Kuliah Elektif Genetik 2021

Gene, PCR primers and understanding genetic variants

25 November 2021

Read me first
● The goal of this practical work is to know the basic principles of gene and its structure,
designing primers for standard PCR and genetic variant nomenclature.
● Questions are in italics and designated by “Q.”
● Not all questions have definite answers but are meant to help you think about the
data/information that is presented.
● The blue boxes contain hints that are available for some questions.
● There are quick references of websites and tools used during this workshop (see list of
contents)
● Useful links are listed in the last page of this manual
● You may ask questions during the workshop.

1
Case
A 35-year-old woman referred to an ophthalmologist with a 6-month history of glare and
painless diminution of vision in both eyes. Her best-corrected visual acuity was 20/20 in the right
eye and 20/60 in the left eye. White "bread crumb" opacities with "moth-eaten" centers were
observed in the superficial and mid-corneal stroma (A, B). These were interspersed with star-
shaped, spiny, or icicle-shaped deposits as seen in anterior segment optical coherence
tomography (C, D). The patient stated that there are more affected individuals in her family.

Based on the ophthalmologic assessment, the ophthalmologist diagnosed this patient with
Avellino Corneal Dystrophy also known as combined granular-lattice dystrophy, or granular
corneal dystrophy (GCD) type 2.

2
Part1 : Gene hunting

Family pedigree

In the pedigrees, men are represented by squares and women by circles. The proband is
indicated by an arrow. Affected individuals are represented by the filled symbols.

Online Mendelian Inheritance in Man (OMIM) is a freely available, continuously updated catalog of
human genes and genetic disorders and traits, with a particular focus on the gene-phenotype
relationship. As of 28 June 2019, approximately 9,000 of the over 25,000 entries in OMIM represented
phenotypes; the rest represented genes, many of which were related to known phenotypes.
URL: https://www.omim.org/

Open a new window in your internet browser and go to OMIM and read the description about
the disorder.
Q1. Which gene is relevant for this disease?
Mutasi pada gen TGFBI di Kromosom 5q31 yang mengkode keratoepitelin

Q2. Based on the pedigree, what is the possible mode of inheritance of the disease? Explain your
reason(s).
Autosomal Dominant
a. Karena semua generasi menderita penyakit tersebut(CDA).
b. Pria dan Wanita semua terkena dan bisa menurunkan.

Q3. Based on the information in OMIM, is there any common mutations or hotspot mutations in
this gene?
Pada mutasi gen TGFBI 🡪Paling banyak terjadi 72% mutasi R214H berhubungan
dengan CDA; 14% mutasi pada R124C berhubungan dengan Lattice Corneal
3
 Dystrophy type I; 6% mutasi Pro501-to-thr berhubungan dengan Lattice Corneal
Dystrophy type IIIA

Part2: Reading the sequencing result

You have performed PCR using your primers and thereafter Sanger sequence them. You get your
results back in .abi format.
Use FinchTV to visualize your data

Step 1 Download the .ab1/ sequence chromatogram data

(file amplicon1_F1.ab1 and amplicon1_F2.ab1)
Step 2 Open FinchTV

Step 3 Load the file amplicon1_F1.ab1 by clicking “File”and then click “Open”

4
And then find the location where your file is located

Now you will see the chromatogram image of file amplicon1_F1.ab1

5
Step 4 You can adjust the height and width of the peaks using vertical and horizontal Scale, so
that it is easier to read

Step 5 Click on “Wrapped view” option to see the entire sequence

6
 single nucleotide variant or small
insertion/ deletion from this
In a DNA chromatogram, each DNA base
chromatogram.
is represented as a peak of a different
color i.e. A: green peaks, G: black peaks,
T: red peaks, C: blue peaks. You can see

Now we know and able to read the entire sequence, but how to detect whether there is any
variants/mutations?

Step 6 Click on position 10 and look at the information on the left lower pane (Selected base
A:10 (Q6))
Hint: The position information is on the top part below the nucleotide sequence

Step 7 Click on position 20 and look at the information on the left lower pane

7
Q4. Compare the information from step 5 and 6 and what do you think “Q” means?
Q pada aplikasi berarti Quality Value, yaitu angka yang menunjukkan akurasi setiap basa
DNA pada sekuens. Q mewakilkan kemampuan software pengidentifikasi basa untuk
mengidentifikasi basa pada posisi tertentu dan dikalkulasi dengan log untuk probabilitas
10

kesalahan dan dikalikan dengan -10. Sebagai contoh, basa dengan Q10 memiliki kemungkinan
1:10 keterjadian misidentifikasi, sedangkan Q20, Q30, Q40 memiliki probabilitas eror 1:100,
1:1.000, dan 1:10.000.  Sekuens DNA yang sering digunakan umumnya memiliki Q30 atau lebih.
Base G:10 (Q5) ; Base G:20 (Q51) 🡪 “Q” adalah Quality Value 🡪 angka yang digunakan untuk
menilai keakuratan basa nukleotida dalam urutan DNA(DNA Squence), untuk menentukan
kemungkinan error atau salah identifikasi.

Step 8 Click on “Chromatogram info” to see the entire nucleotide sequence. Select the entire
sequence and click “

Step 9 Block from position 160 to 180, copy then paste to a separate file

Step 10 Block from position 160 to 180, and then click at “Reverse Complement” (look at the
arrow). Copy and then paste to a separate file

Step 11 Open the file amplicon1_R.ab1 by clicking “File”and then click “Open”
(the same as step 3)

Step 12 Block from position 341 to 361, copy then paste to a separate file

8
Step 13 Block from position 190 to 210, and then click at “Reverse Complement” (look at the
arrow). Copy and then paste to a separate file

Q5. Compare the DNA sequence from step 9, 10, 12 and 13 and highlight part that are similar
and part that are different.
Yang sama adalah step 10 dan 12; Step 9 dan step 13 🡪 step 10 dan 12 ada Y, step 9 dan 13 ada R

Q6. As you know from previous lectures, that there are four different nucleotides which compose
DNA, i.e., A,T,C and G. So what does “R” and “Y” mean in those sequences?
R Terdapat 2 basa nukleotida Guanine dan Adenin 🡪 Purine
Y Terdapat 2 basa nukleotida Cytosin dan Thymin 🡪 Pirimidin
Hint: Look at the peak colors

Q7. Compare the two variants and circle where the variant is located

000000004 ctgtag.tgtaccgtgctctctgt..gagaagggagggtgtggttgggct 000000050

>>>>>>>>> |||||| |||||||||||||||||  |||||||||||||||||||||||| >>>>>>>>>
135381930 ctgtagatgtaccgtgctctctgtcagagaagggagggtgtggttgggct 135381979

000000051 ggacccccagaggccatccctccttctgtcttctgctcctgcagccctac 000000100

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135381980 ggacccccagaggccatccctccttctgtcttctgctcctgcagccctac 135382029

000000101 cactctcaaacctttacgagaccctgggagtcgttggatccaccaccact 000000150

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382030 cactctcaaacctttacgagaccctgggagtcgttggatccaccaccact 135382079

000000151 cagctgtacacggacc.cacggagaagctgaggcctgagatggaggggcc 000000199

>>>>>>>>> |||||||||||||||| ||||||||||||||||||||||||||||||||| >>>>>>>>>
135382080 cagctgtacacggaccgcacggagaagctgaggcctgagatggaggggcc 135382129

000000200 cggcagcttcaccatcttcgcccctagcaacgaggcctgggcctccttgc 000000249

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382130 cggcagcttcaccatcttcgcccctagcaacgaggcctgggcctccttgc 135382179

000000250 cagctgtgagatgacctccgtctgcccgggggactcttatggggaactgc 000000299

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382180 cagctgtgagatgacctccgtctgcccgggggactcttatggggaactgc 135382229

000000300 cttacttccccgaggggtgggcatgatgaatgggagtctgcagtcatttc 000000349

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382230 cttacttccccgaggggtgggcatgatgaatgggagtctgcagtcatttc 135382279

000000350 ctactgtttcaggaagctttctccttaaccccttagaaaaggctgtggaa 000000399

9
>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382280 ctactgtttcaggaagctttctccttaaccccttagaaaaggctgtggaa 135382329

000000400 cttgagctaaaatatgtcttaccaggttgcgtctaatgccccccgttccc 000000449

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382330 cttgagctaaaatatgtcttaccaggttgcgtctaatgccccccgttccc 135382379

000000450 tactgggcagaaagacttgggtgcttcctgaggagggatccttggcagaa 000000499

>>>>>>>>> |||||||||||||||||||||||||||||||||||||||||||||||||| >>>>>>>>>
135382380 tactgggcagaaagacttgggtgcttcctgaggagggatccttggcagaa 135382429

000000500 gagaggcctgggctcacgagggctgagaacatgt 000000533

>>>>>>>>> |||||||||||||||||||||||||||||||||| >>>>>>>>>
135382430 gagaggcctgggctcacgagggctgagaacatgt 135382463

Insertion a in 167 heterozigot pada kromosom 5 135382096 

Now, you need to find out what is the consequence of this variant on the protein level. Use the
instructions inside the blue box.

Q8. Look carefully the page after the last step. Can you find in which chromosome the variants is
located? And which genomic position exactly of that chromosom?
Chromosom 5 (135381930-135382463 (reverse trand)

10