See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/330555007

Molecular Characterization of Fungal Species Isolated From Rice Grains

Article · January 2019

CITATIONS READS
2 323

4 authors:

Sohaib Afzaal Shinawar Waseem Ali

Citrus Research Institute (Pakistan) University of the Punjab Quid-i-Azam Campus Lahore Pakistan
25 PUBLICATIONS   17 CITATIONS    75 PUBLICATIONS   605 CITATIONS   

SEE PROFILE SEE PROFILE

Aftab Ahmed Rashid Mahmood

Government College University Faisalabad University of the Punjab
37 PUBLICATIONS   175 CITATIONS    33 PUBLICATIONS   147 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Investigation on pathogens associated with potato rot and role of PGPR Bacteria in disease Management. View project

Lights Interception and Nitrogen Fertilization may Alter the Concentration of Polyphenols in Medicinal Plants View project

All content following this page was uploaded by Sohaib Afzaal on 23 January 2019.

The user has requested enhancement of the downloaded file.

 International Conference on Chemical, Agricultural and Biological Sciences (CABS-2015) Sept. 4-5, 2015 Istanbul (Turkey)

Molecular Characterization of Fungal Species Isolated From

Rice Grains
Sohaib Afzaal1, Shinawar Waseem Ali1*, Aftab Ahmed1 and Rashid Mahmood1
Institute of Agricultural Sciences, University of the Punjab, Quid-i-Azam Campus, Lahore – 54590, Pakistan
1

*Corresponding author e-mail: shinawar.iags@pu.edu.pk

Abstract: Rice is the 2nd largest food commodity consumed in Pakistan after wheat. Rice grains stored in
godowns are most susceptible to mycotoxins production due to humidity and temperature conditions favorable
for fungal growth. Present study was conducted to analyze occurrence of fungal species, contaminating rice
grains in local markets. Rice samples were collected randomly from local markets, and after serial dilution,
fungal isolates, with distinct morphology, from different plates were isolated and purified through repeated
spreading and streaking. On the basis of phenotypic characters total eight (8) strains were isolated and further
subjected to molecular analysis. The ITS (internal transcribed spacers) regions by using ITS1 and ITS4 primers
were amplified for each isolate. Phylogenetic analysis based on ITS regions revealed that all of these isolates
belong to genus Aspergillus. Four (4) of these isolates were identified as Aspergillus fumigatus species, while
remaining four (4) strains were identified as member of Aspergillus flavus species. Occurrence of high
contamination level of Aspergillus flavus species, approximately 50%, indicates the possible production of
aflatoxins in rice grains. This research provides the baseline studies for the occurrence of Mycotoxigenic fungal
species in rice grains being sold in local markets and their phylogenetic relationship.
Keywords: Rice, Mycobiota, Aspergillus species, Phylogeny, Aflatoxins

1. Introduction
Mycotoxins are the secondary fungal metabolites produced from a variety of molds in food and feed
products. Word mycotoxin is combination of two words, first is mykes that is a Greek word used for fungiand
other is toxicum that is a Latin word used for poisons or toxins. Mycotoxins can be produced in cereal grains at
various stages of food chain, before harvesting in field, after harvesting during transportation, and storage.
Primarily these are produced by strains of Aspergillus, Fusarium and Penicillium. A wide range of foods is
susceptible to mycotoxins having significant adverse effects on human and animal health. Mycotoxicosis is the
disease caused by mycotoxins associated with acute and chronic toxicity leading to severe problems depending
on the kind and dose of toxins. Mycotoxins have been proven as carcinogenic, teratogenic, tremorgenic, and
dermatitis in many organisms and also cause hepatic cancer in human [1].
Mycotoxins have adverse effects on about 1/4th of the world’s food crops. These fungal metabolites
contaminate the huge quantity of our common food commodities including rice grains, wheat grains and maiz,
while animal feed too.. Approximately, 400 different mycotoxins have been reported that are produced by more
than two hundred different fungal species. Among these, twenty mycotoxins build at concentrations likely to
create many health hazards for animals and peoples [2].
Aflatoxins are extremely carcinogenic, muatagenic and toxic compounds produced by several Aspegillus species,
especially Aspergillus flavus and Aspergillus parasiticus as secondary metabolites [3] [4]. Other main mycotoxin
producing fungal strains belongs to Fusarium and Penicillum species. Mycotoxins are produced due to many
factors starting from farm to storage by various fungal species [5]. Temperate and tropical regions are most
susceptible places for fungal growth and production of mycotoxins throughout the world, mainly depending
upon the fungal strains. Food products i.e., cereals, dried fruits, cocoa, coffee, oil seeds, dried peas, beans, fruits
and spices are mainly contaminated by aflatoxins. Barley, cereals and grapes contaminated with mycotoxins are
used for production of liquor, beer and wine, that may contaminate these beverages. Foods from animal origin
including meat, egg and milk products obtained from livestock being fed on contaminated feed are also major
source of entry of mycotoxins in human food chain.

161
 International Conference on Chemical, Agricultural and Biological Sciences (CABS-2015) Sept. 4-5, 2015 Istanbul (Turkey)

Aflatoxin contamination usually occurs before the harvesting of crop in the field. Post-harvest contamination
may occur during storage if drying is delayed or moisture content is allowed to exceed critical limit of fungus
growth. Grain’s sprouting on the panicle of rice is prevalent because of delayed harvesting in drizzling season.
Wet environment enhances the growth of aflatoxegenic fungal strains including Aspergillus flavus, Aspergillus
niger, Aspergillus parasiticus that are main quality detriment in cereal grains during storage [6] [7] [8]. Several
studies for the analysis of aflatoxins in different crops like wheat, rice, maize and chilies have reported high
level contamination of aflatoxins in Pakistani crops [9]. A strong synergistic relation between long-term
exposure to aflatoxin and liver cancer in Pakistan has also been reported by Qureshi et al. [10].
Basmati rice export from Pakistan is severely affected in recent past due to contamination of grains with
aflatoxins. It is need of time to adopt control and management strategies to lower the aflatoxin levels in our rice
to meet the food safety standards and to increase our global rice trade. Initially, there is a strong need to analyze
the fungal mycobiota present on the rice grains, especially the mycotoxigenic fungal species. So, this study was
carried out to isolate and characterize the fungal species contaminating the rice grains and their molecular
identification based on the phylogenetic analysis of Internally Transcribed Spacer (ITS) regions. According to
best of our knowledge, this is the first report on molecular characterization of fungal species contaminating the
rice grains in Pakistan.

2. Materials and Methods

2.1. Samples Collection
Samples of rice grains were purchased from randomly selected local markets of eight different towns. In
each market, ten (10) different retailers were selected to procure rice grains, and rice samples from all retailers
were mixed thoroughly to obtain a homogenized representative sample. Samples from each town were labeled as
R1, R2, R3, R4, R5, R6, R7 and R8 respectively. Subsample of 100 g from each sample was taken and stored for
further studies.

2.2. Isolation and enumeration of fungal species

Fungal species were isolated by using Agar plate and blotter method [11]. Rice grains were aseptically
placed. Sterilized seeds were placed aseptically on Potato Dextrose Agar (PDA) plates while in blotter method
sterilized seeds were placed aseptically on a layer of three sterilized moistened filter paper at the rate of 10
grains per plate. Each sample was triplicated for each method. The plates were incubated at 25 oC. Fungi growing
on different seeds were isolated from emerging colonies and pure cultures were obtained for subsequent studies.
Percentage occurrence of each spp. was also calculated by following formula:
% Occurrence of species = No. of colonies of a species / Total no. of colonies x 100
Purified cultures of different fungal species were maintained by inoculating the spores of actively growing
pure colonies of fungal species on Potato Dextrose Agar (PDA) slants containing antibiotics and preserved at
4oC in refrigerator for further studies.

2.3. Phenotypic characterization

Phenotypic characterization was done on the basis of mycelium growth pattern, color and properties of
fruiting bodies of fungi. Macroscopic characters studied for identification of fungal species include growth
pattern of fungal colonies, colony size and color (reverse and coarse), exudates and colony margins Slides of all
species were prepared for studying microscopic characters. The documentation of fungal isolates including head
size, shape of vesicles, conidiophores and conidia characters like conidial diameter, wall, shape, surface and
conidia attachment with conidiophore was done microscopically. These characters were finally compared with
the synoptic keys for identification of fungal isolates [12].

2.4. Molecular analysis

Fungal DNA extraction was done by CTAB method [13] with some modifications according to our lab
facilities. Quality of the DNA was checked by running extracted DNA on 0.84% gel. Quantification of all
extracted DNA samples was done by taking their absorbance at 260 nm and 280 nm in double beam
spectrophotometer. Polymerase Chain Reaction (PCR) was carried out to amplify the ITS region of different

162
 International Conference on Chemical, Agricultural and Biological Sciences (CABS-2015) Sept. 4-5, 2015 Istanbul (Turkey)

fungal species for their molecular identification. ITS 1 (TCCGTAGGTGAACCTGCGG) and ITS 4
(TCCTCCGCTTATTGATATGC) primers were used for PCR reaction, and amplified PCR products were
confirmed by running PCR amplicons on agarose gel. Purification of PCR products were done by using Gene
Clean kit provided by Thermo Scientific. The PCR products were cloned into a linear pTZ57R/T vector.

2.5. Sequencing and phylogenetic analysis

Cloned samples of ITS region were sent to commercial labs for sequencing. The obtained sequences were
aligned and combined by using software DNAStar and Bio-edit. After combining sequences, these were blasted
on NCBI for finding similar sequences. Multiple alignments of the sequences were performed. Only those
sequences were included that showed highest sequence similarities with our query sequence. Phylogenetic
analysis following the Maximum Likelihood method [14] were conducted using software MEGA6 [15].
Phylogenetic tree was build using the neighbour-joining method and visualized in Tree Explorer provided in the
MEGA6 software. Bootstrap test with 1000 replications was included during tree construction.

3. Results and Discussion

3.1. Morphological analysis
Total eight (8) fungal strains i.e. S1, S2, S3……..S8, were purified based on their distinct morphology on
agar plates. Macro-morphology was determined on the basis of culture media, age of culture and incubation
temperature. Colony morphology was based on color, texture, exudates and diameter and conidial morphology
and arrangements. A brief over-view of morphological characters of isolates is given below:
3.1.1. Isolate S1
Colonies appeared in 7 days of about 3.2 cm diameter on MEA plates at 25 0C. White colored mycelium,
bright yellowish green colonies, reverse uncolored, exudates absent, powdery in texture. Conidial heads of 30 to
60 µm in diameter and 20-40 µm vesicles in diameter, hyaline shaped. Rough conidiophores of 5-9 µm in width
and 2-6mm in length having thick cellular contents, while conidia were rough or smooth surface, 3-6 µm in size,
globular to sub-globular in shape.
3.1.2. Isolate S2
Colonies appeared in 7 days of about 3.2 cm on MEA plates at 25 0C. White colored mycelium, dull green
and reverse cream colored colonies, spore textured. Dark green conidial heads radiated 25 to 35 µm. Vesicles
were 16-20 µm, hyaline and pyriform shaped. Conidiophores were roughened with thick walled and 10-12 µm in
width and more than 3 mm in length. Conidia round to globose in shape, thick walled 3-5 µm in size and smooth
surface.
3.1.3. Isolate S3
Colonies were appeared in spread form and comparatively smaller in size in 7 days at 25 0C. Colonies were
dull green, size of 0.8 cm in dia. Conidial heads were greenish, radiated 15-20 µm in diameter and vesicles shape
containing one thick end. Conidiophores characterized by roughened, thin walled, 6-8 µm in width and more
than 2mm in length. Conidia characterized as globose to round in shape, 2.5-3 µm in size with small spines on
surface, produced in chains basipetally from phailides.
3.1.4. Isolate S4
3.7 cm radiated colonies were appeared in 6 days on PDA plates at 25 0C in spread form. Colonies were dark
grey and reversed dull green, exudates absent and spory in texture. Blackish green conidial heads, radiated 12-15
µm and clavate vesicles. Roughened conidiophores and thin walled, 6-8 µm in width, 5 µm in diameter and
more than 2mm in length. Conidia characterized as globes to round in shape, 2-3 µm in size with small spines on
surface produced in chains basipetally from phailides or single attachment on some phailides.
3.1.5. Isolate S5
Colonies of 3.5 cm were appeared in 7 days on MEA plates at 25 0C. Dark brown to black colored colonies
were observed, while white color was appeared at the margins of colonies containing spory texture. Heads of
conidia were large dark brown, radiated about 35 to 40 µm. Vesicles were of 40 µm in diameter, hyaline and
globose in shape. Conidiophores were smooth walled, hyaline of 8- 10 µm in width and more than 2mm in

163
 International Conference on Chemical, Agricultural and Biological Sciences (CABS-2015) Sept. 4-5, 2015 Istanbul (Turkey)

length. Conidia were globose to subglobose in shape, rough walled, dark brown to black colored and size of 3-4
µm.
3.1.6. Isolate S6
Colonies of 3.8 cm were appeared in in 7 days on MEA plates at 25 0C. Colonies were white to light pink,
white aerial mycelium and pigmentation was present, texture was hard cottony. Conidiophores were erect and
hyaline. Two types of conidia were produced, microconidia and macroconidia. Microconidia were hyaline in
color and measuring 2-3.5 µm in width and 5-12 µm in length. Macroconidia were found boat shaped to oblong,
hyaline, thick walled and 3-4 µm in width while 30 to 45 µm in length.
3.1.7. Isolate S7
Colonies were appeared of 3.6 cm in 7 days on MEA plates at 25 0C. Colonies were black to olivaceous
black in color, growth was observed mat like having floccose texture. Conidiophores were raised from septate
hyphae. Multi-celled conidia were produced sympodialy by simple and short conidiophores. Conidia were
characterized by obclavate, pyriform to ellipsoidal, 15-25 µm in width while more than 100 µm in length.
3.1.8. Isolate S8
Colonies of 2.3 cm were appeared in 7 days on MEA plates at 25 0C. Mycelium white, colony olive green,
reverse uncolored, exudates absent, spory in texture. Colony growth is spread. Conidial heads are relatively high
in abundance, radiated, dark green in color. Vesicles are 30-40 µm in diameter; light green and globose in shape.
Conidiophore roughened 5-9 µm in width and 2-6mm in length thick cellular contents. Conidia smooth surface,
3-6 µm in size, globose to sub-globose in shape.
However, fungi change its morphology at different stages of growth and reproduction, so merely on the basis
of phenotypic studies; identification of species is very difficult task. Therefore, these isolates were subjected to
molecular/phylogenetic analysis through PCR amplification of their ITS regions.

3.2. Molecular Characterization

Molecular analysis was carried out of all eight (8) isolates (S1, S2, S3………S8) designated on the basis of
their distinct morphology. Quantity of extracted DNA from all the samples was between 790 µg/ mL to 1491µg/
mL, which is an excellent quantity range. ITS regions were amplified successfully from each strain, and
subjected to phylogenetic analysis for molecular level identification. Phylogenetic dendrogram for each isolate is
shown in Fig. 1 to Fig. 8 below, respectively.

Fig. 1: Phylogenetic dendrogram on the basis Fig. 2: Phylogenetic dendrogram on the basis
of ITS regions of Isolate S1 of ITS regions of Isolate S2

Fig. 3: Phylogenetic dendrogram on the basis

Fig. 4: Phylogenetic dendrogram on the basis
of ITS regions of Isolate S3
of ITS regions of Isolate S4

164
 International Conference on Chemical, Agricultural and Biological Sciences (CABS-2015) Sept. 4-5, 2015 Istanbul (Turkey)

Fig. 5: Phylogenetic dendrogram on the basis of

ITS regions of Isolate S5 Fig. 6: Phylogenetic dendrogram on the basis
of ITS regions of Isolate S6

Fig. 7: Phylogenetic dendrogram on the basis of Fig. 8: Phylogenetic dendrogram on the basis
ITS regions of Isolate S7 of ITS regions of Isolate S8

Following inferences were made on the basis of phylogenetic analysis:

 Isolate S1 showed maximum similarity with Aspergillus fumigatus strain TUHT28 (LN482424) (Fig. 1).
 Isolate S2 showed maximum similarity with Aspergillus flavus (EF409784.1) (Fig. 2).
 Isolate S3 showed maximum similarity with Aspergillus fumigatus (WM 04.472) (Fig. 3).
 Isolate S4 showed maximum similarity with Aspergillus fumigatus strain TUEF38 (HG798742.1) (Fig. 4).
 Isolate S5 showed maximum similarity with Aspergillus fumigatus strain 1667 (AM490816.1) (Fig. 5).
 Isolate S6 showed maximum similarity with Aspergillus flavus strain TN-LBA2 (JX502758.1) (Fig. 6).
 Isolate S7 showed maximum similarity with Aspergillus flavus strain MB3 (HQ844677.1) (Fig. 7).
 Isolate S8 showed maximum similarity with Aspergillus flavus strain MB39 (HQ844713.1) (Fig. 8).
Prevalence of two dominant species and eight different strains of Aspergillus were concluded on the basis of
Phylogentic analysis. Two species were Aspergillus flavus and Aspergillus fumigatus, while out of total eight (8)
strains, four different (4) strains of Aspergillus flavus as well as four (4) different strains of Aspergillus fmigatus
were analyzed through phylogentic analysis. So we can say that prevalence of Aspergillus flavus in stored rice
grains is about 50%, which is very high, and indicates the possible high level production of aflatoxins in rice
grains under study. Further studies on the quantification of aflatoxins in rice grains and their relationship with
the level of contaminating fungal species are in progress.

4. Conclusion
Mycoflora from stored rice grains was isolated in present study and fungal isolates were characterized on the
basis of their phenotype and genotype. Total eight (8) isolates were purified on the basis of distinct phenotypic
characters and processed for molecular characterization. Results showed the contamination of two main fungal
species i.e. Aspergillus flavus and Aspergillus fumigatus. As Aspergillus flavus is major aflatoxins producing
fungal species, so its presence indicates the possible contamination of aflatoxins in rice grains under study. It
also indicates the poor agronomic practices of the farmers during rice cropping as well as poor processing and
storage practices at post harvest stages of rice in Pakistan. So there is a strong need to devise good agricultural
practices, as well as control strategies to avoid Mycotoxigenic fungal contamination in rice ensure the food
safety standards to increase our rice export and to build a healthy nation.

165
 International Conference on Chemical, Agricultural and Biological Sciences (CABS-2015) Sept. 4-5, 2015 Istanbul (Turkey)

5. Acknowledgements
Dr. Shinawar Waseem Ali is highly obliged to Higher Education Commission (HEC) Pakistan for the
provision of funds through start-up research grant (PM-IPFP/HRD/HEC/2012/3582) to carry out this research.

6. References
[1] V. Kumar, M.S. Basu and T.P. Rajendran, “Mycotoxin research and mycoflora in some commercially important
agricultural commodities,” Crop Protection, vol. 27, pp. 891-905, 2008.
[2] E. Anklam, J. Stroka and A. Boenke, “Acceptance of analytical methods for implementation of EU legislation with
focus on mycotoxins,” Food Control, vol. 13, pp. 173–183, 2002.
[3] B. Romagnoli, V. Menna, N. Gruppioni and C. Bergamini, “Aflatoxins in spices, aromatic herbs, herb-teas and
medicinal plants marketed in Italy,” Food Control, vol. 18, pp. 697–701, 2007.
[4] M.J. O’Riordan and M.G. Wilkinson, “A survey of the incidence and level of aflatoxin contamination in a range of
imported spice preparations on the Irish retail market,” Food Chem., vol. 107, pp. 1429– 1435, 2008.
[5] K. Griessler, I. Rodrigues, J. Handl and U. Hofstetter, “Occurrence of mycotoxins in Southern Europe,” World
Mycotoxin Journal, vol. 3, pp. 301-309, 2010.
[6] K.R.N. Reddy, C.S. Reddy, U.N. Mangala and K. Muralidharan, “Site of Infection of Aspergillus sp. in seeds of rice
cultivars,” J. Mycol., vol. 36, pp. 271–277, 2006.
[7] K.R.N. Reddy, C.S. Reddy, H.K. Abbas, C.A. Abel and K. Muralidharan, “Mycotoxigenic Fungi, Mycotoxins, and
Management of Rice Grains,” Toxin Reviews, vol. 27, pp. 287-317, 2008.
[8] K.R.N. Reddy, C.S. Reddy and K. Muralidharan, “Detection of Aspergillus spp. and aflatoxin B1 in rice in India,”
Food Microbiology, vol. 26, pp. 27–31, 2009.
[9] H. Shanakhat, A.A. Shahid, and S.W. Ali, “Characterization of fungal microbiota on rice grains from local markets of
Lahore,” Journal of Hygienic Engineering and Design, vol. 9, pp. 35-40, 2014.
[10] H. Qureshi, S . J . Zuberi, N . A . Jafarey and S.H. Zaidi, “Hepatocellular carcinoma in Karachi,” J Gasteroenterol
Hepatol., vol. 5, pp. 1-6, 1990.
[11] S.A. Mathur, S.B. Matur and P. Neergaard, “Detection of seed borne fungi in sorghum and location of Fusarium
moniliforme in seed,” Seed Sci. Technol., vol. 3, pp. 683-690, 1975.
[12] H.L. Barnett, B. Barry and F. Hunter, Illustrated Genra of Imperfect Fungi, 4th ed. American Pathology Society. U.S.A:
1998.
[13] M.A. Saghai-Maroof, K.M. Soliman, R.A. Jorgensen and R.W. Allard, “Ribosomal DNA spacer-length Polymorphism
in barley: Mendelian inheritance, chromosomal location and population dynamics,” Proc. Acad. Sci. USA, vol. 81, pp.
8014-8019, 1984.
[14] K. Tamura, and M. Nei, “Estimation of the number of nucleotide substitutions in the control region of mitochondrial
DNA in humans and chimpanzees,” Molecular Biology and Evolution, vol. 10, pp. 512-526, 1993.
[15] K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, “MEGA6: Molecular Evolutionary Genetics Analysis
version 6.0,” Molecular Biology and Evolution, vol. 30, pp. 2725-2729, 2013.

166

View publication stats