Science Discovery

DNA Vaccine as an Example

賴明德特聘教授
國立成功大學 副校長
醫學院生物化學研究所
Curiosity and Enthusiasm
are
the Basis of Research

Curiosity
 We are NOT talking about
“passion”
which is a feeling pushing you
forward despite all odds,
frequently for “a person”
 What shall I do research on?
• A graduate student should by no means
attach himself/herself to a department
doing work that has aroused his
enthusiasm , admiration, or respect; no
goodwill come of merely going whatever a
job offers irrespective the work in
progress.

• Advice to a young scientist. 1981 By P.B.

Medawar
 Curiosity
• Misincorporation
5’ TCGXCCGXTGG
AGCTGGCTACCTACTTCATTCAGCCTATAC
Problem Solving

Curiosity
Nucleic Acid Therapy

Ming-Derg Lai, Ph.D.

Distinguished Professor
College of Medicine
National Cheng Kung University
 Question Addressed
• Can we develop nucleic acid therapeutics
targeting the oncogene in vivo?

• My first nucleic acid therapy paper

• Shaw YT, Chang SH, Chiou ST, Chang WC, Lai MD.
• Partial reversion of transformed phenotype of B104
cancer cells by antisense nucleic acids.
• Cancer Lett. 1993 Apr 15;69(1):27-32.
 Biological Targets by Nucleic
Acid Therapy
• An overwhelming majority of all prospective targets,
greater than 80%, fall into the molecular limbo of targets
currently considered “ undruggable. ”
• It is worth noting that nucleic acid (NA) therapeutics such
as antisense oligonucleotides and siRNAs offer
considerable promise to access intractable targets by
interfering with the activity not of the proteins themselves,
but of the RNA encoding them. NA therapeutics have
proven quite challenging to develop, primarily because
they rarely show adequate levels of systemic
bioavailability, but efforts to overcome this hurdle are
both intensive and wide ranging.
 Nucleic Acid Therapy
• Direct: Silencing the oncogene with
shRNA or siRNA.
• Indirect: Inducing the immune response
against cancer cells.
Key events in the history of cancer
immunotherapy

BCG, Bacillus Calmette-Gue rin; IFN-, interferon alfa;

IL-2, interleukin-2.
 The 2018 Nobel Prize in Physiology or Medicine

jointly to

James P. Allison and Tasuku Honjo

CTLA-4 and PD-1

for their discovery of cancer therapy by inhibition of

negative immune regulation
 Immunotherapy: Immune checkpoint

• Antibodies blocking PD-1 and PD-L1 have

demonstrated durable responses in a number of
different advanced malignancies. The PD-1/PD-
L1 checkpoint is operative in peripheral tissues
and serves as a negative regulator of T-cells to
help control local inflammatory responses and
maintain self-tolerance. PD-1 is expressed on
activated T-cells, natural killer cells, and B-cells
[1]. Its two known ligands are PD-L1 (B7-H1)
and PD-L2 (B7-DC). PD-L1 is constitutively
expressed on a subset of macrophages.
• Curr Opin Pharmacol. 2015 Aug;23:32-8.
Personalized Vaccine

2 2 2 | N AT U R E | VO L 5 4 7 | 1 3 j ul y 2 0 1 7
mRNA Vaccines for Infectious Diseases

Front. Immunol., 27 March 2019

| https://doi.org/10.3389/fimmu.2019.00594
Cancer Vaccine /Gene Therapy

1998-2004

Immune?
Ex vivo Gene Therapy
 Bladder cancer
• The incidence rate for bladder cancer is
much higher in the back-foot-disease
endemic area.

• The recurrence rate for bladder cancer is

more than 70%, and will progress into
muscle-invasive stage in more than 30%
patients with standard chemotherapy and
surgery.
Oncogenes and tumor suppressor
genes in bladder cancer
• Overexpression of Neu/HER2 is observed
in more than 30% of bladder cancer, and
is associated with poor prognosis.

• Tumor suppressor gene p53 is also

frequently inactivated in bladder cancer.
 Animal Model
• Mice species : C3H/HeNCrj

• Tumor cell line : MBT-2 (mouse bladder tumor)

The MBT-2 cell was derived from a carcinogen

(FANFT) -induced bladder tumor in a C3H mouse.
 Aims
• Create the tumor vaccines secreting
various cytokines.
• The cytokines selected: IL-2, IL-4, and
GM-CSF.
  Tumor Vaccine

Retroviral vector containing MBT-2-IL-2

infection
cytokines cDNA MBT-2 MBT-2-IL-4
( hIL-2, mIL-4, mGM-CSF) MBT-2-GM-CSF

60 Gy γ-ray irradiated
Tumor vaccine

The titer for the transfectants:

MBT-2-IL-2: 50 units/106 cells
MBT-2-IL-4: 198 ng/106 cells
MBT-2-GM-CSF: 207 ng/106 cells
 Protocol for vaccination

2 x104 MBT-2 cells

Tumor formation
Day 7 14 21 at day 60
5 x105 tumor vaccines
 Efficacy of gene therapy with low tumor burden

Vaccine % tumor formation

Control 7/10 (70%)

MBT-2-IL-2 0/10(0%)
MBT-2-IL-4 2/10 (20%)
MBT-2-GM-CSF 4/10 (40%)

• Inject 2104 MBT-2 cell

• Tumor vaccine : Irradiated cytokine-secreting tumor cells
5105 cells
 Immune memory
• Three and eight months after the last
inoculation of tumor vaccine, the mice
were injected with 106 MBT-2 live tumor
cells, and no tumor formation was
observed.
Tumor vaccine is only effective at early
phase with large tumor formation
Enhance the effect of
tumor vaccine

DNA Vaccine?
Creativity is just connecting things

Steve Jobs
 Can DNA vaccine elicit immune
responses against cancer?
• Wolff JA et al. Direct gene transfer into mouse
muscle in vivo Science 1990 247: 1465–1468

• Davis HL et al. DNA-mediated immunization in

mice induces a potent MHC class I-restricted
cytotoxic T lymphocyte response to the hepatitis
B envelope protein Hum Gene Ther 1995 6:
1447–1456
 DNA vaccine

Advantages of
DNA vaccine:
(1) Cell-mediated
immunity
(2) Easy preparation
and storage
(3) Low costs
 Neu DNA vaccine
• Why is neu DNA vaccine?

• Overexpression of neu is frequently observed in

many types of cancer.

• DNA vaccine encoding neu may induce

immunity to reject neu-expressing tumor.

• Plasmid DNA CpG motif may act as

immunological adjuvant.
Protocol for DNA vaccine and tumor vaccine

1 x106 MBT-2 cells

Tumor formation
Day 2 9 16 at day 60
5 x105 tumor vaccines
with or without
neu DNA vaccine
  Efficacy of combination of MBT-2-IL-2 and
neu DNA vaccine

Vaccine % tumor formation

Control 84% (27/32)
MBT-2-IL-2 59% (13/22)
pSV-neu 100% (4/4)
MBT-2-IL-2 + pSV-neu 22% (4/18)
MBT-2-IL-2 + pSV-lacOZ 80% (8/10)

• Inject 1106 MBT-2 cell

• treatment at day 2, 9, 16
• Tumor vaccine : Irradiated IL-2-secreting MBT-2 cells
5105 cells
• DNA vaccine : 60 g
Immunohistochemical analysis
Anti-neu antibody
 Summary
• MBT-2-IL-2 tumor vaccine provides best
therapeutic efficacy.
• Neu DNA vaccine can further enhance the effect of
tumor vaccine. The increase of efficacy is
correlated with the increase of CD4+ lymphocytes
and anti-neu antibody.

• Induction of antitumor immunity with combination of

HER2/neu DNA vaccine and interleukin 2 gene-modified
tumor vaccine. Chen SA, Tsai MH, Wu FT, Hsiang A, Chen
YL, Lei HY, Tzai TS, Leung HW, Jin YT, Hsieh CL, Hwang
LH, Lai MD. Clin Cancer Res. 2000 Nov;6(11):4381-8
Can DNA vaccine alone provide
therapeutic effect?

• Whether the DNA vaccine encoding neu

can break the immunological tolerance
and inhibit the progression on established
tumor.
Strategy: Neu-cytokine fusion genes

N’-neu
Neu
Extracellular Intracellular
domain domain
N’-neu

pRc/CMV N’-neu-IL-2
N’-neu
IL-2

N’-neu-GM-CSF
GM-CSF
N’-neu-IL-4
IL-4
 Expression of N’-neu-cytokine in muscle
140

pg/100mg
120 109.7
100
80
60
40
20 0 0
0
saline pRc/CMV pRc/CMV N'-neu-IL-2

140
pg/100mg

120 102.5
100
80
60
40
20 0 0
0
saline pRc/CMV pRc/CMV N'-neu-IL-
4
pg/100mg

140
120
100 89.7
80
60
40
20 0 0
0
saline pRc/CM V pRc/CM V N'-ne u-
GM -CSF
 Treatment of established tumor
with neu-cytokine DNA vaccine
Tumor formation (25mm3)
MBT-2 at day 10

1x106 cells
At day 1

100 g DNA immunization at

day 10, 17, and 24
 Effect of DNA vaccination on subcutaneous
growth of MBT-2 tumor cells in C3H/HeN
4000

3500 saline

3000
pRc/CM V
Tumor volume(mm3)

2500
pRc/CM V-N'-neu-IL-4"

2000

pRc/CM V-N'-neu
1500

pRc/CM V-N'-neu-GM -CSF

1000

500 pRc/CM V-N'-neu-IL-2

0
5 10 15 20 23

Days after tumor

transplantation
 Kaplan-Meier analysis of survival rate
Control,(n=32)
100
N'-neu-IL-2,(n=22)**

N'-neu-GM-CSF,(n=20)**
80
Percent Survival

N'-neu,(n=32)*

60 N'-neu-IL-4,(n=21)

pRc/CMV,(n=16)

40

20

0
0 10 20 30 40 50 60 70 80 90 100

Days after post tumor transplantation

The efficacy of DNA vaccine is in the following order

N’-neu-IL-2 = N’-neu-GM-CSF > N’-neu >>
N’-neu-IL-4= CMV control vector = saline
 Infiltration of lymphocytes
Table 1. Infiltrating immune cells at tumor site

CD4+* CD8+*
Group (n) mean ± SD mean ± SD

Saline (3) 8±2 5±2

pRc/CMV (3) 12 ± 5 7±1
N’-neu (3) 38 ±15 23 ± 7
N’-neu-IL-2 (3) 65 ±10 74 ±20
N’-neu-IL-4 (3) 36 ±16 3 ±1
N’-neu-GM-CSF (3) 55 ± 8 44 ±10

*Cell count performed at x 400, 3 sample and 5 random chose filed/sample was
evaluated. Result are expressed as mean ± SD of positive cells on crystosection by
immunohistochemistry.
• Anti-neu antibody in the mouse serum

TCCSUP-N5 TCCSUP MBT-2

Commercial Ab 185kD

185kD
N’-neu-IL-2

185kD
N’-neu-IL-4

N’-neu-GM-CSF 185kD

N’-neu 185kD

Control mouse serum 185kD

The serum from the DNA vaccine group of mice detect 185neu in western blot
analysis .
 Anti-neu antibody titer
450
400
350 304.3
300
250
ug/ml

195.5
200
146.5 150
150
100
50
0 0
0
saline pRc/CMV N'-neu N'-neu-IL- N'-neu- N'-neu-IL-
4 GM-CSF 2

Mouse ELISA
 3500
A 3000
saline
Tumor Sizes ( mm3 )
2500
N'-neu(anti-CD8)
2000
N'-neu
1500
N'-neu(anti-CD4)
1000
500
0
7 10 13 16 19

B Days after MBT-2 challenge

100 Saline (n=23)

Percent Survival

N'-ne u(anti-CD8),(n=11)
80 N'-ne u(n=15)*

60 N'-ne u(anti-CD4)),(n=13)*

40

20

0
0 10 20 30 40 50 60 70 80

Days after MBT-2 challenge

 Conclusions I
• Plasmid DNA encoding extracellular
domain of HER2/neu can act as a
therapeutic DNA vaccine in our bladder
cancer animal model.

• The therapeutic effect is dependent on the

presence of CD8+ lymphocytes, but not on
the presence of CD4+ lymphocytes or anti-
neu antibodies.
 Conclusions II
• Fusion with IL-2 gene or depletion of CD4+
T lymphocytes can further enhance the
therapeutic efficacy of HER2/neu DNA
vaccine.
• Therapeutic HER2/Neu DNA vaccine inhibits mouse
tumor naturally overexpressing endogenous neu. Lin CC
(林季千）, Chou CW, Shiau AL, Tu CF, Ko TM （柯泰
名）, Chen YL, Yang BC, Tao MH, Lai MD. Mol Ther.
2004 Aug;10(2):290-301.
天資X環境X努力X運氣=成功

50
A Novel Cancer Therapy by Skin
Delivery of Indoleamine 2,3-
Dioxygenase siRNA
Ming-Derg Lai (賴明德), Ph.D.
Department of Biochemistry and Molecular Biology
College of Medicine
National Cheng Kung University
 Aim
• Production of broad-use anti-cancer
nucleic acid therapy.

Approach: Generation of anti-tumor

immunity by in vivo targeting skin dendritic
cells.

Target gene: Indoleamine 2,3-dioxygenase

appears to be an essential negative
immune regulator.
 Target gene: indoleamine 2,3-
dioxygenase (IDO)
L-tryptophan
• IDO also plays an
important role in immune
IDO escape in cancer. The
establishment of tolerance
L-kynuerine may be mediated through
either localized depletion of
tryptophan or accumulation
of toxic metabolites.
3-hydroxylanthralinic acid • Overexpression of IDO
was observed in many
types of tumors and/or
tumor draining lymph node.
Hypothesis: Delivery of IDO shRNA can
generate anti-tumor immunity in vivo
S.C. Tumor Implantation
Skin delivery of IDO siRNA
and tumor tolerance

IDO+
IDO+

Gene gun

CD8+
T cell

Induction of cytotoxic immune IDO-negative Dendritic cells

responses and tumor regression migrate to Lymph node

DC Tumor-draining CD8+
Lymph node Tumor T cell
IDO-negative DC
 The effects of IDO shRNA on
dendritic cells in vivo
1.25

Relative mRNA expression fold

1.00

(IDO/HPRT)
0.75

0.50

0.25

0.00
IDO siRNA Scramble IDO siRNA

Relateive mRNA expression fold

1.25

1.00

(IDO2/HPRT)
0.75

CD11c+ cells was harvested 0.50

from inguinal lymph node 0.25

Forty eight hours after vaccination. 0.00

IDO siRNA scramble IDO siRNA
Cancer therapeutic effect of IDO shRNA
and IDO inhibitor, 1-methyl tryptophan

1x106 MBT-2

5 mg/ml in drinking water, pH=9.9 1-MT treatment

……

Day0 Day8 Day15 Day22 Day29 Day36

1st vaccination and weekly vaccination, until mice were sacrificed

 IDO shRNA or 1-methyltryptophan
delays tumor growth

3000 * Saline (n=4)

Tumor volume (mm )

Scramble IDO siRNA (n=5)

3

2000 IDO siRNA (n=7)

* 1-MT (n=5)

1000

0
5 10 15 20
Days after MBT-2 challenge
Skin delivery of IDO siRNA is more effective
than systemic administration of 1-MT

100
Saline (n=12)
Scrmble IDO siRNA(n=12)
Percent survival

75 IDO siRNA(n=10)**
1-MT(n=10) *
50

25

0
0 10 20 30 40 50 60 70
Days after MBT-2 challenge
 Table.1 T cell infiltration in C3H mice model

CD8+ T cell CD4+ T cell NK cell Neutrophil

Treatment Mean ± SD Mean ± SD Mean ± SD Mean ± SD
Saline 2±2 1±1 1±1 3±2

L-1MT 8 ± 5* 48 ± 12** 13 ± 5* 48 ± 7**

Scramble 2±1 3±2 3±1 14 ± 4

IDO siRNA

IDO siRNA 28 ± 4** 29 ± 7** 16 ± 11 52 ± 6**

Random 5 field counted

* Compared with saline
** compared with saline and scramble
IDO shRNA enhances cytotoxic T
cells activity

30
* saline
Scramble IDO siRNA
Spleenic lysis(%)

20
* IDO siRNA
1-MT

10

0
50:1 25:1 12.5:1
Effector:Target cells
 Effect of IDO compensation vector
1 2 3 4

IDO

β-actin
(u mole per mg protein per hour)

100

75
1: IDO-myc+ Scramble IDO siRNA
Kynurenine

2: IDO-myc+ IDO siRNA

50
3: IDO-myc compensation-1 (2 points)
4: IDO-myc compensation-2 (4 points)
25

0
1 2 3 4
 IDO compensation abolished therapeutic effects

3000
Scramble IDO siRNA (n=5)
Tumor volume (mm )
3

IDO siRNA (n=5)

2000 IDO Com-1 (n=6)
IDO Com-2 (n=5)
IDO-myc (n=5)
1000

0
5 10 15 20 25
Days after MBT-2 challenge

Expression of RNAi-resistant IDO abolished

therapeutic effect induced by IDO siRNA
 Conclusion
• Skin delivery of IDO siRNA can exert cancer
therapeutic effect in two different mouse tumor
animal models.
• Advantages and applications:
1. Simple form of drug: No preparation of DCs for
ex vivo loading.
2. The IDO siRNA can be replaced with other
immunoregulatory genes in DCs.

A novel cancer therapy by skin delivery of indoleamine 2,3-

dioxygenase siRNA. Yen MC, Lin CC, Chen YL, Huang
SS, Yang HJ, Chang CP, Lei HY, Lai MD. Clin Cancer
Res. 2009 Jan 15;15(2):641-9
 Veterinary DNA vaccines
• Wolff et al. first demonstrated that direct intramuscular
(IM) injection of plasmid DNA was able to generate the
expression of the plasmid-encoded antigen in a murine
model. To date, DNA vaccines have been successfully
licensed for use against West Nile virus in horses,
infectious haematopoietic necrosis in schooled salmons,
and canine melanoma in dogs, as well as Clynav against
pancreas disease infection in Atlantic salmon. Moreover,
the first commercial DNA vaccine against H5N1 in
chickens has recently been conditionally approved by
the United States Department of Agriculture (USDA),
which targets highly pathogenic H5 avian influenza.
• Vet Res. 2019 Oct 10;50(1):78.
Final Suggestion
 How can I equip myself to be a
scientist or a better one?
• It is psychologically most important to get
results, even if they are not original. Getting
results, even by repeating another’s work ,
brings with it a great accession of self-
confidence.
• Advice to a young scientist. 1981 By P.B.
Medawar
有能力的表現從自覺有能力開始

Competence Starts with Feeling Competent

Thank You for Listening
TSP-1 shRNA can activate tumor immunity,
but TSP-1 is a tumor suppressor gene
BMDC-TSP-1 knockout exert
similar anticancer effect
Combination of TSP-1 shRNA and Neu DNA
vaccine produce additive therapeutic effect

A novel cancer therapeutic using thrombospondin 1 in dendritic cells.

Weng TY, Huang SS, Yen MC, Lin CC, Chen YL, Lin CM, Chen WC,
Wang CY, Chang JY, Lai MD. Mol Ther. 2014 Feb;22(2):292-302.
 Lung cancer DNA vaccine
• Lung cancer can be categorized by two
types of mutations: EGFR (druggable) and
Ras (undruggable)
• Lung cancer with EGFR mutation can be
treated with EGFR kinase inhibitor, such
as Iressa.
• There is no effective therapy for lung
cancer with Ras mutation.
Development of lung cancer DNA vaccine

Doxycyclin-inducible K-Ras transgenic

lung cancer animal model

K-ras DNA vaccine is effective

in animal tumor model
The specificity for Tumor carrying K-ras
mutation, but not L858REGFR

DNA vaccine elicits an efficient antitumor response by targeting the

mutant Kras in a transgenic mouse lung cancer model.Weng TY, Yen
MC, Huang CT, Hung JJ, Chen YL, Chen WC, Wang CY, Chang JY, Lai
MD. Gene Ther. 2014 Oct;21(10):888-96.
Skin Delivery of Clec4a
Small Hairpin RNA
Elicited an Effective
Antitumor Response by
Enhancing CD8+
Immunity In Vivo.

Mol Ther Nucleic Acids. 2017 Dec

15;9:419-427.
 Arginine and Cancer
Impact of arginine metabolism
on immune microenvironment
and
application of combination
immunotherapy
 Cancer Metabolism and
Therapeutics
• In general, tumour cells metabolize glucose,
lactate, pyruvate, hydroxybutyrate, acetate,
glutamine, and fatty acids at much higher rates
than their nontumour equivalents .

• Thus, targeting the metabolic differences

between tumour and normal cells holds promise
as a novel anticancer strategy

• Nat Rev Clin Oncol. 2017 Feb;14(2):113.

Amino Acid Metabolism and Cancer
• Mechanism of mTORC1 activation via
Rag proteins by amino acids.
mTORC1 is transferred to lysosome
from cytosol by promoting
heterodimerization of GTP-binding
Rag proteins, which work as
mediators of amino acid signaling to
mTORC1. It is then activated by
binding to GTP-bound Rheb on
lysosome. Extracellular arginine and
leucine activate RagA-RagC
heterodimer, GTP-binding RagA, and
GDP-binding RagC via amino acid
transporter CASTOR1/2 and
Sestrin1/2 to transfer mTORC1 to
lysosome. Lysosomal arginine also
activates Rag heterodimer via
lysosomal amino acid transporter
SLC38A9.
• Int J Mol Sci. 2018 Oct 21;19(10). pii:
E3267.
mTORC1 is a sensor for amino acids
and regulate the protein translation
• Two important amino
sensors are leucine
and arginine. Castor
proteins and the
interaction partner
sestrin 1/2 function as
sensor for leucine to
alter mTORC1 activity
through Rag A/C
GTPase proteins.
 Asparaginase-FDA approved drug for
acute lymphoblastic leukemia
• In healthy cells, aspartate
is converted to asparagine
by enzyme asparagine
synthetase. Neoplastic
cells lack the ability to
synthesize the asparagine
due to the absence of l-
asparaginase synthetase
enzyme, hence are
dependent on the
exogenous supply of
asparagine for their
Appl Biochem Biotechnol. 2016 Mar;178(5):900-23.
A Comprehensive Review on l-Asparaginase
existence and
and Its Applications reproduction.
Arginine Metabolism
• Arginine, a semi-essential
amino acid in human. In
addition to protein
biosynthesis, arginine
functions as precursor for
many biological
molecules including nitric
oxide (NO), creatine,
polyamines. In Arginine
biosynthesis is carried out
by argininosuccinate
synthetase (ASS1) and
argininosuccinate lyase
(ASL)
 Arginine Auxotrophy
• Arginine auxotrophy occurs in certain types of
cancer due to downregulation of ASS1, mainly
hepatocarcinoma and melanoma. However,
arginine auxotroph is also observed in other types
of advanced cancer, including prostate (100 %),
pancreatic (>80 %), breast (up to 60 %). Clinically,
arginine auxotroph is associated with advanced
stage and drug resistance. Epigenetically silencing
of ASS1 expression is most common events
leading to arginine auxotroph. Altogether, It is
reasonable to assume that depletion of arginine is
able to inhibit arginine auxotroph tumor growth in
these advanced stage cancer
Arginine as a Therapeutic Target
• There are several methods to
deplete arginine: (a) arginase 1
catabolize arginine to ornithine, (b)
arginine decarboxylase
decarboxylates arginine to
agmatine and carbon dioxide, and
(c) arginine deiminase (ADI)
degrades arginine to citrulline and
ammonia. To date, most of clinical
studies are performed with ADI
with Pegylation to increase half-
life . The first response to arginine
depletion is autophagy, which is
initially to give cells survival
benefit. However, autophagy
becomes a suicide process under
prolong starvation. Growth arrest
or apoptosis were also frequently
observed in arginine-deprived
cells depending on cell types

84
 Arginine Depletion on Tumor
Immune Microenvironment
• Although the safety of ADI-
PEG is demonstrated, and
the drug is well tolerated. It
is less-addressed whether
depletion of arginine
influences the function of
immune cells within the
tumor moicroenvironment
and in the lymphoid organ.
• It is interesting to note that
arginine can enhance T
cell survival and increase
anti-tumor efficacy.
• Arginine depletion by
arginase blunts antitumor
T-cell responses Inhibition
of arginine metabolism
boosts the
immunoimmunotherapy for
leukaemia by azacytidine
and vorinostat.
85
 Current Paradox
• (1) Depletion of arginine by arginase or arginine
deiminase inhibit the growth of arginine
auxotroph tumor (Riess et al., 2018, several
clinical trials on going)
• (2) Addition of arginase I inhibitor to alter tumor
microenvironment is able to inhibit tumor growth
(Fletcher et al., 2015, Mussai et al., 2018)
• (3) a report indicates that ADI-PEG did not
inhibit, even may enhance, immune response in
B16F10 melanoma animal model (Brin et al.,
2017) 86
 Examination of the paradox (Quality,
Quantity, and Time)
• What is the difference between
arginase and ADI?
• The effects of lower arginine
(hypothesis: arginase
decreased arginine much
lower and long period)—
quantity and time

• Check ADI effect

• Journal of Controlled Release
80 (2002) 259–271
• It seems that ADI-PEG20
decrease serum arginine
almost zero concentration and
last for up to 6 days.
• The hypothesis is rejected.

87
• Arginase  ornithine +urea
• ADI citrulline + NH3

• Ammonia is more toxic than

urea
• Arginase has a higher side
toxicity than ADI-PEG, but
the side effect maybe
compensated with citrulline.
Most other cells can convert
citrulline to argininosuccinate
and through ASL to arginine.
• Therefore, the difference is
less likely due to urea or
NH3.

88
 The hypothesis: ornithine and citrulline
• Ornithine need OTC enzyme to form
citrulline.
• The difference between Arginase and ADI
may be due to the differences in OTC.
• Immunohistochemistry confirmed the almost
complete absence of ASS and OTC
enzymes, consistent with a state of arginine
auxotrophy that defines sensitivity to
arginase therapy (Fig. 1f ).
• Case report: Metabolic therapy with PEG-
arginase induces a sustained complete
remission in immunotherapy-resistant
melanoma. Journal ofOTCHematology
expression&
Oncology (2018) 11:68
• Classically arginine depleting
therapies such as pegylated arginine
deiminase or BCT-100 are most
effective when one or more of the
enzymes have low or absent
expression [8, 13]. Interestingly,
BCT-100 also has activity against
tumours which express both ASS
and OTC, unlike ADI-PEG,
suggesting differences in their modes
of action or other intracellular
pathways are contributing to
determine cell fate. (Another
question, the efficacy may be from
the conversion to arginine need two
enzymes and carbamoyl phosphate)
• Arginase is effective in this case,
which may be due to disability of
immune protection in this patient.
89
 The difference between ADI and Arginase
resides in OTC which is absent from other
cell types
• The greater toxicity of the arginase • The immune regulation maybe due to
relative to arginine deiminase may be the toxicity maybe due to OCT, ADI-
due to failure of normal tissues to rescue PEG has less toxicity, but Arginase 1
arginine from ornithine—the product of has detrimental effect, like Arginase 1
arginase. The conversion from ornithine from macrophage. It indicates that
to arginine requires OTC, which we Aginase 1 inhibitor can recover immune
previously showed was low in many inhibition, which further indicates the
normal primary cell cultures [5]. differential mresponse to arginine
• Citrulline can recover the toxicity depletion. However, ADI-PEG will not
affect the immune since citrulline can
• Transl Oncol. 2012 Feb; 5(1): 26–31. be recovered into argininesuccinate in
• Published online 2012 Feb 1. other cell ttpes.
• Recombinant Human Arginase Toxicity in
Mice Is Reduced by Citrulline
Supplementation1
• Jeremy P Mauldin,* Ideen Zeinali,* Keri
Kleypas,* Jung Hee Woo,* Rebecca S
Blackwood,* Chan-Hee Jo,† Everett M
Stone,‡ George Georgiou,‡ and Arthur E
Frankel*

90
 Research Aim
• Is there any additive therapeutic benefit to
combine ADI-PEG and arginase 1
inhibitor?
Mutanome Engineered RNA Immunotherapy:
Towards Patient-Centered Tumor Vaccination

J Immunol Res. 2015;2015:595363.

 Personalized RNA
Vaccine in Human

2 2 2 | N AT U R E | VO L 5 4 7 | 1 3 j ul y 2 0 1 7

Personalized RNA mutanome vaccines mobilize poly-specific therapeutic

immunity against cancer.
a, Recurrence and treatment (top) and progression-free survival
(bottom, right) of patients. Cumulative sum of metastatic events
per month before (grey) or after (green) neo-epitope RNA
vaccination (bottom, left). Patient no., number of monitored
patients. Fisher’s exact test comparing the cumulative observation
time without a metastatic event to the number of months with an
event (P < 0.0001, (bottom, left)). b, c, Computer tomography of
target lesions and vaccine-induced ex vivo responses by ELISpot
for P07. d–i, Vaccine-induced T cell responses of P17. TILs and
the tumour cell line MZ-I-17 derived from a lymph node metastasis
resected after four RNA neo-epitope vaccinations. d, TIL reactivity
against individual neo-epitopes e, HLA multimer staining of HLA-
A*6801-restricted CD8+ TILs recognizing a RETSAT(P546S)
minimal epitope. f, IFNγ-secretion-based single-cell sorting of
CD8+ TILs for TCR cloning after co-culture with RNA-transfected
DCs. Control, eGFP RNA. g–i, CD8+ T cells expressing TCR#8
cloned from single TILs were tested for recognition of peptide-
pulsed K562 cells transfected with individual HLA alleles of the
patient by ELISpot (g) or for killing of P17-derived target cells by
caspase 3/7 or luciferase cytotoxicity assays (i). Controls, CD8+ T
cells without TCR RNA (left); autologous CD14+ cells ± OLPs
(right). Results of triplicates (mean + s.d.). h, Neo-epitope
presentation on two HLA-alleles.
Nat Rev Drug Discov. 2018 Oct;17(10):751-767.
An RNA toolbox for cancer immunotherapy
Customizing a patient-specific
cancer vaccine

Patient tumor biopsies and healthy tissue (e.g., peripheral blood

white blood cells) are subjected to next-generation sequencing.
By comparing the sequences obtained from tumor and normal
DNA, tumor-specific nonsynonymous single-nucleotide variations
or short indels in protein-coding genes are identified. A
computational pipeline is used to examine the mutant peptide
regions for binding to the patient’s HLA alleles (based on
predicted affinity) and other features of the mutated protein
deemed relevant for prioritization of potential vaccine targets.
These data can facilitate selection of multiple mutations to design
unique neoepitope vaccines that are manufactured under GMP
conditions. Science. 2018 Mar 23;359(6382):1355-1360.
Neoepitope vaccines promote a
functional cancer immunity cycle.
The goal of cancer immunotherapy is to
ensure self-propagating revolution of the
dysregulated cancer immunity cycle
through its various steps (24). Vaccine-
induced neoepitope-specific CD4+ TH1
cells may intersect at discrete rate-
limiting steps considered as potentially
difficult to overcome. These include the
promotion of T cell priming and
expansion, proinflammatory reshaping of
the tumor microenvironment, and
recruitment of CD4+ T cells for direct
killing of tumor cells. By concomitantly
inducing CD8+ and CD4+ T cell
responses, multi-neoepitope vaccines
may contribute to tipping the balance
from tolerance toward productive
immunity against tumor cells, rendering
the cancer immunity cycle functional.
Fig. 4 The
interconnected
dimensions of cancer
heterogeneity.
The interaction between
cancer and immune
system is shaped by
various host, tumor and
environmental factors.
The complex interplay of
these sources of
interpatient heterogeneity
affects both the course of
disease and the efficacy
of immunotherapy, and
calls for personalized
h