AEM Accepted Manuscript Posted Online 3 January 2020

Appl. Environ. Microbiol. doi:10.1128/AEM.02487-19

Copyright © 2020 American Society for Microbiology. All Rights Reserved.

Microbial ephedrine degradation

3 Biodegradation of ephedrine isomers by Arthrobacter sp. TS-

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

4 15: The discovery of novel ephedrine and pseudoephedrine

5 dehydrogenases
6

9 Tarek Shanati, Marion B. Ansorge-Schumachera*

10
a
11 Chair of Molecular Biotechnology, Faculty of Biology, Technische Universität Dresden, Zellescher Weg

12 20b, 01062 Dresden, Germany

13

14 *Fax: (+ 49)-351-463-39520

15 Phone: (+ 49)-351-463-39519

16 e-mail: marion.ansorge@tu-dresden.de

17

18

19

20

21

1
 Microbial ephedrine degradation

22 ABSTRACT

23 The gram-positive soil bacterium Arthrobacter sp. TS-15 (DSM 32400), which is capable of metabolizing

24 ephedrine as a sole source of carbon and energy, was isolated. According to 16S rRNA gene sequences

25 and comparative genomic analysis, Arthrobacter sp. TS-15 is closely related to Arthrobacter aurescens.

26 Distinct from all known physiological paths, ephedrine metabolism by Arthrobacter sp. TS-15 is initiated by

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

27 the selective oxidation of the hydroxyl function at the -C-atom, yielding methcathinone as the primary

28 degradation product. Rational genome mining revealed a gene cluster potentially encoding the novel

29 pathway. Two genes from the cluster, which encoded putative short-chain dehydrogenases, were cloned

30 and expressed in Escherichia coli. The obtained enzymes were strictly NAD+-dependent and catalyzed the

31 oxidation of ephedrine to methcathinone. Pseudoephedrine dehydrogenase (PseDH) selectively converted

32 (S,S)-(+)-pseudoephedrine and (S,R)-(+)-ephedrine to (S- and R-)-methcathinone, respectively. Ephedrine

33 dehydrogenase (EDH) exhibited strict selectivity for the oxidation of the diastereomers (R,S)-(–)-ephedrine

34 and (R,R)-(–)-pseudoephedrine.

35

36 IMPORTANCE Arthrobacter sp. TS-15 is a newly isolated bacterium with the unique ability to degrade

37 ephedrine isomers. The initiating steps of the novel metabolic pathway are described. Arthrobacter sp. TS-

38 15 and its isolated ephedrine-oxidizing enzymes have potential for use in decontamination and synthetic

39 applications.

40

2
 Microbial ephedrine degradation

41 INTRODUCTION

42 (R,S)-(–)-Ephedrine and (S,S)-(+)-pseudoephedrine are constituents of various over-the-counter (OTC)

43 drugs and are also used as decongestants and stimulants. Several studies have been published regarding

44 the fate of these active pharmaceutical ingredients in humans (1–5). Primarily, they are eliminated by the

45 kidney and excreted with urine, leaving 70% of the (R,S)-(–)-ephedrine and 98% of the (S,S)-(+)-

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

46 pseudoephedrine in a dose unprocessed (6, 7). According to the International Narcotics Control Strategy

47 report (2017), the top five world economies exported >1,000 tons (S,S)-(+)-pseudoephedrine and >100

48 tons (R,S)-(–)-ephedrine annually between 2013 and 2015 (8). Thus, it is not surprising that the

49 environment has been enriched with these nonmetabolized drugs, which have a potential negative impact

50 on some organisms e.g. Daphnia. Furthermore, (R,S)-(–)-ephedrine and (S,S)-(+)-pseudoephedrine have

51 been detected in aquatic samples from sewage, river sediments and even from the Antarctic region as

52 emerging contaminants (9–12). Additionally, (S,S)-(+)-pseudoephedrine was recently reported as an

53 emerging pollutant in leachates of 19 landfills in the USA (13). Toxicologically, (S,S)-(+)-pseudoephedrine

54 was categorized by Guo et al. 2016 as “chronic 2”, effecting the chronic ecotoxicological properties on

55 Daphnia in a concentration between 1 and 10 mg L-1 (14). During wastewater treatment, (R,S)-(–)-

56 ephedrine partially undergoes isomerization to (S,R)-(+)-ephedrine. (S,R)-(+)-Ephedrine has been

57 detected in wastewater effluent at an even higher frequency than (R,S)-(–)-ephedrine, indicating its higher

58 environmental persistence (15). (S,R)-(+)-Ephedrine and the fourth ephedrine isomer (R,R)-(–)-

59 pseudoephedrine exert significant toxicological effects on tested model organisms, including Daphnia

60 magna, Pseudokirchneriella subcapitata, and Tetrahymena thermophile (16).

61 The metabolic degradation pathways of (R,S)-(–)-ephedrine and (S,S)-(+)-pseudoephedrine in rats,

62 humans, and two bacterial species, Arthrobacter globiformis and Pseudomonas putida, have previously

63 been reported (5, 17–19). In mammals, ephedrine undergoes an enzymatic reaction either through a

64 hydroxylating step, which is catalyzed by a cytochrome P450 monooxygenase and yields p-hydroxylated

65 derivatives, or via the demethylation of the N-methyl group toward norephedrine, which releases

66 formaldehyde (20) (Fig. 1-A). The hydroxylation of the aromatic ring is a common strategy for degrading

67 aromatic compounds (21). However, there is no further metabolic step on p-hydroxynorephedrine, which is

68 then excreted by the kidneys.

69
3
 Microbial ephedrine degradation

70 < Insert Figure 1 about here >

71 For ephedrine degradation in the soil bacterium A. globiformis, a different path has been postulated. The

72 first degrading step is implemented through amine oxidation toward an imine metabolite (18, 19). Since

73 imine bonds are susceptible to hydrolysis under aquatic conditions (22), the resulting imine undergoes

74 hydrolysis, yielding the carbonyl intermediate (phenylacetylcarbinol, [PAC]) and methylamine (Fig. 1-B).

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

75 However, the functional active enzymes involved in these catabolic processes have not yet been identified

76 either in eukaryotic or prokaryotic cells.

77 In an attempt to elucidate the bacterial biodegradation of ephedrine, we isolated a new bacterial strain,

78 Arthrobacter sp. TS-15 (DSM 32400), on the basis of its ability to metabolize ephedrine as a sole source

79 of carbon and energy. According to the results of the genomic analysis, Arthrobacter sp. TS-15 is most

80 closely related to Arthrobacter aurescens TC1. Notably, it has the unique ability to metabolize more than

81 one ephedrine isomer. The differential biodegradation of ephedrine isomers in relation to culture growth

82 was investigated. The enzymes catalyzing the first step of biodegradation were identified by means of

83 traditional purification protocols followed by rational genome mining. Based on this analysis, a novel gene

84 cluster responsible for ephedrine metabolism was postulated. The functionality of three purified enzymes

85 of this gene cluster was confirmed after cloning and overexpressing these genes in Escherichia coli.

86

87 RESULTS

88 Isolation and classification of Arthrobacter sp. TS-15

89 Initially, a number of bacterial strains with the potential capability to degrade ephedrine, A. globiformis

90 (DSM 20124) (23), A. oxydans (DSM 20119) (24), and A. aurescens (DSM 20116) (25), were selected for

91 analysis. However, in our laboratory, none of these strains were able to metabolize ephedrine, and no

92 growth on ephedrine was observed (unpublished data). Alternatively, a novel bacterial strain, Arthrobacter

93 sp. TS-15, was isolated from soil based on its ability to use ephedrine as the sole source of carbon and

94 energy. It was deposited at the German Collection of Microorganisms and Cell Cultures (DSMZ) under

95 collection number DSM 32400. Arthrobacter sp. TS-15 is a gram-positive and aerobic bacterium. On agar

96 plates, it grows in round, slightly yellow colonies (data not shown). Growing cells have a dented-rod V-

97 form shape (Fig. S1-A and -C, Supporting Information), and after 24 h of storage at 4 °C, cells exhibit a

98 coccoid shape (Fig. S1-B and -D, Supporting Information). Scanning electron microscopy (SEM) revealed
4
 Microbial ephedrine degradation

99 cells with either a smooth or a rough surface in the pure culture (Fig. S1-A, Supporting Information).

100 These “cell types” could not be separated from each other despite sequential transfers to agar plates

101 containing ephedrine as the sole source of carbon. No growth on ephedrine as the sole source of nitrogen

102 occurred (data not shown), indicating that Arthrobacter sp. TS-15 cannot metabolize the nitrogen in

103 ephedrine.

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

104 Further investigation into the physiological properties of Arthrobacter sp. TS-15 uncovered antibiotic

105 resistance toward kanamycin at a concentration of 30 µg mL-1. In the presence of kanamycin, the cells

106 showed a tendency to aggregate, forming a pseudomycelium (Fig. S1-C, Supporting Information). This

107 feature was used later to optimize strain purification. Notably, Arthrobacter sp. TS-15 has a kanamycin

108 resistance gene aph (aminoglycoside phosphotransferase), which is located near the origins of

109 replications ColE1 from E. coli and F1 Ori from bacteriophage F1 in the draft genome of Arthrobacter sp.

110 TS-15. The combination is found as a distinct contig bearing additional resistance genes against

111 Glufosinat/Basta (phosphinothricin acetyltransferase) and ampicillin (beta-lactamase/bla), respectively.

112 Arthrobacter sp. TS-15 also harbors a lacZ-gene encoding -galactosidase, which is located close to

113 these resistance genes (Fig. S2, Supporting Information).

114

115 The 16S rRNA gene sequence of Arthrobacter sp. TS-15 (1,452 nt) was determined and submitted to

116 GenBank (accession number MK459547). Based on BLAST analysis

117 (http://blast.ncbi.nlm.nih.gov/Blast.cgi), the sequence of Arthrobacter sp. TS-15 was most similar to that of

118 Arthrobacter sp. M2012083 (4 nucleotide differences, 99.48%), A. aurescens TC1 (8 nucleotide

119 differences, 99.28%) and Arthrobacter sp. Rue61a (8 nucleotide differences, 99.28%). The close

120 relationship between the four strains was confirmed by phylogenetic analysis of 20 16S rRNA gene

121 sequences from different Arthrobacter strains using the MEGA 10.0.5 program and the neighbor-joining

122 method (Fig. S3-A, Supporting Information). Additionally, higher identities of Arthrobacter sp. TS-15 to A.

123 aurescens TC1 than to Arthrobacter sp. Rue61a were found by comparing the draft genome sequence of

124 Arthrobacter sp. TS-15 with the genome sequences of other Arthrobacter strains (Fig. S3-B, Supporting

125 Information); the closest relationship (with a 0.35 DNA-DNA hybridization, [DDH]) was identified between

126 Arthrobacter sp. TS-15 and A. aurescens TC1 by calculating the distances between species derived from

127 in silico DDH (Table S1, Supporting Information).

5
 Microbial ephedrine degradation

128
129 Growth on ephedrine

130 As illustrated in Fig. 2, Arthrobacter sp. TS-15 was capable of metabolizing all isomers of ephedrine as a

131 sole source of carbon and energy.

132 < Insert Figure 2 about here >

133

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

134 (S,S)-(+)-Pseudoephedrine was consumed within the shortest time period (half-life of approximately 6.3 h)

135 and was accompanied by the fastest culture growth (generation time approximately 4.4 h) (Fig. 2-D).

136 Notably, the culture growth continued after complete consumption of the isomers (S,S)-(+)-

137 pseudoephedrine and (R,S)-(–)-ephedrine (Fig. 2-A), indicating a subsequent utilization of the

138 degradation products for cell metabolism. The half-lives of (R,S)-(–)-ephedrine and (S,R)-(+)-ephedrine in

139 a growing culture of Arthrobacter sp. TS-15 (Fig. 2-A and -B) were 13.1 h and 21.4 h, respectively.

140 Correspondingly, the generation time of cultures growing on (R,S)-(–)-ephedrine was approximately 60%

141 shorter than that of cultures growing on (S,R)-(+)-ephedrine (generation times of approximately 6.5 and

142 11.1 h), respectively. The lowest consumption rate was found for (R,R)-(–)-pseudoephedrine (half-life of

143 39.6 h), accompanied by a generation time of 30.2 h (Fig. 2-C). The very similar time course of (R,R)-(–)-

144 pseudoephedrine consumption and culture growth might indicate the simultaneous metabolism of

145 degradation intermediates. The physiological results of the biological half-life of ephedrine isomers in

146 cultivation medium correlated with the generation times of Arthrobacter sp. TS-15 are summarized in Fig.

147 S4 (Supporting Information).

148

149 Ephedrine metabolism

150 After growth of Arthrobacter sp. TS-15 on (R,S)-(–)-ephedrine, gas chromatography-mass spectrometry

151 (GC-MS) of the extracts from the cultivation medium revealed 1-phenylpropan-1,2-dione (PPD), PAC,

152 methcathinone and benzoic acid as metabolites (Fig. S5, Fig. S6; Supporting Information). Methcathinone

153 formation was also detected during culture growth on ephedrine isomers (Fig. 2).

154 Cell extracts of Arthrobacter sp. TS-15 prepared from individual cultivations on the four ephedrine isomers

155 were each able to convert any of the isomers, indicating participation in the reaction of either a

156 promiscuous enzyme or several enzymes with complementary activity. The conversion of all ephedrine

6
 Microbial ephedrine degradation

157 isomers required the addition of NAD+ as an oxidant. Without a surplus oxidant or in the presence of

158 NADP+, cell lysates did not significantly convert ephedrine (data not shown). Consequently, an oxidation

159 reaction was postulated as the general initial step of ephedrine degradation by Arthrobacter sp. TS-15,

160 which was consistent with the ephedrine metabolism described for A. globiformis (18,19). However, A.

161 globiformis metabolism did not agree with the formation of methcathinone as the primary reaction product.

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

162 Methcathinone is generated from ephedrine through the oxidation of a hydroxyl to a carbonyl function,

163 leaving the amine function unreacted. However, PAC, which, according to studies on A. globiformis

164 metabolism (18,19), spontaneously results from the postulated amine oxidation to the corresponding imine

165 (Fig. 1-B), was not detected in reactions catalyzed by the cell extracts. Thus, Arthrobacter sp. TS-15

166 obviously uses a novel initial path for ephedrine metabolism.

167

168 Enrichment of the oxidizing enzymatic activity

169 The NAD+-dependent enzymes catalyzing pseudoephedrine oxidation in Arthrobacter sp. TS-15 were

170 isolated from a growing culture of the bacterium. The culture was supplemented with a small amount of

171 (S,S)-(+)-pseudoephedrine (2 mM) to induce the oxidizing activity one hour before harvest. Due to the

172 previously observed efficient conversion of (S,S)-(+)-pseudoephedrine (Fig. 2-D) by Arthrobacter sp. TS-

173 15, this isomer was used for enzyme enrichment, which was named pseudoephedrine dehydrogenase

174 (PseDH). The enzyme was purified in three steps towards a specific activity of 4.7 U mgProtein-1 (1 unit

175 being defined as the NAD+-dependent oxidation of 1 µM (S,S)-(+)-pseudoephedrine per minute), which

176 corresponded to an enrichment of nearly 200% from the crude extract (Fig. S7, Supporting Information).

177 The molecular weight of the enriched protein was approximately 30 kDa.

178 Tandem-MS peptide fingerprinting on the isolated protein resulted in 51 hits containing 130 peptides

179 (Table S2, Supporting Information). From these hits, the gene encoding the pseudoephedrine

180 dehydrogenase was identified by rational genome mining (PseDH in Fig. 3). Specifically, DNA sequences

181 corresponding to the 51 hits were located on the genomes of Arthrobacter sp. TS-15 and A. aurescens

182 TC1 and compared for differences. Since A. aurescens TC1 is not able to metabolize ephedrine, locations

183 present in Arthrobacter sp. TS-15, but not in A. aurescens TC1, indicated potential participation in

184 ephedrine metabolism.

185
7
 Microbial ephedrine degradation

186 < Insert Figure 3 about here >

187

188 Further comparative genomic analysis revealed a whole new gene cluster with a possible association with

189 ephedrine metabolism. Arthrobacter sp. TS-15 harbors two putative operons encoding homologs of

190 enzymes active in the beta-ketoadipate pathway in its genome, by which aromatic compounds are

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

191 degraded by soil bacteria. These operons are commonly activated by the metabolism of catechol

192 compounds (cat) (26). Nine genes of one putative operon, cat1, were 91% similar to the corresponding

193 genes of A. aurescens TC1 (Fig. 3). The second operon cat2 (Fig. 3, lower panel) appeared to contain

194 only five cat-homologous genes but had in its immediate vicinity a divergently oriented gene cluster

195 possibly encoding functions for ephedrine and pseudoephedrine degradation. These putative genes

196 encode a benzoate transporter (benk), an amino acid permease (AAP), a regulatory protein (catR), two

197 short-chain dehydrogenases (PseDH, EDH), and two additional oxidoreductases (ACAD, Fre).

198

199 Short-chain dehydrogenases PseDH and EDH

200 Considering the observed ability of Arthrobacter sp. TS-15 to accept all isomers of ephedrine as a carbon

201 source, the recognition of two putative genes in the potential gene cluster for ephedrine metabolism

202 encoding distinct short-chain dehydrogenases was highly interesting. One dehydrogenase clearly

203 corresponded to the isolated PseDH; the amino acid sequence of the other dehydrogenase (EDH),

204 however, had only 31.8% identity to this enzyme. Nevertheless, both encoding genes were cloned and

205 expressed in E. coli. The resulting recombinant enzymes were purified (Fig. S8, Supporting Information)

206 and investigated for functionality. EDH exhibited a strict enantioselectivity for the oxidation of (R,S)-(–)-

207 ephedrine and (R,R)-(–)-pseudoephedrine, while PseDH was strictly stereospecific for the other

208 diastereomers (S,S)-(+)-pseudoephedrine and (S,R)-(+)-ephedrine. The reaction product was

209 methcathinone (Fig. 4), as confirmed via GC-MS (Fig. S5, Fig. S6-D and Fig. S9, Supporting

210 Information). Both enzymes did not act on (S,N)-(+)-(pseudo)ephedrine or (R,N)-(–)-(pseudo)ephedrine

211 (data not shown). Based on BLAST research, the most similar enzymes to PseDH and EDH were a

212 putative glucose dehydrogenase form Vagococcus elongatus and hypothetical protein from

213 Modestobacter sp. VKM ac-2676 with identities of 47.55% and 64.26%, respectively. The BLAST results

214 are presented in Table S3 (Supporting Information).

8
 Microbial ephedrine degradation

215 < Insert Figure 4 about here >

216

217 The kinetic parameters of PseDH and EDH were determined with NAD+ and all corresponding ephedrine

218 isomers as substrates (Table 1). The Km values of NAD+ were 3.4 mM and 0.11 mM for PseDH and EDH,

219 respectively. The highest maximal activity was observed with PseDH for the oxidation of (S,S)-(+)-

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

220 pseudoephedrine with a kcat of 3.77 s-1 and a Km of 0.26 mM, which explains the rapid consumption of this

221 ephedrine isomer during the growth of Arthrobacter sp. TS-15 (Fig. 2-D). Its diastereomer, (S,R)-(+)-

222 ephedrine, was oxidized at a slightly lower affinity (Km 0.33 mM) and kcat of 1.45 s-1. Kinetic investigations

223 of (R,S)-(–)-ephedrine and (R,R)-(–)-pseudoephedrine oxidation with EDH uncovered the inhibition of

224 EDH at a low concentration of these compounds. (R,R)-(–)-Pseudoephedrine exhibited higher substrate

225 inhibition with a lower inhibition constant Ki of 1.78 mM than (R,S)-(–)-ephedrine with a higher Ki of 4.61

226 mM (Table 1).

227

228 < Insert Table 1 about here >

229

230 DISCUSSION

231 Due to their high adaptation capacity and rapid response to environmental changes, Arthrobacter strains

232 are ubiquitous and have been documented in many extreme environments, such as herbicide-

233 contaminated soils, leaf surfaces, arctic ice and heavy metal-contaminated sites (27–30). The work

234 presented here confirms the potential of the genus for the degradation of aromatic chiral compounds. A

235 new strain, Arthrobacter sp. TS-15 was isolated by the cultivation of a soil sample on the aromatic

236 aminoalcohol ephedrine as a sole source of carbon and energy.

237

238 Influence of ephedrine isomerism on biodegradation

239 The optical configuration of the isomers of ephedrine considerably affects the catabolism of the molecule.

240 This was previously observed by Klamann et al. (1980) for ephedrine oxidation by A. globiformis (19). With

241 cell extracts from this organism, they obtained the highest specific activity with (S,S)-(+)-pseudoephedrine

242 (0.31 U mg-1). The oxidation activities with (R,S)-(–)-ephedrine, (S,R)-(+)-ephedrine and (R,R)-(–)-

243 pseudoephedrine were approximately 24%, 51% and 10% of the specific activity on (S,S)-(+)-
9
 Microbial ephedrine degradation

244 pseudoephedrine, respectively. Here, we confirmed the highly divergent degradation of ephedrine isomers

245 with growing cultures of Arthrobacter sp. TS-15.

246 Cultures of Arthrobacter sp. TS-15 degraded the more abundant diastereomers (S,S)-(+)-

247 pseudoephedrine and (R,S)-(–)-ephedrine faster than their less abundant diastereomers. Interestingly,

248 these differences were directly coupled with the generation time of the cultures: the generation time of

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

249 cultures growing on (S,S)-(+)-pseudoephedrine was approximately six times shorter than that of cultures

250 growing on (R,R)-(–)-pseudoephedrine. Likewise, the generation time of cultures on (R,S)-(–)-ephedrine

251 was shorter (approximately 1.6 times) than that of cultures on its enantiomer (S,R)-(+)-ephedrine.

252 The limitation in the biodegradation of the less abundant ephedrine diastereomers seems to be caused by

253 the optical configuration of the methylamino group within the molecules. The kinetic parameters of the

254 novel dehydrogenases PseDH and EDH in the ephedrine degradation operon are in agreement with the

255 degradation efficiency in minimal salt medium. Thus, the substrate inhibition of (R,R)-(–)-pseudoephedrine

256 on EDH traces back to the relatively low elimination rate of this isomer from the cultivation medium. In

257 contrast, the rapid degradation of (S,S)-(+)-pseudoephedrine is a result of the highest catalytic efficiency

258 of PseDH with this isomer.

259

260 Ephedrine metabolism

261 Under aerobic conditions, aromatic molecules can undergo O2-dependent ring cleavage through enzyme-

262 catalyzed hydroxylation or epoxidation of the aromatic ring (31). Eukaryotic cells or some prokaryotic

263 microorganisms, such as A. globiformis and P. putida, catabolize aromatic ephedrine through the

264 oxidation of either the external or internal amine bonds, respectively (Fig. 1) (19, 32). Another postulated

265 scenario to destabilize ephedrine is the O2-independent dehydration to the enamine (Fig. 5), which

266 subsequently yields PAC and methylamine. Such a metabolic pathway was suggested by the

267 biodegradation of p-synephrine with Arthrobacter synephrinum (33). However, neither the enzymes

268 involved in amine oxidation nor those catalyzing dehydration were identified.

269

270 < Insert Figure 5 about here >

271

10
 Microbial ephedrine degradation

272 In this study, we discovered a unique initial step for the biodegradation of ephedrine via the oxidation of

273 the hydroxyl function on the α-C-atom of aminoalcohol toward ketoamine N-methcathinone in Arthrobacter

274 sp. TS-15 (Fig. 4). Methcathinone is unstable in aqueous solution and racemizes due to keto-enol

275 tautomerism (34, 35). According to keto-enol and amino-imino tautomerism, methcathinone undergoes

276 further oxidation, generating PPD and methylamine (36, 37). Thus far, the catalytic reactions of the further

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

277 degradation of methcathinone and the responsible enzymes are unknown for Arthrobacter sp. TS-15.

278 However, the degradation intermediates PPD, PAC, and benzoic acid were detected in the culture

279 medium, suggesting a late hydroxylation step of the aromatic ring with benzoate dioxygenases (BenABC).

280 EDH and PseDH overcome the stability of the conjugated molecule PPD by reducing it to α-hydroxyketone

281 (R)- and (S)-PAC, respectively (38). PAC cannot be oxidized by these dehydrogenases and possibly

282 undergoes a cleavage reaction to yield benzaldehyde and acetaldehyde. Both aldehyde molecules can be

283 oxidized to benzoic acid through aldehyde dehydrogenases (ALDHs) (19). Both benzaldehyde and

284 benzoic acid intermediates were detectable in the reaction activity assay of the cell extract and in the

285 cultivation medium of Arthrobacter sp. TS-15, respectively. Benzoic acid can undergo ortho-cleavage via

286 the well-known catechol degradation pathway (26). The postulated active degradation pathway is encoded

287 within the beta-ketoadipate gene cluster and is demonstrated in Fig. 6.

288

289 < Insert Figure 6 about here >

290

291 An intensive characterization might enable the utilization of Arthrobacter sp. TS-15 in water treatment

292 processes to enhance ephedrine elimination. The elucidation of the mechanisms of ephedrine catabolism

293 starting with the oxidation of the alcohol or the amine group is important to understand why ephedrine

294 isomers are currently not completely eliminated in water treatment plants. The newly identified

295 dehydrogenases have a high potential in biotechnological applications due to their activity on diverse

296 pharmaceutical aromatic aminoalcohols (39).

297

298 MATERIALS AND METHODS

299 Media and chemicals

11
 Microbial ephedrine degradation

300 All chemicals and oligonucleotides were purchased from Merck (Darmstadt, Germany). Molecular

301 reagents and E. coli strains were purchased from New England Biolabs (Frankfurt am Main, Germany).

302 Cofactors and medium components were purchased from Roth (Karlsruhe, Germany).

303

304 Cultivation media and growth conditions

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

305 The minimal medium used was modified from a recipe described by Klamann (18). It contained 61.5 mM

306 dipotassium phosphate, 38.5 mM potassium dihydrogen phosphate, 0.04 mM magnesium sulfate, 1.71

307 mM sodium chloride and 15.13 mM ammonium sulfate. The trace elements were 8.08 µM boric acid, 0.01

308 µM copper(II) sulfate, 0.06 µM potassium iodide, 1.1 µM iron(III) chloride, 1.44 µM manganese(II) sulfate,

309 0.01 µM ammonium heptamolybdate, and 1.39 µM zinc sulfate. The salts were dissolved in deionized-

310 distilled water. Ephedrine (10 mM) was used as the sole source of carbon. For experiments regarding the

311 biodegradation of ephedrine isomers, the respective compound (5 mM) was added to minimal medium.

312 The medium was filter-sterilized over membrane filters with 0.2 µm pore size (Fisher Scientific, Schwerte,

313 Germany). LB was used as a complex medium. For solid growth medium, 5 g L-1 agar was added to the

314 cultivation medium before autoclaving. The cultivation was conducted in 30 mL medium at 30 °C with

315 shaking at 180 rpm. The culture growth was monitored with a spectrophotometer at 600 nm. The

316 biological half-life and the growth rate were derived from experimental data and plotted in GraphPad Prism

317 (8.0).

318

319 Strain isolation and characterization

320 Soil samples were collected outside of the Biology building of TU Dresden. A total of 200 mg of each

321 sample was washed with 10 mL mineral medium and subsequently sedimented at 500 x g. The

322 supernatant was collected and kept on ice. One milliliter of the samples was diluted with 9 mL medium

323 containing 10 mM (R,S)-(–)-ephedrine. The samples were incubated at 30 °C with shaking at 180 rpm.

324 When microbial growth was observed (after approximately 4 days), the cultures were diluted in nine

325 successive transfers (using various volumes for inoculation) to enrich the isolated strain(s). To obtain a

326 pure culture, cultures were spread on agar plates containing (R,S)-(–)-ephedrine. One distinct colony was

327 picked from the agar plate and used for further studies.

12
 Microbial ephedrine degradation

328 The isolated strain was examined via basic optical transmission microscopy and SEM to investigate the

329 morphological form of the cells. To classify the type of the isolated bacterial strain, the 16S rRNA-

330 encoding sequence was amplified by PCR using the oligonucleotides 16SV3_fwd, 16SV6_rev,

331 16SV1_fwd and 16SV9_rev (Table 2). Genomic DNA (gDNA) was previously isolated with the Invisorb

332 Spin DNA Extraction Kit (Stratec, Berlin, Germany) as a template. Sequencing of the PCR products was

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

333 carried out by Eurofins Genomics (Ebersberg, Germany). Sequences were analyzed by homology

334 alignment using the BLASTn search program (http://www.ncbi.nlm.nih.gov/BLAST.html).

335

336 < Insert Table 2 about here >

337

338 Genome isolation, sequencing and analysis

339 Genomic DNA (gDNA) was isolated from Arthrobacter sp. TS-15 grown on minimal salt medium with

340 pseudoephedrine as a sole source of carbon following a modified protocol of phenol-chloroform extraction

341 described by Marmur (40) excluding isoamyl alcohol. Genome sequencing was carried out by the

342 Genomics Service Unit of the Ludwig-Maximilians University Munich (Germany). The sequencing library

343 was constructed from 1 ng of gDNA with the Nextera XT DNA Sample Preparation Kit (Illumina, San

344 Diego, USA) according to the manufacturer's protocol. The library was quality-controlled by analysis on an

345 Agilent 2000 Bioanalyzer with the High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, USA) for

346 fragment sizes of approximately 200-500 bp. Sequencing on a MiSeq sequencer (Illumina; 2x250 bp

347 paired-end sequencing, v3 chemistry) generated 2.9 Mio reads, which were quality-trimmed (>Q20) and

348 de novo assembled using CLC Genomics Server v7.5 (Qiagen, Hilden, Germany) with the following

349 parameters: word size, 21; bubble size, 172; mismatch cost, 2; insertion cost, 3; deletion cost, 3; length

350 fraction, 0.5; similarity fraction, 0.8; and minimum contig length, 1,000. The resulting assembly of 151

351 contigs (N50: 136,320 bp) had a 96-fold mean coverage. The Whole Genome Shotgun project has been

352 deposited in the GenBank database under the accession number SDXQ00000000. The genome size is

353 4.9 Mbp.

354

355 Determination of strain relationships

13
 Microbial ephedrine degradation

356 The evolutionary history of Arthrobacter sp. TS-15 was inferred using the neighbor-joining method (41)

357 with sequence alignments generated with Clustal X2 software (version 2.1) (42) with 20 16S rRNA gene

358 sequences. The evolutionary distances were computed using the Jukes-Cantor method (43). All positions

359 containing gaps and missing data were eliminated (complete deletion option). The percentage of replicate

360 trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) are shown

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

361 next to the branches (44). The tree was drawn to scale, with branch lengths in the same units as those of

362 the evolutionary distances used to infer the phylogenetic tree. There were a total of 1,427 positions in the

363 final dataset. Phylogenetic and molecular evolutionary analyses were conducted using MEGA 10.0.5 (45).

364 To perform genome rearrangements, a multiple nucleotide-based genome alignment of the draft genome

365 of Arthrobacter sp. TS-15 and the reference sequence of A. aurescens TC1 were constructed using an

366 automated reordering algorithm in MAUVE genome alignment software (version 2.3.1) (46). The genomic

367 differences between Arthrobacter sp. TS-15 and five Arthrobacter strains were visualized on circular

368 genome comparisons using BLAST Ring Image Generator (BRIG, version 0.95) (47). In silico DDH

369 between the genome of Arthrobacter sp. TS-15 and five Arthrobacter-related strains was performed using

370 the Genome to Genome Distance Calculator (GGDC) (48). The distances were determined as the sum of

371 all identities found in high-scoring segment pairs (HSPs) divided by overall HSP length.

372

373 Enzyme purification from Arthrobacter sp. TS-15

374 All steps of enzyme purification were carried out at 4 °C. The protein concentration of the crude cell

375 extract and during the purification process was determined using the Bradford assay (49). The activity of

376 the fractions was measured with a spectrophotometer at 340 nm. The assay contained 0.3 µM (S,S)-(+)-

377 pseudoephedrine and 0.5 µM NAD+ in 1 mL potassium phosphate buffer (100 mM, pH 7.8). The reaction

378 was started by the addition of 30 µL cell extract or enriched protein fraction. Cells from a 1-L overnight

379 culture of Arthrobacter sp. TS-15 from a 2-L bioreactor containing 10 mM (S,S)-(+)-pseudoephedrine

380 (Sartorius, Göttingen, Germany) were harvested in 35 mL of potassium phosphate buffer (100 mM, pH

381 7.8). Cell disruption was carried out with a French pressure cell model FA-078 w (SLM-Aminco, Urbana,

382 USA) at 1 MPa. After centrifugation of crude cell extract (15,000 x g, 30 min), the proteins in the

383 supernatant were precipitated with ammonium sulfate between 10-100% saturation over ten fractions. The

384 fractions with the highest (S,S)-(+)-pseudoephedrine oxidizing activity were pooled and immediately
14
 Microbial ephedrine degradation

385 loaded onto a 1-mL Resource Phe column (GE Healthcare Life Sciences, Pittsburgh, USA) on an ÄKTA

386 protein purification system (GE Healthcare Life Sciences, Pittsburgh, USA). The most active fractions

387 were pooled and applied to a 1-mL Resource Q column (GE Healthcare Life Sciences, Pittsburgh, USA).

388 Sample aliquots were analyzed via SDS-PAGE. An enriched protein with a molecular mass of

389 approximately 30 kDa was excised from the gel (Fig. S7, Supplementary Information) and identified via

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

390 mass spectrometry fingerprinting (conducted by the Proteome Factory AG, Berlin, Germany).

391

392

393 Analysis of metabolites

394 The metabolites of the medium and from the cell lysate activity assay were extracted after 16 h of

395 Arthrobacter sp. TS-15 cultivation and 4 h of incubation of the substrate ephedrine with the cell lysate,

396 respectively. The extraction of substrates and products from the culture medium or after the activity assay

397 was performed under basic conditions with 100 mM sodium hydroxide and an equal volume of ethyl

398 acetate. Analysis of ephedrine isomers and their degradation was performed by gas chromatography (GC)

399 (Shimadzu GC-2010, Kyto, Japan) with flame ionization detection using nitrogen as the carrier gas. The

400 separation of substrates was performed on a chiral column CycloSil-B 30 m in length, ID 0.25 mm and film

401 thickness of 0.25 µm (Agilent Technologies, Santa Clara, USA), applying a temperature gradient for 15

402 min from 130-185 °C with a ramp of 4 °C min-1. Retention times for (R,S)-(–)-ephedrine, (R,R)-(–)-

403 pseudoephedrine, (S,R)-(+)-ephedrine, and (S,S)-(+)-pseudoephedrine were detected at 11.78 min, 11.86

404 min, 11.67 min, and 11.95 min, respectively (Fig. S9, Supporting Information). The identification of the

405 intermediates from the enzymatic assays and culture supernatant was performed with GC-MS using an

406 Agilent 6890N GC/ HP 5973N MSD equipped with an Optima 35 MS column. A constant temperature

407 program at 130 °C for 30 min was applied. The intermediates extracted from the culture medium,

408 benzaldehyde and methcathinone, were detected at 10.11 min and 12.43 min, respectively. (Fig. S5,

409 Supporting information).

410

411 Gene cloning

412 For gene amplification from gDNA, PCR was conducted with the appropriate oligonucleotides (Table 2).

413 After restriction enzyme (NdeI and XhoI) digestion, the inserts were ligated separately into pET19, thereby
15
 Microbial ephedrine degradation

414 creating gene variants encoding an N-terminal 10X histidine-tag. After transfer of the plasmids into E. coli

415 DH5a cells, the nucleotide sequences were verified by sequencing at Eurofins Genomics (Ebersberg,

416 Germany). The plasmids pET-EDH and pET-PseDH were subsequently transferred into E. coli T7 SHuffle

417 (DE3) cells.

418

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

419 Heterologous production, purification and characterization of dehydrogenases

420 A 5-mL overnight culture (in LB medium at 30 °C with shaking at 180 rpm) of E. coli T7 SHuffle (DE3)

421 harboring the EDH or PseDH encoding gene was used to inoculate 50 mL of the same LB medium to an

422 optical density of 0.05 at 600 nm. At an OD600 nm of 0.8 (incubated under the same conditions), 1 mM IPTG

423 was added, and incubation continued for 3 h. The produced enzymes were purified via immobilized metal

424 ion affinity chromatography using a 5-mL Histrap FF column (GE Healthcare Life Sciences, Pittsburgh,

425 USA) charged with nickel. Equilibration, elution, etc. were performed according to the manufacturer’s

426 instructions. The protein concentration of purified enzymes was determined using a NanoDrop

427 spectrophotometer ND-1000 (ThermoFisher Scientific, Bremen, Germany) with the specific extinction

428 coefficients at 280 nm of 20.97 and 19.18 for EDH and PseDH, respectively. Kinetic parameters of the

429 purified enzymes were determined photometrically by following the reduction of NAD+ at 340 nm and 25

430 °C after the addition of variable amounts of (R,N)-(–)-(pseudo)ephedrine or (S,N)-(+)-(pseudo)ephedrine.

431 The assay contained 1 µM NAD+ in 1 mL potassium phosphate buffer (100 mM, pH 7.8). The reaction was

432 started by the addition of 0.03 mg mL-1 EDH or 0.13 mg mL-1 PseDH. Kinetic parameters for NAD+ were

433 determined at fixed concentrations of (R,S)-(–)-ephedrine (0.5 mM) and (S,S)-(+)-pseudoephedrine (3

434 mM) for EDH and PseDH, respectively. The Michaelis-Menten equation was used to calculate the initial

435 rates (ε(NADH)340 0.00622 L μM−1 cm−1). Kinetic parameters (Km and Vmax) were calculated by fitting to

436 experimental data using nonlinear regression in GraphPad Prism 8.

437

438 Data availability

439 Genomic data of Arthrobacter sp. TS-15 is available on the Genbank NIH genetic sequence database of

440 NCBI. The project has the accession number SDXQ01000000 and consists of sequences

441 SDXQ01000001-SDXQ01000151. The amino acid sequences of PseDH and EDH are available in the

442 NCBI databank under the accession numbers TQS88919 and TQS88917, respectively.
16
 Microbial ephedrine degradation

443

444 ACKNOWLEDGMENTS

445 We thank Friedrich-Ebert-Stiftung e.V., Bonn, Germany, for generous personal support of T.S. We also

446 thank professors Michael Rother (Technische Universität Dresden, Germany) and Gideon Grogan

447 (University of York, UK) for critically reading the manuscript.

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

448

449 CONFLICT OF INTEREST

450 Arthrobacter sp. TS-15 and its ephedrine-degrading enzymes are protected for commercial applications

451 with the patents WO2019002459A1 and DE102017210944B4 (published on 03 January 2019).

452

453 REFERENCES

454 1. Wilkinson GR, Beckett AH. 1968. Absorption metabolism and excretion of the ephedrines in man. I. The

455 influence of urinary pH and urine volume output. J Pharmacol Exp Ther 162:139–147.

456 http://jpet.aspetjournals.org/content/162/1/139.

457 2. Welling PG, Lee, KP, Patel JA, Walker JE, Wagner JG. 1971. Urinary excretion of ephedrine in man

458 without pH control following oral administration of three commercial ephedrine sulfate preparations. J

459 Pharm Sci 60:1629–1634. https://doi.org/10.1002/jps.2600601107.

460 3. Sever PS, Dring LG, Williams RT 1975. The metabolism of (–)-ephedrine in man. Eur J Clin Pharmacol

461 9:193–198. https://doi.org/10.1007/BF00614017.

462 4. Brater DC, Kaojarern S, Benet LZ, Lin ET, Lockwood T, Morris RC, McSherry EJ, Melmon KL.1980.

463 Renal excretion of pseudoephedrine. Clin Pharmacol Ther 28:690–694.

464 https://doi.org/10.1038/clpt.1980.222.

465 5. Inoue T, Suzuki S. 1990. The metabolism of (±)-methylephedrine in rat and man. Xenobiotica 20:99–

466 106. https://doi.org/10.3109/00498259009046816.

467 6. Beckett AH, Wilkinson GR. 1965. Urinary excretion of (–)‐methylephedrine, (–)‐ephedrine and (–)‐

468 norephedrine in man. J Pharm Pharmacol 17:107–108. https://doi.org/10.1111/j.2042-

469 7158.1965.tb07756.x.

470 7. Lai CM, Stoll RG, Look ZM, Yacobi A. 1979. Urinary excretion of chlorpheniramine and

471 pseudoephedrine in humans. J Pharm Sci 68:1243–1246. https://doi.org/10.1002/jps.2600681012.

17
 Microbial ephedrine degradation

472 8. United states separtment of state, Bureau for international narcotics and law enforcement affairs. 2017.

473 International narcotics control strategy report (INCSR). Narcotics control reports, Volume 1.

474 http://www.state.gov/documents/organization/268025.pdf.

475 9. Petrie B, Barden R, Kasprzyk-Hordern B. 2015. Review on emerging contaminants in wastewaters and

476 the environment: current knowledge, understudied areas and recommendations for future monitoring.

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

477 Water Res 72:3–27. https://doi.org/10.1016/j.watres.2014.08.053.

478 10. Yang YY, Toor GS, Williams CF. 2015. Pharmaceuticals and organochlorine pesticides in sediments

479 of an urban river in Florida, USA. J Soils Sediments 15:993–1004. https://doi.org/10.1007/s11368-015-

480 1077-7.

481 11. González-Alonso S, Merino LM, Esteban S, López de Alda M, Barceló, D, Durán J.J, López-Martínez

482 J, Aceña J, Pérez S, Mastroianni N, Silva A, Catalá M, Valcárcel Y.2017. Occurrence of pharmaceutical,

483 recreational and psychotropic drug residues in surface water on the northern Antarctic Peninsula region.

484 Environ Pollut 229:241–254. https://doi.org/10.1016/j.envpol.2017.05.060.

485 12. Archer E, Petrie B, Kasprzyk-Hordern B, Wolfaardt GM. 2017. The fate of pharmaceuticals and

486 personal care products (PPCPs), endocrine disrupting contaminants (EDCs), metabolites and illicit drugs

487 in a WWTW and environmental waters. Chemosphere 174:437–446.

488 https://doi.org/10.1016/j.chemosphere.2017.01.101.

489 13. Masoner JR, Kolpin DW, Furlong ET, Cozzarelli IM, Gray JL, Schwab EA. 2014. Contaminants of

490 emerging concern in fresh leachate from landfills in the conterminous United States. Environ Sci Process

491 Impacts 16:2335–2354. https://doi.org/10.1039/c4em00124a.

492 14. Guo J, Sinclair CJ, Selby K, Boxall AB. 2016. Toxicological and ecotoxicological risk-based

493 prioritization of pharmaceuticals in the natural environment. Environ Toxicol Chem 35:1550–1559.

494 https://doi.org/10.1002/etc.3319.

495 15. Kasprzyk-Horder B, Baker DR. 2012. Enantiomeric profiling of chiral drugs in wastewater and

496 receiving waters. Environ Sci Technol 46:1681–1691. https://pubs.acs.org/doi/10.1021/es203113y.

497 16. Rice J, Proctor K, Lopardo L, Evans S, Kasprzyk-Hordern, B. 2018. Stereochemistry of ephedrine and

498 its environmental significance: Exposure and effects directed approach. J Hazard Mater 348:39–46.

499 https://doi.org/10.1016/j.jhazmat.2018.01.020.

18
 Microbial ephedrine degradation

500 17. Axelrod J. 1959. Metabolism of epinephrine and other sympathomimetic amines. Physiol Rev 39:751–

501 776. https://doi.org/10.1152/physrev.1959.39.4.751.

502 18. Klamann E. Schröppel E, BlecherR, Lingens F. 1976. Degradation of (–)-ephedrine by Arthrobacter

503 globiformis. European J Appl Microbiol 2:257– 265. https://doi.org/10.1007/BF01278609.

504 19. Klamann E, Lingens F. 1980. Degradation of (–)-ephedrine by Pseudomonas putida. Detection of (–)-

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

505 ephedrine: NAD+-oxidoreductase from Arthrobacter globiformis. Z Naturforsch C 35:80–87.

506 https://doi.org/10.1515/znc-1980-1-216.

507 20. Axelrod J. 1955. The enzymatic demethylation of ephedrine. J Pharmacol Exp Ther 114:430–8.

508 http://jpet.aspetjournals.org/content/114/4/430.long.

509 21. Ulrich R, Hofrichter M. 2007. Enzymatic hydroxylation of aromatic compounds. Cell Mol Life Sci

510 64:271–93. https://doi.org/10.1007/s00018-007-6362-1.

511 22. Layer RW. 1963. The Chemistry of Imines. Chem Rev 63:489–510.

512 https://pubs.acs.org/doi/10.1021/cr60225a003.

513 23. Conn HJ, Dimmick I. 1947. Soil bacteria similar in morphology to mycobacterium and

514 corynebacterium. J Bacteriol 54:291–303. http://jb.asm.org/cgi/pmidlookup?view=long&pmid=16561362.

515 24. Knackmuss HJ, Beckmann W. 1973. The structure of nicotine blue from Arthrobacter oxydans. Arch

516 Mikrobiol 90:167–169. https://doi.org/10.1007/BF00414521.

517 25. Busse HJ. 2016. Review of the taxonomy of the genus Arthrobacter, emendation of the genus

518 Arthrobacter sensu lato, proposal to reclassify selected species of the genus Arthrobacter in the novel

519 genera Glutamicibacter gen. nov., Paeniglutamicibacter gen. nov., Pseudoglutamicibacter gen. nov.,

520 Paenarthrobacter gen. nov. and Pseudarthrobacter gen. nov., and emended description of Arthrobacter

521 roseus. Int J Syst Evol Microbiol 66:9–37. https://dx.doi.org/10.1099/ijsem.0.000702.

522 26. Harwood CS, Parales RE. 1996. The beta-ketoadipate pathway and the biology of self-identity. Annu

523 Rev Microbiol 50:553–590. https://doi.org/10.1002/etc.3319.

524 27. Turnbull GA, Ousley M, Walker A, Shaw E, Morgan JA 2001. Degradation of substituted phenylurea

525 herbicides by Arthrobacter globiformis strain D47 and characterization of a plasmid-associated hydrolase

526 gene, puhA. Appl Environ Microbiol 67:2270–2275. https://doi.org/10.1128/AEM.67.5.2270-2275.2001.

527 28. Suzuki Y, Banfield JF. 2004. Resistance to, and accumulation of, uranium by bacteria from a uranium-

528 contaminated site. Geomicrobiol J 21:113–121. https://doi.org/10.1080/01490450490266361.

19
 Microbial ephedrine degradation

529 29. Scheublin TR, Leveau JH. 2013. Isolation of Arthrobacter species from the phyllosphere and

530 demonstration of their epiphytic fitness. Microbiologyopen 2:205–213.

531 https://dx.doi.org/10.1002%2Fmbo3.59.

532 30. Swer PB, Joshi SR, Acharya C. 2016. Cesium and strontium tolerant Arthrobacter sp. strain KMSZP6

533 isolated from a pristine uranium ore deposit. AMB Express 6:69. https://doi.org/10.1186/s13568-016-0247-

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

534 3.

535 31. Fuchs G, Boll M, Heider J. 2011. Microbial degradation of aromatic compounds - from one strategy to

536 four. Nat Rev Microbiol 9: 803–816. https://doi.org/10.1038/nrmicro2652.

537 32. Axelrod J. 1953. Studies on sympathomimetic amines. I. Biotransformation and physiological

538 disposition of l-ephedrine and I-norephedrine. J Pharmacol Exp Ther 109:62–73.

539 http://jpet.aspetjournals.org/cgi/pmidlookup?view=long&pmid=13097335.

540 33. Veeraswamy M, Devi NA, Kutty RK, Rao PV. 1976. Conversion of (+/-)-synephrine into p-

541 hydroxyphenylacetaldehyde by Arthrobacter synephrinum. A novel enzymic reaction. Biochem J 159:807–

542 809. https://doi.org/10.1042/bj1590807.

543 34. DeRuiter J, Hayes L, Valaer A, Clark CR, Noggle FT. 1994. Methcathinone and designer analogues:

544 synthesis, stereochemical analysis, and analytical properties, J Chromatogr Sci 32:552–564.

545 https://doi.org/10.1093/chromsci/32.12.552.

546 35. Kerrigan S, Savage M, Cavazos C, Bella P. 2016. Thermal degradation of synthetic cathinones:

547 Implications for forensic toxicology. JAT 40:1–11. https://doi.org/10.1093/jat/bkv099.

548 36. O'Byrne PM., Williams R, Walsh JJ, Gilmer JF 2010. The aqueous stability of bupropion. J Pharm

549 Biomed Anal 53:376–381. https://doi.org/10.1016/j.jpba.2010.04.024.

550 37. Tsujikawa K, Mikuma T, Kuwayama K, Miyaguchi H, Kanamori T, Iwata YT, Inoue H. 2012.

551 Degradation pathways of 4-methylmethcathinone in alkaline solution and stability of methcathinone

552 analogs in various pH solutions. Forensic Sci Int 220:103–110.

553 https://doi.org/10.1016/j.forsciint.2012.02.005.

554 38. Shanati, T., Ansorge-Schumacher, M. 2019. Enzymes and methods for the stereoselective reduction

555 of carbonyl compounds, oxidation and stereoselective reductive amination – for the enantioselective

556 preparation of alcohol amine compounds. WO/2019/002459 A1. PCT/EP2018/067407, p27.

20
 Microbial ephedrine degradation

557 39. Shanati, T., Lockie, C., Beloti, L., Grogan, G., Ansorge-Schumacher, M. 2019. Two

558 enantiocomplementary ephedrine dehydrogenases from Arthrobacter sp. TS-15 with broad substrate

559 specificity. ACS Catal 9:6202–6211. https://doi.org/10.1021/acscatal.9b00621 .

560 40. Marmur JA. 1961 Procedure for the isolation of deoxyribonucleic acid from microorganisms. J Mol Biol

561 3:208–218. https://doi.org/10.1016/S0022-2836(61)80047-8.

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

562 41. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic

563 trees. Mol Biol Evol 4:406–425. https://doi.org/10.1093/oxfordjournals.molbev.a040454.

564 42. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace

565 IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG.2007. Clustal W and Clustal X version 2.0.

566 Bioinformatics 23:2947–2948. https://doi.org/10.1093/bioinformatics/btm404.

567 43. Jukes TH, Cantor CR. 1969. Evolution of protein molecules. In Munro HN, editor, Mammalian Protein

568 Metabolism, New York, NY: Academic Press pp 21–132.

569 44. Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution

570 39:783–791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x.

571 45. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular evolutionary genetics

572 analysis across computing platforms. Mol Biol Evol 35:1547–1549.

573 https://doi.org/10.1093/molbev/msy096.

574 46. Rissman AI, Mau B, Biehl BS, Darling AE, Glasner JD, Perna NT 2009. Reordering contigs of draft

575 genomes using the Mauve aligner. Bioinformatics 25:2071–2073.

576 https://doi.org/10.1093/bioinformatics/btp356.

577 47. Alikhan NF, Petty NK, Zakour BNL, Beatson SA. 2011. BLAST Ring Image Generator (BRIG): simple

578 prokaryote genome comparisons. BMC Genomics 12:402. https://doi.org/10.1186/1471-2164-12-402

579 48. Meier-Kolthoff JP, Auch AF, Klenk HP, Göker M. 2013. Genome sequence-based species delimitation

580 with confidence intervals and improved distance functions. BMC Bioinformatics 14:60.

581 https://doi.org/10.1186/1471-2105-14-60.

582 49. Bradford MM. 1976. Rapid and sensitive method for quantitation of microgram quantities of protein

583 utilizing principle of protein-dye binding. Anal Biochem 72:248–254. https://doi.org/10.1016/0003-

584 2697(76)90527-3.

585
21
 Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

22
Microbial ephedrine degradation

586
 Microbial ephedrine degradation

587 Figure legends

588 Figure 1: Catabolism of ephedrine in mammals (A) and in Arthrobacter globiformis (B). O, cytochrome

589 P450 monooxygenase; D, NADPH-dependent enzyme; E, ephedrine dehydrogenase; H, spontaneous

590 imine hydrolyzation.

591 Figure 2: Growth of Arthrobacter sp. TS-15 on ephedrine isomers (R,S)-(–)-ephedrine (A), (S,R)-(+)-

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

592 ephedrine (B), (R,R)-(–)-pseudoephedrine (C) and (S,S)-(+)-pseudoephedrine (D) in liquid medium at 30

593 °C. (●): culture growth, (■): degradation of ephedrine isomer, and (▲): concentration of methcathinone.

594 Figure 3: Gene clusters of the beta-ketoadipate pathway in the metabolism of catechol (cat). The upper

595 cluster stems from Arthrobacter aurescens TC1 cat, and the two lower clusters belong to Arthrobacter sp.

596 TS-15 cat1 and cat2. The cat genes shared by all clusters are shown in orange, and the cat genes

597 displaying high nucleic acid sequence similarity only between Arthrobacter aurescens TC1 cat and

598 Arthrobacter sp. TS-15 cat1 are shown in blue. Red: unique genes within cluster cat2 in Arthrobacter sp.

599 TS-15 cat2 containing PseDH and EDH. Common cat clusters include catH/catG, catechol 3,4-

600 dioxygenase subunits A/B; catB, 3-carboxy-cis, cis-muconate cycloisomerase; catD, beta-ketoadipate

601 enol-lactone hydrolase; catC, 4-carboxymuconolactone decarboxylase; catF, 3-ketoacyl-CoA thiolase;

602 catI/catJ, 3-ketoacid-CoA transferase subunits A/B; and catR, cat regulon regulatory protein. The new

603 second cat ephedrine catabolic cluster contains the following additional genes: benK, benzoate MFS

604 transporter; EDH, ephedrine dehydrogenase; catR, cat regulon regulatory protein; PseDH,

605 pseudoephedrine dehydrogenase; AAP, amino acid permease; ACAD, acyl-CoA-dehydrogenase; and Fre,

606 flavin reductase.

607 Figure 4: Enantioselective oxidation of (–)-(R,N)-(pseudo)ephedrine and (+)-(S,N)-(pseudo)ephedrine

608 catalyzed by PseDH and EDH, respectively. Oxidation targets the hydroxyl group resulting in the

609 corresponding (S/R)-methcathinone.

610 Figure 5: Degradation of synephrine by enzymatic dehydration with so-called hydrolyase (E1). The

611 subsequent reaction step proceeds under aquatic conditions via enamine-imine tautomerism and imine

612 hydrolysis (modified from Veeraswamy (36)).

613 Figure 6: Postulated degradation of ephedrine in Arthrobacter sp. TS-15.

23
Downloaded from http://aem.asm.org/ on October 14, 2020 by guest
Downloaded from http://aem.asm.org/ on October 14, 2020 by guest
Downloaded from http://aem.asm.org/ on October 14, 2020 by guest
Downloaded from http://aem.asm.org/ on October 14, 2020 by guest
Downloaded from http://aem.asm.org/ on October 14, 2020 by guest
Downloaded from http://aem.asm.org/ on October 14, 2020 by guest
Table 1: Kinetic parameters of ephedrine oxidation catalyzed by PseDH and EDH, respectively.

Steady-state kinetic data are given in Fig. S10 (Supporting Information).

Substrate vmax (U mg-1) Km (mM) Ki (mM) kcat (s-1)

EDH

(R,S)-(–)-ephedrine 5.48±0.2 0.036±0.00 4.61±0.59 2.62±0.10

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

(R,R)-(–)-pseudoephedrine 4.29±0.36 0.094±0.01 1.78±0.32 2.06±0.17

NAD+ 11.36±0.11 0.11±0.00 5.44±0.07

PseDH

(S,R)-(+)-ephedrine 2.8±0.07 0.33±0.03 1.45±0.04

(S,S)-(+)-pseudoephedrine 7.3±0.19 0.263±0.03 3.77±0.10

NAD+ 17.88±0.44 3.4±0.26 9.22±0.23

Table 2: PCR primers used for 16S rRNA gene amplification.

Sequence Restriction sites

Primer (restriction sites are underlined)
16S rRNA Primer
16SV3_fwd CCAGACTCCTACGGGAGGCAG

Downloaded from http://aem.asm.org/ on October 14, 2020 by guest

16SV6_rev ACATTTCACAACACGAGCTGACGA
16SV1_fwd CAACGGAGAGTTTGATCCTGGC and
16SV9_rev AGGAGGTGATCCAGCCGCA
Cloning Primer
PseDH_fwd AATTCCATATGATCAATATGCGAAACAG NdeI
PseDH_rev AATATCTCGAGTTAGTTGACGAGAGCGG XhoI
EDH_fwd AATTCCATATGCTGGTTGAAGGAAAAAACG NdeI
EDH_rev AATATCTCGAGTCAGAAAGCCGAGTATCC XhoI