Scientia Horticulturae 277 (2021) 109782

Contents lists available at ScienceDirect

Scientia Horticulturae
journal homepage: www.elsevier.com/locate/scihorti

Production of doubled-haploid(DH) selfed-progenies in ‘Banpeiyu’

pummelo [Citrus maxima (Burm.) Merr.] and its genetic analysis with
simple sequence repeat markers
Miki Kawano a, 1, Masaki Yahata b, 1, Tokurou Shimizu c, Chitose Honsho d, Tomonari Hirano d,
Hisato Kunitake d, *
a
Graduate School of Agriculture, University of Miyazaki, 1-1 Gakuenkibanadainishi, Miyazaki-shi, Miyazaki, 889-2192, Japan
b
Faculty of Agriculture, Shizuoka University, 836 Ohya, Suruga, Shizuoka, 422-8529, Japan
c
Division of Citrus Research, Institute of Fruit Tree and Tea Science, NARO, 485-6 Okitsu Nakacho Shimizu, Shizuoka, 424-0292, Japan
d
Faculty of Agriculture, University of Miyazaki, 1-1 Gakuenkibanadainishi, Miyazaki-shi, Miyazaki, 889-2192, Japan

A R T I C L E I N F O A B S T R A C T

Keywords: The genetic analysis of five haploid plants (BX1-BX5) of ‘Banpeiyu’ pummelo (BP), [Citrus maxima (Burm.)
Flow cytometry Merr.] using 32 simple sequence repeat (SSR) markers carried out for the purpose of confirming their gynoge­
Reciprocal cross netic origin and genetic differences. As the results, all the haploid plants possessed only either one of the BP
Parthenogenesis
alleles, confirming that they are gynogenetic origin. We also confirmed that BX1 and its doubled haploid (BX1-
Gynogenesis
Seed weight
DH) have exactly the same SSR alleles. Interestingly, all the five haploids had common alleles on the linkage
group (LG) 6 in the case of three markers. Then, we performed self-pollination of DH plants and reciprocal
crosses between DH and BP, which has strong self-incompatibility. The seeds obtained by these crosses germi­
nated in vitro or ex vitro normally and developed into diploid seedlings, except for one tetraploid seedling. Ge­
netic analysis of these seedlings with 32 SSR markers revealed that segregation ratios of the 32 loci in the 30 BP
inbred, 30 BP x DH and 30 DH x BP progenies mostly fitted to the expected ratios. However, significantly dis­
torted segregation ratios were found in one, five and three SSR markers for BP inbred, BP x DH and DH x BP
progenies, respectively. All of the 30 DH inbred progenies showed exactly the same SSR alleles as the original
DH. This is the first example in which self and back cross progenies of DH in fruit crops were genetically analyzed
using SSR markers.

1. Introduction
Haploid and doubled haploid (DH) plants are of great value for ge­
netic analysis and premeditated breeding (Chaikam et al., 2019; Das
et al., 2018; Khar et al., 2019; Yahata and Kunitake, 2018). This is
especially the case for woody species, which are generally characterized
by a long reproductive cycle, a high degree of heterozygosity, a large
plant size, and self-incompatibility (Akgol et al., 2017). In Citrus and
related genera, therefore, some haploid plants have been produced by
various techniques such as anther or microspore culture (Cimò et al.,
2016; Germanà and Chiancone, 2003; Hidaka et al., 1979), interploid
hybridization (Germanà and Chiancone, 2001; Oiyama and Kobayashi,
1993), and pollination of irradiated pollen (Aleza et al., 2009; Froelicher
et al., 2007; Kundu et al., 2017; Wang et al., 2016).
Toolapong et al.(1996) selected a haploid progeny among small
seed-derived seedlings obtained from the cross between ‘Banpeiyu’
pummelo (BP) and ‘Ruby Red’ grapefruit. This haploid showed dwarf
growth behavior and rosette morphology, similar to that of haploids
previously obtained from other cross combination methods. On the
other hand, it grew very well when it was grafted onto a trifoliate orange
plant (Yahata et al., 2005a). The haploid produced slightly fertile pollen
grains, and diploid hybrid progenies were obtained from the cross be­
tween some monoembryonic citrus cultivars and the haploid (Yahata
et al., 2005b, 2011). Moreover, colchicine treatment to the axillary

* Corresponding author.
E-mail address: hkuni@cc.miyazaki-u.ac.jp (H. Kunitake).
1
These authors contributed equally to the article.

https://doi.org/10.1016/j.scienta.2020.109782
Received 3 July 2020; Received in revised form 1 October 2020; Accepted 3 October 2020
Available online 21 November 2020
0304-4238/© 2020 Elsevier B.V. All rights reserved.
M. Kawano et al. Scientia Horticulturae 277 (2021) 109782

Table 1 selected DNA markers to certify their transferability among those

Plant materials for genetic analysis with SSR markers. hybrids.
Plant material Ploidy level Number of individuals Aleza et al. (2009) used the technique of in situ gynogenesis induced
by irradiated pollen and obtained haploid and DH clementine plants
`Banpeiyu’ 2x 1
BX1 x 1 which were then confirmed to possess single alleles specific to the
BX2 x 1 mother plant using 52 SSR marker analysis. Wang et al. (2015) induced
BX3 x 1 androgenesis by the anther culture of ‘Rohde Red’ sweet orange and
BX4 x 1 obtained two DH plants. They confirmed that these two DH plants
BX5 x 1
DH 2x 1
possessed a single allele in each of using 43 SSR markers tested. SSR
`Banpeiyu’ pummelo selfed progenies 2x 30 marker is a multiallelic marker and it is beneficial for identifying the
`Banpeiyu’ pummelo x DH progenies 2x 30 origin of four parental chromosomes.
DH x `Banpeiyu’ pummelo progenies 2x 29 In the present study, we carried out genetic analysis using SSR
DH selfed progenies 2x 30
markers of these haploid and DH plants to confirm their gynogenetic
origin. Also, we performed self-pollination in the DH plants and the
shoot buds was carried out in order to produce a homozygous strain of reciprocal crosses between the DH and BP. Then, we genetically
the haploid (Yahata et al., 2005a), and the DH showed higher pollen analyzed these seedlings with SSR markers.
fertility and a larger number of seeds than the haploid (Yahata et al.,
2015). In addition, Yahata et al. (2010) obtained some haploid plants by 2. Materials and methods
means of pollination with soft X-ray-irradiated pollen followed by
pseudo-fertilized ovule culture in BP. However, their gynogenetic origin 2.1. Plant materials
and genetic differences these haploid plants have not been revealed.
In Citrus, various DNA markers such as simple sequence repeat (SSR), ‘Banpeiyu’ pummelo [C. maxima (Burm.) Merr.], five haploid pum­
single nucleotide polymorphism (SNP), and cleaved amplified poly­ melos, namely BX1- BX5, and BX1-DH were used for our study (Table 1).
morphic sequences (CAPS) markers have been developed and used for BX1 was obtained from small seeds through a cross between BP and
taxonomic classification and for genetics and breeding research (Ahmed ‘Ruby Red’ grapefruit (Toolapong et al., 1996). BX1-DH was induced by
et al., 2017; Ramadugu et al., 2015). For example, Ruiz et al. (2000) colchicine treatment to axillary shoot buds of the BX1 (Yahata et al.,
distinguished between zygotic and nucellar seedlings by using SSR 2005b). BX2 was obtained from an undeveloped seed through the
markers. Also, Shimizu et al.(2016) inferred the parentage of indigenous open-pollinated BP. BX3, BX4 and BX5 were haploids obtained from
citrus varieties using SSR and insertion-deletion(indel) markers devel­ undeveloped seeds through a cross between BP and triploid ‘Oroblanco’
oped from various citrus genome sequence resources. They demon­ grapefruit (C. paradisi Macfad.). They were grafted onto trifoliate orange
strated that their SSR markers are valuable and widely available in Citrus plants and grown in containers for one to five years in the greenhouse of
species by performing parentage tests with 122 known hybrids using the the University of Shizuoka, Japan.

Table 2
Nucleotide sequences of SSR markers.
Linkage SSR marker Product Forward primer Reverse primer Universal
group size primer
a
1 TSRA103 188 GTTGTAAAACGACGGCCAGTTGGAGATGCTCTAACTTAACATGG TGTTGTCTACGTTAATCAGACGG UnivM13
1 CUBER939 215 TTGACACCAGACCAACTGGTTAAGATTAGGAAGTTGACCGA GGCAGAGGATACTTGGATA Lambda11RV
1 F21 163 GTTGTAAAACGACGGCCAGTCTACAAGTTCCCCAGTTATCCCG ACTTGACCCGCTCTAGGAGTGAC UnivM13
2 NSX186 209 TTGACACCAGACCAACTGGTACACTTTGAGAGTTTCTTCAGAC TTACCAAGACTTGTTTAAGGAATC Lambda11RV
2 SSR08B40 148 GATTTAGGTGACACTATAGACTCTCCCACTGTTTATGACTG GCCTTTGCGTTCAACTGATAA SP6
2 TSRP07 161 CGACGACTCCTGGAGCCCGATCACCAACTTATATTTGCTCAT CGACCTATCATAGAAAGCACA L11 F
3 GRW3011 94 GTTGTAAAACGACGGCCAGTCACGGACACAGTTTCAACAC AAAGCTCTAGCACTCTCACC UnivM13
3 NSX32 261 GTTGTAAAACGACGGCCAGTCTTTGGTGGGAATTGTCAGAGA AAAGACTCGAAATGCTGACCTT UnivM13
3 NSX23 246 TTGACACCAGACCAACTGGTAAGATCATGGCTTCCATTCAAATC GTTGTGTTATTACGTACTTTGCATTT Lambda11RV
3 CX2040 112 GTTGTAAAACGACGGCCAGTACAGCCTCCCCACTTTCTTT GATTACTTTTTGCTTCGCCG UnivM13
4 TSRA108 187 GATTTAGGTGACACTATAGTCAACTTGTTCACGACTTTCAC CTCAGCAGATCCAGAAGGT SP6
4 NSX145 128 GTTGTAAAACGACGGCCAGTATCCCTAACAATTTCCCTCCT TGTGATTAGTAAATAAATCCAAGAGAC UnivM13
4 TSRB11.2 215 GATTTAGGTGACACTATAGCAATGGCGGGAACAAAGTC CATCAGCTGAATCATTCCCA SP6
4 GSR3121 156 TTGACACCAGACCAACTGGTCCAGTAATCAAGACATTGTAGG CGAAACTGCTTTAGTCTAAGAG Lambda11RV
5 SSR08A16.2 122 CGACGACTCCTGGAGCCCGCATATTTACGCAAAGTGGAAGT TATTATTCCCATCAATCTCAAATG L11 F
5 NSX79 223 GATTTAGGTGACACTATAGTAGCGCGGGTGTAGTCTTT ATCTATACCAAACTCTGATGGCAA SP6
5 CX0004 276 GATTTAGGTGACACTATAGAAACCCCACTTCACAGCAAC GAAAGCGAGCCTTTGATGTC SP6
6 CiBE0447 326 GATTTAGGTGACACTATAGCACAAAGAGAGTAACCCACAA CGTCAAGAAGAGAGAATGATG SP6
6 GSR6129 227 TTGACACCAGACCAACTGGTGAAGAGAAATGGGAAAGTTGG AAGCTCAAAAGAAGAGTCAAG Lambda11RV
6 SSR08B32.1 74 GATTTAGGTGACACTATAGATATTCATTACCTCGCAGTGT GCCAACTCATCATCGTCAT SP6
6 TSRP06.2 185 CGACGACTCCTGGAGCCCGAACAGCACAAACACGCAAA CAAGTACATGAACACGCAC L11 F
6 SSR08B27.2 78 GTTGTAAAACGACGGCCAGTCCAACTCATCATCGTCATCTC GCTTAATATTCATTACCTCGCAG UnivM13
6 SSR08B82.1 149 GTTGTAAAACGACGGCCAGTTGAGCAAAGGGTGAAGGAG CAACCGTTCAAGAAAGCAT UnivM13
6 SSR08B29.2 137 CGACGACTCCTGGAGCCCGCTCCTCAGCAAGAGATCAC GCGGGTACTGATAGTACTG L11 F
7 GSR3114 155 GTTGTAAAACGACGGCCAGTATCCGGCTCTTCTGATTATG AGTGTTAGCAAATAGTCGGT UnivM13
7 GSR6101 248 GTTGTAAAACGACGGCCAGTAAAAACAGAGCAGAAGGAAC TGCAATCCCATAATAGCAAAG UnivM13
7 NSX153 142 CGACGACTCCTGGAGCCCGACTGTGGCGTACCTTTGAG GCAATAGGAAGGCTGAGGA L11 F
7 TSRF208.1 191 GTTGTAAAACGACGGCCAGTTCCTCCAAACCAAAACCCTTC GTGGGTATGAAGATTCCGGTG UnivM13
7 TSRF157.1 270 CGACGACTCCTGGAGCCCGCGTTGTGTGAGAGTTACAATGC CAAGGCTGGTGGTATCAGATG L11 F
8 GSR3141 144 TTGACACCAGACCAACTGGTGGGATATACTCGATTAAGTAGAC AATAGTAGGGATTCAGATTCAC Lambda11RV
9 SSR07B09 203 CGACGACTCCTGGAGCCCGTTTAGCACGTGTTTGTTCTG CCGTTGGATTATCAGATGGG L11 F
9 TSRF169.1 287 GTTGTAAAACGACGGCCAGTCGTGTAACAGCGAGTTCATTG AGATTAAAAATGGGCGTTGCG UnivM13
a
Each marker is provided for genetic analysis with fluorescent dye. The nucleotide sequences of the universal primers are underlined.

2
M. Kawano et al.
Table 3
Universal primers individually labeled with different fluorescent dyes.
Dye Name Nucleotide sequence(5′ -3′ )
6-FAM UnivM13 GTTGTAAAACGACGGCCAGT
NED SP6 GATTTAGGTGACACTATAG
VIC L11 F CGACGACTCCTGGAGCCCG
PET Lambda11RV TTGACACCAGACCAACTGGT
2.2. Crossing and selfing for producing progenies
BP and the BX1-DH (referred to as DH thereafter) were used for
selfing and reciprocal crosses. Bud pollination was performed using the
method of Yamashita(1978). In selfing of both BP and DH, the flowers
3–5 days before anthesis were pollinated immediately after emascula­
tion and covered with paraffin paper bags because BP is
self-incompatible and needs bud pollination for obtaining selfed-seeds.
The reciprocal crosses between BP and DH were conducted as
described by Yahata et al. (2005a) using 10 flowers for each cross
direction.
2.3. Seeding and aseptic culture of seeds
Fruits were harvested at maturity and the seeds were extracted from
each fruit and classified into two categories, namely normally developed
seeds and undeveloped (empty) seeds. To investigate the quality of seeds
in DH selfing, BP selfing and DH x BP were used as controls, and then the
numbers and weight of seeds were examined. The seeds obtained from
BP selfing and those from BP x DH were surface-dried and weighed, and
their seed coats were removed. Then they were placed on double layers
of moistened filter paper and kept at 25 ◦ C for seven days. After
germination, the seedlings were transplanted into vermiculite in boxes
and transferred to a greenhouse at the Kibana Agriculture Science Sta­
tion of the University of Miyazaki, Japan.
The seeds obtained from DH x BP and those from DH selfing were
aseptically cultured on 1/2 Murashige and Skoog medium (1962) con­
taining 30 g⋅L− 1 sucrose and 3 g⋅L− 1 gellan gum without removing the
seed coats. These cultures were kept at 25 ◦ C under continuous illumi­
nation (38 μmol m− 2⋅s− 1) with cool white fluorescent lamps.
2.4. Flow cytometry
To confirm the ploidy level of the progenies obtained from BP selfing,
BP x DH, DH x BP, and DH selfing, flow cytometry analysis was con­
ducted for 30 plantlets each. Tissue segments were collected from the
developing leaves of a plantlet, chopped with a razor blade in 200 μl of
nuclei extraction buffer (Sysmex Cystain UV PreciseP) to isolate intact
nuclei, and incubated for 30 s. Crude samples were filtered through a
20 μm Trics filter (Partec, Germany) and stained with 800 μl of staining
buffer (Sysmex Cystain UV PreciseP). The relative fluorescence of total
DNA was measured for each nucleus using flow cytometry (CyFlow
Ploidy Analyzer; Sysmex Partec). To calculate the relative nuclear DNA
content of the obtained seedlings, tahiti lime (C. latifolia) (2n = 3x = 27)
Table 4
Fruiting rate and seed contents in ‘Banpeiyu’ pummelo selfing, ‘Banpeiyu’ pummelo x DH, DH x ‘Banpeiyu’ pummelo and DH selfing
Plant materials Fruiting rate (%)
Developed seeds
‘Banpeiyu’ pummelo selfing 80.0 48.8a
‘Banpeiyu’ pummelo x DH 30.0 – –
DH x ‘Banpeiyu’ pummelo 40.0 48.7a
DH selfing 30.0 18.2b
Mean separation by Tukey’s multiple range test. P<0.05.
3
Scientia Horticulturae 277 (2021) 109782
was used as an internal standard (Ollitraut et al., 1994).
2.5. DNA extraction
Genomic DNAs were extracted from 0.1 g lyophilized young leaves of
greenhouse-grown plants of BP, five haploid BP strains (BX1- BX5) and
DH, for SSR analysis to clarify the gynogenetic origin of the haploids
using the Qiagen DNeasy Plant Mini Kit according to the protocol sup­
plied by the manufacturer. Genomic DNAs were also extracted for SSR
analysis from 0.1 g lyophilized young leaves from 40 day-old progenies
in vitro obtained from BP selfing, BP x DH, DH x BP, and DH selfing
(Table 1) to confirm the segregation of alleles in the progenies using the
same protocol.
2.6. Multiplexed genotyping analysis using SSR markers
Multiplexed genotyping analysis was performed using the modified
method of Honsho et al.(2012). Polymerase chain reaction (PCR)
amplification was conducted using 32 SSR primer sets selected to cover
all the 9 linkage groups (LG) (Shimizu et al., 2016) (Table 2) for
exhibiting the heterozygosity in BP. For all primer pairs, the M13-tailed
PCR method (Schuelke, 2000) was used for fluorescent dye labeling
(Table 3). The original forward primer sequence was redesigned by
adding a universal tail sequence to the 5′ end. Multiplex PCR reactions
for prelabeled primers with the fluorescent dye 6-FAM, VIC, NED, or PET
at their 5′ end were performed using a Type-it Microsatellite PCR Kit
(Qiagen, Valencia, USA) in a total volume of 10 μL reaction mixture
containing 1x Type-it Multiplex PCR Master Mix attached to the kit, 2 μL
of genomic DNA, 0.05 μM of the primers added with the universal
primer sequences, and 0.2 μM of the remaining primers. The PCR cycling
profile was 5 min at 95 ◦ C followed by 18 cycles of 30 s at 95 ◦ C, 90 s at
57 ◦ C, and 30 s at 72 ◦ C. The annealing temperature was then reduced to
53 ◦ C with a 2 ◦ C decrement followed by further eight cycles of 30 s at
95 ◦ C, 90 s at 53 ◦ C, and 30 s at 72 ◦ C followed by a final elongation step
for 30 min at 60 ◦ C. The PCR products were diluted tenfold using sterile
water. For SSR genotyping, 2 μL of diluted PCR products were added to
9.25 μL Hi-Di™ formamide (Thermo Fisher Scientific, Foster City, USA)
and 0.25 μL GeneScanTM-600 LIZ® Size Standard v2.0 (Applied Bio­
systems). The mixture was then denatured for 3 min at 95 ◦ C and run on
the Applied Biosystems 3500xL genetic analyzer (Applied Biosystems).
Genotypes were determined using the program GeneMapper® v.4.0
(Applied Biosystems).
2.7. Genetic structure in haploid plants
To show the genetic variations among haploid plants, each SSR ge­
notype was used to generate a principal coordinate analysis based on the
covariance matrix with data standardization as implemented in the
program GenAlEx6.5 (Peakall and Smouse, 2012).
2.8. Statistical analysis
At each of the 32 SSR loci, Chi square values (χ2) and probability
levels at p = 0.05 and p = 0.01 were calculated using BellCurve for
No. of seeds per fruit
Weight of developed seeds (g)
Undeveloped seeds Total seeds
98.0a 146.8a 0.44a
– –
51b 99.7b 0.21b
26.6b 44.8c 0.16c
M. Kawano et al. Scientia Horticulturae 277 (2021) 109782

Fig. 1. Plant materials. (A) Morphology of fruits obtained from the ‘Banpeiyu’ pummelo selfing, DH x ‘Banpeiyu’ pummelo and DH selfing. (Bar =10 cm). (B)
Developed and undeveloped seeds obtained from ‘Banpeiyu’ pummelo selfing, DH x ‘Banpeiyu’ pummelo and DH selfing. (Bar =1 cm). (C) Seedlings of ‘Banpeiyu’
pummelo selfing after 2 years of seeding (Bar =10 cm). (D) Seedlings of ‘Banpeiyu’ pummelo x DH after 2 years of seeding (Bar =10 cm). (E) Seedlings of DH x
‘Banpeiyu’ pummelo after half a year of seeding (Bar =10 cm). (F) Seedling of DH selfing after 40 days of culture (Bar =1 cm).

Excel (Social Survey Research Information, Tokyo, Japan). The allele respectively.
frequency (F) for each locus was calculated according to Mather (1957)
using the following formula for BP selfing, BP x DH and DH x BP 3. Results
populations:
3.1. Number and weight of seeds obtained by the crosses
Fa,b = (A, B) / n

In addition to the following formula for the BP selfing population:
Fh = 1 – (Fa + Fb)
Where (Fa,b) is the estimate of the allele frequency of either A or B allele,
(A, B) is the number of A or B alleles at one locus, H is the heterozygous
portion at one locus of diploid, Fh is the estimate of the allele frequency
for heterozygosity, and (n) represents the size of the population for each
locus, respectively.
Segregation analysis was performed using Microsoft Excel functions.
In the progenies of BP selfing, BP x DH, and DH x BP. 32 SSR loci were
tested by (χ2) analysis against expected 1:2:1, 1:1, and 1:1 ratios,
The fruiting rates in BP selfing, BP x DH, DH x BP, and DH selfing
were 80.0, 30.0, 40.0, and 30.0 %, respectively (Table 4). In BP selfing,
DH x BP, and DH selfing, the average numbers of developed seeds per
fruit were 48.8, 48.7, and 18.2, respectively, whereas those of unde­
veloped seeds per fruit were 98.0, 51.0, and 26.6, respectively (Table 4).
Thus, DH selfing showed significantly fewer production of both devel­
oped and undeveloped seeds as compared to BP selfing and DH x BP
(Fig. 1A and B).
The weights of the developed seeds differed depending on the cross
combinations (Fig. 2). The highest weight of seeds was obtained in BP
selfing, followed by DH x BP and DH selfing. The seed weight for the DH
selfing ranged from 0.10 g to 0.22 g, with an average of 0.16 g, was

4
M. Kawano et al.
Fig. 2. Comparison of the weights of developed seeds in DH selfing, DH x ‘Banpeiyu’ pummelo and ‘Banpeiyu’ pummelo selfing.
a
Percentage of developed seeds (%) = the number of developed seeds / the number of all seeds (= developed and undeveloped seeds).
significantly lighter than that for BP selfing. Seedlings obtained from BP
selfing (Fig. 1C) and BP x DH (Fig. 1D) grew normally. In contrast,
seedlings of DH x BP were weak, and only several seedlings survived
(Fig. 1E). In vitro cultured developed seeds obtained from DH selfing
germinated normally and mostly developed leaves after 40 days of
culture (Fig. 1F). However, after acclimatization, 27 of the 30 DH x BP
progenies and all of 30 DH selfed-progenies died.
3.2. Ploidy level of seedlings
Flow cytometric analysis revealed that all of the progenies obtained
from BP selfing, BP x DH, DH selfing, and DH x BP progenies were
diploid (Fig. 3A–D), except for one plant obtained from DH x BP which
was tetraploid (Fig. 3E). The tetraploid plantlet was removed from the
DH x BP population for the analysis of the segregation ratio.
3.3. Genetic analysis of haploids, DH, and DH selfed-progenies
Genotypes of the five haploid plants of BP (BX1- BX5) and the DH
were compared with BP at 32 SSR loci. As the results, all haploid plants
exhibited one of the BP alleles at all 32 SSR loci (Table 5), demonstrating
clearly that all haploid plants were obtained from female gametes of BP
by gynogenesis. In most of the SSR loci, haploid plants randomly
possessed either of the two alleles of BP. However, in the SSR08B82.1,
TSRP06.2, and CiBE0447 markers on LG6, all haploid plants posessed
the same alleles as shown in Table 5. The principal coordinate analysis
were performed based on the SSR genotypes to identify the genetic
similarity among haploid plants and revealed that BX2 and BX3 are
relatively similar (Fig. 4).
The DH exhibited the exact same SSR alleles as the BX1. Further­
more, in the analysis of variations of the DH selfed-progenies, a total of
30 seedlings showed exactly the same SSR alleles as the DH (Tables 5, 6).
3.4. Segregation of markers
Thirty-one of the 32 segregating loci in the BP selfed-progenies
(Fig. 1C) were fitted to the expected ratio (a:b:h = 1:1:2, P > 0.05);
namely, the chi-square values showed excellent matches with the hy­
pothesized ratios for 97 % of the markers analyzed (Table 6). On the
other hand, remaining one marker, TSRF157.1 on LG7 showed a dis­
torted segregation ratio (a:b:h = 5:14:11, P = 0.023 < 0.05).
Of the 32 SSR loci analyzed in the BP x DH progenies (Fig. 1E), 27
5
Scientia Horticulturae 277 (2021) 109782
loci fitted the 1:1 segregation ratio expected for Mendelian segregation.
However, 5 loci (15.6 %) showed significant skewness in segregation at
P = 0.05, with markers GRW3011 on LG3 (a:h = 8:22, P = 0.011 <
0.05), NSX145 on LG4 (a:h = 9:21, P = 0.028 < 0.05), GSR3114 on LG7
(a:h = 21:9, P = 0.028 < 0.05), GSR6101 on LG7 (a:h = 21:9, P = 0.028
< 0.05), and NSX153 on LG7 (a:h = 21:9, P = 0.028 < 0.05) (Table 6).
Of the 32 SSR loci analyzed in the DH x BP progenies (Fig. 1F), 29 loci
fitted a 1:1 ratio and 3 loci (9.4 %) showed significant skewness in
segregation at P = 0.05. Distorted segregation ratios were found for the
NSX79 marker on LG5 (a:h = 8:22, P = 0.011 < 0.05), the CX0004
marker on LG5 (a:h = 22:8, P = 0.011 < 0.05), and the SSR08B29.2
marker on LG6 (a:h = 22:8, P = 0.011 < 0.05) (Table 6).
4. Discussion
SSR have been the most widely used DNA marker for identifying
gynogenetic origin (Malik et al., 2011; Anandhan et al., 2014; Dong
et al., 2016). In the present study, five individual haploid plants
generated from small seeds and undeveloped seeds of BP were analyzed
using 32 SSR markers for genetic analysis and to evaluate the genetic
relationships between and within the five plants. As the results, it was
demonstrated that five haploid plants were derived from female gam­
etes. Furthermore, the progenies of BP selfing, BP x DH, and DH x BP
were genetically analyzed with SSR markers for their segregation, and
most of the 32 segregating loci were fitted to the expected ratio. To the
best of our knowledge, this is the first example in which self and back
cross progenies of DH in fruit crops were genetically analyzed using SSR
markers.
In the present study, the fruits and developed seeds obtained from
DH selfing were significantly smaller than BP fruits and seeds (Fig. 1A
and B) although Yahata et al. (2015) showed that this DH had similar
morphological characteristics to those of the BP. In the previous study,
Yahata and Kunitake (2018) reported that the DH had a significantly
reduced number of ovules per ovary, approximately half, compared with
the BP. In addition, the pollen fertility of the DH (84.1 % stainability and
32.9 % pollen germination rate) was significantly lower than that of the
BP (97.7 % and 88.2 %) (Yahata et al., 2015). Therefore, these reduced
function of reproductive organ in DH might be the reasons for the
significantly smaller numbers of both developed seeds and undeveloped
seeds in the DH selfed-progenies obtained in this study compared to
those numbers in the BP selfing. Similar results were previously reported
by Yahata et al. (2015), in which the developed seed weight of the DH at
M. Kawano et al. Scientia Horticulturae 277 (2021) 109782

Fig. 3. Flow cytometric analysis. (A) ‘Banpeiyu’ pummelo selfing seedling (2n = 2x = 18). (B) ‘Banpeiyu’.
pummelo x DH seedling (2n = 2x = 18). (C) DH selfing seedling (2n = 2x = 18). (D) DH x ‘Banpeiyu’ pummelo seedling (2n = 2x = 18). (E) DH x ‘Banpeiyu’ pummelo
seedling (2n = 4x = 36).
a
3C indicated the G0G1 peak corresponding to triploidy of Tahiti lime (Ollitrault et al., 1994).

0.14 g was significantly lighter than that of the BP at 0.37 g. Moreover,
weakness of the DH selfed-seedlings might be due to the accumulation of
homologous recessive traits which acted as obstacles for the early
growth of the seedlings.
The haploid plants BX1-BX5 randomly had either of the two alleles of
BP (Table 5), indicating that the origin of all haploid pummelos was a
female gamete of BP. However, among the seven markers (SSR08B32.1,
SSR08B27.2, SSR08B29.2, SSR08B82.1, TSRP06.2, CiBE0447 and
GSR6129), which amplify the loci on LG6, three markers (SSR08B82.1,
TSRP06.2 and CiBE0447) amplified each only the same allele
(SSR08B82.1; 161, TSRP06.2; 204, CiBE0447. 306) in all the 5 haploid
plants. On the other hand, other 4 markers amplified different alleles
depending on the haploid plants. Based on these results, it can be
postulated that parthenogenesis-related genes are closely linked and
exist near the three markers on LG6, and that only the female gametes
with these allele combinations could induce parthenogenesis leading to
the regeneration of haploid plants. It has been revealed that spontaneous
development of embryo and endosperm is suppressed by several genes
such as METHYLTRANSFERASE1 (MET1), which has a function to
maintain methylation and is downregulated as the result of interaction
with RETINOBLASTOMA RELATED1(RBR1) and MULTICOPY SUP­
PRESSOR OF IRA1 (MSI1) (Vijverberg et al., 2019). According to Curtis

6
M. Kawano et al. Scientia Horticulturae 277 (2021) 109782

Table 5
Genetic analysis of `Banpeiyu’ pummelo, DH and haploids (BX1-BX5) using thirty-two SSR markers, assignments to linkage groups.
SSR genotype
No SSR marker Linkage group
`Banpeiyu’ DH BX1 BX2 BX3 BX4 BX5

1 CUBER939 LG1 207/215 215 215 207 207 207 207

2 F21 LG1 144/149 144 144 149 149 149 149
3 TSRA103 LG1 170/174 170 170 170 174 170 174
4 NSX186 LG2 213/222 222 222 222 213 213 213
5 TSRP07 LG2 154/181 181 181 154 181 154 154
6 SSR08B40 LG2 166/170 166 166 170 166 170 166
7 NSX23 LG3 250/256 256 256 256 256 256 250
8 CX2040 LG3 93/99 99 99 93 99 93 93
9 GRW3011 LG3 90/93 93 93 93 93 90 93
10 NSX32 LG3 235/243 243 243 243 243 235 235
11 GSR3121 LG4 146/152 152 152 152 146 152 152
12 TSRB11.2 LG4 222/225 222 222 222 225 222 222
13 NSX145 LG4 121/131 131 131 131 121 131 131
14 TSRA108 LG4 179/182 182 182 182 179 182 179
15 CX0004 LG5 259/271 259 259 271 271 271 271
16 NSX79 LG5 210/215 215 215 215 215 210 215
17 SSR08A16.2 LG5 134/140 134 134 134 134 140 134
18 GSR6129 LG6 221/227 227 227 221 221 221 221
19 SSR08B32.1 LG6 92/96 96 96 92 92 92 96
20 SSR08B27.2 LG6 93/96 96 96 93 93 93 96
21 SSR08B29.2 LG6 156/159 156 156 159 159 159 156
22 CiBE0447 LG6 303/306 306 306 306 306 306 306
23 SSR08B82.1 LG6 161/176 161 161 161 161 161 161
24 TSRP06.2 LG6 201/204 204 204 204 204 204 204
25 TSRF208.1 LG7 206/211 206 206 211 211 211 211
26 TSRF157.1 LG7 285/288 285 285 288 285 285 288
27 GSR3114 LG7 144/174 144 144 147 144 144 174
28 GSR6101 LG7 237/246 246 246 237 246 246 237
29 NSX153 LG7 137/140 137 137 140 137 137 137
30 GSR3141 LG8 95/127 95 95 95 127 127 95
31 SSR07B09 LG9 204/205 204 204 205 204 205 205
32 TSRF169.1 LG9 297/300 297 297 300 297 300 300
a
Numbers indicate the size in nucleotids (nt) of the two alleles for each SSR marker.
b
SSR markers which indicated all haploid plants to possess the same alleles are shown in boldface.

Fig. 4. Principal coordinates analysis (PCoordA) of the five haploid plants of ‘Banpeiyu’ pummelo (BX1-BX5).
Data are shown in the coordinate plane of the first principal coordinates (Coord 1 and Coord 2).

and Grossniklaus (2008), spontaneous production of haploid embryos
are originated from egg cells in MSI1 mutant (msi1) of Arabidopsis,
suggesting that egg cell has the potential for parthenogenesis in the
mutants of these genes. Therefore, it is possible that such mechanism is
also involved in the parthenogenesis of pummelo species, and that the
haploid production of pummelo can be caused by a mutation in any of
the genes postulated to locate on LG6 as mentioned above.
The principal coordinate analysis for identifying the genetic simi­
larity among the 5 independent haploid plants revealed that they were
genetically quite different each other but that BX2 and BX3 were
relatively similar (Fig. 4). Shimizu et al. (2014) reported that pummelo
varieties including ‘Banpeiyu’ pummelo showed particularly high ho­
mozygosity among citrus varieties based on the analysis using 598 SNP
markers. The heterozygosity was 0.02178 for ‘Banpeiyu’ pummelo,
while it was 0.71572 for sweet orange (C. sinensis) and 0.50502 for
hassaku (C. hassaku) respectively. Thus, although some variations were
observed in these haploids according to the principal component anal­
ysis, it may be difficult to produce haploids with large genetic diversity
in the pummelo because of its low heterozygousity nature.
In the SSR analysis of the 3 kind of progeny groups obtained from BP

7
M. Kawano et al. Scientia Horticulturae 277 (2021) 109782

Table 6
Thirty-two SSR primers revealing polymorphic fragments in ‘Banpeiyu’ pummelo self,‘Banpeiyu’ pummelo x DH, DH x ‘Banpeiyu’ pummelo, DH self progenies, as­
signments to linkage groups, Chi-square (χ2) values andalleles frequencies.
No SSR marker Linkage group `Banpeiyu’ self population (1:1:2 `Banpeiyu’ x DH population (1:1 DH x `Banpeiyu’ population (1:1 DH self polulation
expected ratio) expected ratio) expected ratio)

Fa Fb Fh χ2 Fa Fh χ2 Fa Fh χ2 Fa

1 CUBER939 1 0.24 0.34 0.41 1.47 0.37 0.63 2.13 0.60 0.37 1.69 1.00
2 F21 1 0.23 0.30 0.47 0.40 0.37 0.63 2.13 0.50 0.47 0.03 1.00
3 TSRA103 1 0.20 0.30 0.50 0.60 0.37 0.63 2.13 0.40 0.57 0.86 1.00
4 NSX186 2 0.20 0.30 0.50 0.60 0.53 0.47 0.13 0.43 0.53 0.31 1.00
5 TSRP07 2 0.23 0.17 0.60 1.47 0.53 0.47 0.13 0.33 0.63 2.79 1.00
6 SSR08B40 2 0.23 0.13 0.63 2.73 0.47 0.53 0.13 0.33 0.63 2.79 1.00
7 NSX23 3 0.27 0.13 0.60 2.27 0.47 0.53 0.13 0.43 0.53 0.31 1.00
8 CX2040 3 0.20 0.20 0.60 1.20 0.43 0.57 0.53 0.53 0.43 0.31 1.00
9 GRW3011 3 0.20 0.23 0.57 0.60 0.27 0.73 6.53* 0.53 0.43 0.31 1.00
10 NSX32 3 0.27 0.17 0.57 1.13 0.43 0.57 0.53 0.57 0.40 0.86 1.00
11 GSR3121 4 0.27 0.13 0.60 2.27 0.67 0.33 3.33 0.40 0.57 0.86 1.00
12 TSRB11.2 4 0.27 0.17 0.57 1.13 0.67 0.33 3.33 0.40 0.57 0.86 1.00
13 NSX145 4 0.27 0.17 0.57 1.13 0.30 0.70 4.80* 0.53 0.43 0.31 1.00
14 TSRA108 4 0.30 0.20 0.50 0.60 0.63 0.37 2.13 0.37 0.60 1.69 1.00
15 CX0004 5 0.30 0.13 0.57 2.20 0.47 0.53 0.13 0.70 0.27 5.83* 1.00
16 NSX79 5 0.13 0.37 0.50 3.27 0.57 0.43 0.53 0.27 0.70 5.83* 1.00
17 SSR08A16.2 5 0.17 0.33 0.50 1.67 0.60 0.40 1.20 0.47 0.50 0.03 1.00
18 GSR6129 6 0.33 0.23 0.50 0.87 0.47 0.53 0.13 0.47 0.47 0.03 1.00
19 SSR08B32.1 6 0.27 0.37 0.37 2.73 0.43 0.57 0.53 0.50 0.47 0.03 1.00
20 SSR08B27.2 6 0.27 0.37 0.37 2.73 0.43 0.57 0.53 0.50 0.47 0.03 1.00
21 SSR08B29.2 6 0.23 0.30 0.47 0.40 0.40 0.60 1.20 0.73 0.23 7.76* 1.00
22 CiBE0447 6 0.20 0.27 0.53 0.40 0.53 0.47 0.13 0.47 0.50 0.03 1.00
23 SSR08B82.1 6 0.20 0.30 0.57 0.87 0.53 0.47 0.13 0.47 0.50 0.03 1.00
24 TSRP06.2 6 0.23 0.33 0.43 1.13 0.53 0.47 0.13 0.47 0.50 0.03 1.00
25 TSRF208.1 7 0.20 0.40 0.40 3.60 0.50 0.50 0.00 0.33 0.63 2.79 1.00
26 TSRF157.1 7 0.17 0.47 0.37 7.53* 0.33 0.67 3.33 0.57 0.40 0.86 1.00
27 GSR3114 7 0.20 0.43 0.37 5.40 0.70 0.30 4.80* 0.57 0.40 0.86 1.00
28 GSR6101 7 0.17 0.43 0.40 5.47 0.70 0.30 4.80* 0.57 0.40 0.86 1.00
29 NSX153 7 0.17 0.40 0.43 3.80 0.70 0.30 4.80* 0.57 0.40 0.86 1.00
30 GSR3141 8 0.37 0.13 0.50 3.27 0.67 0.33 3.33 0.47 0.50 0.03 1.00
31 SSR07B09 9 0.33 0.17 0.50 1.67 0.50 0.50 0.00 0.37 0.60 1.69 1.00
32 TSRF169.1 9 0.37 0.17 0.47 2.53 0.53 0.47 0.13 0.40 0.57 0.86 1.00

* Significantly deviated at 0.05 (χ2 (t) = 5.99 for‘Banpeiyu’pummelo selfing progenies, and 3.84 for‘Banpeiyu’pummelo x DH and DH x‘Banpeiyu’pummelo prog­
enies)
** Significantly deviated at 0.01 (χ2(t) = 9.21 for ‘Banpeiyu’ pummelo selfing progenies, and 6.64 for ‘Banpeiyu’ pummelo x DH and DH x ‘Banpeiyu’ pummelo
progenies). (Fa) frequency of A allele, (Fb) frequency of B allele, (Fh) Frequency of heterozygotes.
(Fa) frequency of A allele, (Fb) frequency of B allele, (Fh) Frequency of heterozygotes.

selfing, BP x DH, and DH x BP, segregation ratios of the 32 loci mostly
fitted to the expected ratios although distorted segregation with a P
value less than 0.05 was observed in the reciprocal crosses between BP
and DH (Table 6). Especially in the progeny of BP x DH, five markers had
a P value of less than 0.05 and 3 of them GSR3114, GSR6101, and
NSX153 were in LG7, suggesting a possibility that genotype segregation
was distorted among the markers of specific LGs. However, no such
distortion was observed in the reverse cross. Therefore, such distorted
segregation ratios may have been caused due to the small number of
progenies examined. In the present study, although the numbers of in­
dividuals and primers used were still small, segregation distortion in the
BP inbred population was much lower than those of BP x DH and DH x
BP populations. However, CiBE0447, SSR08B82.1 and TSRP06.2
markers showed distorted segregation in the 5 haploids obtained
through parthenogenesis whereas these three markers were normally
segregated in the inbred or cross progeny that developed through
fertilization. Since abnormal segregation was confirmed only in the
haploids, it seems that parthenogenesis-related genes may commonly
exist in these haploids and be linked near three markers on LG6.
To our knowledge, this is the first report on the production and ge­
netic analysis of progeny obtained from DH selfing in Citrus. As a result,
it was proved that DH selfed-progenies can maintain exactly the same
alleles as their parent. In addition, we obtained progenies by reciprocal
crosses between DH and BP. These DH-selfed and crossed populations
would be important genetic resources for selecting vatiable DNA
markers for citrus breeding. In three markers on LG6 were normally
segregated in the inbred or cross progeny that developed through
fertilization whereas showed distorted segregation in the 5 haploids
obtained through parthenogenesis. From this result, it is considered that
parthenogenesis-regulated genes may be linked near LG6, in which
confirmed the distorted segregation was confirmed in the haploid. In the
future, it will be necessary to increase the number of SSR markers and
haploid plants to obtain new knowledge about useful traits for breeding.
CRediT author statement
Miki Kawano: Writing original draft preparation, creation and/or
presentation of the published work, specifically writing the initial draft,
conducting a research and investigation process, specifically performing
the experiments
Masaki Yahata: Performing the experimnts
Tokurou Shimizu: Provision of study material
Chitose Honsho: Provision of study material
Tomonari Hirano: Oversight and leadership responsibility for the
research activity planning and execution, including mentorship external
to the core team
Hisato Kunitake: Management and coordination responsibility for
the research activity planning and execution, Acquisition of the financial
support for the project leading to this publication
Funding information
This research was supported by a Grant-in-Aid for Scientific Research
(KAKENHI, No. 16K07599) from the Japan Society for the Promotion of

8
M. Kawano et al. Scientia Horticulturae 277 (2021) 109782

Science (JSPS). recovery of haploid plantlets. Turk. J. Biol. 41, 469–483. https://doi.org/10.3906/
biy-1606-28.
Malik, A.A., Cui, L., Zhang, S.X., Chen, J.F., 2011. Efficiency of SSR makers for
determining the origin of melon plantlets derived through unfertilized ovary culture.
Declaration of Competing Interest
Hort. Sci. 38, 27–34. https://doi.org/10.17221/47/2010-HORTSCI.
Mather, K., 1957. The Measurement of Linkage in Heredity. John Wiley & Sons, New
The authors declare that they have no known competing financial York.
interests or personal relationships that could have appeared to influence Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bio assays with
tobacco tissue cultures. Physiol. Plant. 15, 473–497.
the work reported in this paper. Oiyama, I., Kobayashi, S., 1993. Haploids obtained from diploid x triploid cross of Citrus.
J. Jpn. Soc. Hort. Sci. 62, 89–93. https://doi.org/10.2503/jjshs.62.89.
Ollitraut, P., Dambier, D., Luro, F., Duperray, C., 1994. Nuclear genome size variations in
Acknowledgements
Cirus. Fruits 49, 390–393.
Peakall, R., Smouse, P.E., 2012. GenAlEx 6.5: genetic analysis in Excel. Population
The authors are grateful to Dr. Masahiro Mii of Center for Environ­ genetic software for teaching and research—an update. Bioinformatics 28,
2537–2539.
ment, Health and Field Science, Chiba University, for his advice and
Ramadugu, C., Keremane, M.L., Hu, X., Karp, D., Federici, C.T., Kahn, T., Roose, M.L.,
critical reading of this manuscript. This research was supported by Lee, R.F., 2015. Genetic analysis of citron (Citrus medica L.) using simple
Grant-in-Aid (no. 14560025) from the Ministry of Education, Science, sequencerepeats and single nucleotide polymorphisms. Sci. Hort. 195, 124–137.
Sports and Culture of Japan. https://doi.org/10.1016/j.scienta.2015.09.004.
Ruiz, C., Breto, M.P., Asíns, M.J., 2000. A quick methodology to identify sexual seedlings
in citrus breeding programs using SSR markers. Euphytica 112, 89–94. https://doi.
References org/10.1023/A:1003992719598.
Schuelke, M., 2000. An economic method for the fluorescent labeling of PCR fragments.
Nat. Biotechnol. 18, 233–234. https://doi.org/10.1038/72708.
Ahmed, S., Rattanpal, H.S., Kumari, P., Singh, J., 2017. Study of genetic variability in
Shimizu, T., Kaminuma, E., Nonaka, K., Yoshioka, T., Goto, S., Matsumoto, T.,
Citrus fruit crop by molecular markers - a review. Int. J. Pure App. Biosci. 5,
Katayose, Y., Mochizuki, T., Tanizawa, Y., Toyoda, A., Fujiyama, A., Nakamura, Y.,
111–128. https://doi.org/10.18782/2320-7051.2480.
2014. A genomic approach to selecting robust and versatile SNP sets from next-
Akgol, M., Simsek, O., Donmez, D., Kacar, Y.A., 2017. An overview of in vitro haploid
generation sequencing data for genome-wide association study in citrus cultivars.
plant production in Citrus. Am. J. Plant Biol. 2, 19–23. https://doi.org/10.11648/j.
Acta Hort. 1135, 23–32. https://doi.org/10.17660/ActaHortic.2016.1135.4.
ajpb.s.2017020301.13.
Shimizu, T., Kitajima, A., Nonaka, K., Yoshioka, T., Ohta, S., Goto, S., 2016. Hybrid
Aleza, P., Juárez, J., Hernández, M., Pina, J.A., Ollitrault, P., Navarro, L., 2009. Recovery
origins of citrus varieties inferred from DNA marker analysis of nuclear and
and characterization of a Citrus clementina Hort. ex Tan.’ Clemenules’ haploid plant
organelle genomes. PLoS One 11, e0166969. https://doi.org/10.1371/journal.
selected to establish the reference whole Citrus genome sequence. BMC Plant Biol. 9,
pone.0166969.
110. https://doi.org/10.1186/1471-2229-9-110.
Toolapong, P., Komatsu, H., Iwamasa, M., 1996. Triploids and haploid progenies derived
Anandhan, S., Chavan, A.A., Gopal, J., Mote, S.R., Shelke, P.V., Lawande, K.E., 2014.
from small seeds of ‘Banpeiyu’ pummelo, crossed with ‘Ruby Red’ grapefruit.
Variation in gynogenic potential for haploid induction in Indian short-day onions.
J. Japan Soc. Hort. Sci. 65, 255–260. https://doi.org/10.2503/jjshs.65.255.
Indian J. Genet. 74, 526–528. https://doi.org/10.5958/0975-6906.2014.00883.9.
Vijverberg, K., Ozias-Akins, P., Schranz, M.E., 2019. Identifying and engineering genes
Chaikam, V., Molenaar, W., Melchinger, A.E., Boddupalli, P.M., 2019. Doubled haploid
for parthenogenesis in plants. Front. Plant Sci. 10, 128. https://doi.org/10.3389/
technology for line development in maize: technical advances and prospects. Theor.
fpls.2019.00128.
Appl. Genet. https://doi.org/10.1007/s00122-019-03433-x.
Wang, S.M., Lan, H., Cao, H.B., Xu, Q., Chen, C.L., Deng, X.X., Guo, W.W., 2015.
Cimò, G., Casamento, D., Marinoni, D., Botta, R., Germanà, M.A., 2016. Gametic
Recovery and characterization of homozygous lines from two sweet orange cultivars
embryogenesis through isolated microspore culture in mandarin (Citrus reticulata
via anther culture. Plant Cell Tissue Organ Cult. 123, 633–644.
Blanco), Mandarino Tardivo Di Ciaculli: effect of meta-Topolin and temperature
Wang, S.M., Lan, H., Jia, H.H., Xie, K.D., Wu, X.M., Chen, C.L., Guo, W.W., 2016.
treatments. Citrus R&T 37, 113–122. https://doi.org/10.4322/crt.ICC034.
Induction of parthenogenetic haploid plants using gamma irradiated pollens in
Curtis, M.D., Grossniklaus, U., 2008. Molecular control of autonomous embryo and
‘Hirado Buntan’ pummelo (Citrus grandis [L.] Osbeck). Sci. Hort. 207, 233–239.
endosperm development. Sex. Plant Reprod. 21, 79–88. https://doi.org/10.1007/
https://doi.org/10.1016/j.scienta.2016.05.028.
s00497-007-0061-9.
Yahata, M., Kunitake, H., 2018. Flowering and fruiting haploid and doubled haploid
Das, A., Kumar, K., Tribhuvan, K.U., Das, S.S., Mishra, M., 2018. Development of haploid
pummelos. In: Sajid, M. (Ed.), Citrus-Health Benefits and Production Technology,
and double haploid in fruit crops - a review. Int. J. Curr. Microbiol. App. Sci. 7,
6th ed. IntechOpen, pp. 95–113. https://doi.org/10.5772/intechopen.79180.
2119–2132. https://doi.org/10.20546/ijcmas.2018.705.247.
Yahata, M., Kunitake, H., Yabuya, T., Yamashita, K., Kashihara, Y., Komatsu, H., 2005a.
Dong, Y.Q., Zhao, W.X., Li, X.H., Liu, X.C., Gao, N.N., Huang, J.H., Wang, W.Y., Xu, X.L.,
Production of a doubled haploid from a haploid pummelo using colchicine treatment
Tang, Z.H., 2016. Androgenesis, gynogenesis, and parthenogenesis haploids in
of axillary shoot buds. J. Am. Soc. Hortic. Sci. 130, 899–903. https://doi.org/
cucurbit species. Plant Cell Rep. 35, 1991–2019. https://doi.org/10.1007/s00299-
10.21273/JASHS.130.6.899.
016-2018-7.
Yahata, M., Kurogi, H., Kunitake, H., Nagano, K., Yabuya, T., Yamashita, K., Komatsu, H.,
Froelicher, Y., Bassene, J., Jedidi-Neji, E., Dambier, D., Morillon1, R., Bernardini, G.,
2005b. Evaluation of reproductive function in a haploid pummelo by crossing with
Costantino, G., Ollitrault, P., 2007. Induced parthenogenesis in mandarin for haploid
several diploid citrus cultivar. J. Japan Soc. Hort. Sci. 74, 281–288. https://doi.org/
production: induction procedures and genetic analysis of plantlets. Plant Cell Rep.
10.2503/jjshs.74.281.
26, 937–944. https://doi.org/10.1007/s00299-007-0314-y.
Yahata, M., Yasuda, K., Nagasawa, K., Harusaki, S., Komatsu, H., Kunitake, H., 2010.
Germanà, M.A., Chiancone, B., 2001. Gynogenetic haploids of Citrus after in vitro
Production of haploid plant of ‘Banpeiyu’ pummelo [Citrus maxima (Burm.) Merr.]
pollination with triploid pollen grains. Plant Cell Tissue Organ Cult. 66, 59–66.
by pollination with soft X-ray irradiated pollen. J. Japan Soc. Hort. Sci. 79, 239–245.
https://doi.org/10.1023/A:1010627310808.
https://doi.org/10.2503/jjshs1.79.239.
Germanà, M.A., Chiancone, B., 2003. Improvement of Citrus clementina Hort. ex Tan.
Yahata, M., Kunitake, H., Yasuda, K., Hirai, T., Yabuya, T., Yamashita, K., Komatsu, H.,
microspore-derived embryoid induction and regeneration. Plant Cell Rep. 22,
2011. Abnormality of gamete formation in a pummelo [Citrus maxima (Burm.)
181–187. https://doi.org/10.1007/s00299-003-0669-7.
Merr.] haploid. J. Japan Soc. Hort. Sci. 80, 14–18. https://doi.org/10.2503/
Hidaka, T., Yamada, Y., Shichijo, T., 1979. In vitro differentiation of haploidplants by
jjshs1.80.14.
anther culture in Poncirus trifoliata (L.) Raf. Jpn. J. Breed. 29, 248–254. https://doi.
Yahata, M., Nukaya, T., Sudo, M., Ohta, T., Yasuda, K., Inagaki, H., Mukai, H.,
org/10.1270/jsbbs1951.29.248.
Harada, H., Takagi, T., Komatsu, H., Kunitake, H., 2015. Morphological
Honsho, C., Inada, M., Yuji, K., Tojiki, M., Kurogi, S., Kanzaki, S., Tetsumura, T., 2012.
characteristics of a doubled haploid line from ‘Banpeiyu’ pummelo [Citrus maxima
Efficiency of hybrid formation by open-pollination of two cultivars in a closed plastic
(Burm.) Merr.] and its reproductive function. Hort. J. 84, 30–36. https://doi.org/
house and the effect of the male parent on fruit characteristics in mango. J. Japan
10.2503/hortj.MI-005.
Soc. Hort. Sci. 81, 27–34. https://doi.org/10.2503/jjshs1.81.27.
Yamashita, K., 1978. Studies on self-incompatibility of Hyuganatsu, Citrus tamurana hort
Khar, A., Islam, S., Kalia, P., Bhatia, R., Kumar, A., 2019. Present status of haploidy
Ex Tanaka I. Pollen behavior on stigmas and pollen tube growth in styles observed
research in onion (Allium cepa) – a review. Indian J. Agric. Sci. 89, 396–405.
under a scanning electron microscope and a fluorescent microscope. J. Japan. Soc.
Kundu, M., Dubey, A., Srivastav, M., Malik, S., 2017. Induction of haploid plants in citrus
Hort. Sci. 47, 188–194.
through gamma-irradiated pollen and ascertainment of ovule age for maximum