chomatis infection in high-risk women in Senegal, West Africa. J Clin Microbiol
2000;38(1):138–45.
[10] Smith JS, et al. Evidence for Chlamydia trachomatis as a human papillomavirus
cofactor in the etiology of invasive cervical cancer in Brazil and the Philippines.
J Infect Dis 2002;185(3):324–31.
[11] Madeleine MM, et al. Risk of cervical cancer associated with Chlamydia tra-
chomatis antibodies by histology: HPV type and HPV cofactors. Int J Cancer
2007;120(3):650–5.
[12] Safaeian M, et al. Chlamydia trachomatis and risk of prevalent and inci-
dent cervical premalignancy in a population-based cohort. J Natl Cancer Inst
2010;102(23):1794–804.
[13] Menon S, et al. Human and pathogen factors associated with Chlamy-
dia trachomatis-related infertility in women. Clin Microbiol Rev
2015;28(4):969–85.
320 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320
[14] Torre LA, et al. Global cancer statistics, 2012. Ca-a Cancer J Clin
2015;65(2):87–108.
[15] Simard EP, Jemal A. Commentary Infection-related cancers in low- and
middle-income countries: challenges and opportunities. Int J Epidemiol
2013;42(1):228–9.
[16] Healey A, et al. Protocol: a simple method for extracting next-generation
sequencing quality genomic DNA from recalcitrant plant species. Plant Meth-
ods 2014;10.
[17] Finan RR, et al. Detection of human papillomavirus (HPV) genotypes in cervico-
vaginal scrapes of women with normal and abnormal cytology. Clin Microbiol
Infect 2001;7(12):688–92.
[18] de Abreu ALP, et al. Short report: molecular detection of HPV and Chlamydia
trachomatis infections in Brazilian women with abnormal cervical cytology.
Am J Trop Med Hyg 2012;87(6):1149–51.
[20] Misganaw A, et al. Epidemiology of major non-communicable diseases in
Ethiopia: a systematic review. J Health Popul Nutr 2014;32(1):1–13.
[21] Denny L, et al. Human papillomavirus prevalence and type distribution in inva-
sive cervical cancer in sub-Saharan Africa. Int J Cancer 2014;134(6):1389–98.
[22] Arinze AU, Onyebuchi NV, Isreal J. Genital chlamydia trachomatis infection
among female undergraduate students of University of Port Harcourt, Nigeria.
Niger Med J 2014;55(1):9–13.
[23] Patel AL, et al. Prevalence of Chlamydia infection among women visiting a
gynaecology outpatient department: evaluation of an in-house PCR assay for
detection of Chlamydia trachomatis. Ann Clin Microbiol Antimicrob 2010:24.
[24] Nwankwo EO, Sadiq MN. Prevalence of Chlamydia trachomatis infection among
patients attending infertility and sexually transmitted diseases clinic (STD) in
Kano, North Western Nigeria. Afr Health Sci 2014;14(3):672–8.
[25] Al-Thani A, et al. Prevalence of Chlamydia trachomatis infection in the general
population of women in Qatar. Sex Transm Infect 2013;89(Suppl. 3):iii57–60.
[26] Piazzetta RC, et al. Prevalence of Chlamydia trachomatis and Neisseria gonor-
rhoea infections in sexual actives young women at a southern Brazilian city.
Rev Bras Ginecol Obstet 2011;33(11):328–33.
[27] Naidoo S, et al. High prevalence and incidence of sexually transmitted infec-
tions among women living in Kwazulu-Natal, South Africa. AIDS Res Ther
2014;11:31.
[28] Vieira RC, et al. Prevalence of type-specific HPV among female university stu-
dents from northern Brazil. Infect Agent Cancer 2015;10:21.
[29] Dutta S, et al. Prevalence of human papillomavirus in women without cer-
vical cancer: a population-based study in Eastern India. Int J Gynecol Pathol
2012;31(2):178–83.
[30] Sharma K, et al. Higher prevalence of human papillomavirus infection in ado-
lescent and young adult girls belonging to different Indian tribes with varied
socio-sexual lifestyle. PLoS One 2015;10(5):e0125693.
[31] Akarolo-Anthony SN, et al. Age-specific prevalence of human papilloma virus
infection among Nigerian women. BMC Public Health 2014;14:656.
[32] Domfeh A, et al. Cervical human papillomavirus infection in Accra, Ghana.
Ghana Med J 2008;42(2):71–8.
[33] Ebrahim S, et al. High burden of human papillomavirus (HPV) infection among
young women in KwaZulu-Natal, South Africa. PLoS One 2016;11(1):e0146603.
[34] Panatto D, et al. Chlamydia trachomatis prevalence and Chlamydial/HPV
co-infection among HPV-unvaccinated young Italian females with normal
cytology. Hum Vaccin Immunother 2015;11(1):270–6.
[35] Forman D, et al. Global burden of human papillomavirus and related diseases.
Vaccine 2012;30(Suppl. 5):F12–23.
[36] Vaccarella S, et al. Worldwide trends in cervical cancer incidence:
impact of screening against changes in disease risk factors. Eur J Cancer
2013;49(15):3262–73.
[37] Seraceni S, et al. High prevalence of hpv multiple genotypes in women with
persistent Chlamydia trachomatis infection. Infect Agent Cancer 2014;9:30.
[38] Ikeme AC, et al. Seroprevalence of Chlamydia trachomatis in Enugu, Nigeria.
Niger J Clin Pract 2011;14(2):176–80.
[39] Sobze Sanou M, et al. Condom perception and prevention of HIV/AIDS infection
in Cameroon: appraisal of knowledge, attitudes and practices among level one
students of the University of Dschang. Ig Sanita Pubbl 2013;69(2):183–94.
[40] Engbang JP, et al. Histo-epidemiological aspects of genital cancers in women in
the Littoral Region, Cameroon. Pan Afr Med J 2015;21:116.
[41] Atashili J, et al. Age trends in the prevalence of cervical squamous intraepithelial
lesions among HIV-positive women in Cameroon: a cross-sectional study. BMC
Res Notes 2012;5:590.