Animal 15 (2021) 100022

Contents lists available at ScienceDirect

Animal
The international journal of animal biosciences

Nanoencapsulation (in vitro and in vivo) as an efficient technology to boost

the potential of garlic essential oil as alternatives for antibiotics in broiler nutrition
N. Amiri a, M. Afsharmanesh a,⁎, M. Salarmoini a, A. Meimandipour b, S.A. Hosseini c, H. Ebrahimnejad d
a
Department of Animal sciences, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman, Iran
b
Department of Animal Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
c
Department of Animal and Poultry Nutrition, Animal Science Research Institute, Karaj, Iran
d
Department of Food Hygiene and Public Health, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran

a r t i c l e i n f o a b s t r a c t

Article history: The addition of essential oil (EO) as chitosan encapsulated can increase the efficiency of these oils in broiler feed-
Received 14 January 2020 ing. Therefore, the objective of the current research was to explore the antibacterial and antioxidant potential of
Received in revised form 4 July 2020 garlic essential oil (GEO) (free vs. nanoencapsulated) and their effects on performance, gene expression of
Accepted 7 July 2020
mucin2, microbial, and morphology of intestine in broilers. A total of 900 1-day-old male broilers (Ross 308)
Available online 25 December 2020
were assigned to six dietary treatments (0, 100, and 200 mg/kg free GEO and 0 (contain of chitosan), 100 and
Keywords:
200 mg/kg nanoencapsulated GEO) with a 2 × 3 factorial arrangement based on completely randomized design.
Antibacterial Garlic essential oil encapsulation with chitosan significantly enhanced antibacterial and antioxidant parameters.
Antioxidant At 100 mg/kg nanoencapsulated GEO had significant (P < 0.01) advantages in improving BW gain (BWG) (22–42
Garlic and 0–42) and feed conversion ratio (FCR) (0–42). Maximum feed intake (FI) was also associated with the con-
Mucin2 gene expression trol group (P < 0.05). Broilers fed on 100 mg/kg of nanoencapsulated GEO showed higher villi length and width
Nanoencapsulation relative to other treatments and villi length to crypt depth ratio as well (P < 0.01). The nanoencapsulation process
of GEO (P < 0.01) affected the Lactobacilli population in the digesta of ileo-caecum and mucin2 gene expression.
In broiler chickens, the tested EO, especially nanoencapsulated type, enhanced more evaluated parameters. Be-
cause of its ideal properties, nanoencasulating with chitosan may also be an effective and inexpensive way to pro-
tect bioactive compounds and improve GEO effects in broiler chickens.
© 2020 Published by Elsevier Inc. on behalf of The Animal Consortium. This is an open access article under the CC
BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Implications
Antibiotic growth promoters not used in feeds due to increased con-
cerns about the potential for antibiotic resistant and residues of antibi-
otics in broiler tissues. The present research explores the wide-ranging
effects of encapsulation of essential oil as a promising alternative to an-
tibiotic. Essential oil encapsulation can be used to increase the stability
and bioavailability of bioactive compounds, protecting the form and
controlled secretion to target tissues. The data presented herein could
help mitigate residues of antibiotics in broiler. For researchers, this
study highlights potential areas for further investigation.
Introduction
Due to concerns regarding the human health threats associated with
antibiotic residues in animal products and the environment (Barton,
2000), the use of antibiotic growth promoters is banned in poultry
⁎ Corresponding author.
E-mail address: mafshar@uk.ac.ir (M. Afsharmanesh).
industry and researchers are seeking new natural feed additives as al-
ternatives. Most of these feed additives are phytogenic, and the proper-
ties of phytogenic additives are considered to be related to essential oils,
which may stimulate blood circulation, reduce the burden of pathogenic
bacteria, and increase the production of digestive secretions as well as
the immune status of birds (Brenes and Roura, 2010). Among the plants,
garlic has been used as growth promoter in poultry and swine for about
50 years. The increased benefits associated with garlic oil consumption
can be attributed to thiosulfinates, the single most abundant class of
organosulfur compounds, as allicin, typically accounts for 70% of total
thiosulfinates that act as antibacterial, immunomodulatory, and antiox-
idant properties (Fujisawa et al., 2008; Shang et al., 2019). Other bene-
fits of garlic is its effectiveness against many gram-positive (Clostridium,
Staphylococcus aureus, and Bacillus subtulis) and gram-negative
(Escherichia coli, Salmonella, Pseudomonas, Klebsiella, and Helicobacter)
bacteria (Rehman and Munir, 2015) that may enhance the activity of di-
gestive enzymes. Adding phytogenic to broiler diet increased villi
length, crypt depth, and number of goblet cells (Reisinger et al., 2011).
Depth of crypts in ileum were reduced in fed with a diet including garlic
and thyme in comparison with a diet supplemented with antibiotic
growth promoters (Demir et al., 2005).

https://doi.org/10.1016/j.animal.2020.100022
1751-7311/© 2020 Published by Elsevier Inc. on behalf of The Animal Consortium. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
N. Amiri, M. Afsharmanesh, M. Salarmoini et al.
Direct integration of essential oil (EO) into animal diets has shown
limitations, related to the reactive, hydrophobic, and volatile nature of
the bioactive component constituting EO. Essential oil efficacy has
been shown to increase when it is used in a protected form such as
the encapsulated one (Ribeiro-Santos et al., 2017). Nanoencapsulation
is a new technology in poultry industry that protected EO against an ad-
verse environment such as high temperature, high humidity, and dry-
ing, which released their contents at controlled rates under specific
conditions (Natrajan et al., 2015; Hosseini and Meimandipour, 2018).
As a result, nanoencapsulation could develop growth performance
through effective EO delivery and antimicrobial properties of chitosan
(Meimandipour et al., 2017). Therefore, chitosan has a great potential
for being used as a suitable EO carrier for the controlled release
(Natrajan et al., 2015). The aim of this study was therefore to investigate
the in vitro evaluation of the antibacterial and antioxidant characteris-
tics of the various forms of garlic essential oil (GEO) (free versus
nanoencapsulation) and their effects on growth performance, mucin2
gene expression, microbial population, and intestinal morphology.
Material and methods
Material
We prepared GEO from the Exir Pharmaceutical Company (Mash-
had, Iran) and ethanol and acetic acid from Merck (NYSE: MRK).
Nanoencapsulation was produced using chitosan, derived from crab
shell and sodium triphosphate pentabasic (TPP), provided from Sigma
Chemical Company (St. Louis, MO.).
Nanoencapsulation of essential oil
Nanoencapsulation of the GEO was done via ionic gelation based on
the procedure of Sawtarie et al. (2017). First, chitosan was dissolved by
1 mg/mL concentration in 1% (w = v) acetic acid and sonicated before
the solution became transparent. The dropwise addition of 10 mL TPP
solution (1 mg/mL) to a 25 mL chitosan solution (pH = 5), under con-
stant stirring at room temperature, produced chitosan-TPP nanoparti-
cles by ionic gelation. For the preparation of chitosan-TPP
nanoparticles loaded with herbal EO, 20% (w = v) EO were added to
the chitosan solution before adding the TPP solution.
Gas chromatography/mass spectrometry analysis of essential oil
Gas chromatography/MS (GC/MS) analysis was performed by using
gas chromatograph (Agilent 7890B) connected with a mass detector
(Model 5977A, Agilent technologies, USA). The following states were
used: capillary column: HP-5MS (phenyl methyl siloxane, 30 m × 0.25
mm ID 0.25 μm); injector temperature: 270 °C; oven temperature: 60 °C
(0 min) to 200 °C at the rate of 5 °C/min; carrier gas: helium; flow rate: 1
mL/min; injection volume: 1ul; electron impact: 70 eV; interface temper-
ature: 280 °C; mass range: 35–500 m/z. The identification of ingredients
was done by comparison of their mass spectra with the database of the
GC/MS system and Kovats retention index (Adams and Sparkman, 2007).
Determination of minimum inhibitory concentrations
The bacterial strain used in this study was Escherichia coli (E. coli)
(ATCC 25922). A suspension of the organism was adjusted to the
0.5 McFarland standard turbidity. For the agar dilution method, a
series of agar plates containing different concentrations (1, 3, 7, 15, 30,
60, 120, and 140 mg/mL) of the antimicrobial agent (free and
nanoencapsulation EO) were prepared and used twofold dilution tech-
niques. About 1 μL of 0.5 McFarland was placed on each of the series of
plates. Then, inoculated plates were incubated at 35 °C for 24 h,
and minimum inhibitory concentrations (MICs) were determined
after 24 h. The MIC is the lowest concentration of GEO (free and
2
Animal 15 (2021) 100022
nanoencapsulation forms) that will inhibit the growth of microorgan-
isms after nocturnal incubation (Wiegand et al., 2008).
Determination of antioxidant activity by the 2,2-diphenyl-1-picrylhydrazyl
test
This procedure was determined based on the method of Burits and
Bucar (2000). Totally, 500 μL of different dilutions of the EO (free and
nanoencapsulation forms) compounds were added to 500 μL of a
0.004% methanolic solution of 2,2-diphenyl-1-picrylhydrazyl (DPPH).
After remaining 30 min at room temperature, the resorption of the sam-
ples was recorded at 517 nm by a PowerWave™ HT Microplate Spectro-
photometer (Bio Tek Instruments, Winooski, VT). The inhibition
percentage of the DPPH free radicals was calculated by the next
equation:
I% ¼ ðA blank−A sample=A blankÞ  100
A blank ¼ the absorbance of the control
A sample ¼ the absorbance of the EO
The IC50 value is described the concentration of the antioxidant
needed to the 50% inhibition of the radicals of the DPPH.
Thiobarbituric acid reactive substances assay
Five grams of broiler breast meat sample was weighed and placed in
a test tube (50 mL) with 15 mL deionized distilled water and a homog-
enizer used for 15 s. Homogenate sample (1 mL) was transferred to a
test tube (13 × 100 mm) and butylated hydroxyanisole (50 μL, 7.2%)
and 2 mL of thiobarbituric acid (20 mM TBA)/trichloroacetic acid (15%
TCA) solution were added. The mixture was vortexed and heated in a
boiling water bath (15 min) to develop color and then was cooled in
cold water (10 min) and centrifuged at 2 000 × g (15 min). The absor-
bance of the above solution was determined at 531 nm with a spectro-
photometer. Thiobarbituric acid reactive substances (TBARS) assay was
determined based on the procedure of Ahn et al. (1998).
Management of experimental birds
A total of 900 (with average body weight 44 ± 2 g) day-old male
broiler chicks (Ross 308) were purchased from a commercial hatchery
and transferred to the Animal Science Research Institute, Tehran, Iran.
Then, the chicks were weighed and randomly assigned to 30 pens
(100 × 300 × 300 cm). The temperature was maintained at 33 °C at
the start of trial and was reduced gradually to 22 °C on day 21 and
was then kept constant. During the whole feeding period, birds were
given feed and water ad libitum. The experiment was conducted ac-
cording to the animal welfare guidelines at the Animal Science Research
Institute, Tehran, Iran.
Diets and treatments
The trial was done based on a randomized complete design with five
replicates of 30 birds each, using a 2 × 3 factorial arrangement with two
forms of GEO (free and nanoencapsulation) and three levels of GEO (0,
100, and 200 mg/kg). Experimental treatments (diets) were 1 – basal
diet without GEO as control (Ctrl 1); 2 – basal diet with 100 mg/kg
free GEO; 3 – basal diet with 200 mg/kg free GEO; 4 – basal diet without
nanoencapsulated GEO (contain 150 mg/kg chitosan); 5 – basal
diet with 100 mg/kg nanoencapsulated GEO; 6 – basal diet with
200 mg/kg nanoencapsulated GEO. We used amino NIRS to predict AA
content of soybean and corn samples (Supplementary Table S1).The
trial diets were offered from 1 to 14, 15–28, and 29–42 days and were
based on corn and soybean meal (Table 1). Diets were formulated
N. Amiri, M. Afsharmanesh, M. Salarmoini et al. Animal 15 (2021) 100022

according to the standards prescribed in Ross 308 Broiler Nutrition The samples were transferred to the laboratory on ice, and the microbial
Specification (Aviagen, 2014). evaluation was performed in less than 4 h through a plate counting
method. The ileal content (1 g) was 10-fold serial diluted in 99 mL of
Performance parameters sterile normal saline using the stomacher. About 0.1 mL of diluted sam-
ples was inoculated into the MacConkey agar and De Man, Rogosa and
The feed intake (FI) and BW gain (BWG) were recorded weekly, and Sharpe agar for the E. coli and Lactobacilli, respectively. MacConkey
feed conversion ratio (FCR) was calculated using this data. Daily mortal- agar and De Man, Rogosa and Sharpe agar plates have been incubated
ity was weighed and used for adjusting FCR. at 37 °C for 1 and 2 days, respectively. Bacteria were counted and
expressed as total cfu/g digest (Yang et al., 2012).
Intestinal morphology
Mucin2 mRNA gene expression
After slaughtering two male chicks per pen by cervical dislocation,
tissue samples from the middle of jejunum (approximately 2 cm) Total mRNA was extracted from chick jejunum tissue (two birds per
were collected and the contents removed with physiological saline. In- replicate) using GeneJet™ RNA Purification Kit procedure (Thermo Sci-
testinal tissue samples were fixed in 10% buffered formalin for 24 h entific #K0731) according to the manufacturer's protocol (Manal,
and then the 10% buffered formalin was renewed. Tissue samples 2016). The concentration of extracted RNA was measured using ND-
were dehydrated by transferring through a series of alcohols with in- 1000 spectrophotometer (Thermo Fisher Scientific). The RNA was re-
creasing concentrations, placed into xylol, and embedded in paraffin. vers transcribed to cDNA using Revert Aid first Strand cDNA Synthesis
The cuts with 5 μm thickness were stained with hematoxylin and Kit (Thermo Scientific #K1621) on the basis manufacturer company in-
eosin. Villi length and width were measured from the tip of the villus structions. The cDNA was stored until analysis (−80 °C). Reverse tran-
to the valley between individual villi, and crypt depth was measured scription-PCR (RT-PCR) was in accordance with Kamali Sangani et al.
from the valley between individual villi to the basolateral membrane. (2014). Briefly, 6.25 ng cDNA was adjusted in 25 μL of the PCR reaction
Ten villi were measured for each sample (Thompson and Applegate, at a final concentration of 0.25 ng/μL in SYBR Green. Glyceraldehyde
2006). In the morphometric study, images were captured using a light 3-phosphate dehydrogenase (GAPDH) was considered as endogenous
microscope (Leica) and a system that analyzes computerized images control. Polymerase chain reaction was designed for 40 cycles and
(Leica Queen 550). was as follows: denaturation (at 95 °C for 30 s), annealing (at 63 °C for
30 s), and elongation (at 72 °C for 30 s). Melting curves analysis was per-
Measurement of some selected ileum micro biota formed by slowly heating the PCR mixtures from 55 to 95 °C (0.2 °C/s)
with simultaneous measurements of the SYBR Green signal intensities.
Contents of the ileum (10 cm anterior to the junction with caecum Fluorescence results were evaluated and collected at the final stage by
and rectum) were collected from 60 birds and put into sterilized vials. combined SYBR Green with expanding DNA. Primers were designed
based on published sequences in broiler using the GenBank database
of National Center for Biotechnology Information (NCBI) (http://www.
Table 1 ncbi.nlm.nih.gov). The difference between the CT amount of mucin 2
Ingredients and chemical composition of basal diets fed to broiler chicks during different gene and cycle threshold was considered as ΔCT. The highest value of
periods. ΔCT represents the lowest expression. The value of ΔCT was estimated
Ingredients (% diet) Starter Grower Finisher in accordance with Livak and Schmittgen (2001). The specific primers
(d 1–14) (d 15–28) (d 29–42) for intestinal mucin2 gene are shown in Table 2. Relative expression of
Corn 52.375 55.605 60.805
mucin2 mRNA was determined using the method 2-ΔΔC T and then anal-
Soybean meal 39.00 38.30 33.60 yses were conducted using GLM of SAS.
Corn gluten 2.50 0.00 0.00
Soybean oil 1.65 2.10 1.90 Statistical analysis
Calcium carbonate 1.25 1.20 1.10
Dicalcium phosphate 1.60 1.30 1.10
Common salt 0.25 0.25 0.25 The data were analyzed by ANOVA using the GLM procedure of SAS
Sodium bicarbonate 0.20 0.20 0.20 software (SAS institute, 2004) as a 2 × 3 factorial based on a completely
DL-methionine 0.32 0.30 0.30 randomized design (CRD) with five replications by the following
HCl-lysine 0.25 0.14 0.14
model:
L-threonine 0.10 0.10 0.10
Vitamin and mineral premix1 0.50 0.50 0.50 Y ijk ¼ μ þ ai þ βj þ aβij þ eijk
Phytase 10,000 (Hostazym-P) 0.005 0.005 0.005

Calculated chemical composition where Yijk was the evaluated trait; μ was the mean; ai was the EO form;
Metabolizable energy (MJ/kg) 12.20 12.34 12.57 βj was the EO level; aβij was the interaction of oil form × oil level, and
Crude protein (%) 22.05 20.33 18.72 eijk was the error. Randomized complete design and differences in treat-
Methionine (%) 0.63 0.58 0.58
ment means were evaluated by Tukey's multiple range tests. All state-
Methionine + cysteine (%) 0.93 0.85 0.85
Lysine (%) 1.26 1.14 1.14 ments of significance were based on P < 0.05. Relative expression of
Threonine (%) 0.84 0.79 0.79
Tryptophan (%) 0.23 0.22 0.22
Arginine (%) 1.36 1.30 1.30
Calcium (%) 1.01 0.93 0.93 Table 2
Available phosphorous (%) 0.50 0.45 0.45 Primers used for RT-PCR analysis of chicken mRNAs.
Sodium (%) 0.17 0.17 0.17
Target Primer Sequence (5′→3′) ToC
m
Linoleic acid (%) 1.94 1.93 1.93
1 GAPDH Forward TCTCTGGCAAAGTCCAAGTG 57.74
Provided per kg of diet: retinyl acetate, 10,000IU; cholecalciferol, 4 500IU; DL-α-
Reverse TGCCCATTGATCACAAGTTT 55.81
tocopheryl acetate, 65 IU; menadione, 3 mg; thiamin, 2.5 mg; riboflavin, 5.2 mg; niacin,
Mucin 2 Forward CAGCGTTAACACAGGGCTTA 58.20
35mg; pantothenic acid, 18mg; pyridoxine, 3.2mg; biotin, 0.18mg; folic acid, 1.6mg; cy-
Reverse GCAGCAGACGTTGATCTCAT 58.35
anocobalamin, 0.017mg; choline choloride, 800mg and antioxidant, 2.5mg. Provided per
kg of diet: copper, 16 mg; iodine, 1.25 mg; iron,20 mg; manganese,120 mg; selenium, RT-PCR = reverse transcription-PCR; GAPDH = glyceraldehyde 3-phosphate dehydroge-
0.30mg; and zinc, 100mg. nase; Tm= melting temperature.

3
N. Amiri, M. Afsharmanesh, M. Salarmoini et al.
Table 3
Phytochemical GEO components fed to broiler chicks.
Number Retention time Compounds
1 3.20 Propylene
3 3.40 Allyl n-propyl sulfide
4 4.40 3-Methylthiophene
5 5.10 Methyl allyl disulfide
6 7.80 Diallyl disulfide
7 11.30 Diallyl trisulfide
GEO = garlic essential oil.
mucin2 mRNA was determined using the method 2-ΔΔC
T and then anal-
yses were conducted using GLM of SAS.
Results
Chemical composition of garlic (Allium sativum)
As shown in Table 3, different components of GEO were analyzed by
GC/MS instrument. The main components of the oil were diallyl trisul-
fide (32.82%), diallyl disulfide (20.18%), methyl allyl disulfide (7.18%),
and allyl n-propyl sulfide (3.53%).
Antibacterial activity
Fig. 1 shows the comparison of MIC values (in vitro) and intestinal
E. coli population (in vivo) by tested GEO in different forms. The results
showed that these forms of GEO had sufficient inhibitory effects on
E. coli bacteria. Under in vitro studies, chitosan-nanoencapsulated GEO
again showed strong antimicrobial activity in inhibiting the growth of
E. coli bacteria at MIC 7 mg/mL. Also under in vivo condition,
nanoencapsulated GEO reduced the population of E. coli in digesta of
ileo-caecum compared to the free form of the EO.
Antioxidant activity
In this study, the inhibition of DPPH-free radicals and the amount of
lipid oxidation in breast muscle of broiler were evaluated using an in
vitro and in vivo methods for different forms of GEO (Fig. 2). The IC50
of free EO was 51.92 ppb, while the IC50 of nanoencapsulation EO was
18.57 ppb. The antioxidant activity of nanoencapsulation form of GEO
under in vitro studies was significantly better than free form. Also
under in vivo condition, the least amount of TBARS produced in broiler
breast muscle tissue was associated with nanoencapsulation treatment
at 161 μg of malonaldehyde/kg.
Fig. 1. Comparison of antibacterial activity under in vitro (MIC values) and in vivo
(intestine E. coli broiler population) conditions of GEO in different forms. GEO: Garlic
essential oil; MICs: Minimum inhibitory concentrations.
Animal 15 (2021) 100022
% Total
0.01
3.53
0.10
7.18
20.18
32.82
Fig. 2. Comparison of antioxidant activity under in vitro (IC50)1 and in vivo (broiler breast
muscle tissue) conditions of GEO in different forms. GEO: garlic essential oil; DPPH: 2,2-
diphenyl-1-picrylhydrazyl; TBARS: thiobarbituric acid reactive substance. 1IC50 is the
concentration of essential oil that inhibits 50% of free radicals.
Performance: body weight gain, feed intake, and feed conversion ratio
The main effects of form and level of GEO and their interactions on
BWG, FI, and FCR in broiler chicks are depicted in Table 4 and Supple-
mentary Table S2. The BWG was significantly (P < 0.05) higher in the
nanoencapsulated GEO group than in the free GEO group at 0–21 and
0–42 days, while the EO levels were not significant (P < 0.05 or 0.01) ex-
cept for 0–42 days, with the highest BWG reported for broilers fed 100
mg/kg GEO. Interaction between form and GEO level was also observed
for growth performance (P < 0.05). Body weight gain was improved by
the inclusion of 100 mg/kg GEO nanoencapsulated (from 22 to 42 days
and from 0 to 42 days) in the diet compared to the control group (P <
0.05). Feed intake was higher in the free GEO group than in the
nanoencapsulated GEO group (0− 21), while the EO level of 200 mg/
kg showed the lowest FI at 22–42 and 0–42 days (P < 0.05). The effect
of the interaction between the form and the GEO level on FI was
significant. During the 22- to 42-day period, FI increased significantly
in control treatment compared to other treatments (P = 0.04). The
nano-encapsulated GEO group achieved the best FCR values at days
0–21 and 0–42, while the best FCR values at days 22–42 and 0–42
were 100 mg/kg GEO (P < 0.01). Also, the interaction effect between
the GEO form × levels was also significant for the FCR. The FCR was im-
proved (P < 0.05) by the inclusion of 100 mg/kg nanoencapsulated GEO
in the diet during the period from 0 to 42 days.
Intestinal morphology
The effects of different forms of EO supplementation on villus height,
villus width, crypt depth, and the ratio of villus height to crypt depth
of the jejunum at day 42 are shown in Table 5 and Supplementary
Table S3. In birds fed diets supplemented with 100 mg / kg GEO, mean
villi height and villi width were the highest (P < 0.05). Significant inter-
actions have been observed between the form and the EO level on the
villus height (P = 0.02), the villus width (P < 0.01), and the villus
height: the crypt depth (P < 0.01) of the jejunum. In the jejunum of
birds fed diets supplemented by 100 mg/kg nanoencapsulated GEO, vil-
lus height and width and the villi length to crypt depth ratio were signif-
icantly higher (P < 0.01).
Measurement of microbial population and mucin2 gene expression
The influences of different form of EO on the number of lactobacilli of
broiler are depicted in Table 6 and Supplementary Table S4. Main effects
reveal that encapsulating EO had positive significant effects on micro-
bial population (P < 0.05). Feeding broilers with 100 mg/kg GEO
4
N. Amiri, M. Afsharmanesh, M. Salarmoini et al. Animal 15 (2021) 100022

Table 4
Effects of feeding free and nanoencapsulated form of GEO on growth performance of broilers.

Treatment Main effects

EO form EO levels (mg/kg) P-value

Free Nanoencapsulation SEM 0 100 200 SEM EO form EO levels Form × Levels
b a
BWG(g/b/d) 0-21d 31.52 33.10 0.47 32.07 32.99 31.88 0.82 0.02 0.35 0.05
22-42d 69.13 70.57 0.88 68.20 74.65 69.74 1.52 0.27 0.09 0.03
0-42d 49.54b 50.97a 0.46 48.71b 51.88a 50.17ab 0.80 0.04 0.01 0.02
FI (g/b/d) 0-21d 43.85a 41.81b 0.71 43.27 43.24 41.54 1.24 0.03 0.14 0.40
22-42d 115.93 115.03 1.20 119.95a 113.86b 112.62b 2.08 0.59 0.01 0.04
0-42d 88.90 88.34 0.64 90.71a 88.24ab 86.91b 1.12 0.58 0.01 0.91
FCR (g/g) 0-21d 1.39a 1.26b 0.01 1.37 1.31 1.30 0.02 0.01 0.15 0.09
22-42d 1.67 1.63 0.02 1.75a 1.59ab 1.62b 0.03 0.19 0.01 0.32
0-42d 1.79a 1.73b 0.02 1.86a 1.70b 1.73b 0.03 0.01 0.01 0.04

GEO = garlic essential oil; EO = essential oil; BWG = BW gain; FI = feed intake; FCR = feed conversion ratio.
a,b Values within a row with different superscripts differ significantly at P < 0.05.

Table 5
Effects of feeding free and nanoencapsulated form of GEO on intestinal morphology of broiler chicken at 42 days of age.

Treatment Main effects

EO form EO levels (mg/kg) P-value

Free Nanoencapsulation SEM 0 100 200 SEM EO form EO levels Form × Levels

Villus height (μm) 1613.18 1698.42 5.19 1531.10b 1794.30a 1642.01ab 6.36 0.15 0.01 0.02
Villus width (μm) 153.92 160.88 40.59 142.08b 172.82a 157.29ab 49.72 0.35 0.01 0.01
Crypt depth (μm) 205.23 193.25 0.42 200.97 205.22 191.52 0.52 0.40 0.72 0.10
Villus height:crypt depth 8.10 9.15 10.02 7.91 9.18 8.77 12.27 0.09 0.23 0.01

GEO = garlic essential oil; EO = essential oil.

a,b Values within a row with different superscripts differ significantly at P < 0.05.

increased lactobacilli population in comparison with the control
treatment.
Also, the effects of different forms and levels of GEO supplementa-
tion on the expression of jejunal mucin2 gene of broiler are shown in
Table 6 and Supplementary Table S4. In the present study, there was
no significant interaction effect between GEO forms and levels (P >
0.05), but the main effect of EO form on mucin2 gene expression was
significant (P < 0.01). Expression of mucin2 gene was increased by feed-
ing nanoencapsulated form of EO.
Discussion
The GEO components found here were approximately homogenous
with the results of most of the studies. Previous analysis of volatile garlic
oils has revealed, among others, the presence of diallyl sulfide, diallyl di-
sulfide, diallyl trisulfide, and 2-vinyl-4H-1,3-dithiin (Edris and Fadel,
2002; Abu-Lafi et al., 2004). It is also worth noting that the encapsula-
tion of GEO by ionic gelation method dose not induce interaction in be-
tween the compounds of the GEO and the capsule shell materials.
Therefore, the EO profile is the same in both encapsulated and free
groups (Hosseini and Meimandipour, 2018).
In in vitro (inhibition zone) and in vivo (E. coli count) studies, chito-
san-nanoencapsulated GEO was effective against E. coli bacteria com-
pared to free form. Garlic activity is well demonstrated against
bacteria that are gram-positive and gram-negative (Rehman and
Munir, 2015). Rees et al. (1993) reported a differential inhibition
of garlic between beneficial intestinal microflora and potentially
harmful enterobacteria. The antibacterial activity mechanism of
nanoencapsulated chitosan GEO is possibly due to the interaction be-
tween positively charged amino groups of chitosan and the negative
charge of bacterial cell membranes, resulting in a reduction in the per-
meability of bacterial cell membranes (Friedman and Juneja, 2010;
Menconi et al., 2014). Essential oil's antimicrobial action is also medi-
ated by lipophilic properties to perforate the bacterial membrane and
alter the chemical composition of the bacterial medium (Helander et
al., 1998), which releases membrane components from the cells to the
external environment (Beyki et al., 2014).The results of the current
study showed the positive effects of nanoencapsulation form of GEO
with chitosan on the antioxidant activity in vitro condition and the de-
crease of oxidative deterioration of meat by free radicals in vivo condi-
tion. The antioxidant properties of garlic have been showed in in vitro
condition (Jakubcová et al., 2014), which reported due to the sulfide
compounds released from garlic and their phenolic content. These com-
pounds may be responsible for the significant antioxidant potential of
the essential oils, suggesting possible additive or synergistic effects of
the constituents (Kim et al., 1997).
The effect of nanoencapsulated GEO was insignificant on BWG, FI,
and FCR of broiler chickens. The beneficial effects of free form of GEO
diet supplementation in broiler chickens have been previously docu-
mented. There are no available data on the effects of nanoencapsulated
GEO on broiler performance and gut health. Broilers fed supplementa-
tion of garlic had greater performance than those fed control diet
when garlic was added at 1% level (Karangiya et al., 2016). Bioactive
substances of these herbs may influence the digestive system by stimu-
lating digestive enzymes and appetite as well as balancing the intestinal
microbial population (Ghazanfari et al., 2014). In addition, the EO
contained substances that increased bile acid secretion and influenced
intestinal morphology by stimulating the release of digestive enzymes
from the pancreas and intestinal mucosa such as trypsin and amylase
(Hafeez et al., 2016).The study showed that nanoencapsulation with chi-
tosan improved the effect of the EO on growth performance. This in-
crease can be attributed to the positive charge on chitosan for oil
binding, protection against acid and protease degradation in the stom-
ach, increased intestinal absorption, and retention of active compounds
(LeHoux and Grondin, 1993). As a result, nanoencapsulation could im-
prove growth efficiency through efficient delivery of the EO and chitosan
antimicrobial properties (Meimandipour et al., 2017). Sundari et al.
(2013) showed that the formulation of nanocapsules using turmeric

5
N. Amiri, M. Afsharmanesh, M. Salarmoini et al. Animal 15 (2021) 100022

Table 6
Effects of feeding free and nanoencapsulated form of GEO on intestinal microbial population (log) and mucin2 gene expression in intestinal of broiler chicken at 42 days of age.

Treatment Main effects

EO form EO levels (mg/kg) P-value

Free Nanoencapsulation SEM 0 100 200 SEM EO form EO levels Form × Levels
b a b a ab
Lactobacilli 6.92 7.58 0.11 6.69 7.73 7.32 0.14 0.03 0.02 0.09
mucin2 gene expression 1.80a 1.85a 0.01 1.80 1.83 1.84 0.01 0.01 0.05 0.13

GEO = garlic essential oil; EO = essential oil.

a,b Values within a row with different superscripts differ significantly at P < 0.05.

extract, industrial chitosan (as the polymer), and Na-TPP (as a cross-
linker) increases true metabolizable energy and feeds efficiency in
broiler chicks. Li et al. (2012) found that adding encapsulated thymol
and cinnamaldehyde EO to diet had increased weaned pig BWG and FCR.
In this trial, nanoencapsulated GEO significantly improved the mor-
phology of intestine tissue. Karangiya et al. (2016) showed that using 1%
garlic in broiler diet significantly enhanced villi length and villi width.
Furthermore, Bahadoran et al. (2016) indicated that birds fed dietary
garlic could enhance duodenal and jejunal villus length, width, and sur-
face area compared to control group. Development in villus height and
width is directly correlated with an increased epithelial turnover that
leads to an increase in the absorption of available nutrients, and longer
villi are associated with the increased epithelial cell mitosis. Also, villi
development provided greater absorption surface for availability of nu-
trients (Karangiya et al., 2016). These results showed that nanochitosan
can bind the oils and release their contents in the gut cells at controlled
rates, creating better absorption (Sundari et al., 2013) and retaining the
EO properties, compounds, and effects used at low concentrations.
The use of EO (100 mg/kg) especially coated with chitosan signifi-
cantly improved intestinal populations of Lactobacilli in broilers. Shams
Shargh et al. (2012) reported that birds fed garlic-containing diets
showed significantly higher lactobacillus and lower coliform counts
compared to other treatments. The mechanism of this differential inhibi-
tion is not clear, but it maybe be due to permeating the microorganism's
cell membranes and mitochondria and their absorptivity to allicin
(Nazzaro et al., 2013; Adaszyńska-Skwirzyńska and Szczerbińska,
2017). This effect may also be due to the antimicrobial property of chito-
san, especially in the form of nanoparticles, and to the protective cover-
ing layer of the nanocapsule synergizing with the antimicrobial activity
of the EO (Nouri, 2019). Chitosan-nanoencapsulated garlic supplemen-
tation imposed positive effects on the expression of mucin2 in jejunum
of broilers. These results showed that antimicrobial properties of GEO
and chitosan could help stimulate the growth of small intestinal mucosal
absorptive cells, reduce competition with the host for available nutri-
ents, stimulate the growth of small intestinal mucosal absorptive cells,
and cause the secretion of innate digestive enzymes. Bioactive sub-
stances of garlic EO can affect the concentration of extracellular protein-
ase (HapA) and may increase the secretion and accumulation of mucin 2
gene in the gastrointestinal tract. Bioactive substances that also alter the
function of transcription factors such as GATA4 and Fox1, which control
the expression of mucin 2 genes in broiler chickens (van der Sluis et al.,
2004; Zeinali et al., 2017).
In conclusion, in this study, the benefits of supplementation of
broiler diet with a garlic encapsulated EO were superior to the tested
garlic EO in free form. Nanoencapsulated GEO significantly increased
the beneficial effects of EO on in vitro (antibacterial and antioxidant
properties) and in vivo condition (performance and gut health) in
broiler chickens. Thus, nanoencapsulated GEO could be a suitable alter-
native to antibiotics as in-feed growth promoters in poultry production.
Supplementary materials
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.animal.2020.100022.
Ethics approval
All animal experiments were performed in accordance with guide-
lines for the care and use of laboratory animals and approved by Veter-
inary Faculty of Shahid Bahonar University of Kerman (approval
number: IR.UK.VETMED.REC 2019-03-05).
Data and model availability statement
The authors declare that the data of this research are not deposited
in any official repository.
Author ORCIDs
https://orcid.org/0000-0002-4782-8687 (Mohsen Afsharmanesh).
Author contributions
N. Amiri: Methodology, Investigation; M. Afsharmanesh: Concep-
tualization, Methodology, Formal analysis, Writing - review & editing;
M. Salarmoini: Conceptualization, Methodology; A. Meimandipour:
Methodology; S.A. Hosseini: Methodology, Formal analysis; H.
Ebrahimnejad: Conceptualization, Methodology.
Declaration of interest
The authors declare that there are no conflicts of interest.
Acknowledgements
The authors gratefully acknowledge the financial support of Shahid
Bahonar University of Kerman, Iran, and the Animal Science Research
Institute and the National Institute of Genetic Engineering and Biotech-
nology, Tehran, Iran.
Financial support statement
None.
References
Abu-Lafi, S., Dembicki, J.W., Goldshlag, P., Hanuš, LrO, Dembitsky, V.M., 2004. The use of
the ‘Cryogenic'GC/MS and on-column injection for study of organosulfur compounds
of the Allium sativum. Journal of Food Composition and Analysis 17, 235–245.
Adams, R.P., Sparkman, O.D., 2007. Review of identification of essential oil components by
gas chromatography/mass spectrometry. Journal of the American Society for Mass
Spectrometry 18, 803–806.
Adaszyńska-Skwirzyńska, M., Szczerbińska, D., 2017. Use of essential oils in broiler
chicken production–a review. Annals of Animal Science 17, 317–335.
Ahn, D., Sell, J., Jo, C., Chen, X., Wu, C., Lee, J.I., 1998. Effects of dietary vitamin E supple-
mentation on lipid oxidation and volatiles content of irradiated, cooked Turkey
meat patties with different packaging. Poultry Science 77, 912–920.
Aviagen, 2014. Ross 308 broiler: nutrition specifications. Retrieved on 10 April 2016 from.
http://tmea.staging.aviagen.com/assets/Tech_Center/Ross_Broiler/Ross-308-Broiler-
Nutrition-Specs-2014r17-EN.pdf.
Bahadoran, S., Hassanpour, H., Shafigh, Z., 2016. Garlic supplement improves intestinal
mucosa morphology in broiler chickens with developmental pulmonary hyperten-
sion. Poultry Science 4, 117–125.

6
N. Amiri, M. Afsharmanesh, M. Salarmoini et al.
Barton, M.D., 2000. Antibiotic use in animal feed and its impact on human healt. Nutrition
Research Reviews 13, 279–299.
Beyki, M., Zhaveh, S., Khalili, S.T., Rahmani-Cherati, T., Abollahi, A., Bayat, M., Tabatabaei,
M., Mohsenifar, A., 2014. Encapsulation of mentha piperita essential oils in chito-
san–cinnamic acid nanogel with enhanced antimicrobial activity against Aspergillus
flavus. Industrial Crops and Products 54, 310–319.
Brenes, A., Roura, E., 2010. Essential oils in poultry nutrition: main effects and modes of
action. Animal Feed Science and Technology 158, 1–14.
Burits, M., Bucar, F., 2000. Antioxidant activity of Nigella sativa essential oil. Phytotherapy
Research 14, 323–328.
Demir, E., Sarica, S., Ozcan, M., Suicmez, M., 2005. The use of natural feed additives as al-
ternatives to an antibiotic growth promoter in broiler diets. Archiv fur Geflugelkunde
69, 110–116.
Edris, A.E., Fadel, H.M., 2002. Investigation of the volatile aroma components of garlic
leaves essential oil. Possibility of utilization to enrich garlic bulb oil. European Food
Research and Technology 214, 105–107.
Friedman, M., Juneja, V.K., 2010. Review of antimicrobial and antioxidative activities of
chitosans in food. Journal of Food Protection 73, 1737–1761.
Fujisawa, H., Suma, K., Origuchi, K., Kumagai, H., Seki, T., Ariga, T., 2008. Biological and
chemical stability of garlic-derived allicin. Journal of Agricultural and Food Chemistry
56, 4229–4235.
Ghazanfari, S., Adib Moradi, M., Mahmoodi Bardzardi, M., 2014. Intestinal morphology
and microbiology of broiler chicken fed diets containing myrtle (Myrtus communis)
essential oil supplementation. Iranian Journal of Applied Animal Science 4, 549–554.
Hafeez, A., Männer, K., Schieder, C., Zentek, J., 2016. Effect of supplementation of
phytogenic feed additives (powdered vs. encapsulated) on performance and nutrient
digestibility in broiler chickens. Poultry Science 95, 622–629.
Helander, I.M., Alakomi, H.-L., Latva-Kala, K., Mattila-Sandholm, T., Pol, I., Smid, E.J., Gorris,
L.G., von Wright, A., 1998. Characterization of the action of selected essential oil com-
ponents on gram-negative bacteria. Journal of Agricultural and Food Chemistry 46,
3590–3595.
Hosseini, S., Meimandipour, A., 2018. Feeding broilers with thyme essential oil loaded in
chitosan nanoparticles: an efficient strategy for successful delivery. British Poultry
Science 59, 669–678.
Jakubcová, Z., Mareš, P., Zeman, L., Horký, P., Juríková, T., Mlček, J., Balla, Š., Kalhotka, L.,
Mrkvicová, E., Sochor, J., 2014. Influence of garlic extract on antioxidant status of
chicken. Potravinarstvo Slovak Journal of Food Science 81, 315–320.
Kamali Sangani, A., Masoudi, A.A., Hosseini, S.A., 2014. The effects of herbal plants on
Mucin 2 gene expression and performance in ascetic broilers. Iranian Journal of Vet-
erinary Medicine 8, 47–52.
Karangiya, V., Savsani, H., Patil, S.S., Garg, D., Murthy, K., Ribadiya, N., Vekariya, S., 2016.
Effect of dietary supplementation of garlic, ginger and their combination on feed in-
take, growth performance and economics in commercial broilers. Veterinary World 9,
245.
Kim, S.M., Kubota, K., Kobayashi, A., 1997. Antioxidative activity of sulfur-containing fla-
vor compounds in garlic. Bioscience, Biotechnology, and Biochemistry 61,
1482–1485.
LeHoux, J., Grondin, F., 1993. Some effects of chitosan on liver function in the rat. Endocri-
nology 132, 1078–1084.
Li, P., Piao, X., Ru, Y., Han, X., Xue, L., Zhang, H., 2012. Effects of adding essential oil to the
diet of weaned pigs on performance, nutrient utilization, immune response and in-
testinal health. Asian-Australasian Journal of Animal Sciences 25, 1617.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408.
Manal, I., 2016. Detoxification and antioxidant effects of garlic and curcumin in
Oreochromis niloticus injected with aflatoxin B 1 with reference to gene expression
Animal 15 (2021) 100022
of glutathione peroxidase (GPx) by RT-PCR. Fish Physiology and Biochemistry 42,
617–629.
Meimandipour, A., Emamzadeh, A.N., Soleimani, A., 2017. Effects of nanoencapsulated
Aloe vera, dill and nettle root extract as feed antibiotic substitutes in broiler chickens.
Archives Animal Breeding 60 (1), 1–7.
Menconi, A., Pumford, N.R., Morgan, M.J., Bielke, L.R., Kallapura, G., Latorre, J.D.,
Wolfenden, A.D., Hernandez-Velasco, X., Hargis, B.M., Tellez, G., 2014. Effect of chito-
san on Salmonella Typhimurium in broiler chickens. Foodborne Pathogens and Dis-
ease 11, 165–169.
Natrajan, D., Srinivasan, S., Sundar, K., Ravindran, A., 2015. Formulation of essential oil-
loaded chitosan–alginate nanocapsules. Journal of Food and Drug Analysis 23,
560–568.
Nazzaro, F., Fratianni, F., De Martino, L., Coppola, R., De Feo, V., 2013. Effect of essential oils
on pathogenic bacteria. Pharmaceuticals 6, 1451–1474.
Nouri, A., 2019. Chitosan nano-encapsulation improves the effects of mint, thyme, and
cinnamon essential oils in broiler chickens. British Poultry Science 60, 530–538.
Rees, L., Minney, S., Plummer, N., Slater, J., Skyrme, D., 1993. A quantitative assessment of
the antimicrobial activity of garlic (Allium sativum). World Journal of Microbiology
and Biotechnology 9, 303–307.
Rehman, Z., Munir, M.T., 2015. Effect of garlic on the health and performance of broilers.
Australian Veterinary Journal 3, 32–39.
Reisinger, N., Steiner, T., Nitsch, S., Schatzmayr, G., Applegate, T., 2011. Effects of a blend of
essential oils on broiler performance and intestinal morphology during coccidial vac-
cine exposure. Journal of Applied Poultry Research 20, 272–283.
Ribeiro-Santos, R., Andrade, M., Sanches-Silva, A., 2017. Application of encapsulated es-
sential oils as antimicrobial agents in food packaging. Current Opinion in Food Sci-
ence 14, 78–84.
SAS institute, 2004. SAS user's guide. Version 9. SAS Institute Inc., Cary, NC, USA.
Sawtarie, N., Cai, Y., Lapitsky, Y.J.C., Biointerfaces, S.B., 2017. Preparation of chitosan/
tripolyphosphate nanoparticles with highly tunable size and low polydispersity. Col-
loids and Surfaces B: Biointerfaces 157, 110–117.
Shams Shargh, M., Dastar, B., Zerehdaran, S., Khomeiri, M., Moradi, A., 2012. Effects of
using plant extracts and a probiotic on performance, intestinal morphology, and mi-
croflora population in broilers. Journal of Applied Poultry Research 21, 201–208.
Shang, A., Cao, S.-Y., Xu, X.-Y., Gan, R.-Y., Tang, G.-Y., Corke, H., Mavumengwana, V., Li, H.-
B., 2019. Bioactive compounds and biological functions of garlic (Allium sativum L.).
Foods 8, 246.
Sundari, S., Zuprizal, Z., Yuwanta, T., Martien, R., 2013. Metabolizable energy of ration
added with nanocapsule of turmeric extract on broiler chicken. Journal of the Indone-
sian Tropical Animal Agriculture 38, 41–46.
Thompson, K., Applegate, T., 2006. Feed withdrawal alters small-intestinal morphology
and mucus of broilers. Poultry Science 85, 1535–1540.
van der Sluis, M., Melis, M.H., Jonckheere, N., Ducourouble, M.-P., Büller, H.A., Renes, I.,
Einerhand, A.W., Van Seuningen, I., 2004. The murine Muc2 mucin gene is transcrip-
tionally regulated by the zinc-finger GATA-4 transcription factor in intestinal cells.
Biochemical and Biophysical Research Communications 325, 952–960.
Wiegand, I., Hilpert, K., Hancock, R.E., 2008. Agar and broth dilution methods to deter-
mine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature
Protocols 3, 163.
Yang, C., Cao, G., Ferket, P., Liu, T., Zhou, L., Zhang, L., Xiao, Y., Chen, A., 2012. Effects of pro-
biotic, clostridium butyricum, on growth performance, immune function, and cecal
microflora in broiler chickens. Poultry Science 91, 2121–2129.
Zeinali, S., GHazanfari, S., Ebrahimi, M.A., 2017. Mucin2 gene expression in the chicken in-
testinal goblet cells are affected by dietary essential oils. Bulgarian Journal of Agricul-
tural Science 23, 134–141.