Environmental Research 191 (2020) 110125

Contents lists available at ScienceDirect

Environmental Research
journal homepage: www.elsevier.com/locate/envres

Benzo[a]pyrene exposure disrupts steroidogenesis and impairs

spermatogenesis in diverse reproductive stages of male scallop
(Chlamys farreri)
Yingying Yang, Luqing Pan *, Yueyao Zhou, Ruiyi Xu, Dongyu Li
The Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao, 266003, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Benzo[a]pyrene (BaP), a model compound of polycyclic aromatic hydrocarbon known to impair reproductive
Benzo[a]pyrene functions of vertebrates, while the data is scarce in marine invertebrates. To investigate the toxic effects of BaP
Chlamys farreri on invertebrates reproduction, we exposed male scallop (Chlamys farreri) to BaP (0, 0.38 and 3.8 μg/L)
Steroidogenesis
throughout three stages of reproductive cycle (early gametogenesis stage, late gametogenesis stage and ripe
Spermatogenesis
Reproductive toxicity
stage). The results demonstrated that BaP decreased the gonadosomatic index and mature sperms counts in a
dose-dependent manner. Significant changes in sex hormones contents and increased 17β-estradiol/testosterone
ratio suggested that BaP produced the estrogenic endocrine effects in male scallops. In support of this view, we
confirmed that BaP significantly altered transcripts of genes along the upstream PKA and PKC mediated signaling
pathway like fshr, lhcgr, adcy, PKA, PKC, PLC and NR5A2. Subsequently, the expressions of genes encoding
downstream steroidogenic enzymes (e.g., 3β-HSD, CYP17 and 17β-HSD) were impacted, which corresponded
well with hormonal alterations. In addition, BaP suppressed transcriptions of spermatogenesis-related genes,
including ccnd2, SCP3, NRF1 and AQP9. Due to different functional demands, these transcript profiles involved in
spermatogenesis exhibited a stage-specific expression pattern. Furthermore, histopathological analysis deter­
mined that BaP significantly inhibited testicular development and maturation in male scallops. Overall, the
present findings indicated that, playing as an estrogenic-like chemical, BaP could disrupt the steroidogenesis
pathway, impair spermatogenesis and caused histological damages, thereby inducing reproductive toxicities with
dose- and stage-specific effects in male scallops. And the adverse outcomes might threaten the stability of bivalve
populations and destroy the function of marine ecosystems in the long term.

1. Introduction decline in population and potential risk of extinction were observed in

Polycyclic aromatic hydrocarbons (PAHs) are highly persistent and
ecologically toxic endocrine disrupting chemicals (EDCs). Sixteen PAHs
are listed as priority contaminants due to their strong carcinogenic,
teratogenic and mutagenic properties (EPA, 2010). PAHs input into
marine ecosystems through a variety of processes including atmospheric
deposition, wastewater discharges and oil spills (Qiu et al., 2009).
Further, PAHs tend to accumulate in marine ecosystems and various
marine organisms (e.g., invertebrates and fishes) on account of their low
solubility and bioavailability (Livingstone et al., 1998; Lu et al., 2019).
Short-term and chronic exposure to these pollutants lead to a plethora of
reprotoxic effects on invertebrates which play pivotal ecological roles in
ecosystems (Cuvillier-Hot and Lenoir, 2020). For instance, the acute
diverse invertebrates (e.g., oyster Saccostrea commercialis and dogwhelks
Nucella lapillus) inhibited in the worst polluted regions (Bryan et al.,
1986; Roach and Wilson, 2009; Titley-O’Neal et al., 2011). And indi­
vidual defects, such as intersex, sexual aberrations and reversal, and
reproductive disease have been reported in various invertebrate species
living in coastal areas polluted by EDCs (Graceli et al., 2013; Grilo and
Rosa, 2017; Jobling et al., 2002). Besides, numerous field and laboratory
studies have reported the negative impacts on invertebrate reproduc­
tion, such as decreased gonadosomatic index (GSI), delayed gameto­
genesis and histological disorders in invertebrates, which were
associated with the presence of EDCs (Bugel et al., 2010; Graceli et al.,
2013; Pait and Nelson, 2009; Smolarz et al., 2017). Collectively, EDCs
have drawn continuous and increasing concerns on their potential

* Corresponding author. Fisheries College, Ocean University of China, Yushan Road 5, Qingdao, 266003, PR China.
E-mail address: panlq@ouc.edu.cn (L. Pan).

https://doi.org/10.1016/j.envres.2020.110125
Received 10 June 2020; Received in revised form 8 August 2020; Accepted 13 August 2020
Available online 27 August 2020
0013-9351/© 2020 Elsevier Inc. All rights reserved.
Y. Yang et al.
reproductive toxicity on invertebrates. Interestingly, a large number of
toxicological studies have clearly demonstrated that males were more
susceptible to environmental pollutants than females (Chatel et al.,
2017; Lee et al., 2018). For instance, Ciocan et al. (2010) reported that
transcriptional levels of vitellogenin (vtg) and estrogen receptor (ER) in
testis were higher than these in ovary of Mytilus edulis, suggesting that
male mussels were more sensitive to EDCs compared with female mus­
sels. Likewise, manila clams (Tapes philippinarum) exposed to 4-nonyl­
phenol significantly increased vtg-like protein levels in both
hemolymph and digestive gland of males, whereas no alterations were
observed in females (Matozzo and Marin, 2005). Indeed, testicular
development and spermatogenesis of aquatic invertebrates could last for
a period from a few weeks to many months (Liu et al., 2014). And male
reproductive systems of aquatic invertebrates are directly exposed to
environmental toxicants present in seawater during the process of
testicular development and maturation because invertebrates lack of
blood-gonad barrier found in mammals (Lewis and Ford, 2012).
Therefore, male reproductive systems of invertebrates have been
demonstrated to be the major target of EDCs. Both sex steroids pro­
duction and gametogenesis are crucial factors involved in maintaining
reproductive functions and as a consequent ensuring population stabil­
ity of invertebrates species (Croll and Wang, 2007). Building on this
observation, special attention should be paid to the potential toxic ef­
fects on steroidogenesis and gametogenesis in male invertebrates.
Numerous toxicological information suggests that exposure to EDCs
could induce interruption on sex steroids contents, and consequently
disturb reproductive functions (Cappello et al., 2017; Vigano et al.,
2010). For instance, waterborne concentrations of phenanthrene
(ranging from 0.06 μg/L to 60 μg/L) were shown to alter 17β-estradiol
(E2) levels in male adult rockfish (Sebastiscus marmoratus) (Sun et al.,
2011). And short-term exposure to benzo[a]pyrene (BaP) decreased
levels of E2, progesterone (P), and testosterone (T) in pre-spawn scallop
(Chlamys farreri) and female crab (Portunus trituberculatus) (Deng et al.,
2014; Wen and Pan, 2016). One possible mechanism responsible for sex
steroid disruption is that EDCs can interfere with gonadotropin receptors
and cAMP-PKA signaling pathway, and subsequently alter transcripts of
steroid synthesis enzymes (e.g. 3β or 17β-hydroxysteroid de­
hydrogenases, 3β-HSD or 17β-HSD; 17α-hydroxylase, 17, 20-lyase,
CYP17a) in fishes (Da Cuna et al., 2016; Lee et al., 2018; Santangeli
et al., 2019; Yang et al., 2018; Zheng et al., 2006). Apparently, the
hormonal disruption induced by EDCs in fish species have been well
documented. However, there is insufficient data to perform the disrup­
tion of PAHs on sex hormone homeostasis in invertebrates, particularly
their impacts on upstream PKA and PKC mediated signaling pathways in
male reproductive systems.
On the other hand, recent studies have reported that spermatogen­
esis was also a major target of EDCs, and that sperm count and quality
could be adversely impacted by exposure to persistent organic pollutants
(Au et al., 2003; Cardone et al., 2002; Lewis and Ford, 2012). Marine
invertebrate sperm can be exposed to any EDCs presented in seawater
during the process of spermatogenesis, and the disruption on sper­
matogenesis may impair fertility and reproductive rate, subsequently
threatening the survival of invertebrate species (Au et al., 2003). It was
reported that 2,3,7,8-tetrachlorodibenzo-p-dioxin induced unsynchro­
nized sperm development and inhibited gametogenesis in eastern oyster
(Crassostrea gigas) (Wintermyer and Cooper, 2007). Moreover, a study
conducted by Bonnefille et al. (2018) showed a toxic effect of diclofenac
on gamete production and release in mussels (Mytilus galloprovincialis).
Studying alterations at the molecular level of spermatogenesis could
better understand the toxic effects on male reproductive systems.
However, as yet, poor information is known about the impact of PAHs on
spermatogenesis and the underlying molecular mechanisms in aquatic
invertebrates. Accordingly, a further study needs to be done to investi­
gate the potential mechanisms of PAHs disrupting on steroidogenesis
and spermatogenesis in male invertebrates.
BaP is regarded as a typical representative of PAHs and has been
2
Environmental Research 191 (2020) 110125
listed on EDCs screening programs (EPA, 2010). In addition, BaP is
globally distributed in the marine environment and has been widely
detected in numerous marine invertebrates (Cao et al., 2019; Sarria-Villa
et al., 2016; Sogbanmu et al., 2019; Zhang et al., 2020). Bivalves, the
typical representatives of marine invertebrates, are regarded as bio­
indicators in costal pollution monitoring programs (Pan et al., 2008).
Besides, the reproductive stage is more sensitive to environmental
contaminants than any other life stage of bivalves (Diepens et al., 2017).
However, previous toxicological studies on bivalves only contained a
specific stage of reproduction (Alonso et al., 2019; Cappello et al., 2017;
Smolarz et al., 2017). Whether or how BaP act on male bivalves
throughout diverse stages of reproduction remain largely unknown. In
this study, we exposed male scallops Chlamys farreri to BaP (0, 0.38 and
3.8 μg/L) throughout three stages of gametogenesis (early gametogen­
esis stage, late gametogenesis stage and ripe stage). We performed an­
alyses on: (1) GSI and sperm number; (2) E2, T and P levels, E2/T ratio,
and genes within both upstream steroidogenesis signaling and down­
stream steroidogenesis enzymes; (3) transcripts of genes involved in the
spermatogenesis; (4) testicular histology. These analyses provide new
insights into the reproductive toxicity of organic pollutants on male
bivalves throughout diverse reproductive stages. And the negative out­
comes should be taken into account during bivalve population conser­
vations and ecological risk assessments.
2. Materials and methods
2.1. Chemicals
BaP (CAS No. 50-32-8, 99% purity) and dimethyl sulfoxide (DMSO,
99% purity) were purchased from Sigma Aldrich. The concentrated
stock solution of BaP was prepared by dissolving in DMSO, and stored in
the dark at 4 ◦ C. The ELISA kits for measuring E2, T and P levels were
purchased from Lengton Bioscience Co. (Shanghai, China).
2.2. Experimental design and sampling
Male scallops C. farreri at pre-early gametogenesis stage were ob­
tained from Nanshan market in Qingdao, China, and were immediately
transported to the laboratory. Before chemical exposure, all scallops
were acclimated for ten days in aquarium tanks filled with sand-filtered
seawater. The photoperiod was maintained a 10 h light/14 h dark cycle
at 18 ± 1 ◦ C. At the end of acclimation period, male scallops were
transferred into tanks containing 100 L sand-filtered seawater each
(1.25 L seawater/scallop) for BaP exposure. Nominal BaP exposure
concentrations were set as 0.38 and 3.8 μg/L, and BaP-free solution was
set as the control. Each treatment contained triplicates, and each repli­
cate incorporated eighty individuals in an aquarium. The BaP exposure
experiments were conducted for 24 days, when male scallops were in
sexual maturity.
Test concentrations were selected based on PAHs concentrations in
costal seawater from different areas ranging from 1.6 to 3504 ng/L
(Guigue et al., 2014; Mirza et al., 2012; Wang et al., 2013; Zhang et al.,
2016). BaP (0.38 and 3.8 μg/L), one of the most carcinogenic PAHs,
were selected to mimic the environmental PAHs concentrations. Ac­
cording to the classified standard of PAHs pollution in water (Chen et al.,
2008), 0.38 μg/L was at the relatively medium pollution level
(250–1000 ng/L), and 3.8 μg/L was at the relatively high pollution level
(>1 μg/L). Considering that BaP at relatively low concentrations had no
effects on bivalves in our previous studies (Tian et al., 2015; Wen and
Pan, 2016), relatively medium and high concentrations of BaP (0.38 and
3.8 μg/L, respectively) were chosen to investigate the ecotoxicological
effects on bivalves. The concentrated stock solution of BaP was prepared
by dissolving in DMSO and contained a consistence of 0.001% DMSO.
DMSO has no influence on scallops according to our preliminary works
(Tian et al., 2015; Yao et al., 2017). During the acclimation and exposure
experiment, scallops were fed daily with fresh microalgae
Y. Yang et al. Environmental Research 191 (2020) 110125

Phaeodactylum tricormiyum (2.5–3.0 × 105 cells/mL) and dried powder
of microalgae Spirulina platensis (1.0 g/mL). Half of the exposure me­
dium in each tank was renewed daily to maintain the relatively constant
experimental conditions, including stable exposure concentrations, the
physical and chemical indexes of seawater (pH, temperature, dissolved
oxygen and salinity), and a certain density of microalgae. The pH,
temperature, dissolved oxygen and salinity were monitored every day,
and detailed values were presented in Supplementary Information
(Table S1). All animal experiments were conducted following the
Committee of Laboratory Animal Care and Use at Ocean University of
China.
Based on characteristics of gametogenesis and diameters of germinal
cells (Park et al., 2013), we examined the stages of testicular develop­
ment by observing gonadal condition based on our rich experience in
C. farreri culture (Supplementary Information, Fig. S1) and imaging
testicular histology with Nikon microscope (Nikon, Japan). The chronic
BaP treatments were performed in three successive reproductive stages:
stage I (early gametogenesis stage), stage II (late gametogenesis stage),
and stage III (ripe stage). From day 0–3, the experimental scallops were
at stage I; from day 10–17, the experimental scallops were at stage I;
then male scallops reached sexual maturity at day 24 (stage III).
Therefore, the sampling times were determined by the stages of gonadal
development.
Then, male scallops were sampled at days 0, 3, 10, 17 and 24, and
executed as follows: (1) Four individual scallops were randomly selected
from each replicate. The weights of total soft tissue and testis were
recorded, and then the GSI values were calculated. GSI values= (weight
of gonad/weight of total soft tissue body) *100%. (2) At day 24, eight
individual scallops were sampled and dissected to separate testis for
mature sperm counting. (3) Testicular samples of three individuals from
each replicate were dissected, and then stockpiled at − 80 ◦ C for
measuring sex steroids concentrations. (4) Testicular samples of three
individual scallops were dissected and grinded in liquid nitrogen, and
then stockpiled at − 80 ◦ C for the extraction of RNA. (5) Four individuals
were randomly selected from each replicate for evaluating testicular
histology.
supernatants were carefully collected. Then, E2, T and P concentrations
were analyzed following the instructions of ELISA kits (Shanghai
Lengton Bioscience Co., China) (Cat BPET058, BPET045 and BPET029,
respectively). Finally, the data was quantified at 450 nm by using
MULTISKAN GO (Thermo, Finland). The detection limits were 2 ng/mL,
0.2 ng/mL and 0.2 ng/mL for E2, T and P, respectively.
2.6. Quantitative real-time PCR (qRT-PCR) analysis
The relative transcriptional levels of genes were measured with qRT-
PCR. The β-actin was regarded as housekeeping gene in the present
study. The primer sequences of these genes were listed in Table 1. Total
RNA was extracted from testis using RNAiso Plus (TaKaRa, Dalian,
China). The concentration and quality of RNA were verified with
MULTISKAN GO (Thermo, Finland). Then, cDNA were obtained from
RNA samples (1 μg) by using the PrimeScript™ RT reagent Kit (TaKaRa,
Dalian, China). For qRT-PCR reactions, the Thermal Cycler 5100
(Thermo, Finland) was used. The relative transcriptional levels of target
genes were normalized to the housekeeping gene, and evaluated with
the 2− ΔΔCt methods according to Livak and Schmittgen (2001).
2.7. Histological examination of testis
Histology of testis was observed because gonadal tissue development
could be disrupted by BaP (Tian et al., 2015). Testes were washed in PBS
and fixed in formalin (10%) for 48 h at room temperature. Testes were
dehydrated in ascending grades of ethanol and xylene, and embedded in
paraffin. Then, testes were sectioned at 5 μm thickness, and stained with
Ehrlich’s hematoxylin and eosin (HE). At last, gonadal cross-sections
were photographed using a microscope (Nikon, Japan). The propor­
tion of each cell type at each stage was shown as the percentage of sperm
counts in sections examined.
2.8. Data analysis
The data were statistically analyzed by SPSS 25.0 for Mac (SPSS,

2.3. Chemical analysis

Table 1
Primer sequences for genes used in the present study.
Seawater samples in triplicate were collected before and after
Gene name Primer Sequence (5′ -3′ ) Accession number
seawater replacement for the analysis of BaP concentrations. The actual
BaP concentrations were measured by using the high performance liquid β-actin F: TTCTTGGGAATGGAATCTGC AY335441.2
R: TCTGCGATACCTGGGAACAT
chromatograph (HPLC Shimadzu, LC-20AT, Japan) as described by Pan
fshr F: GCCAATAGAAAGAGCAGT PRJNA185465
et al. (2017). The measured concentrations of BaP were presented by R: ACATCACTTAGGCACGAC
mean ± standard deviation and % (measured/nominal). During the lhcgr F: GTGTAAGTCGCTTGTTGAA SRP018044
exposure period, the measured concentrations in BaP exposure groups of R: TGTATGGGAGTGTATCTGG
0.38 and 3.8 μg/L were 0.36 ± 0.01 (95%) and 3.65 ± 0.12 (96%) μg/L, adcy9 F: TAACGACTCTTGCGATGT PRJNA185465
R: TCTGTGCCTCTGGGTGT
respectively. And BaP concentrations in control seawater were not
PLC F: CTACCATCCCAACAGTCA SRP018044
detected. The measured concentrations were close to the corresponding R: ATCAACTCCTCCCACAAC
nominal concentrations, therefore the nominal BaP concentrations were PKAc F: CCACCCTTCTTTGCTGAC PRJNA185465
used throughout the manuscript. R: AGGTTGCCGTATCGTTTT
PKC F: CTGTGGGTCCCTGCTCTA PRJNA185465
R: TGGATTGGTCCTCTGGTA
2.4. Mature sperm number count NR5A2 F: CCATTTGTTGGAGGATTG SRP018044
R: GAGGCAGTGAGACAGGATAG
Mature sperms were acquired with the method of Tian et al. (2015). 3β-HSD F: CTCGGCGTACTTCTTCCTCAT SRP018044
The diluted sperms were delivered in a hemocytometer for counting R: GGTTTTCTTGGACAACACATT
CYP17a F: AGGATGTGGACGATGCTTTTC SRP018044
sperm number under the microscope.
R: CTTCGCTTCAGACTTCCGAGG
17β-HSD1 F: GACGGGCATTCTCATCCAT SRP018044
2.5. Determination of sex steroids concentrations R: TACTGACACACTCCGACAAGA
ccnd2 F: GTCGCCGAATGGATGTT PRJNA185465
R: GCACACACATCCCAGAAGT
Testicular subsamples (1g) were homogenized in PBS (5 mL,
SCP3 F: GTAAAGGGAATGGAGGAT SRP018044
pH = 7.4) at 4 ◦ C for 10 min with Teflon homogenizer and wheaton R: TCTGTAGCGACTTTCTCAC
glass. Hemolymph was collected from adductor muscle with a sterilized NRF1 F: CTTTGTGCCAAGCAGTTCA SRP018044
syringe, and then put into falcon tubes which contains an equal volumes R: TTGGGACGACTTGTGTAGGTA
of anti-coagulant. Both testicular homogenate and hemolymph samples AQP9 F: GCTTTCCGAGGACGACTAC SRP018044
R: AACGCCGCCATCATAAT
from each treatment were centrifuged at 3000 rpm (20 min, 4 ◦ C). Their

3
Y. Yang et al.
USA) and diagrams were created by GraphPad Prism 8.0 for Mac
(GraphPad, CA). All values are shown as the mean ± standard deviation
(SD). Shapiro-Wilk test was used to evaluate the normality of values.
Then the values were verified for homogeneity by using Levene’s test.
Statistical differences between control groups and BaP treatments were
evaluated using one-way analysis of variance (one-way ANOVA) fol­
lowed by Dunnett’s post-hoc test to the P-values (*, P < 0.05; **,
P < 0.01).
3. Results
3.1. GSI and sperm numbers in scallops
BaP exposure significantly decreased GSI values in male scallops at
the stage II (day 17: P0.38 = 0.012; P3.8 = 0.001) and stage III (day 24:
P0.38 = 0.006; P3.8 < 0.001)(Fig. 1A). However, GSI of male scallops in
BaP treatments did not show significant alterations at the stage I (days
0 and 3) and stage II (day 10) (Fig. 1A). After the 24-day exposure, the
number of sperm in two BaP treatment groups were significantly
reduced depending on a concentration effect (P0.38 < 0.001;
P3.8 < 0.001), compared to that in control (Fig. 1B).
3.2. Influence of BaP on sex steroid concentrations and E2/T ratio
Influence of BaP on sex steroid concentrations and E2/T ratio in testis
were observed (Fig. 2A). In control groups, E2 levels reduced at day 3,
increased at day 10 and then kept on decreasing during days 10–24. T
concentrations in control continued increasing during the 24 days of test
period. In BaP exposure groups, the contents of E2 and T significantly
lessened at the stage II (day 17) (E2: P0.38 < 0.001; P3.8 = 0.013; T:
P0.38 = 0.002, P3.8 = 0.025) and stage III (day 24) (E2: P0.38 = 0.020;
P3.8 = 0.007; T: P0.38 < 0.001, P3.8 <0.001). In contrast, E2 levels in testis
were significantly increased following treatments with 3.8 μg/L BaP at
the stage I (day 3) (P < 0.001). 3.8 μg/L of BaP exposure significantly
decreased the concentrations of P at stage II (day 10) (P = 0.049; day 17:
P = 0.021) and stage III (day 24) (P = 0.023). 0.38 μg/L of BaP exposure
decreased P levels at the stage I (day 3) (P = 0.004) and stage II (day 10,
P = 0.007; day 17, P < 0.001), but increased P levels at the stage III (day
24) (P = 0.015). The E2/T ratios were significantly increased following
treatment with 0.38 and 3.8 μg/L BaP at the stage I (day 3)
(P0.38 < 0.001; P3.8 < 0.001), stage II (day 10) (P3.8 < 0.001) and stage II
(day 24) (P0.38 = 0.005, P3.8 = 0.049).
Influence of BaP on sex steroid concentrations and E2/T ratio in
hemolymph were observed (Fig. 2B). Compared to the control group, E2
concentrations in hemolymph were significantly increased in BaP
Fig. 1. Impacts of BaP on fecundity of male scallops. A: gonadosomatic index (GSI); B: the number of mature sperm. Asterisks indicate statistically significant
differences compared to the control group (*P < 0.05; **P < 0.01). Data are given as mean ± SD of three replicates.
4
Environmental Research 191 (2020) 110125
exposure groups at the stage I (day 3, P0.38 < 0.001, P3.8 < 0.001), stage
II (day 17, P0.38 = 0.002, P3.8 < 0.001) and stage III (day 24,
P0.38 = 0.684, P3.8 < 0.001). Conversely, E2 concentrations decreased
markedly in response to 3.8 μg/L BaP at the stage II (day 10) (P < 0.001).
The levels of T were significantly increased by exposure to 0.38 μg/L BaP
at the stage II (day 10) (P < 0.001). Scallops from BaP treatment groups
did not exhibit any significant changes to the levels of T at the stage I
(day 3, P0.38 = 0.670, P3.8 = 0.758), stage II (day 17, P0.38 = 0.963,
P3.8 = 0.286) and stage III (day 24, P0.38 = 0.151, P3.8 = 0.117). BaP
exposure significantly lowered the levels of P at the stage II (days 10,
P0.38 = 0.012, P3.8 < 0.001; day 17, P0.38 = 0.007, P3.8 = 0.126) and
stage III (day 24, P0.38 = 0.008, P3.8 = 0.003). The ratios of E2/T in BaP
test solutions significantly increased at the stage I (day 3, P0.38 = 0.002,
P3.8 = 0.016), stage II (day 17, P0.38 = 0.002, P3.8 < 0.001) and stage III
(day 24, P3.8 = 0.005), comparing with the control group. In contrast,
the E2/T ratio significantly decreased in BaP test solutions at the stage II
(day 10, P0.38 < 0.001, P3.8 < 0.001).
3.3. Influence of BaP on transcriptions of genes within the steroidogenesis
pathway
A total of ten steroidogenic genes were measured for their tran­
scriptional alterations in male scallop testis upon BaP exposure, and the
results were shown in Fig. 3. The transcriptions of follicle stimulating
hormone receptor (fshr), adenylate cyclase (adcy), and phospholipase C
(PLC) were significantly down-regulated in response to BaP at the stage I
(day 3, fshr: P0.38 = 0.005, P3.8 = 0.008; adcy: P0.38 = 0.006,
P3.8 = 0.004; PLC: P0.38 = 0.067, P3.8 = 0.013) and stage II (day 10, fshr:
P0.38 = 0.009, P3.8 = 0.182; adcy: P0.38 = 0.024; PLC: P0.38 < 0.001,
P3.8 = 0.002). BaP exposure also significantly decreased the transcripts
of protein kinase catalytic subunit A (PKAc), PKC and nuclear receptor
5A subfamily 2 (NR5A2) at the stage II (day 10) (PKAc: P0.38 = 0.005;
PKC: P0.38 = 0.004, P3.8 = 0.027; NR5A2: P0.38 = 0.013). In contrast, the
up-regulation of luteinizing hormone/choriogonadotropin receptor
(lhcgr) was induced by exposure to 3.8 μg/L BaP at the stage II (day 10)
(P = 0.003). Similarly, significant up-regulation of adcy, PKAc and
NR5A2 were observed in BaP exposures at the stage II (day 17, adcy:
P0.38 = 0.005; PKAc: P0.38 < 0.001; NR5A2: P0.38 = 0.039) and stage III
(day 24, adcy: P0.38 = 0.03, P3.8 = 0.001; PKAc: P0.38 = 0.013; NR5A2:
P0.38 = 0.013, P3.8 = 0.033). In addition, the significant down-regulation
was detected for transcriptional levels of downstream steroidogenesis
enzymes (CYP17 and 17β-HSD) in testis following 24 days of BaP
exposure (P < 0.01), while significant up-regulation of 3β-HSD was
induced in BaP exposure groups at the stage II (day 17, P0.38 = 0.031)
and stage III (day 24, P0.38 < 0.001, P3.8 < 0.001).
Y. Yang et al. Environmental Research 191 (2020) 110125

Fig. 2. Influence of BaP on E2, T and P concentrations and E2/T radio in male scallops. A: testis; B: hemolymph. Statistically significant differences between exposure
groups and the control group are indicated (*P < 0.05; **P < 0.01). Data are given as mean ± SD of three replicates.

5
Y. Yang et al.
Fig. 3. Transcriptional levels of genes in the testes of scallops after exposure to BaP. I: genes within the steroidogenesis pathway (A: gonadotropin receptors; B–D:
PKA and PKC signaling; E: steroidogenesis enzymes). II: spermatogenesis-related genes. The expression profiles are presented with the heat map.
3.4. Influence of BaP on expressions of spermatogenesis-related genes
As shown in Fig. 3, the transcriptions of genes within spermatogen­
esis were all down-regulated in male scallop testis exposed to BaP.
3.8 μg/L BaP decreased the mRNA levels of cyclin D2 (ccnd2) at the stage
I (day 3) (P < 0.01), while the expressions of ccnd2 showed no signifi­
cant changes in BaP test solutions at the stage II (days 10 and 17) and
stage III (day 24). As for synaptonemal complex protein 3 (SCP3) and
nuclear respiratory factor 1 (NRF1) transcription, obvious reduction was
detected in BaP exposure groups at the stage I (day 3) and stage II (days
10 and 17) (P < 0.01). Moreover, the significant down-regulation of
aquaporin 9 (AQP9) was induced following BaP exposure at the stage II
(days 10 and 17) and stage III (day 24) (P < 0.01).
3.5. Histological examination of testis
According to characteristics of spermatogenesis, the testicular
development was divided into four different categories (Park et al.,
2013). Histology of testis from male scallops in control showed regular
characteristics of spermatogenesis and experienced three successive
reproductive stages: stage I (early gametogenesis stage); stage II (late
gametogenesis stage); stage III (ripe stage) (Fig. 4A–E). (a) stage I (early
gametogenesis stage): during day 0–3, histological sections of testis
displayed that the follicle walls were composed of spermatogonia and
spermatocytes, and the amount of spermatocytes increased in a gradual
way (Fig. 4 A, B); (b) stage II (late gametogenesis stage): from day
10–17, spermatocytes and spermatids counts increased progressively
and several layers of spermatocytes were observed, while sperm cells in
diverse phases of spermatogenesis coexisted in testis (Fig. 4 C, D); (c)
stage III (ripe stage): male scallops have already reached sexual maturity
at day 24, as the follicles were predominantly composed of mature
spermatozoa which arranged in a radial manner (Fig. 4 E).
Although scallops in BaP treatment groups also experienced these
three different stages, the process of testicular development and sper­
matogenesis were retarded evidently (Fig. 4F–O). Atrophy of gonadal
follicles and emission of immature sperm cells were observed in the
testis of scallops at the stage II (days 10 and 17) following dose and
exposure time (Fig. 4H, I, M, N). Sloughing of spermatids and thickened
basement membrane of follicles appeared in testis from BaP test solu­
tions at the stage II (day 17) and stage III (day 24) (Fig. 4I, J, M, N). After
6
Environmental Research 191 (2020) 110125
24 days’ exposure, the characteristic radial structures of germinal
epithelium were damaged depending on a dose-dependent manner in
male scallops exposed to BaP (Fig. 4J, O). And greater disorders of
spermatogenesis were observed by exposure to 3.8 μg/L BaP at the stage
III (day 24), with abnormal aggregates of spermatid and spermatozoids
(Fig. 4O). In testis, a significant decrease in the percentage of sper­
matocytes was induced by BaP at the stage II (day 10), whereas BaP
exposure decreased the relative percentages of spermatids spermato­
zoids at the stage II and stage II (Fig. 5). The relative percentages of
spermatocytes and spermatids were significantly increased in response
to BaP exposure at the stage II (day 17) and stage III (day 24), respec­
tively (Fig. 5).
4. Discussion
Considering the seriousness of PAHs pollution in marine environ­
ment, high concerns are rising on their toxic effects, especially for
reproductive toxicity on diverse marine organisms. Nevertheless, the
potential molecular mechanisms of reproductive toxicity to male bi­
valves during diverse reproductive stages remain ambiguous. In this
study, fecundity (GSI and sperm count), steroidogenesis pathway (sex
steroid concentrations, the upstream gonadotropin receptor-mediated
signaling and downstream enzymes), genes involved in spermatogen­
esis and testicular histology were observed in male scallops. Accord­
ingly, these results could provide new insights into understanding the
mechanisms of reproductive toxicity to diverse reproductive stages of
male bivalves.
The GSI values are regarded as an important indicator of gonadal
development, and are frequently used as an unspecific biomarker of
EDCs in organisms (Corsi et al., 2003; Hutchinson et al., 2006). In a
recent study on male adult tilapia, the GSI was significantly reduced
following a 26-day BaP exposure, indicating that BaP may cause damage
to gametogenesis and be the endocrine disrupting compound (Cristina
Colli-Dula et al., 2018). Previously, it was documented that PAHs could
cause alterations in GSI values of adult fathead minnow (Pimephales
promelas) by changing the number and size of germ cells (Loughery
et al., 2018). Our observation of significant decrease in both GSI and
sperm numbers suggests that BaP has adverse effects on sexual devel­
opment and spermatogenesis.
Sex steroids hormones (E2, T and P) and their balance play pivotal
Y. Yang et al. Environmental Research 191 (2020) 110125

Fig. 4. Testicular histology of male scallops at the early gametogenesis stage, late gametogenesis stage and ripe stage. A–E: control (0 μg/L BaP); F–J: 0.38 μg/L BaP;
K–O: 3.8 μg/L BaP. Gonadal follicle (gf); spermatogonia (Sg); spermatocytes (Sc); spermatids (St); spermatozoids (Sz). H&E ( × 100).

Fig. 5. Impacts of BaP on the relative percentage of diverse stages of sperm cells in male scallops. Statistically significant differences between exposure groups and
the control group are indicated (*P < 0.05; **P < 0.01). Data are given as mean ± SD of three replicates.

7
Y. Yang et al. Environmental Research 191 (2020) 110125

roles in controlling sexual maturation and gametogenesis of bivalves
(Croll and Wang, 2007; Ketata et al., 2007; Zheng et al., 2014). The
gonad and digestive gland are reported to be steroid-producing organs
(Croll and Wang, 2007). Even though digestive gland appear to produce
sex steroids, the highest levels of sex steroids in bivalves were detected
in gonads (Janer and Porte, 2007). And it is sex steroids synthesized in
gonads that vary with the reproductive cycle and play a role in game­
togenesis and gonadal development (Fernandes et al., 2011; Liu et al.,
2014). In this study, sex steroid levels in both gonad and hemolymph
were analyzed to investigate the effects of BaP on steroid production and
circulating levels, respectively. E2 and T levels in control testis keep on
decreasing and increasing, respectively. Matsumoto et al. (1997) re­
ported that sex steroid levels varied with the reproductive cycle and
might play an important part in gonadal development. Therefore, the
significant increase and decrease in sex steroid of male scallops were
major reasons for the inhibited testicular development. In this work, a
significant increase in the ratio of E2/T following BaP exposure suggests
that the balance between E2 and T is disrupted. And this result shows
that BaP may produce the estrogen effect in male scallops. Similarly,
recent studies reported that BaP was a typical estrogen chemical that
could increase female individuals in marine polychaete (Perinereis nun­
tia) (Wu et al., 2017). Conversely, BaP decreased contents of E2 and T in
an anti-estrogenic manner in pre-spawn rainbow trout (Oncorhynchus
mykiss) and mature female scallops (C. farreri) (Kennedy and Smyth,
2015; Yang et al., 2020). These data suggested that the estrogenic and
anti-estrogenic impacts of BaP on sex steroid production and E2/T ratios
differed in diverse reproductive systems. And the opposite effects may
be associated with species, genders or BaP concentrations.
However, the hormonal variation in hemolymph was inconsistent
with that in gonad, and the significant decreased-ratio of E2/T was
contrary to the increased-ratio of E2/T in gonad. The results suggested
that other steroids-producing organs which may mediate the total levels
of steroids releasing to hemolymph were also damaged after exposure to
BaP. To well clarify the difference in both hormonal levels and E2/T
ratio between gonad and hemolymph under BaP exposure, further study
needs to be conducted.
The production of sex steroids in gonads is regulated by the complex
steroidogenesis pathway which contains complicated regulatory factors.
Therefore, the measurement of gene transcriptions along the steroido­
genesis pathway would enhance the estrogenic effects on male scallops
(Fig. 6). And the measurement of gene transcriptions along the ste­
roidogenic pathway has been used as a functional biomarker for varia­
tions in sex steroid concentrations (Lee et al., 2018). The activated
gonadotropin receptors (fshr and lhcgr) play crucial roles in regulating
sex steroids synthesis and reproduction through promoting transcription
of genes within the steroidogenesis pathway, including upstream PKA
and PKC signaling and downstream steroidogenesis enzymes (Ohta
et al., 2007; Stocco et al., 2005). Fshr and lhcgr could be activated once
follicle stimulating hormone and luteinizing hormone interact with
them, respectively, and consequently promoting gametogenesis. Previ­
ous studies showed that the significant down-regulation of fshr and lhcgr
caused significant decrease in E2 levels (Pogrmic-Majkic et al., 2018;
Saunders et al., 2015; Teng et al., 2020). In addition, the transcripts of
fshr and lhr and the contents of E2 and T in zebrafish exposed to
4-hydroxyphenyl, 4-isoprooxyphenylsulfone were lower than those in
control zebrafish (Lee et al., 2018). In the present study, the
down-regulation of fshr, adcy, PKAc and PLC in male scallops exposed
BaP at the early gametogenesis stage and late gametogenesis stage
suggests possible negative impacts on the steroidogenesis signaling
pathway and sex steroids production. The upstream second messengers
(adcy-PKA and PLC-PKC signaling) are regulated by the active fshr and
lhcgr (Stocco et al., 2005). The up-regulation of lhcgr, adcy and PKAc in
male scallops at the late gametogenesis stage and ripe stage suggests that
BaP could regulate lhcgr expressions, which could subsequently impact
adcy and PKAc transcripts. However, our previous study showed that the
expressions of lhcgr, adcy and PKAc decreased in female scallops from
BaP treatment groups (Yang et al., 2020). The diverse impacts of BaP on
male and female scallops could be associated with gender, and need to
be clarified in further studies. The upstream second messenger pathways
could stimulate NR5A2 gene transcription, which could subsequently
activate the downstream steroidogenesis enzymes, including 3β- or
17β-HSD, CYP 17 and CYP 19) (Clark and Stocco, 2014). Suzawa and
Ingraham (2008) showed that atrazine significantly up-regulated tran­
scriptions of NR5A receptor subfamily, which were probably mediated
by cAMP signaling in the second messenger pathways. In the present
study, NR5A2 transcriptions were suppressed in male scallops at the late

Fig. 6. Transcriptomic response of genes within the steroidogenesis pathway in male scallops following BaP exposure. Different colors represent different changes in
gene expression levels. Red represents that gene expression levels are up-regulated after exposure to BaP. Blue represents that gene expression levels are down-
regulated after exposure to BaP. Green represents that gene expression levels have opposite changes in BaP treatment groups at the same reproductive stage. For
instance, the expression levels of adcy were significantly down-regulated at day 10 (late gametogenesis stage), whereas they were up-regulated at day 17 (late
gametogenesis stage). Furthermore, grey color represents that all gene expressions are not significantly changed. (For interpretation of the references to color in this
figure legend, the reader is referred to the Web version of this article.)

8
Y. Yang et al.
gametogenesis stage (day 13), while they were up-regulated in male
scallops at the late gametogenesis stage (day 17) and ripe stage. The
adverse impacts on NR5A2 mRNA levels were likely mediated by the
amplification of PKA and PKC signaling at relevant stages. Besides, the
up-regulation of 3β-HSD at the late gametogenesis stage and ripe stage
suggests the positive correlations between NR5A2 and 3β-HSD. Simi­
larly, a recent study showed that atrazine could directly increase NR5A
mRNA levels, causing the up-regulation of steroidogenic enzymes in
mammalian cells (Suzawa and Ingraham, 2008). Taken together, these
results showed that BaP could interrupt sex steroids secretion via the
convergence of fshr, lhcgr, PKA and PKC signaling and NR5A2 activity,
and as a consequent disrupt normal reproductive functions in bivalves.
The downstream steroidogenesis enzymes are critical for sex steroid
biosynthesis and they have been proposed in mollusks (Blalock et al.,
2018; Fernandes et al., 2011; Lafont and Mathieu, 2007). Our obser­
vation of significant decrease in hemolymph E2 and T contents was
supported by the down-regulation of CYP17 and 17β-HSD during the
entire experiment (Fig. 6). In bivalves, 3β-HSD is a primary enzyme
generating the production of progesterone, CYP17 is a necessary enzyme
catalyzing the reduction of progesterone to androstenedione, and
17β-HSD is responsible for the conversion for the androstenedione to
testosterone (Liu et al., 2014; Thitiphuree et al., 2019). Although genes
within the steroidogenesis enzymes are not transcribed to the same
degree, enzyme activities are generally connected with their transcrip­
tional levels (Trant et al., 2001). Therefore, significant alterations in
these key enzymes were modulated by the upstream PKA and PKC
signaling, which may disrupt the steroidogenic process and alter sex
steroids levels in male scallops. However, CYP19, a critical enzyme
catalyzing the conversion of T to E2 in vertebrates, has not been iden­
tified in invertebrates. The precise pathway for this conversion in in­
vertebrates is still unclear. To summarize, the present results manifest
that BaP, as an estrogenic-like chemical, can interfere with PKA and PKC
signaling pathways, and subsequently alter transcription levels of ste­
roidogenesis enzymes, and suppressed the production of endogenous
hormones.
Increasing evidence has demonstrated that the estrogenic effects in
response to EDCs could inhibit the process of spermatogenesis (Cardone
et al., 2002; de Almeida et al., 2018). And imbalance in sex steroid levels
was responsible for disruption on spermatogenesis of male organisms
(Wang et al., 2019b; Yin et al., 2017). In this study, the correlation be­
tween estrogenic effects (increase in E2/T ratio) and reduced sperm
numbers suggested that BaP impaired spermatogenesis at diverse
reproductive stages in an estrogenic manner. In fact, spermatogenesis in
bivalves is a complex process including germ cell proliferation (mitosis),
gametic meiosis and energy production (Hodgson, 1986). Ccnd2 has
been found to regulate mitosis progression of germinal cells and play an
important role in germinal cell proliferation (Pradeep et al., 2002;
Robker and Richards, 1998). It was reported that ccnd2 mRNA levels
were suppressed in DEHP-treated Sertoli cells, indicating that DEHP may
disturb cell division though changing transcriptions of ccnd2 (Li et al.,
2000). The present study revealed that BaP exposure caused significant
down-regulation of ccnd2 at the late gametogenesis stage, indicating
that BaP could impede spermatogonial cells proliferation. And the
down-regulated transcription of ccnd2 provided possible evidence for
the decreased number of spermatogonial cells at the early gametogen­
esis stage. Previous investigations have demonstrated that synaptone­
mal complex developed between homologous chromosomes was
necessary for regular gametic meiosis (Aarabi et al., 2006; Syrjaenen
et al., 2014). SCP3 is specifically localized in primary spermatocytes and
plays a vital role in meiosis of spermatogenesis in male scallops
(C. farreri) (Ma et al., 2017). In the present study, SCP3 mRNA levels
were significantly down-regulated in testis treated with BaP. The results
were consistent with the reduced number of spermatocytes following
BaP exposure at the early gametogenesis stage and late gametogenesis
stage. NRF1 is an important regulator involving in oxidative phosphor­
ylation of mitochondria which could provide energy for sperm cells to
9
Environmental Research 191 (2020) 110125
ensure their normal development and survival (Ramalho-Santos et al.,
2009; Scarpulla, 2008). In the present study, the significantly decreased
mRNA levels of NRF1 were in accordance with the reduced number of
spermatocytes at the early gametogenesis stage and late gametogenesis
stage. Similarly, a previous study showed that ablation of NRF1 in sperm
cells impeded germ cell proliferation, and subsequently led to sterility in
male mice (Wang et al., 2017). These data suggest that the
down-regulated NRF1 transcripts may also be responsible for decreased
sperm counts and disrupted spermatogenesis. Aquaporins, trans­
membrane channel proteins mediating water transport and providing
aerobic metabolic substrate (glycerol) for sperm, play an important part
in regulating sperm maturation during spermatogenesis (Boj et al.,
2015; Calamita et al., 2001; Chauvigne et al., 2011). Arena et al. (2011)
reported that down-regulation of AQP9 led to hypo-spermatogenesis in
male reproductive systems. In this study, male exposure to BaP
down-regulated AQP9 transcriptions, which was associated with
decreased percentage of sperm at the late gametogenesis stage and ripe
stage. Similarly, in adult rare minnow (Gobiocypris rarus) exposed to
Bisphenol A, the decreased AQP3 and AQP8 expressions may also play
significant roles in reducing sperm quality and increasing abnormal
sperm (Zhang et al., 2018). Overall, the present study demonstrated that
BaP could interrupt the spermatogenesis process in male scallops at
diverse stages of reproduction through disturbing mitosis, meiosis and
energy production of germinal cells, sequentially.
The histology of testis in invertebrates is known as powerful evidence
for reproductive impairment, experiencing suppression of spermato­
genesis, reduction in germ cell counts and disorder of testicular archi­
tectures (Alonso et al., 2019). The process of gonadal development in
scallops is separated into four stages: early gametogenesis stage (stage I),
late gametogenesis stage (stage II), ripe stage (stage III) and resting stage
(stage IV) in accordance with characteristics of gametogenesis and di­
ameters of germinal cells (Park et al., 2013). Our observations of control
testicular histology showed regular characteristics of spermatogenesis at
the stage I, stage II and stage III, indicating that male reproductive
systems of scallops from the control group worked in a good way.
However, histopathological disorders and suppressed sperm production
were detected in BaP-treated male scallops. The pathologies followed a
growing malignancy sequence relying on dose-time effects: atrophy of
gonadal follicles, emission of immature sperm cells, sloughing of sper­
matids, thickened basement membrane of follicles, damaged radial
structures and finally disorders of sperm cells. These data indicate that
BaP actually has adverse effects on gonadal development and sper­
matogenesis, which is associated with the decreased GSI and sperm
counts at the late active stage and ripe stage. The results are consistent
with our previous work, which performed spermatogenesis disruption
and disorders of germinal cells in pre-spawn scallops (C. farreri) and
manila clam (Ruditapes philippinarum) exposed to BaP and BDE-47,
respectively (Liu et al., 2017; Tian et al., 2015). The histopathological
disorders would reduce the quality and number of sperms, damage the
reproductive function, and ultimately have adverse impacts on the
sustainability of bivalve resource.
5. Conclusion
In conclusion, the present study systematically demonstrated the
underlying molecular mechanisms of BaP-caused reproductive toxicity
on diverse reproductive stages of male scallops C. farreri. Reproductive
cycle exposure to BaP could lead to significant decrease in GSI and
mature sperm counts in male scallops. And the estrogen-like (increase in
E2/T ratio) endocrine disrupting effects were observed in males which
might attribute to the inhibited testicular development. The changes in
sex steroid contents were supported by a battery of negative responses
along the steroidogenesis pathway, ranging from the preliminary
adverse impacts on transcripts of fshr, lhcgr, upstream PKA and PKC
signaling, to the negative regulation on their downstream enzymes. BaP
exposure also disturbed germ cell proliferation (ccnd2 transcripts),
Y. Yang et al.
meiosis (SCP3 transcripts) and energy metabolism (NRF1 and AQP9
transcripts) in testis following a stage-specific pattern, thereby disrupt­
ing spermatogenesis in males. In addition, the testicular histology were
examined to certify the damage on testicular development and sper­
matogenesis. Overall, our study demonstrated that BaP exposure dis­
rupted steroidogenesis, impaired spermatogenesis and caused
histological damages, and consequently induced reproductive toxicity
on diverse reproductive stages of male scallops. The negative outcomes
should be taken into account during bivalve population conservations
and ecological risk assessments.
Credit authors contribution statement
Yingying Yang: Conceptualization, Methodology, Investigation,
Formal analysis, Resources, Writing - original draft, Writing - review &
editing. Luqing Pan: Conceptualization, Methodology, Resources.
Yueyao Zhou: Investigation, Formal analysis. Ruiyi Xu: Investigation.
Dongyu Li: Investigation.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgements
This work was supported by the Key Research and Development
Program of Shandong Province (2018GHY115007). We thank the staff
of the Laboratory of Physiology for the help with the exposure and
scallops sampling.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.envres.2020.110125.
References
Aarabi, M., Modarressi, M.H., Soltanghoraee, H., Behjati, R., Amirjannati, N.,
Akhondi, M.M., 2006. Testicular expression of synaptonemal complex protein 3
(SYCP3) messenger ribonucleic acid in 110 patients with nonobstructive
azoospermia. Fertil. Steril. 86, 325–331. https://doi.org/10.1016/j.
fertnstert.2005.12.070.
Alonso, A., Suarez, P., Ruiz, Y., Dobal, V., San Juan, F., 2019. Gonadal histopathological
disorders in Mytilus galloprovincialis male exposed to tars used in mussel farms. Front.
Mar. Sci. 6 https://doi.org/10.3389/fmars.2019.00577.
Arena, S., Arena, F., Maisano, D., Di Benedetto, V., Romeo, C., Nicotina, P.A., 2011.
Aquaporin-9 immunohistochemistry in varicocele testes as a consequence of hypoxia
in the sperm production site. Andrologia 43, 34–37. https://doi.org/10.1111/
j.1439-0272.2009.01009.x.
Au, D.W.T., Yurchenko, O.V., Reunov, A.A., 2003. Sublethal effects of phenol on
spermatogenesis in sea urchins (Anthocidaris crassispina). Environ. Res. 93, 92–98.
https://doi.org/10.1016/s0013-9351(02)00094-4.
Blalock, B.J., Robinson, W.E., Loguinov, A., Vulpe, C.D., Krick, K.S., Poynton, H.C., 2018.
Transcriptomic and network analyses reveal mechanistic-based biomarkers of
endocrine disruption in the marine mussel, Mytilus edulis. Environ. Sci. Technol. 52,
9419–9430. https://doi.org/10.1021/acs.est.8b01604.
Boj, M., Chauvigne, F., Cerda, J., 2015. Aquaporin biology of spermatogenesis and sperm
physiology in mammals and teleosts. Biol. Bull. 229, 93–108. https://doi.org/
10.1086/BBLv229n1p93.
Bonnefille, B., Gomez, E., Alali, M., Rosain, D., Fenet, H., Courant, F., 2018.
Metabolomics assessment of the effects of diclofenac exposure on Mytilus
galloprovincialis: potential effects on osmoregulation and reproduction. Sci. Total
Environ. 613, 611–618. https://doi.org/10.1016/j.scitotenv.2017.09.146.
Bryan, G.W., Gibbs, P.E., Hummerstone, L.G., Burt, G.R., 1986. The decline of the
gastropod Nucella lapillus around south-west england: evidence for the effect of
tributyltin from antifouling paints. J. Mar. Biol. Assoc. U. K. 66, 611–640. https://
doi.org/10.1017/S0025315400042247.
Bugel, S.M., White, L.A., Cooper, K.R., 2010. Impaired reproductive health of killifish
(Fundulus heteroclitus) inhabiting Newark Bay, NJ, a chronically contaminated
estuary. Aquat. Toxicol. 96, 182–193. https://doi.org/10.1016/j.
aquatox.2009.10.016.
10
Environmental Research 191 (2020) 110125
Calamita, G., Mazzone, A., Bizzoca, A., Svelto, M., 2001. Possible involvement of
aquaporin-7 and-8 in rat testis development and spermatogenesis. Biochem. Biophys.
Res. Commun. 288, 619–625. https://doi.org/10.1006/bbrc.2001.5810.
Cao, F., Martyniuk, C.J., Wu, P., Zhao, F., Pang, S., Wang, C., et al., 2019. Long-term
exposure to environmental concentrations of Azoxystrobin delays sexual
development and alters reproduction in zebrafish (Danio rerio). Environ. Sci.
Technol. 53, 1672–1679. https://doi.org/10.1021/acs.est.8b05829.
Cappello, T., Fernandes, D., Maisano, M., Casano, A., Bonastre, M., Bebianno, M.J., et al.,
2017. Sex steroids and metabolic responses in mussels Mytilus galloprovincialis
exposed to drospirenone. Ecotoxicol. Environ. Saf. 143, 166–172. https://doi.org/
10.1016/j.ecoenv.2017.05.031.
Cardone, A., Comitato, R., Bellini, L., Angelini, F., 2002. Effects of the aromatase
inhibitor Fadrozole on plasma sex steroid secretion, spermatogenesis and epididymis
morphology in the lizard, Podarcis sicula. Mol. Reprod. Dev. 63, 63–70. https://doi.
org/10.1002/mrd.10151.
Chatel, A., Bruneau, M., Lievre, C., Goupil, A., Mouneyrac, C., 2017. Spermatozoa: a
relevant biological target for genotoxicity assessment of contaminants in the
estuarine bivalve Scrobicularia plana. Mar. Pollut. Bull. 116, 488–490. https://doi.
org/10.1016/j.marpolbul.2016.12.062.
Chauvigne, F., Zapater, C., Cerda, J., 2011. Role of aquaporins during teleost
gametogenesis and early embryogenesis. Front. Physiol. 2 https://doi.org/10.3389/
fphys.2011.00066.
Chen, Y., 2008. The Spatial and Temporal Distribution, Source and Bioavailability of
PAHs in Qiantang River. College of Environmental and Resource Science. Zhejiang
University, Hangzhou, pp. 15–16.
Ciocan, C.M., Cubero-Leon, E., Puinean, A.M., Hill, E.M., Minier, C., Osada, M., et al.,
2010. Effects of estrogen exposure in mussels, Mytilus edulis, at different stages of
gametogenesis. Environ. Pollut. 158, 2977–2984. https://doi.org/10.1016/j.
envpol.2010.05.025.
Clark, B.J., Stocco, D.M., 2014. Cholesterol Transporters of the START Domain Protein
Family in Health and Disease. Springer.
Corsi, I., Mariottini, M., Sensini, C., Lancini, L., Focardi, S., 2003. Cytochrome P450,
acetylcholinesterase and gonadal histology for evaluating contaminant exposure
levels in fishes from a highly eutrophic brackish ecosystem: the Orbetello Lagoon.
Italy. Mar. Pollut. Bull. 46, 203–212. https://doi.org/10.1016/s0025-326x(02)
00359-4.
Cristina Colli-Dula, R., Fang, X., Moraga-Amador, D., Albornoz-Abud, N., Zamora-
Bustillos, R., Conesa, A., et al., 2018. Transcriptome analysis reveals novel insights
into the response of low-dose benzo(a)pyrene exposure in male tilapia. Aquat.
Toxicol. 201, 162–173. https://doi.org/10.1016/j.aquatox.2018.06.005.
Croll, R.P., Wang, C., 2007. Possible roles of sex steroids in the control of reproduction in
bivalve molluscs. Aquaculture 272, 76–86. https://doi.org/10.1016/j.
aquaculture.2007.06.031.
Cuvillier-Hot, V., Lenoir, A., 2020. Invertebrates facing environmental contamination by
endocrine disruptors: novel evidences and recent insights. Mol. Cell. Endocrinol. 504
https://doi.org/10.1016/j.mce.2020.110712.
Da Cuna, R.H., Vazquez, G.R., Dorelle, L., Rodriguez, E.M., Moreira, R.G., Lo Nostro, F.L.,
2016. Mechanism of action of endosulfan as disruptor of gonadal steroidogenesis in
the cichlid fish Cichlasoma dimerus. Comp. Biochem. Physc. 187, 74–80. https://doi.
org/10.1016/j.cbpc.2016.05.008.
de Almeida, M.D., Boscolo Pereira, T.S., Batlouni, S.R., Pereira Boscolo, C.N., de
Almeida, E.A., 2018. Estrogenic and anti-androgenic effects of the herbicide
tebuthiuron in male Nile tilapia (Oreochromis niloticus). Aquat. Toxicol. 194, 86–93.
https://doi.org/10.1016/j.aquatox.2017.11.006.
Deng, X., Pan, L., Miao, J., Cai, Y., Hu, F., 2014. Digital gene expression analysis of
reproductive toxicity of benzo a pyrene in male scallop chlamys farreri. Ecotoxicol.
Environ. Saf. 110, 190–196. https://doi.org/10.1016/j.ecoenv.2014.09.002.
Diepens, N.J., Koelmans, A.A., Baveco, H., van den Brink, P.J., van den Heuvel-Greve, M.
J., Brock, T.C.M., 2017. Prospective environmental risk assessment for sediment-
bound organic chemicals: a proposal for tiered effect assessment. In: DeVoogt, P.
(Ed.), Rev. Environ. Contam. Toxicol. 239, 1–77.
EPA, U., 2010. Second EDSP List of Chemicals for Tier 1 Screening. Environmental
Protection Agency, United States. Available from: http://www.epa.gov/en
do/pubs/prioritysetting/draftlist2.html.
Fernandes, D., Loi, B., Porte, C., 2011. Biosynthesis and metabolism of steroids in
molluscs. J. Steroid Biochem. Mol. Biol. 127, 189–195. https://doi.org/10.1016/j.
jsbmb.2010.12.009.
Graceli, J.B., Sena, G.C., Iguatemy Lopes, P.F., Zamprogno, G.C., da Costa, M.B., Locateli
Godoi, A.F., et al., 2013. Organotins: a review of their reproductive toxicity,
biochemistry, and environmental fate. Reprod. Toxicol. 36, 40–52. https://doi.org/
10.1016/j.reprotox.2012.11.008.
Grilo, T.F., Rosa, R., 2017. Intersexuality in aquatic invertebrates: prevalence and causes.
Sci. Total Environ. 592, 714–728. https://doi.org/10.1016/j.scitotenv.2017.02.099.
Guigue, C., Tedetti, M., Ferretto, N., Garcia, N., Méjanelle, L., Goutx, M., 2014. Spatial
and seasonal variabilities of dissolved hydrocarbons in surface waters from the
Northwestern Mediterranean Sea: results from one year intensive sampling. Sci.
Total Environ. 466–467, 650–662. https://doi.org/10.1016/j.
scitotenv.2013.07.082.
Hodgson, A.N., 1986. Invertebrate spermatozoa–structure and spermatogenesis. Arch.
Androl. 17, 105–114. https://doi.org/10.3109/01485018608990179.
Hutchinson, T.H., Ankley, G.T., Segner, H., Tyler, C.R., 2006. Screening and testing for
endocrine disruption in fish - biomarkers as "signposts," not "traffic lights," in risk
assessment. Environ. Health Perspect. 114, 106–114. https://doi.org/10.1289/
ehp.8062.
Y. Yang et al.
Janer, G., Porte, C., 2007. Sex steroids and potential mechanisms of non-genomic
endocrine disruption in invertebrates. Ecotoxicology 16, 145–160. https://doi.org/
10.1007/s10646-006-0110-4.
Jobling, S., Coey, S., Whitmore, J.G., Kime, D.E., Van Look, K.J.W., McAllister, B.G.,
et al., 2002. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Reprod.
67, 515–524. https://doi.org/10.1095/biolreprod67.2.515.
Kennedy, C.J., Smyth, K.R., 2015. Disruption of the rainbow trout reproductive
endocrine axis by the polycyclic aromatic hydrocarbon benzo a pyrene. Gen. Comp.
Endocrinol. 219, 102–111. https://doi.org/10.1016/j.ygcen.2015.03.013.
Ketata, I., Guermazi, F., Rebai, T., Hamza-Chaffai, A., 2007. Variation of steroid
concentrations during the reproductive cycle of the clam Ruditapes decussatus: a one
year study in the gulf of Gabes area. Comp. Biochem. Physiol. A 147, 424–431.
https://doi.org/10.1016/j.cbpa.2007.01.017.
Lafont, R., Mathieu, M., 2007. Steroids in aquatic invertebrates. Ecotoxicology 16,
109–130. https://doi.org/10.1007/s10646-006-0113-1.
Lee, J., Park, N.-Y., Kho, Y., Ji, K., 2018. Effects of 4-hydroxyphenyl 4-
isoprooxyphenylsulfone (BPSIP) exposure on reproduction and endocrine system of
zebrafish. Environ. Sci. Technol. 52, 1506–1513. https://doi.org/10.1021/acs.
est.7b00498.
Lewis, C., Ford, A.T., 2012. Infertility in male aquatic invertebrates: a review. Aquat.
Toxicol. 120, 79–89. https://doi.org/10.1016/j.aquatox.2012.05.002.
Li, L.H., Jester Jr., W.F., Laslett, A.L., Orth, J.M., 2000. A single dose of Di-(2-ethylhexyl)
phthalate in neonatal rats alters gonocytes, reduces sertoli cell proliferation, and
decreases cyclin D2 expression. Toxicol. Appl. Pharmacol. 166, 222–229. https://
doi.org/10.1006/taap.2000.8972.
Livingstone, D.R., 1998. The fate of organic xenobiotics in aquatic ecosystems:
quantitative and qualitative differences in biotransformation by invertebrates and
fish. Comp. Biochem. Physiol. 120, 43–49. https://doi.org/10.1016/s1095-6433(98)
10008-9.
Liu, J., Zhang, Z., Zhang, L., Liu, X., Yang, D., Ma, X., 2014. Variations of estradiol-17
beta and testosterone levels correlated with gametogenesis in the gonad of Zhikong
scallop (Chlamys farreri) during annual reproductive cycle. Can. J. Zool. 92,
195–204. https://doi.org/10.1139/cjz-2013-0202.
Liu, P., Miao, J., Song, Y., Pan, L., Yin, P., 2017. Effects of 2,2 ’,4,4 ’-tetrabromodipheny
ether (BDE-47) on gonadogenesis of the manila clam Ruditapes philippinarum. Aquat.
Toxicol. 193, 178–186. https://doi.org/10.1016/j.aquatox.2017.10.022.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408.
https://doi.org/10.1006/meth.2001.1262.
Loughery, J.R., Kidd, K.A., Mercer, A., Martyniuk, C.J., 2018. Part B: morphometric and
transcriptomic responses to sub-chronic exposure to the polycyclic aromatic
hydrocarbon phenanthrene in the fathead minnow (Pimephales promelas). Aquat.
Toxicol. 199, 77–89. https://doi.org/10.1016/j.aquatox.2018.03.026.
Lu, Q., Chen, K., Long, Y., Liang, X., He, B., Yu, L., et al., 2019. Benzo(a)pyrene
degradation by cytochrome P450 hydroxylase and the functional metabolism
network of Bacillus thuringiensis. J. Hazard Mater. 366, 329–337. https://doi.org/
10.1016/j.jhazmat.2018.12.004.
Ma, X., Yang, D., Ji, A., Liang, S., Ma, X., Zhang, Z., 2017. A potential role of SCP3 as a
molecular marker of primary spermatocytes in Chlamys farreri. J. Fish. China 41,
1096–1104. https://doi.org/10.11964/jfc.20160310313.
Matozzo, V., Marin, M.G., 2005. Can 4-nonylphenol induce vitellogenin-like proteins in
the clam Tapes philippinarum? Environ. Res. 97, 43–49. https://doi.org/10.1016/j.
envres.2004.03.002.
Matsumoto, T., Osada, M., Osawa, Y., Mori, K., 1997. Gonadal estrogen profile and
immunohistochemical localization of steroidogenic enzymes in the oyster and
scallop during sexual maturation. Comp. Biochem. Physiol. B 118, 811–817. https://
doi.org/10.1016/s0305-0491(97)00233-2.
Mirza, R., Mohammadi, M., Sohrab, A.D., Safahieh, A., Savari, A., Hajeb, P., 2012.
Polycyclic aromatic hydrocarbons in seawater, sediment, and rock oyster Saccostrea
cucullata from the northern part of the Persian Gulf (Bushehr Province). Water Air
Soil Pollut. 223, 189–198. https://doi.org/10.1007/s11270-011-0850-5.
Ohta, T., Miyake, H., Miura, C., Kamei, H., Aida, K., Miura, T., 2007. Follicle-stimulating
hormone induces spermatogenesis mediated by androgen production in Japanese
Eel, Anguilla japonica. Biol. Reprod. 77, 970–977. https://doi.org/10.1095/
biolreprod.107.062299.
Pait, A.S., Nelson, J.O., 2009. A survey of indicators for reproductive endocrine
disruption in Fundulus heteroclitus (killifish) at selected sites in the Chesapeake Bay.
Mar. Environ. Res. 68, 170–177. https://doi.org/10.1016/j.marenvres.2009.06.006.
Pan, L., Miao, J., Wang, J., Liu, J., 2008. AHH activity, tissue dose and DNA damage in
different tissues of the scallop Chlamys farreri exposed to benzo a pyrene. Environ.
Pollut. 153, 192–198. https://doi.org/10.1016/j.envpol.2007.07.022.
Pan, L., Xu, R., Wen, J., Guo, R., 2017. Assessing PAHs pollution in Shandong coastal
area (China) by combination of chemical analysis and responses of reproductive
toxicity in crab Portunus trituberculatus. Environ. Sci. Pollut. Res. Int. 24,
14291–14303. https://doi.org/10.1007/s11356-017-8993-6.
Park, K., Yung, C.E., Lee, K., Park, K.H., 2013. Gametogenic cycle and the size at 50% of
group sexual maturity in male Chlamys (Azumapecten) farreri nipponensis (Kuroda,
1932) (Bivalvia: pectinidae) in Western Korea. Korean J. Malacol. 29, 65–76.
https://doi.org/10.9710/kjm.2013.29.1.65.
Pogrmic-Majkic, K., Samardzija, D., Stojkov-Mimic, N., Vukosavljevic, J., Trninic-
Pjevic, A., Kopitovic, V., et al., 2018. Atrazine suppresses FSH-induced
steroidogenesis and LH-dependent expression of ovulatory genes through PDE-cAMP
signaling pathway in human cumulus granulosa cells. Mol. Cell. Endocrinol. 461,
79–88. https://doi.org/10.1016/j.mce.2017.08.015.
Pradeep, P.K., Li, X., Peegel, H., Menon, K.M., 2002. Dihydrotestosterone inhibits
granulosa cell proliferation by decreasing the cyclin D2 mRNA expression and cell
11
Environmental Research 191 (2020) 110125
cycle arrest at G1 phase. Endocrinology 143, 2930–2935. https://doi.org/10.1210/
endo.143.8.8961.
Qiu, Y.-W., Zhang, G., Liu, G.-Q., Guo, L.-L., Li, X.-D., Wai, O., 2009. Polycyclic aromatic
hydrocarbons (PAHs) in the water column and sediment core of Deep Bay, South
China. Estuar. Coast Shelf Sci. 83, 60–66. https://doi.org/10.1016/j.
ecss.2009.03.018.
Ramalho-Santos, J., Varum, S., Amaral, S., Mota, P.C., Sousa, A.P., Amaral, A., 2009.
Mitochondrial functionality in reproduction: from gonads and gametes to embryos
and embryonic stem cells. Hum. Reprod. Update 15, 553–572. https://doi.org/
10.1093/humupd/dmp016.
Roach, A.C., Wilson, S.P., 2009. Ecological impacts of tributyltin on estuarine
communities in the Hastings River, NSW Australia. Mar. Pollut. Bull. 58, 1780–1786.
https://doi.org/10.1016/j.marpolbul.2009.08.021.
Robker, R.L., Richards, J.S., 1998. Hormone-induced proliferation and differentiation of
granulosa cells: a coordinated balance of the cell cycle regulators cyclin D2 and
p27Kip1. Mol. Endocrinol. 12, 924–940. https://doi.org/10.1210/mend.12.7.0138.
Santangeli, S., Consales, C., Pacchierotti, F., Habibi, H.R., Carnevali, O., 2019.
Transgenerational effects of BPA on female reproduction. Sci. Total Environ. 685,
1294–1305. https://doi.org/10.1016/j.scitotenv.2019.06.029.
Sarria-Villa, R., Ocampo-Duque, W., Paez, M., Schuhmacher, M., 2016. Presence of PAHs
in water and sediments of the Colombian Cauca River during heavy rain episodes,
and implications for risk assessment. Sci. Total Environ. 540, 455–465. https://doi.
org/10.1016/j.scitotenv.2015.07.020.
Saunders, D.M.V., Podaima, M., Wiseman, S., Giesy, J.P., 2015. Effects of the brominated
flame retardant TBCO on fecundity and profiles of transcripts of the HPGL-axis in
Japanese medaka. Aquat. Toxicol. 160, 180–187. https://doi.org/10.1016/j.
aquatox.2015.01.018.
Scarpulla, R.C., 2008. Nuclear control of respiratory chain expression by nuclear
respiratory factors and PGC-1-related coactivator. In: Gibson, G.E., Ratan, R.R.,
Beal, M.F. (Eds.), Mitochondria and Oxidative Stress in Neurodegenerative
Disorders, vol. 1147, pp. 321–334.
Smolarz, K., Hallmann, A., Zabrzanska, S., Pietrasik, A., 2017. Elevated gonadal atresia
as biomarker of endocrine disruptors: field and experimental studies using Mytilus
trossulus (L.) and 17-alpha ethinylestradiol (EE2). Mar. Pollut. Bull. 120, 58–67.
https://doi.org/10.1016/j.marpolbul.2017.04.007.
Sogbanmu, T.O., Osibona, A.O., Otitoloju, A.A., 2019. Specific polycyclic aromatic
hydrocarbons identified as ecological risk factors in the Lagos lagoon, Nigeria.
Environ. Pollut. 255, 113295. https://doi.org/10.1016/j.envpol.2019.113295.
Stocco, D.M., Wang, X., Jo, Y., Manna, P.R., 2005. Multiple signaling pathways
regulating steroidogenesis and steroidogenic acute regulatory protein expression:
more complicated than we thought. Mol. Endocrinol. 19, 2647–2659. https://doi.
org/10.1210/me.2004-0532.
Sun, L., Zuo, Z., Luo, H., Chen, M., Zhong, Y., Chen, Y., et al., 2011. Chronic Exposure to
phenanthrene influences the spermatogenesis of male Sebastiscus marmoratus: u-
shaped effects and the reason for them. Environ. Sci. Technol. 45, 10212–10218.
https://doi.org/10.1021/es202684w.
Suzawa, M., Ingraham, H.A., 2008. The herbicide atrazine activates endocrine gene
networks via non-steroidal NR5A nuclear receptors in fish and mammalian cells.
PloS One 3, e2117. https://doi.org/10.1371/journal.pone.0002117.
Syrjaenen, J.L., Pellegrini, L., Davies, O.R., 2014. A molecular model for the role of
SYCP3 in meiotic chromosome organisation. Elife 3. https://doi.org/10.7554/
eLife.02963.
Teng, M., Wang, C., Song, M., Chen, X., Zhang, J., Wang, C., 2020. Chronic exposure of
zebrafish (Danio rerio) to flutolanil leads to endocrine disruption and reproductive
disorders. Environ. Res. 184 https://doi.org/10.1016/j.envres.2020.109310.
Thitiphuree, T., Nagasawa, K., Osada, M., 2019. Molecular identification of
steroidogenesis-related genes in scallops and their potential roles in gametogenesis.
J. Steroid Biochem. Mol. Biol. 186, 22–33. https://doi.org/10.1016/j.
jsbmb.2018.09.004.
Tian, S., Pan, L., Tao, Y., Sun, X., 2015. Environmentally relevant concentrations of
benzo[a]pyrene affect steroid levels and affect gonad of male scallop Chlamys farreri.
Ecotoxicol. Environ. Saf. 114, 150–156. https://doi.org/10.1016/j.
ecoenv.2015.01.019.
Titley-O’Neal, C.P., MacDonald, B.A., Pelletier, E., Saint-Louis, R., 2011. Using Nucella
lapillus (L.) as a bioindicator of tributyltin (TBT) pollution in eastern Canada: a
historical perspective. Water Qual. Res. J. Can. 46, 74–86. https://doi.org/10.2166/
wqrjc.2011.012.
Trant, J.M., Gavasso, S., Ackers, J., Chung, B.C., Place, A.R., 2001. Developmental
expression of cytochrome P450 aromatase genes (CYP19a and CYP19b) in zebrafish
(Danio rerio). J. Exp. Zool. 290, 475–483. https://doi.org/10.1002/jez.1090.
Vigano, L., Benfenati, E., Bottero, S., Cevasco, A., Monteverde, M., Mandich, A., 2010.
Endocrine modulation, inhibition of ovarian development and hepatic alterations in
rainbow trout exposed to polluted river water. Environ. Pollut. 158, 3675–3683.
https://doi.org/10.1016/j.envpol.2010.07.033.
Wang, J., Tang, C., Wang, Q., Su, J., Ni, T., Yang, W., et al., 2017. NRF1 coordinates with
DNA methylation to regulate spermatogenesis. Faseb. J. 31, 4959–4970. https://doi.
org/10.1096/fj.201700093R.
Wang, Y.Q., Li, Y.W., Chen, Q.L., Liu, Z.H., 2019b. Long-term exposure of xenoestrogens
with environmental relevant concentrations disrupted spermatogenesis of zebrafish
through altering sex hormone balance, stimulating germ cell proliferation, meiosis
and enhancing apoptosis. Environ. Pollut. 244, 486–494. https://doi.org/10.1016/j.
envpol.2018.10.079.
Wang, Z., Wang, Y., Ma, X., Na, G., Lin, Z., Yao, Z.J.P.A.C., 2013. Probabilistic ecological
risk assessment of typical PAHs in coastal water of Bohai Sea. Polycycl. Aromat.
Comp. 33, 367–379. https://doi.org/10.1080/10406638.2013.781040.
Y. Yang et al.
Wen, J., Pan, L., 2016. Short-term exposure to benzo[a]pyrene causes oxidative damage
and affects haemolymph steroid levels in female crab Portunus trituberculatus.
Environ. Pollut. 208, 486–494. https://doi.org/10.1016/j.envpol.2015.10.019.
Wintermyer, M.L., Cooper, K.R., 2007. The development of an aquatic bivalve model:
evaluating the toxic effects on gametogenesis following 2,3,7,8-tetrachlorodibenzo-
p-dioxin (2,3,7,8-TCDD) exposure in the eastern oyster (Crassostrea virginica). Aquat.
Toxicol. 81, 10–26. https://doi.org/10.1016/j.aquatox.2006.10.005.
Wu, Q., Wang, S., Chen, X., Li, P., 2017. Reproductive toxicity assessment of benzo a
pyrene in the marine polychaete Perinereis nuntia. Chin. J. Oceanol. Limnol. 35,
867–873. https://doi.org/10.1007/s00343-017-6024-6.
Yang, X., Song, W., Liu, N., Sun, Z., Liu, R., Liu, Q.S., et al., 2018. Synthetic phenolic
antioxidants cause perturbation in steroidogenesis in vitro and in vivo. Environ. Sci.
Technol. 52, 850–858. https://doi.org/10.1021/acs.est.7b05057.
Yang, Y., Zhou, Y., Pan, L., Xu, R., Li, D., 2020. Benzo a pyrene exposure induced
reproductive endocrine-disrupting effects via the steroidogenic pathway and
estrogen signaling pathway in female scallop Chlamys farreri. Sci. Total Environ. 726
https://doi.org/10.1016/j.scitotenv.2020.138585, 138585-138585.
Yao, L.L., Pan, L.Q., Guo, R.M., Miao, J.L., 2017. Expression profiles of different
glutathione S-transferase isoforms in scallop Chlamys farreri exposed to benzo a
pyrene and chrysene in combination and alone. Ecotoxicol. Environ. Saf. 142,
480–488. https://doi.org/10.1016/j.ecoenv.2017.04.050.
12
Environmental Research 191 (2020) 110125
Yin, P., Li, Y.W., Chen, Q.L., Liu, Z.H., 2017. Diethylstilbestrol, flutamide and their
combination impaired the spermatogenesis of male adult zebrafish through
disrupting HPG axis, meiosis and apoptosis. Aquat. Toxicol. 185, 129–137. https://
doi.org/10.1016/j.aquatox.2017.02.013.
Zhang, A., Zhao, S., Wang, L., Yang, X., Zhao, Q., Fan, J., et al., 2016. Polycyclic aromatic
hydrocarbons (PAHs) in seawater and sediments from the northern Liaodong Bay,
China. Mar. Pollut. Bull. 113, 592–599. https://doi.org/10.1016/j.
marpolbul.2016.09.005.
Zhang, C.C., Li, Y.L., Wang, C.L., Feng, Z.Y., Hao, Z., Yu, W.W., et al., 2020. Polycyclic
aromatic hydrocarbons (PAHs) in marine organisms from two fishing grounds, South
Yellow Sea, China: bioaccumulation and human health risk assessment. Mar. Pollut.
Bull. 153 https://doi.org/10.1016/j.marpolbul.2020.110995.
Zhang, Y., Guan, Y., Zhang, T., Yuan, C., Liu, Y., Wang, Z., 2018. Adult exposure to
bisphenol A in rare minnow Gobiocypris rarus reduces sperm quality with disruption
of testicular aquaporins. Chemosphere 193, 365–375. https://doi.org/10.1016/j.
chemosphere.2017.11.034.
Zheng, B.H., An, L.H., Chang, H., Liu, Y., Jiang, Z.Q., 2014. Evidence for the presence of
sex steroid hormones in Zhikong scallop, Chlamys farreri. J. Steroid Biochem. Mol.
Biol. 143, 199–206. https://doi.org/10.1016/j.jsbmb.2014.03.002.
Zheng, R.H., Wang, C.G., Zuo, Z.H., Chen, Y.X., Zhao, Y., 2006. Combined effect of
tributyltin and benzo a pyrene on the levels of sex hormone and vitellogenin in
female Sebastiscus marmoratus. J. Environ. Sci. 18, 359–363.