Resource

Cloning of Macaque Monkeys by Somatic Cell

Nuclear Transfer
Graphical Abstract Authors
Zhen Liu, Yijun Cai, Yan Wang, ...,
Zhanyang Wang, Muming Poo, Qiang Sun

Correspondence
qsun@ion.ac.cn

In Brief
Generation of cloned cynomolgus
monkeys by somatic cell nuclear transfer
using fetal monkey fibroblasts.

Highlights
d Somatic cell nuclear transfer (SCNT) using fetal fibroblasts
yielded two live monkeys

d Epigenetic modulators promoted development and

pregnancy rate of SCNT embryos

d SCNT using adult cumulus cells yielded live births of

monkeys that were short-lived

d Genetic analysis confirmed the clonal origin of the SCNT

monkey offspring

Liu et al., 2018, Cell 172, 881–887

February 8, 2018 ª 2018 Elsevier Inc.
https://doi.org/10.1016/j.cell.2018.01.020
Resource
Cloning of Macaque Monkeys
by Somatic Cell Nuclear Transfer
Zhen Liu,1 Yijun Cai,1 Yan Wang,1 Yanhong Nie,1 Chenchen Zhang,1 Yuting Xu,1 Xiaotong Zhang,1 Yong Lu,1
Zhanyang Wang,1 Muming Poo,1 and Qiang Sun1,2,*
1Institute of Neuroscience, CAS Center for Excellence in Brain Science and Intelligence Technology, State Key Laboratory of Neuroscience,
CAS Key Laboratory of Primate Neurobiology, Chinese Academy of Sciences, Shanghai, China
2Lead Contact
*Correspondence: qsun@ion.ac.cn
https://doi.org/10.1016/j.cell.2018.01.020
SUMMARY
Generation of genetically uniform non-human pri-
mates may help to establish animal models for
primate biology and biomedical research. In this
study, we have successfully cloned cynomolgus
monkeys (Macaca fascicularis) by somatic cell nu-
clear transfer (SCNT). We found that injection of
H3K9me3 demethylase Kdm4d mRNA and treatment
with histone deacetylase inhibitor trichostatin A at
one-cell stage following SCNT greatly improved
blastocyst development and pregnancy rate of trans-
planted SCNT embryos in surrogate monkeys. For
SCNT using fetal monkey fibroblasts, 6 pregnancies
were confirmed in 21 surrogates and yielded
2 healthy babies. For SCNT using adult monkey
cumulus cells, 22 pregnancies were confirmed in
42 surrogates and yielded 2 babies that were short-
lived. In both cases, genetic analyses confirmed
that the nuclear DNA and mitochondria DNA of the
monkey offspring originated from the nucleus donor
cell and the oocyte donor monkey, respectively.
Thus, cloning macaque monkeys by SCNT is feasible
using fetal fibroblasts.
INTRODUCTION
Cloning of animals by somatic cell nuclear transfer (SCNT) has
been achieved in 23 mammalian species (see review Rodri-
guez-Osorio et al., 2012), including sheep (Wilmut et al., 2007),
mouse (Wakayama et al., 1998), cattle (Kato et al., 1998), pig
(Polejaeva et al., 2000), cat (Shin et al., 2002), rat (Zhou et al.,
2003), and dog (Lee et al., 2005). As species closer to humans,
non-human primates are ideal animal models for studying
physiological functions unique to primates and for developing
therapeutic treatments of human diseases (Izpisua Belmonte
et al., 2015; Jennings et al., 2016). Animal models with genetic
uniformity are often desirable (Schramm and Paprocki, 2004),
but an inbreeding approach as used in generating rodent models
is not practical for non-human primates because of their long
generation time (Smedley et al., 2002), although the latter could
be shortened by speeding sperm maturation with testicular
xenografting (Liu et al., 2016b). Cloning of non-human primates
by SCNT has failed to generate live offspring so far (Mitalipov
et al., 2002; Mitalipov et al., 2007; Ng et al., 2004; Simerly
et al., 2003; Sparman et al., 2010). In view of the fact that live
monkeys could be generated using nuclear transfer of early
blastomeres (Meng et al., 1997), previous failure of SCNT
appears to be caused by inappropriate reprogramming of the so-
matic nucleus for supporting the development of transplanted
embryos.
Histone deacetylase inhibitors such as trichostatin A and
scriptaid have been used to improve the efficiency of mammalian
SCNT in several species, including mouse, bovine, pig, monkey,
and human (Akagi et al., 2011; Kishigami et al., 2006; Sparman
et al., 2010; Tachibana et al., 2013; Zhao et al., 2009). Further-
more, reprogramming-resistant regions (RRRs) that are enriched
for histone 3 lysine 9 trimethylation (H3K9me3) modification were
identified in SCNT embryos. Expression of human H3K9me3
demethylase Kdm4d/4a could reduce the H3K9me3 level and
significantly improve the efficiency of both mouse and human
SCNT (Antony et al., 2013; Chung et al., 2015; Liu et al., 2016a;
Matoba et al., 2014), suggesting that RRRs are conserved
among mammalian species. In this study, we applied both his-
tone demethylase Kdm4d mRNA and histone deacetylase inhib-
itor trichostatin A (TSA) to the cloning of macaque monkeys. We
performed SCNT using both fetal monkey fibroblasts and adult
monkey cumulus cells and successfully produced live birth of
monkey offspring carrying nuclear DNA of the donor cell and
mitochondria DNA of the oocyte donor monkey. Monkey
neonates generated using fetal fibroblasts were healthy,
whereas those generated using adult cumulus cells survived
only briefly after birth. Since fetal fibroblasts could be genetically
modified efficiently in vitro and properly screened for precise
gene editing (Gao et al., 2017; Lai et al., 2016; Rogers, 2016) prior
to SCNT, our results pave the way for the generation of geneti-
cally uniform monkey models for basic research and biomedical
applications.
RESULTS
Optimization of SCNT Methods
We first optimized the SCNT protocol, including polarized-light
imaging for the removal of spindle-chromosome complex from
the oocyte, incubation of the nuclear donor cell with viral enve-
lope isolated from the Hemagglutinin Virus of Japan (HVJ-E,
Cell 172, 881–887, February 8, 2018 ª 2018 Elsevier Inc. 881

Tachibana et al., 2010), and facilitation of donor cell insertion into
the perivitelline space with laser lesion of zona pellucida (Fig-
ure 1A–1F). Clear spindle-like structure was detected after the
fusion of the fetal monkey fibroblast with the enucleated oocyte
(Figures 1G and S1A). About 1–2 hr after the fusion, ‘‘recon-
structed’’ oocytes were activated with ionomycin and 6-dime-
thylaminopurine (I/D). All activated embryos showed a single
pronucleus (Figures 1H and S1B) and were further cultured for
in vitro development. A small percentage (4/30, or 13.8%) of
I/D-activated SCNT embryos developed to the blastocyst stage.
To improve the developmental potential of SCNT embryos, we
treated another group of SCNT embryos (I/D/T) with 10 nM of
the histone deacetylase inhibitor trichostatin A (TSA) (Kishigami
et al., 2006) for 10 hr during and after I/D activation. We found
a similarly low blastocyst rate (5/31, or 16.7%), but the quality
of blastocysts was improved. For the I/D-activated group, we
found no or little inner cell mass (ICM), but prominent ICM was
observed in 2/5 of the blastocysts in the I/D/T group (Figures
2A, 2B, S1C, and S1D).
Based on the recent progress in studying epigenetic modifica-
tion of transferred nuclear DNA in mammalian cloning by SCNT
(Matoba et al., 2014), we injected exogenous human Kdm4d
mRNA to the SCNT embryos after the activation under I/D/T
condition (I/D/T/K). We found that a much higher percentage
(17/38, or 44.7%) of Kdm4d mRNA-injected SCNT embryos
derived from fetal monkey fibroblasts were able to develop into
882 Cell 172, 881–887, February 8, 2018
Figure 1. Procedure for Monkey SCNT
Using Fetal Monkey Fibroblasts
(A) Fetal monkey fibroblasts in primary culture.
(B and C) Spindle-chromosome complex (arrow-
head) in a monkey MII oocyte before (B) and after
(C) removal.
(D–F) An oocyte with a slit in the zona pellucida (D,
arrowhead) induced by laser irradiation, and the
HVJ-E-incubated fibroblast (arrowhead) before (E)
and after (F) injection into the perivitelline space.
(G) Spindle-like structure formed by the donor
fibroblast nucleus after fibroblast-cytoplast fusion.
(H) Single nucleus formed after embryo activation
with ionomycin and DMAP.
(I) Blastocysts developed from Kdm4d mRNA-
injected embryos, which were produced by SCNT
using fetal fibroblasts (arrowheads: ICM).
(J–L) Example images of blastocysts with and
without normal development of ICM shown at a
higher resolution. Blastocysts with a prominent
ICM (arrowhead) obtained by SCNT (J), blasto-
cysts with a prominent ICM (arrowhead) obtained
by ICSI (K), and poor-quality blastocysts without
clear ICM obtained by SCNT (L).
All scale bars, 60 mm.
blastocysts, among which a large fraction
(11/17, or 64.7%) showed prominent ICM
similar to the ICM in embryos obtained by
intracytoplasmic sperm injection (Figures
1I–1L, 2A, and 2B). We also tested the
effect of Kdm4d mRNA injection on
SCNT embryos derived from cumulus
cells of adult female monkeys (from which the oocytes were
obtained) and found that all SCNT embryos showed a single
pronucleus after activation under I/D/T condition (Figures S2A–
S2D). The majority of them (24/33, or 72.7%) developed into
blastocysts, most of which (15/24, or 62.5%) showed prominent
ICM. By contrast, in the absence of Kdm4d mRNA injection, only
5% (1/20) of SCNT embryos derived from cumulus cells
developed into blastocysts, none of which showed prominent
ICM (Figures 2C, 2D, S2E, and S2F).
To further understand the mechanism by which Kdm4d
mRNA improved the development of monkey SCNT embryos,
RNA sequencing (RNA-seq) was performed on cumulus cells,
4- and 8-cell embryos obtained by ICSI, and 8-cell SCNT em-
bryos (derived from cumulus cells) with and without Kdm4d
mRNA injection. Analysis of RNA-seq datasets of monkey
ICSI embryos at 4- and 8-cell stage (n = 4 embryos each) led
to identification of 3,997 regions (20–160 kb) that were ex-
pressed at least 5-fold higher (FC > 5) in 8-cell embryos as
compared to 4-cell embryos (Data S1), indicating massive up-
regulation of genes during early embryonic development. Com-
parison of these regions between 8-cell ICSI embryos and 8-
cell SCNT embryos without Kdm4d mRNA injection showed
2,465 RRRs (FC > 5) in SCNT embryos (Data S1). By contrast,
2,178/2,465 RRRs were markedly upregulated (FC > 2) in
Kdm4d mRNA-injected SCNT embryos (Figure 2E, Data S1).
The effect of Kdm4d mRNA expression in removing the histone

methylation site H3K9me3 of SCNT embryos was further
confirmed by immunostaining of H3K9me3 (Figure 2F), showing
that the level of H3K9me3 was high in control one-cell SCNT
embryos but greatly reduced in those injected with
Kdm4d mRNA.
To identify candidate genes that were repressed by H3K9me3
and may be responsible for the poor development of monkey
SCNT embryos, we further examined the RNA-seq data and
found that some developmental pluripotency-associated genes
such as Dppa2, Dppa4, and Myc were repressed by H3K9me3
in monkey SCNT embryos. Other repressed genes found in
mouse SCNT embryos, such as Zscan4 and Polr3h, were also
identified in monkey SCNT embryos. A more complete list of
genes identified is shown in Data S1. Further studies on directly
manipulating these genes in SCNT embryos are needed to
confirm their roles in facilitating embryonic development (Ma-
toba et al., 2014). Taken together, the expression of H3K9me3
demethylase Kdm4d significantly improved epigenetic reprog-
ramming in monkey SCNT embryos similar to that found in other
species (Chung et al., 2015; Matoba et al., 2014). Thus, Kdm4d
mRNA injection was used in all subsequent experiments in the
present study.
Table 1. Statistics on the Development of SCNT Embryos
Donor cells Oocytes SCNT embryos Embryos transferred
Fetal fibroblasts 127 109 79
Cumulus cells 290 192 181
Figure 2. Blastocyst Development of SCNT
Monkey Embryos
(A and C) Percentages of cleaved embryos that
developed into blastocysts (blastocyst rate) of
SCNT embryos using fetal fibroblasts (A) and adult
cumulus cells (C) under different conditions.
I: ionomycin, D: 6-dimethylaminopurine, T: TSA,
K: Kdm4d mRNA.
(B and D) Percentages of blastocysts showing
prominent ICM in SCNT embryos using fetal
fibroblasts (B) and adult cumulus cells (D).
(E) Upregulation of RRRs resulting from Kdm4d
modification in SCNT embryos. CC: Expression
levels of RRRs in native donor cumulus cells. ICSI:
Expression levels of RRRs in eight cell-stage
monkey embryos obtained by intracytoplasmic
sperm injection (ICSI), indicating normal develop-
mental upregulation of RRRs. SC: expression
levels of RRRs in cumulus cells derived eight
cell-stage control SCNT embryos in the absence of
Kdm4d mRNA injection, showing low-level
expression of RRRs. SK: expression levels of
RRRs in cumulus cells derived eight cell-stage
SCNT embryos injected with Kdm4d mRNA,
showing elevated expression of many RRRs, some
of which correspond to those of ICSI eight cell-
stage embryos.
(F) Representative nuclear images of cumulus cells
derived one-cell stage SCNT embryos stained with
anti-H3K9me3 and DAPI at 5 hr after Kdm4d
mRNA injection. Scale bar, 30 mm.
SCNT Using Fetal Monkey Fibroblasts
Fetal fibroblasts in primary culture derived from an aborted
female cynomolgus monkey fetus were prepared by standard
methods (see STAR Methods) and used for SCNT. These cells
were chosen for their potential in obtaining a large number of
nuclei with uniform genetic background. Using the SCNT pro-
tocol described above, a total of 109 Kdm4d mRNA-injected
SCNT embryos under I/D/T condition were obtained using
127 MII-stage oocytes, and 79 of them (between 2-cell to
blastocyst stage) were transferred to 21 cynomolgus female
surrogates (Sun et al., 2008) (Table 1 and Data S2). The choice
of the embryo transfer time was based on the number of
SCNT embryos prepared and that of surrogates available at
the time. Pregnancy was confirmed in 6 surrogates by ultra-
sound examination one month later, 4 of them carried 5 fe-
tuses (one twin), and the other 2 carried only gestational
sacs (GS, Figures 3C and 3D). Among the 4 pregnancies, 2
aborted at the early gestation stage (within two months),
and 2 developed beyond 140 days (Figure 3E and Data S2).
Two live babies were obtained at full term (155 and
141 days) by caesarean section. The newborn baby monkeys,
named Zhong Zhong (ZZ) and Hua Hua (HH) (Figures 4A and
Surrogates Pregnancies Live birth Survived offspring
21 6 2 2
42 22 2 0
Cell 172, 881–887, February 8, 2018 883

4B), survived in good conditions under human feeding and
care for 50 and 40 days, respectively, at the time of manu-
script resubmission. In comparison with newborn monkeys
obtained by natural fertilization, they showed no hypertrophy
of umbilical cord at birth, normal postnatal temperature regu-
lation, and exhibited sucking reflex during feeding, as well as
normal growth rate in body weight and head circumference
(Movie S1).
SCNT Using Adult Monkey Cumulus Cells
We also used adult cumulus cells of female monkeys (from
which the oocytes were obtained) as donor cells for SCNT.
A total of 192 SCNT embryos obtained from 290 MII stage oo-
cytes under I/D/T activation condition, were injected with
Kdm4d mRNA at the pronuclear stage, and 181 of them (at
2-cell to blastocyst stage) were transferred to 42 monkey fe-
male surrogates (Table 1 and Data S2). Pregnancy was
confirmed in 22 surrogates, 12 of them carried 17 live fetuses,
and the rest yielded only GS (Figures 3A–3D). Among the 12
pregnant surrogates with fetuses, 8 aborted at early gestation
stage (within 2 months) and 2 aborted on day 84 and 94. The
last two pregnancies developed beyond 130 days and yielded
two live births (infants A and B) via caesarean section on day
135 and 137, respectively (Figure 3E, Data S2). Infant A
884 Cell 172, 881–887, February 8, 2018
Figure 3. Pregnancy and Fetal Develop-
ment of SCNT Embryos
(A and B) Ultrasound imaging of the pregnancy
status from SCNT with cumulus cells, showing
example images of a surrogate uterus containing a
gestational sac (GS, arrow) without a fetus (A) and
with a fetus (B, arrow).
(C and D) Pregnancy rates (C) and percentage of
pregnancies with a fetus (D) for two groups of
SCNT embryos using fetal fibroblasts and adult
cumulus cells, respectively.
(E) Overall percentages of pregnancies that yiel-
ded gestational sacs (GS) without a fetus, preg-
nancies with fetuses that led to early abortion
(within two months) without a fetus, late abortion
with a fetus, and live births (by caesarian section)
for SCNT using fetal fibroblasts (in healthy condi-
tion) and adult cumulus cells (lived for a short time),
respectively.
showed normal head circumference
but impaired body development at birth
and died 3 hr later due to apparent res-
piratory failure. Infant B had apparent
normal head and body development
and showed normal breathing and
food and water intake but died 30 hr
later with respiratory failure (see
Data S4).
Genetic Analyses of Monkeys
Generated by SCNT
Single-nucleotide polymorphism (SNP)
and short-tandem repeat (STR) analyses
(Penedo et al., 2005; Tachibana et al., 2009) were performed to
examine the mitochondria and nuclear DNAs of monkey babies
obtained by SCNT. The STR analysis of 27 loci demonstrated
that the nuclear DNAs of ZZ and HH ear tissues completely
matched that of the fetal fibroblast donor, and three example
loci are shown in Figure 4C (complete information on 27 loci
are shown in Data S3). The SNPs of the ND3 gene of mitochon-
dria DNA for the ear tissue obtained from ZZ and HH were iden-
tical to that of their respective oocyte donor monkeys (examples
shown in Figures 4D and 4E; more examples are shown in Fig-
ure S3) due to the overwhelming abundance of oocyte mitochon-
dria in comparison to that of somatic cell used for SCNT. Similar
SNP and STR analyses performed on the ear tissues of
deceased infants A and B obtained by SCNT using monkey
cumulus cells also confirmed the origin of the mitochondria
and nuclear DNAs from their respective oocyte donor monkey
and cumulus cells obtained from the latter (Figure S4 and Data
S3). These genetic analyses fully confirmed the clonal origin of
the monkeys generated by our SCNT method.
DISCUSSION
In this study, we have generated two healthy cynomolgus mon-
keys by the SCNT method using fetal monkey fibroblasts. We

attributed the success of cloning of a non-human primate by
SCNT to the optimization of the nuclear transfer protocol, the
use of fetal cell nuclei, and epigenetic modifications by Kdm4d
and TSA, and all of them together greatly improved the quality
of blastocyst development and pregnancy rate. Genetic analysis
fully confirmed the clonal origin of the monkeys generated by
SCNT. This study demonstrated that cloning of non-human pri-
mates is feasible by SCNT using fetal somatic cells, which could
be efficiently modified by genetic editing and screening in vitro
(Gao et al., 2017; Lai et al., 2016; Rogers, 2016). Such cloning al-
lows the production of genetically uniform monkeys as animal
models for basic research in primate biology and for studying hu-
man disease mechanisms and therapeutic treatments.
Previous studies on monkey SCNT using adult fibroblasts
(Sparman et al., 2010) and cumulus cells (Ng et al., 2004) have
yielded pregnancies up to 80 days. The main obstacle to the
live birth appeared to be poor reprogramming of transferred
nuclei for supporting embryonic development. In this study, we
Figure 4. Analysis of Cloned Cynomolgus
Monkeys
(A and B) Images of Zhong Zhong (ZZ) and Hua
Hua (HH), two cynomolgus monkeys generated by
SCNT using fetal monkey fibroblasts, at 20 and
34 days after birth, respectively.
(C) Three examples of short tandem repeats
(STRs) from ear tissues of ‘‘ZZ’’ and ‘‘HH,’’
showing that their nuclear DNA was identical to
that of the donor fibroblast but different from those
of their oocyte donor and surrogate monkeys.
More extensive list of STRs are shown in Data S3.
(D and E) Examples of single-nucleotide poly-
morphisms (SNPs) for ‘‘ZZ’’ and ‘‘HH,’’ respec-
tively, showing mitochondria DNA SNPs that were
identical to those of the oocyte donor monkey but
different from those of surrogate monkey and
donor fibroblast. More examples are shown in
Figure S3.
demonstrated the effectiveness of
H3K9me3 demethylase Kdm4d and his-
tone deacetylase inhibitor TSA in promot-
ing normal blastocyst formation, preg-
nancy rate, and fetal development.
Immunostaining of Kdm4d mRNA-in-
jected one-cell embryos showed that
H3K9me3 sites were greatly reduced
(Figure 2F), and transcriptome analysis
further confirmed that Kdm4d treatment
indeed promoted the upregulation of
RRRs of the embryo’s genome at the
early blastomere stage (Figure 2E). In
addition to the use of H3K9me3 demethy-
lase and histone deacetylase inhibitor,
several other approaches such as
impeding Xist gene expression of the
active X chromosome (Inoue et al.,
2010), embryo aggregation (Boiani et al.,
2003), trophectoderm replacement
(Lin et al., 2011), and H3K4me3 demethylase injection (Liu
et al., 2016a) were also found to improve the development of
mouse SCNT embryos. Previous studies showed that caffeine,
electric stimulation (Tachibana et al., 2013), and translation in-
hibitor puromycin (Yamada et al., 2014) could facilitate the
production of human embryonic stem cells via SCNT methods.
All these additional approaches could be used for further
improving the efficiency of monkey SCNT. Finally, we noted
that the lower efficiency in SCNT using adult cumulus cells as
compared to fetal fibroblasts could be attributed to the fact
that reprogramming of adult nuclei is less efficient than fetal
nuclei or, alternatively, to the difference in the somatic cell
type. More extensive studies of reprogramming adult somatic
nuclei are required for the future use of SCNT on adult so-
matic cells.
Our choice of using fetal fibroblasts as donor cells for SCNT is
based on the consideration of not only reprogramming potential
of fetal cells, but also their potential application for genetic
Cell 172, 881–887, February 8, 2018 885
editing. Although recent advances in gene editing methods, e.g.,
CRISPR/Cas9 technology, could achieve efficient gene
knockout or knockin monkey embryos (Niu et al., 2014; Cui
et al., 2018; Yao et al., 2018), mosaicism in gene editing and
off-target effects remain problematic for direct gene editing of
monkey embryos. In vitro screening of gene-edited fibroblasts
prior to SCNT could circumvent some of these problems and
allow the generation of a large number of cloned monkeys with
uniform genetic background. This is particularly relevant for
developing monkey models for human diseases with defined
genetic defects that could be used for studying disease mecha-
nisms and testing potential therapeutic treatments. Basic
studies on the genetic basis of primate-specific traits will find
genetically uniform clones of non-human primates a useful labo-
ratory animal model.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Animal Ethics Statements
d METHOD DETAILS
B Preparation of Nuclear Donor Cells
B Superovulation and Oocyte Collection
B Monkey SCNT and ICSI Procedures
B Culture of Monkey Embryos and Embryos Transfer
B Genetic Analysis of Cloned Monkeys
B Kdm4d In Vitro Transcription
B Immunostaining
B RNA-Sequencing and Data Analysis
d DATA AND SOFTWARE AVAILABILITY
SUPPLEMENTAL INFORMATION
Supplemental Information includes four figures, four data files, and one movie
and can be found with this article online at https://doi.org/10.1016/j.cell.2018.
01.020.
ACKNOWLEDGMENTS
We thank Lina Wang, Tikui Zhang, Jia Liu, Qiming Liu, Jiantao Huang, Chang-
shan Gao, and Yuzhuo Li for help in animal breeding and care, Jiahuai Han and
Yufeng Yang for providing human Kdm4d plasmid, Qian Hu for the help in fluo-
rescence imaging, and Tiansheng Zhou for the pathology report. This work
was supported by grants from Chinese Academy of Sciences (Key Research
Program of Frontier Sciences QYZDY-SSW-SMC001) to M.P., CAS Key Tech-
nology Talent Program to Q.S., Shanghai Municipal Government Bureau of
Science and Technology Grant (16JC1420200) to M.P. and Q.S., and National
Postdoctoral Program for Innovative Talents (BX201700266) to Z.L.
AUTHOR CONTRIBUTION
Q.S. and Z.L. designed the experiments. Q.S. and M.P. supervised the project.
Z.L. performed the somatic cell nuclear transfer procedure. Y.C performed
Kdm4d mRNA in vitro transcription and fibroblasts culturing. Z.L., Y.W.,
Y.N., C.Z., and Y.X. performed oocyte collection, embryo transfer, pregnancy
886 Cell 172, 881–887, February 8, 2018
examination, and infant care. Z.L. and Z.W. performed immunofluorescence
study and STR/SNP analyses. Z.L., Q.S., and M.P. wrote the manuscript.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: December 21, 2017
Revised: January 11, 2018
Accepted: January 16, 2018
Published: January 24, 2018; corrected online: June 25, 2018
REFERENCES
Akagi, S., Matsukawa, K., Mizutani, E., Fukunari, K., Kaneda, M., Watanabe,
S., and Takahashi, S. (2011). Treatment with a histone deacetylase inhibitor
after nuclear transfer improves the preimplantation development of cloned
bovine embryos. J. Reprod. Dev. 57, 120–126.
Antony, J., Oback, F., Chamley, L.W., Oback, B., and Laible, G. (2013).
Transient JMJD2B-mediated reduction of H3K9me3 levels improves reprog-
ramming of embryonic stem cells into cloned embryos. Mol. Cell. Biol. 33,
974–983.
Boiani, M., Eckardt, S., Leu, N.A., Schöler, H.R., and McLaughlin, K.J. (2003).
Pluripotency deficit in clones overcome by clone-clone aggregation: epige-
netic complementation? EMBO J. 22, 5304–5312.
Chung, Y.G., Matoba, S., Liu, Y., Eum, J.H., Lu, F., Jiang, W., Lee, J.E.,
Sepilian, V., Cha, K.Y., Lee, D.R., and Zhang, Y. (2015). Histone Demethylase
Expression Enhances Human Somatic Cell Nuclear Transfer Efficiency and
Promotes Derivation of Pluripotent Stem Cells. Cell Stem Cell 17, 758–766.
Cui, Y., Niu, Y., Zhou, J., Chen, Y., Cheng, Y., Li, S., Ai, Z., Chu, C., Wang, H.,
Zheng, B., et al. (2018). Generation of a precise Oct4-hrGFP knockin cynomol-
gus monkey model via CRISPR/Cas9-assisted homologous recombination.
Cell Res. https://doi.org/10.1038/cr.2018.10.
Gao, Y., Wu, H., Wang, Y., Liu, X., Chen, L., Li, Q., Cui, C., Liu, X., Zhang, J.,
and Zhang, Y. (2017). Single Cas9 nickase induced generation of NRAMP1
knockin cattle with reduced off-target effects. Genome Biol. 18, 13.
Inoue, K., Kohda, T., Sugimoto, M., Sado, T., Ogonuki, N., Matoba, S., Shiura,
H., Ikeda, R., Mochida, K., Fujii, T., et al. (2010). Impeding Xist expression from
the active X chromosome improves mouse somatic cell nuclear transfer. Sci-
ence 330, 496–499.
Izpisua Belmonte, J.C., Callaway, E.M., Caddick, S.J., Churchland, P., Feng,
G., Homanics, G.E., Lee, K.F., Leopold, D.A., Miller, C.T., Mitchell, J.F., et al.
(2015). Brains, genes, and primates. Neuron 86, 617–631.
Jennings, C.G., Landman, R., Zhou, Y., Sharma, J., Hyman, J., Movshon, J.A.,
Qiu, Z., Roberts, A.C., Roe, A.W., Wang, X., et al. (2016). Opportunities and
challenges in modeling human brain disorders in transgenic primates. Nat.
Neurosci. 19, 1123–1130.
Kato, Y., Tani, T., Sotomaru, Y., Kurokawa, K., Kato, J., Doguchi, H., Yasue, H.,
and Tsunoda, Y. (1998). Eight calves cloned from somatic cells of a single
adult. Science 282, 2095–2098.
Kishigami, S., Mizutani, E., Ohta, H., Hikichi, T., Thuan, N.V., Wakayama, S.,
Bui, H.T., and Wakayama, T. (2006). Significant improvement of mouse cloning
technique by treatment with trichostatin A after somatic nuclear transfer.
Biochem. Biophys. Res. Commun. 340, 183–189.
Lai, S., Wei, S., Zhao, B., Ouyang, Z., Zhang, Q., Fan, N., Liu, Z., Zhao, Y., Yan,
Q., Zhou, X., et al. (2016). Generation of Knock-In Pigs Carrying Oct4-
tdTomato Reporter through CRISPR/Cas9-Mediated Genome Engineering.
PLoS ONE 11, e0146562.
Lee, B.C., Kim, M.K., Jang, G., Oh, H.J., Yuda, F., Kim, H.J., Hossein, M.S.,
Kim, J.J., Kang, S.K., Schatten, G., and Hwang, W.S. (2005). Dogs cloned
from adult somatic cells. Nature 436, 641.
Lin, J., Shi, L., Zhang, M., Yang, H., Qin, Y., Zhang, J., Gong, D., Zhang, X., Li,
D., and Li, J. (2011). Defects in trophoblast cell lineage account for the
impaired in vivo development of cloned embryos generated by somatic
nuclear transfer. Cell Stem Cell 8, 371–375.
Liu, W., Liu, X., Wang, C., Gao, Y., Gao, R., Kou, X., Zhao, Y., Li, J., Wu, Y., Xiu,
W., et al. (2016a). Identification of key factors conquering developmental arrest
of somatic cell cloned embryos by combining embryo biopsy and single-cell
sequencing. Cell Discov. 2, 16010.
Liu, Z., Nie, Y.H., Zhang, C.C., Cai, Y.J., Wang, Y., Lu, H.P., Li, Y.Z., Cheng, C.,
Qiu, Z.L., and Sun, Q. (2016b). Generation of macaques with sperm derived
from juvenile monkey testicular xenografts. Cell Res. 26, 139–142.
Matoba, S., Liu, Y., Lu, F., Iwabuchi, K.A., Shen, L., Inoue, A., and Zhang, Y.
(2014). Embryonic development following somatic cell nuclear transfer
impeded by persisting histone methylation. Cell 159, 884–895.
Meng, L., Ely, J.J., Stouffer, R.L., and Wolf, D.P. (1997). Rhesus monkeys
produced by nuclear transfer. Biol. Reprod. 57, 454–459.
Mitalipov, S.M., Yeoman, R.R., Nusser, K.D., and Wolf, D.P. (2002). Rhesus
monkey embryos produced by nuclear transfer from embryonic blastomeres
or somatic cells. Biol. Reprod. 66, 1367–1373.
Mitalipov, S.M., Zhou, Q., Byrne, J.A., Ji, W.Z., Norgren, R.B., and Wolf, D.P.
(2007). Reprogramming following somatic cell nuclear transfer in primates is
dependent upon nuclear remodeling. Hum. Reprod. 22, 2232–2242.
Ng, S.C., Chen, N., Yip, W.Y., Liow, S.L., Tong, G.Q., Martelli, B., Tan, L.G.,
and Martelli, P. (2004). The first cell cycle after transfer of somatic cell nuclei
in a non-human primate. Development 131, 2475–2484.
Niu, Y., Shen, B., Cui, Y., Chen, Y., Wang, J., Wang, L., Kang, Y., Zhao, X., Si,
W., Li, W., et al. (2014). Generation of gene-modified cynomolgus monkey via
Cas9/RNA-mediated gene targeting in one-cell embryos. Cell 156, 836–843.
Penedo, M.C., Bontrop, R.E., Heijmans, C.M., Otting, N., Noort, R., Rouweler,
A.J., de Groot, N., de Groot, N.G., Ward, T., and Doxiadis, G.G. (2005). Micro-
satellite typing of the rhesus macaque MHC region. Immunogenetics 57,
198–209.
Polejaeva, I.A., Chen, S.H., Vaught, T.D., Page, R.L., Mullins, J., Ball, S., Dai,
Y., Boone, J., Walker, S., Ayares, D.L., et al. (2000). Cloned pigs produced
by nuclear transfer from adult somatic cells. Nature 407, 86–90.
Rodriguez-Osorio, N., Urrego, R., Cibelli, J.B., Eilertsen, K., and Memili, E.
(2012). Reprogramming mammalian somatic cells. Theriogenology 78,
1869–1886.
Rogers, C.S. (2016). Genetically engineered livestock for biomedical models.
Transgenic Res. 25, 345–359.
Schramm, R.D., and Paprocki, A.M. (2004). Strategies for the production of
genetically identical monkeys by embryo splitting. Reprod. Biol. Endocrinol.
2, 38.
Shin, T., Kraemer, D., Pryor, J., Liu, L., Rugila, J., Howe, L., Buck, S., Murphy,
K., Lyons, L., and Westhusin, M. (2002). A cat cloned by nuclear transplanta-
tion. Nature 415, 859.
Simerly, C., Dominko, T., Navara, C., Payne, C., Capuano, S., Gosman, G.,
Chong, K.Y., Takahashi, D., Chace, C., Compton, D., et al. (2003). Molecular
correlates of primate nuclear transfer failures. Science 300, 297.
Smedley, J.V., Bailey, S.A., Perry, R.W., and O Rourke, C.M. (2002). Methods
for predicting sexual maturity in male cynomolgus macaques on the basis of
age, body weight, and histologic evaluation of the testes. Contemp. Top.
Lab. Anim. Sci. 41, 18–20.
Sparman, M.L., Tachibana, M., and Mitalipov, S.M. (2010). Cloning of non-
human primates: the road ‘‘less traveled by’’. Int. J. Dev. Biol. 54, 1671–1678.
Sun, Q., Dong, J., Yang, W., Jin, Y., Yang, M., Wang, Y., Wang, P.L., Hu, Y.,
and Tsien, J.Z. (2008). Efficient reproduction of cynomolgus monkey using
pronuclear embryo transfer technique. Proc. Natl. Acad. Sci. USA 105,
12956–12960.
Tachibana, M., Sparman, M., Sritanaudomchai, H., Ma, H., Clepper, L., Wood-
ward, J., Li, Y., Ramsey, C., Kolotushkina, O., and Mitalipov, S. (2009).
Mitochondrial gene replacement in primate offspring and embryonic stem
cells. Nature 461, 367–372.
Tachibana, M., Sparman, M., and Mitalipov, S. (2010). Chromosome transfer in
mature oocytes. Nat. Protoc. 5, 1138–1147.
Tachibana, M., Amato, P., Sparman, M., Gutierrez, N.M., Tippner-Hedges, R.,
Ma, H., Kang, E., Fulati, A., Lee, H.S., Sritanaudomchai, H., et al. (2013). Hu-
man embryonic stem cells derived by somatic cell nuclear transfer. Cell 153,
1228–1238.
Wakayama, T., Perry, A.C., Zuccotti, M., Johnson, K.R., and Yanagimachi, R.
(1998). Full-term development of mice from enucleated oocytes injected with
cumulus cell nuclei. Nature 394, 369–374.
Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J., and Campbell, K.H. (2007).
Viable offspring derived from fetal and adult mammalian cells. Cloning Stem
Cells 9, 3–7.
Yamada, M., Johannesson, B., Sagi, I., Burnett, L.C., Kort, D.H., Prosser,
R.W., Paull, D., Nestor, M.W., Freeby, M., Greenberg, E., et al. (2014). Human
oocytes reprogram adult somatic nuclei of a type 1 diabetic to diploid plurip-
otent stem cells. Nature 510, 533–536.
Yao, X., Liu, Z., Wang, X., Wang, Y., Nie, Y.H., Lai, L., Sun, R., Shi, L., Sun, Q.,
and Yang, H. (2018). Generation of knock-in cynomolgus monkey via CRISPR/
Cas9 editing. Cell Res. https://doi.org/10.1038/cr.2018.9.
Zhao, J., Ross, J.W., Hao, Y., Spate, L.D., Walters, E.M., Samuel, M.S., Rieke,
A., Murphy, C.N., and Prather, R.S. (2009). Significant improvement in cloning
efficiency of an inbred miniature pig by histone deacetylase inhibitor treatment
after somatic cell nuclear transfer. Biol. Reprod. 81, 525–530.
Zhou, Q., Renard, J.P., Le Friec, G., Brochard, V., Beaujean, N., Cherifi, Y.,
Fraichard, A., and Cozzi, J. (2003). Generation of fertile cloned rats by regu-
lating oocyte activation. Science 302, 1179.
Cell 172, 881–887, February 8, 2018 887
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Anti-H3K9me3 Abcam ab8898; RRID: AB_306848
Cy3 AffiniPure-conjugated donkey anti-Rabbit IgG Jackson 711-165-152; RRID: AB_2307443
Chemicals, Peptides, and Recombinant Proteins
Ionomycin Beyotime S1672
6-dimethylaminopurine Sigma D2629
Trichostatin A Sigma T1952
Cytochalasin B Sigma C6762
HVJ-E COSMO BIO CO. LTD 808920
Chorionic Gonadotrophin Human Sigma CG10-10VL
Recombinant Human Follitropin Merck Serono S20130055 (75IU)
Hamster embryo culture medium 9 (HECM-9) Liu et al., 2016b N/A
HEPES-buffered Tyrode’s lactate medium (TH3) Liu et al., 2016b N/A
Deposited Data
RNaseq data of Cumulus cells and cumulus This paper https://www.ncbi.nlm.nih.gov/Traces/
cell-derived SCNT embryos (8-cell stage with and study/?acc=SRP131536
without Kdm4d mRNA injection, 4/group), ICSI http://www.biosino.org/node/project/
embryos (4-cell and 8-cell stage, 4/group), and detail/NODEP00371766
cumulus cells
SNPs and STR analysis for ZZ, HH and corresponding This paper http://www.biosino.org/node/project/
nuclear donor cells, oocyte donor cells, surrogate detail/NODEP00371774
monkeys are accessible
SNPs and STR analysis for deceased cloned monkey This paper http://www.biosino.org/node/project/
(infant A, infant B) and corresponding oocyte donor detail/NODEP00371775
cells, surrogate monkeys
Experimental Models: Organisms/Strains
Cynomolgus monkeys (Macaca fascicularis) Suzhou Xishan N/A
Oligonucleotides
Primer:ND3 Forward:CCACTTCACATCAAACCATCACTT This paper N/A
Primer:ND3 Reverse:CAAGCAGCGAATACCAGCAAAA This paper N/A
Primer:Kdm4d in vitro transcription This paper N/A
Forward:TTAATACGACTCACTATAGGGATGGAAACT
ATGAAGTCTAAGGCCAACT
Primer:Kdm4d in vitro transcription Reverse:ATATAAA This paper N/A
GACAGCCCGTGGACTTAGG
Software and Algorithms
ABI PRISM 3730 genetic analyzer ABI https://softgenetics.com/GeneMarker.php
Other
rTaq Takara R500Z
Piezo impact drive system Prime Tech N/A
Oosight imaging system CRi N/A
Laser system Hamilton Thorne N/A
P97 micropipet puller Sutter Instrument N/A
Inverted microscope Olympus IM-73
Syringe IM 9B Narishige N/A
Syringe CellTram vario Eppendorf N/A

e1 Cell 172, 881–887.e1–e3, February 8, 2018

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Qiang Sun
(qsun@ion.ac.cn).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animal Ethics Statements

Healthy female cynomolgus monkeys (Macaca fascicularis), ranging in age from 5 to 12 years, were selected for this study. All animals
were housed in the sunny room. The use and care of animals complied with the guideline of the Animal Advisory Committee at the
Shanghai Institute of Biological Science, Chinese Academy of Sciences. The ethics application entitled ‘‘Reproductive physiology of
cynomolgus monkeys and establishment transgenic monkeys’’ (#ER-SIBS-221106P) was approved by Shanghai Institutes of Biolog-
ical Sciences, Chinese Academy of Sciences.

METHOD DETAILS

Preparation of Nuclear Donor Cells

Primary fibroblasts were isolated from a 61 day-old freshly aborted cynomolgus fetus. The fetal tissue were cut into small pieces after
removing the head, tail, limbs, and viscera and digested with DNase (1 mg/ml) and collagenase IV (0.5 mg/ml) in cell culture medium
containing DMEM supplemented with 100 IU/ml penicillin and streptomycin, 10% FBS, non-essential amino acids, and glutamine at
37 C in 5% CO2 for 4 h. Isolated monkey fibroblasts were cultured in 10 cm dishes for 10-20 h until they reached confluency, dis-
aggregated by trypsin, and stored in liquid nitrogen in cell culture medium containing 10% dimethylsulfoxide. Frozen fibroblasts
(P0-P5) were thawed and cultured until confluency, and used for SCNT 3-7 days later. For preparation of adult monkey cumulus cells,
fresh cumulus cells were collected from the follicular aspirates of oocyte donors and washed twice with TH3 medium. Re-suspended
cumulus cells were used directly for SCNT.

Superovulation and Oocyte Collection

Healthy female cynomolgus monkeys with regular menstrual cycles were chosen for superovulation and laparoscopy was used for
oocyte collection. From day 3 of menstrual cycle, 25 IU recombinant human follitropin was injected intramuscularly twice daily for
7–8 days. On day 11, 1000 IU of human chorionic gonadotrophin (hCG) was also injected, oocytes were aspirated from
follicles 2–8 mm in diameter 36 h later. The collected oocytes were cultured in the pre-equilibrated hamster embryo culture
medium 9 (HECM-9) medium. Metaphase II-arrested oocytes were selected for manipulation.

Monkey SCNT and ICSI Procedures

For monkey SCNT, a group of 15-20 monkey MII oocytes were transferred to manipulation drops containing HEPES-buffered
Tyrode’s lactate medium (TH3) with 5 mg/ml cytochalasin B in a glass bottom dish. The spindle-chromosome complex was removed
rapidly by a piezo-driven pipette under a spindle imaging microscopic system (Oosight) within 10 min for the entire group of oocytes.
The enucleated oocytes were transferred to pre-equilibrated HECM-9 at 37 C under 5% CO2. After all oocytes were enucleated, a
group of 15-20 enucleated oocytes were re-transferred to manipulation drops with TH3 and 5 mg/ml cytochalasin B. Fibroblasts or
cumulus cells were briefly incubated in a medium containing fusogenic viral envelop HVJ-E and introduced to the perivitelline space
of the enucleated oocytes by a micropipette through a slit in the zona pellucida that was created by laser irradiation. At 1-2 h after cell
fusion, reconstructed embryos were activated in TH3 medium with 5 mM ionomycin for 5 min and transferred to HECM-9 medium
containing 2 mM 6-dimethylaminopurine for 5 h. TSA (10 nM) were applied for 10 h during and after activation. For Kdm4d mRNA
injection, 10 pl of 1000 ng/ml Kdm4d mRNA were used for injection at 6 h after activation with a piezo-driven micromanipulator
(Primetech). It is possible that the Kdm4d mRNA concentration we used was not optimal and further optimization of the concentration
is needed.
For monkey intracytoplasmic sperm injection (ICSI), previously published procedure was used (Liu et al., 2016b). Briefly, a single
picked sperm was injected into the ooplasm using a piezo-driven micromanipulator and fertilization was confirmed 6 h later by the
presence of two pronuclei. Embryos were cultured in pre-equilibrated HECM-9 at 37 C under 5% CO2.

Culture of Monkey Embryos and Embryos Transfer

Monkey ICSI and SCNT embryos were cultured in HECM-9 medium at 37 C under 5% CO2. The embryos were transferred to
HECM-9+5% FBS medium after reaching 8-cell stage and the medium was changed every other day until the embryo reached
the blastocyst stage. For embryo transfer, females with synchronous menstrual cycle whose ovaries had a stigma or fresh corpus
luteum were used as surrogates. Embryos (at 2-cell to blastocyst stage) were transferred to the oviduct.

Cell 172, 881–887.e1–e3, February 8, 2018 e2

Genetic Analysis of Cloned Monkeys
For short tandem repeats (STR) analysis, ear tissue sample collected from monkeys were used to extract DNA. Locus-specific
primers each containing a fluorescent dye (FAM/HEX/TMR) were used for PCR amplification in batches. FAM, HEX or TMR-labeled
STR amplicons were diluted and mixed with internal size standard ROX500 and deionized formamide, followed by capillary electro-
phoresis on ABI PRISM 3730 genetic analyzer to obtain the raw data. Sequencer-generated raw data were analyzed with the program
Gene Marker 2.2.0, which produces wave plots, Excel documents (including information such as size and genotype), and DNA
profiles.
For single nucleotide polymorphism (SNP) analysis, ear tissue sample collected from monkeys were used to extract DNA. PCR with
specific primers (F: CCACTTCACATCAAACCATCACTT, R: CAAGCAGCGAATACCAGCAAAA) in mtDNA were performed. DNA was
amplified with 35 cycles of 95 C for 30 s, 55 C for 30 s, and 72 C for 1 min, followed by a 5-min extension at 72 C. The PCR products
were used for sequencing and the result were used for the SNP analysis.

Kdm4d In Vitro Transcription

For Kdm4d in vitro transcription, CDS of human Kdm4d gene was cloned from the cDNA plasmid provided by Dr. J.H. Han of Xiamen
University. The DNA template was amplified by the T7 promoter containing primer (F: TTAATACGACTCACTATAGGGATGGAAAC
TATGAAGTCTAAGGCCAACT, R: ATATAAAGACAGCCCGTGGACTTAGG). T7-Kdm4d PCR product was purified and used as the
template for in vitro transcription (IVT) using mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, AM1345). The RNA products
were purified using MEGA clear kit (Life Technologies, AM1908) and eluted in RNase-free water.

Immunostaining
Monkey SCNT embryos (one-cell stage) were fixed in PBS with 4% paraformaldehyde (PFA) for 20 min. After being washed three
times with PBS, embryos were permeabilized with 0.5% Triton X-100 in PBS (permeabilization buffer) for 30 min. After being blocked
in a permeabilization buffer with 10% donkey serum for 1h, embryos were incubated for overnight at 4 C with anti-H3K9me3
(1/200, Abcam, ab8898), which were diluted in a permeabilization buffer containing 10% donkey serum. After being washed with
PBS for 3 times every 10 min, Cy3 AffiniPure-conjugated donkey anti-Rabbit IgG (1:500, Jackson: 711-165-152) for 2 hr at 37 C.
After being washed with PBS and counterstain of nucleus chromosome (nuclear DNA) with DAPI (Sigma), embryos were transfer
into a spinning disk for confocal microscopic analysis (Olympus Microsystems).

RNA-Sequencing and Data Analysis

Cumulus cells and cumulus cell-derived SCNT embryos (8-cell stage with and without Kdm4d mRNA injection, 4/group), ICSI
embryos (4-cell and 8-cell stage, 4/group), and cumulus cells were collected for lysed and cDNA synthesis using SMARTer Ultra
Low Input RNA cDNA preparation kit (Clontech 634936). Sequencing libraries were generated using NEBNext Ultra RNA Library
Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences
to each sample. Library preparations were sequenced on an Illumina Hiseq platform and 125 bp/150 bp paired-end reads were
generated. Expression level of each gene was quantified with normalized FPKM (fragments per kilobase of exon per million mapped
fragments). A sliding window (size 20 kb, step size 10 kb) was used to assess the genome-wide expression level of monkey embryos.
For each window, the expression level was quantified with normalized RPM (reads per millions of uniquely mapped reads).
A sliding window (size 100 kb, step size 20 kb) was used to assess the genome-wide expression level of embryos following the
previous reported method (Matoba et al., 2014). For each window, the expression level was quantified with normalized RPM (reads
per millions of uniquely mapped reads) and used for identification of reprogramming resistant regions.

DATA AND SOFTWARE AVAILABILITY

RNaseq data of Cumulus cells and cumulus cell-derived SCNT embryos (8-cell stage with and without Kdm4d mRNA injection,
4/group), ICSI embryos (4-cell and 8-cell stage, 4/group), and cumulus cells discussed in this publication have been deposited in
NCBI’s Sequence Read Archive and are accessible through accession number PRJNA431820: (https://www.ncbi.nlm.nih.gov/
Traces/study/?acc=SRP131536) and in http://www.biosino.org/node/project/detail/NODEP00371766.
Single-nucleotide polymorphisms (SNPs) and short tandem repeats (STR) analysis for ZZ, HH and corresponding nuclear donor
cells, oocyte donor cells, surrogate monkeys are accessible at: http://www.biosino.org/node/project/detail/NODEP00371774 and
SNPs and STR analysis for deceased cloned monkey (infant A, infant B) and corresponding oocyte donor cells, surrogate monkeys
can be accessed at http://www.biosino.org/node/project/detail/NODEP00371775.

e3 Cell 172, 881–887.e1–e3, February 8, 2018

Supplemental Figures

Figure S1. SCNT Monkey Embryos Using Fetal Fibroblasts as Donors, Related to Figure 1 and 2
(A) Similar to Figure 1G, but showing a group of embryos exhibiting spindle-like structures after fusion of fetal fibroblasts with enucleated oocytes. (Red rectangle
on the lower right side is inherent form of the software and it does not have any relationship with the figure).
(B) Similar to Figure 1H, but showing a group of embryos exhibiting single well-formed nucleus after embryo activation.
(C and D) Blastocysts developed after fibroblast nuclear transfer under I/D condition (C) and I/D/T condition (D), showing poor quality of embryo development,
with no or very few embryo with inner cell mass (ICM).
All scale bars, 120 mm.
Figure S2. SCNT Monkey Embryos Using Cumulus Cells as Donors, Related to Figure 2
(A) Adult monkey cumulus cells isolated from a female monkey used for obtaining the oocytes for SCNT. Scale bar, 100 mm.
(B–F) Similar to those presented for SCNT using fetal fibroblasts, showing spindle-like structures formed by cumulus cell nuclei (B, Scale bar, 120 mm), single
nucleus formed after embryo activation (C, scale bar, 50 mm; D, scale bar, 120 mm), blastocysts developed from SCNT embryos with cumulus cells under I/D/T
condition (E, scale bar, 120 mm) and I/D/T/K condition (F, scale bar, 120 mm).
Figure S3. SNP Analysis of ‘‘ZZ’’ and ‘‘HH’’ Generated by SCNT Using Fetal Fibroblasts, Related to Figure 4
(A and B) Three examples of single nucleotide polymorphism (SNP) for ‘‘ZZ’’ and ‘‘HH,’’ showing that their mitochondria DNA SNPs were identical to those of the
oocyte donor monkey, but different from those of the surrogate monkey and donor cell.
Figure S4. Genetic Analysis of Deceased Monkeys Neonates Generated by SCNT Using Adult Cumulus Cells, Related to Table 1 and Figure 3
(A) Three examples of short tandem repeats (STRs) in tissues from deceased monkey infants ‘‘A’’ and ‘‘B,’’ showing that their nuclear DNA was identical to those of
the donor cumulus cell and their oocyte donor monkey, but different from that of the surrogate monkey. More extensive list of STRs are shown in Data S3.
(B and C) An example of single nucleotide polymorphism (SNP) for two deceased cloned monkey infants ‘‘A’’ and ’’B,’’ showing that their mitochondria DNA SNPs
were identical to those of the oocyte donor monkey, but different from those of the surrogate monkey.