36 

CHA PTER 2
STRUCTURE AND PHYSIOLOGY
SECTION 1: DEVELOPMENT,

Molecular Genetics in Paediatric Dermatology

Anna C. Thomas1 & Veronica A. Kinsler1,2
1
 Genetics and Genomic Medicine, UCL Great Ormond Street Institute of Child Health, London, UK
2
 Paediatric Dermatology Department, Great Ormond Street Hospital for Children NHS Foundation Trust, London, UK

Introduction, 36 Which samples to take for genetic Concept of personalized medicine, 39

Genetics and inheritance in brief, 36 testing, 39 Molecular genetics techniques, 40
Consent for genetic testing and incidental How to interpret genetic results, 39
findings, 38 What to do with a genetic result, 39

Abstract volume of genetic data generation, and have made the transition
from the research sphere to the diagnostic laboratories. The iden-
tification of disease‐causing genetic mutations in both inherited
Molecular genetics is the study of the structure of genes at molecu-
and sporadic paediatric dermatological conditions has begun to
lar level, and the impact of gene expression and regulation on the
influence clinical management, allowing preimplantation genetic
biology of the organism. The interplay between these two fields,
diagnosis, stratification for targeted personalized medical therapies,
genetics and biology, is a burgeoning area in all disease. In recent
or gene therapy in some cases. This chapter reviews the essential
years the process of disease gene identification and clinical genetic
terminology, key techniques and important advances needed to
diagnostic reporting has been revolutionized by the technologies
update paediatric dermatologists in this field, forming a basis for
discussed in this chapter, most prominently next‐generation
the detailed disease‐specific chapters that follow.
­sequencing (NGS). These techniques have increased the speed and

­Introduction confirm a diagnosis or to subclassify disease, the

Molecular genetics is the study of the structure of genes at
a molecular level, and the impact of gene expression and
regulation on the biology of the organism. The interplay
between these two fields, genetics and biology, is a bur-
geoning area in all disease. For essential terminology in
molecular genetics, see Table 2.1.
A large number of skin conditions have now had their
genetic aetiology identified and this information can be
easily accessed through many of the online curated
databases available, for example Online Mendelian
Inheritance in Man (www.omim.org) and the Decipher
database (https://decipher.sanger.ac.uk), as well as from
published literature.
In recent years, the process of disease gene identifica-
tion and clinical genetic diagnostic reporting has been
revolutionized by the technologies discussed in this chap-
ter, most prominently next‐generation sequencing (NGS).
These techniques have increased the speed and volume of
genetic data generation, and have made the transition
from the research sphere to the diagnostic laboratories.
Storage and analysis of this data however, is still fraught
with difficulties, not least in the interpretation of novel
(undescribed) variants. In addition, functional analysis of
the implications of any novel findings still requires vali-
dation by cell biology and animal model generation.
The implications of genetic diagnosis have changed
in recent years. Whereas this used to serve only to
i­dentification of disease‐causing genetic mutations in
both inherited and sporadic paediatric dermatologi-
cal conditions has begun to be clinically relevant in
clinical management. Preimplantation genetic diagno-
sis (PGD) as part of the in vitro fertilization (IVF) pro-
cess can be offered for future pregnancies where there is
a family history and the genetic defect is known, for
example in epidermolysis bullosa and the autosomal
recessive ichthyoses. In other instances the genetic
defect will stratify patients towards targeted medical
therapies, such as in the vascular overgrowth disorders.
In addition, paediatric dermatology is now in the era
of personalized genetic therapy, and this will surely
be an area of tremendous growth in the decade to come.
Techniques of gene therapy will be discussed in
Chapter 170.
­Genetics and inheritance in brief
The human genome is comprised of deoxyribonucleic acid
(DNA) neatly contained within 23 pairs of chromosomes
in the human, one of each pair inherited maternally and
one paternally. The sex chromosomes are inherited XX for
a female and XY for a male, and the other 22 pairs are
described as autosomes. It should also be noted that cel-
lular mitochondria house 37 genes within a circular
genome that is inherited maternally. DNA is transcribed

Harper’s Textbook of Pediatric Dermatology, Fourth Edition. Edited by Peter Hoeger, Veronica Kinsler and Albert Yan.
© 2020 John Wiley & Sons Ltd. Published 2020 by John Wiley & Sons Ltd.
 Chapter 2  Molecular Genetics in Paediatric Dermatology 37

Table 2.1  Essential terminology in molecular genetics

STRUCTURE AND PHYSIOLOGY

SECTION 1: DEVELOPMENT,
Allele The alternative form of a gene’s sequence
Allele‐specific A test or treatment directed at only one allele
Array An ordered arrangement of probes on a solid surface
Base/nucleotide A DNA or RNA nucleotide (ACTG or ACUG)
Biallelic mutations Two different mutations at the same site in a gene
Chimaera An organism resulting from the fusion of two or more zygotes
Compound heterozygous mutations Two different mutations at different sites in a gene
Copy number Number of copies of a DNA sequence, usually at chromosomal or gene level but can be applied to
repeats in the DNA sequence
Copy number variation A change in the copy number of a portion of DNA, which is described in the normal population and
therefore considered to be a variant rather than pathogenic
De novo mutation Not inherited from either parent, but arisen for the first time in the patient
Digenic mutation A condition which is caused by mutations in two different genes
Exons The parts of the DNA sequence that code for proteins
Frameshift mutation A mutation that causes a shift in the reading frame of the DNA sequence
Gain‐of‐function/activating mutation A mutation that increases the function of the gene
Germline mutation A mutation that affects all the cells of an organism including the gametes
Hemizygous mutation Having only a single copy of a gene, which results in monoallelic expression
Heterozygous mutation The occurrence of a mutation in one copy of a gene but not in the other
Homozygous mutation The occurrence of the same mutation in both copies of a gene
Hybridization Binding of DNA or RNA to complementary strands or probes
Imprinting Natural silencing of one allele, leading to monoallelic expression
Introns The parts of the DNA sequence of the genome that do not code for proteins
In silico The analysis of the effects of a mutation using bioinformatics rather than laboratory experiments
Knockdown The deliberate reduction in expression of a gene (e.g. in an experiment to see what it does)
Knockout The deliberate obliteration of expression of a gene (e.g. in a mouse model)
Ligation Joining together of fragments of DNA
Loss‐of‐function mutation A mutation that reduces or obliterates the function of a gene
Missense mutation A single base change in the DNA sequence that alters an amino acid in the protein but does not
truncate it
Monoallelic expression Expression of only one allele instead of two. This occurs with X inactivation and with imprinted genes
Mosaicism The presence of two or more genotypes in an organism arising from a single zygote
Mutant or minor allele frequency The proportion of a sample or a population affected by a mutation
Mutation A change in the DNA sequence that is thought or known to be pathogenic. Non‐synonymous
mutations are those that alter the amino acid code in an exon whereas synonymous mutations do
not
Nonsense mutation A mutation that truncates the protein product
Novel A mutation that has not previously been described in the literature or in public databases
Oligonucleotide A short synthetic sequence of DNA or RNA bases
Overexpression Increased expression of a gene, usually deliberately to analyse the effects
Panel/targeted panel A selected set of genes for DNA sequencing
Polymorphism A change in the sequence of DNA that is commoner than 1% frequency in a population, and
therefore considered to be a variant rather than pathogenic
Post‐zygotic A mutation that occurs in utero
Segregation The co‐occurrence of a phenotype in members of a family who are affected by a particular genotype,
and the absence of that phenotype in unaffected family members
Sequencing Elucidation of the sequence of the bases in DNA or RNA
Single nucleotide polymorphism (SNP) or variant A single base pair change in DNA that is seen in more than 1% of a normal population
(SNV)
Somatic mutation A mutation within a tissue
Splice site A sequence of DNA that indicates the junction of an exon and intron
Sporadic A disorder that does not appear to be inherited or passed on
Transcription The process of making RNA from a DNA template
Translation The process of making protein from an RNA template
Uniparental disomy (UPD) The inheritance of two copies of a gene or genes from one parent
Validation The use of secondary or functional tests to confirm a DNA mutation

into messenger ribonucleic acid (mRNA) and mRNA is
translated into protein. Proteins are the molecules in each
cell that perform the vital functional tasks required in the
human body. It is the chemical properties of the amino
acids and the exact order in which they are aligned that
causes the protein to fold into a particular shape, and
therefore determines its functional properties.
The genetic code of DNA occurs in the form of four
chemicals or ‘bases’, namely cytosine (C), thymine (T),
guanine (G) and adenine (A). Complementary pairing
occurs between C bases and G via three hydrogen bonds,
and between T with A via two hydrogen bonds, at the
centre of the famous DNA double helix [1,2]. Long runs of
these four bases are grouped into regions known as exons
 38 Section 1  Development, Structure and Physiology of the Skin
and introns. Exons are known to be the regions that ‘code’
STRUCTURE AND PHYSIOLOGY
for RNA and therefore for protein products, and they
SECTION 1: DEVELOPMENT,
make up only around 1% of the whole DNA sequence.
Introns make up the rest of the sequence and their func-
tion is still not completely understood. Early on in the
study of molecular genetics they were considered to be
‘junk DNA’, however it is now well established that
intronic sequences are crucial for the functioning and con-
trol of the exonic areas and their protein products. The
four bases of the exons and their flanking sequences are
‘transcribed’ into RNA by the process of transcription. In
this process an RNA molecule is made from the DNA
sequence transcript, with the intronic sequences removed,
and the thymine base of DNA replaced by the uracil base
of RNA. The four RNA molecule bases (UCGA) can be
arranged into groups of three in 64 different ways, called
codons. Sixty one of these codons code for one of 20 amino
acids, and three code for a so‐called stop codon. This is
known as the genetic code, and the excess of codons for
amino acids is known as the redundancy or degeneracy of
the genetic code. Amino acids are the building blocks
of proteins, and stop codons tell the protein when the
exonic instructions are finished. The process of forming a
string of amino acids from the RNA code is known as
translation.
DNA mutations can occur anywhere in the human
genome, and in some cases lead directly to or contribute
to disease. Broadly speaking the most damaging muta-
tions are found within exons, however they are increas-
ingly being discovered outside coding regions, for
example in important regulatory regions outside the
gene itself such as the promoter. Mutations can be clas-
sified into (i) point mutations, similar to a spelling mis-
take where a single base is replaced by another, and (ii)
insertions or deletions, where part of the DNA message
is missing or a part is added. Point mutations can be
subdivided into synonymous or non‐synonymous and,
where non‐synonymous, into missense or nonsense.
Synonymous mutations are base changes that do not
change the amino acid which is coded for and therefore
the protein product remains the same. These are usually
but not always benign, and therefore usually without
apparent functional consequence. Non‐synonymous
mutations are those that alter the amino acid code in an
exon. Within this group missense mutations are those
that change the amino acid but not to a stop codon,
producing a protein, although this protein is abnormal
in sequence. Nonsense mutations on the other hand
lead to an absent or truncated protein product by chang-
ing the codon to a stop codon. For mutations that are
deletions or insertions of sequence this can be ′in‐frame’
or leading to a ′frameshift’. In‐frame insertions or dele-
tions lead to one codon being changed, either to a dif-
ferent codon or a stop codon, and frameshift alter the
reading frame of the gene – in other words the three‐
letter codons are no longer read in the correct groups of
three, which leads to a nonsense protein product and
sometimes to a premature stop codon. Large deletions,
duplications and insertions can also occur at gene level,
causing whole exons or multiple exons to be removed
or disrupted, and on a larger scale there can be chromo-
somal structural aberrations such as translocations and
inversions.
In many cases a disease manifests itself because the
flow of molecular information from DNA to RNA to pro-
tein contains a mutation, usually originating from the
DNA code. Many diseases can be described as ‘dominant’
or ‘recessive’ in inheritance pattern, where either one or
both copies of the gene are required to be faulty respec-
tively in order to cause the resultant disease. As males
have one copy of the X chromosome, all genes in males
that do not lie on the pseudoautosomal regions of the X/Y
chromosomes cannot be described as heterozygous or
homozygous and in this situation are referred to as
‘hemizygous’. X‐linked disorders in general are therefore
more likely to be severe in males as there is only one copy
of the gene.
A disease is described as monogenic if there is only one
gene involved in the phenotype; however this is a rapidly‐
disappearing concept, as the background genotype of the
patient will almost inevitably have some phenotype‐
modifying effect in any disease situation. Polygenic disor-
ders are those in which more than one gene is known to
be involved in the phenotype. Mosaic disorders are dealt
with in Section 23.
­References
1 Watson JD, Crick FH. Molecular structure of nucleic acids; a structure
for deoxyribose nucleic acid. Nature 1953;171:737–8.
2 Watson JD, Crick FH. Genetical implications of the structure of deox-
yribonucleic acid. Nature 1953;171:964–7.
­ onsent for genetic testing and
C
incidental findings
Individual hospitals usually have their own standards
and protocols for obtaining consent for genetic testing.
This will vary depending on the method to be used, and
whether the test is a diagnostic laboratory test or being
done on a research basis. Oral consent for genetic testing
may be sufficient for established diagnostic tests, but any
research testing should have fully informed written con-
sent recorded in the hospital and research notes.
In most diagnostic tests the issue of incidental find-
ings does not arise as only a single gene is being tested.
However, with the increase in gene panel testing and of
clinical exome testing there may be genes being tested
which are known to affect clinical outcome in other
­diseases, such as tumour suppressor genes or onco-
genes. In these cases, there is no international consen-
sus as yet for whether specific consent needs to be
taken in advance, however, a gradual consensus is
emerging, and in general it is good practice to inform
families that there is a possibility that other mutations
may be uncovered which could affect their health in
other areas. Ideally there is a specific option after
informed consent for the patient/family to choose
whether they would like to be told of incidental find-
ings. Recent US and European publications in this area
may help with consideration of issues around consent
for incidental findings [1–6].
 Chapter 2  Molecular Genetics in Paediatric Dermatology
­References
1 Evans BJ. Minimizing liability risks under the ACMG recommenda-
tions for reporting incidental findings in clinical exome and genome
sequencing. Genet Med 2013;15:915–20.
2 Green RC, Berg JS, Grody WW et al. ACMG recommendations for
reporting of incidental findings in clinical exome and genome
sequencing. Genet Med 2013;15:565–74.
3 Hehir‐Kwa JY, Claustres M, Hastings RJ et al. Towards a European
consensus for reporting incidental findings during clinical NGS
testing. Eur J Hum Genet 2015;23:1601–6.
4 May T. On the justifiability of ACMG recommendations for report-
ing of incidental findings in clinical exome and genome sequencing.
J Law Med Ethics 2015;43:134–42.
5 Anderson JA, Hayeems RZ, Shuman C et al. Predictive genetic testing
for adult‐onset disorders in minors: a critical analysis of the arguments
for and against the 2013 ACMG guidelines. Clin Genet 2015;87:301–10.
6 Kalia SS, Adelman K, Bale SJ, et al. Recommendations for reporting of
secondary findings in clinical exome and genome sequencing, 2016
update (ACMG SF v2.0): a policy statement of the American College of
Medical Genetics and Genomics. Genet Med 2017;19:249–55.
­ hich samples to take for genetic
W
testing
Blood DNA
Methods of DNA extraction from whole blood can vary
dependent on the local laboratory, and it is always worth
checking before obtaining a sample. Very commonly
1–5 mL is sufficient from children, collected into an EDTA‐
containing vial. The sample is safe overnight at room tem-
perature if need be.
Cheek swab or saliva DNA
Increasingly it is possible to get good‐quality DNA from
a cheek swab, however this will also depend on the local
laboratory. These samples require a specialized swab (not
a normal skin swab), and instructions for collection
should be followed. Generally lower quantities of DNA
are obtainable than from blood. The method is, however,
particularly suitable for young babies if it is difficult to
obtain a blood sample, or from family members who are
not able to attend clinic to have blood taken, when a cheek
swab or saliva sample can be sent remotely by following
the manufacturer’s instructions.
Skin DNA
Skin biopsy is required for DNA extraction where it is
possible that the mutation is not present in the germline
and therefore not detectable in blood but only in affected
tissue. A skin biopsy for DNA extraction must not be put
into formalin. It can be transported fresh to the laboratory
on a saline‐soaked gauze, or snap‐frozen in liquid nitro-
gen, or placed in a medium that stabilizes nucleic acids.
Most diagnostic laboratories when presented with a skin
sample for DNA extraction will culture fibroblasts from it
by default, and then extract DNA from the fibroblasts. This
may not be appropriate in a mosaic disorder as the muta-
tion may not be present in that cell type, and therefore DNA
extraction from whole skin should be specifically requested.
­How to interpret genetic results
Once a clinical or research test has been ordered it is use-
ful to be able to understand the result. The full genetic
39
result as reported should be inserted into the patient’s
STRUCTURE AND PHYSIOLOGY
medical notes, as the exact mutation may be extremely
SECTION 1: DEVELOPMENT,
important. Reading the results of a DNA sequence muta-
tion is explained in Table 2.2.
­What to do with a genetic result
In general terms it is best to refer the family to Clinical
Genetics for the result to be given. Even if the paediatric
dermatologist feels confident of their knowledge in the
area, they are not trained in genetic counselling and may
not be aware of all the implications for all family mem-
bers. In referral of the family, mention that the whole fam-
ily may need to attend, and certainly both parents where
possible, and warn that further testing may be required.
Clinical geneticists can also deal with the issues surround-
ing incidental findings where relevant.
­Concept of personalized medicine
A rapidly evolving area of science is that of personalized
medicine, or precision medicine [1,2]. This is a broad term
to describe the use of genetic data on an individual to tai-
lor the treatment of a disorder to that individual. There
are two principal ways in which this research is being
driven. First, genetic information is being analysed retro-
spectively from cohorts of patients who have had success-
ful or unsuccessful responses to therapy to create a model
of genotypic association with outcomes including side‐
effects. Second, where disorders are found to be caused
by or driven by a specific mutation, researchers and clini-
cians are prescribing therapies targeted to these mutations
or to the known effects of these mutations. In paediatric
dermatology this is currently being used in trials such as
of AKT1 inhibitors in Proteus syndrome, rapamycin in the
PIK3CA‐related overgrowth spectrum, and collagen VII
Table 2.2  Terminology used in genetic testing results
_ (Underscore) is a range (e.g. c.76_78delACT)
> Indicates a substitution at DNA level (e.g. c.76A>T)
c. Position of base pair in cDNA
c.(83G=/83G>C) Describes the two genotypes of a mosaic case
del Indicates a deletion (e.g. c.76delA)
dup Indicates a duplication (e.g. c.76dupA)
fs Frameshift
fs*# *# Indicates at which codon position the new
reading frame ends in a stop codon (*). The
position of the stop in the new reading frame is
calculated starting at the first amino acid that is
changed by the frameshift, and ending at the first
stop codon (*#)
g. Position of base pair in genomic DNA
ins Indicates an insertion (e.g. c.76_77insG)
inv Indicates an inversion (e.g. c.76_83inv)
m. Position in mitochondrial DNA
n. Position in noncoding RNA
p. Position of amino acid in protein
p.(Arg97Profs*23) Frameshifting change with arginine‐97 as the first
affected amino acid, changing into a proline, and the
new reading frame ending in a stop at position 23
r. Position in RNA (e.g. r.76a>u)
 40 Section 1  Development, Structure and Physiology of the Skin
replacement therapy in recessive dystrophic epidermoly-
STRUCTURE AND PHYSIOLOGY
sis bullosa. This personalized medicine approach will
SECTION 1: DEVELOPMENT,
change the face of medicine and is likely to improve
patient outcome in response to drug therapies, reducing
the requirement for multiple therapies and avoidable
side‐effects.
­References
1 Ashley EA. Towards precision medicine. Nat Rev Genet 2016;
17:507–22.
2 Collins DC, Sundar R, Lim JS, Yap TA. Towards precision medicine
in the clinic: from biomarker discovery to novel therapeutics. Trends
Pharmacol Sci 2017;38:25–40.
­Molecular genetics techniques
Key reviews are referenced for further reading.
Karyotype
A karyotype test is used to determine chromosomal num-
ber, structure and integrity. The test has to be performed
on actively dividing live cells, and therefore the speci-
mens need to be freshly delivered to the laboratory.
Karyotyping can be performed on blood or skin. Single
nucleotide polymorphism (SNP) arrays are increasingly
replacing karyotyping for the assessment of chromosomal
number and integrity (detection of duplications and dele-
tions); however if structural rearrangements are to be
detected (for example inversions or translocations) then
karyotyping is still required.
Mutation identification by DNA sequencing
All methods of DNA sequencing rely on the existence of
what is known as the reference sequence, which is the
accepted and curated version of the human genome. There
are various version of the reference sequence, and new
‘builds’ of these become available at intervals of a few
years, when the current version is updated with the latest
data. The reference sequence can be found at various web-
sites such as the University of California Santa Cruz
(UCSC) genome browser, https://genome.ucsc.edu. The
production of the reference sequence was made possible as
a result of the revolutionary Human Genome Project [1].
Sanger sequencing
Sanger sequencing is a technique of sequencing DNA that
was discovered by Frederick Sanger and coworkers [2].
The method is to design numerous pairs of oligonucleo-
tide DNA ‘primers’ that cover the coding region of the
gene of interest. Primers are essentially small pieces of
DNA of around 20 base pairs in length that bind to DNA
#70
G C T G C G G G T C C
C G A C G C C C A G G
#130
Fig. 2.1  A typical Sanger sequencing trace after importing the data into an appropriate analysis software tool. Bases are represented in different colours.
of complementary sequence in the gene of interest.
Polymerase chain reaction (PCR) is then performed to
amplify DNA fragments followed by dideoxynucleotide
chain termination sequencing to obtain a sequencing
readout that can be compared to the known ‘wild‐type’
reference version. An example is shown in Fig. 2.1.
Next‐generation sequencing (NGS) of DNA [3]
NGS is the best way to sequence DNA on a large scale.
Sequencing that would previously have taken years
can now be done in around a week by hand or 3 days
when using a robotic automated system. Over the years
there have been different technologies for NGS, and
there are still a wide variety of methods available.
However, the principles behind NGS are similar in all
cases, and there are also certain major categories of
experiment. These categories vary in how the DNA of
interest is captured:
1 Whole exome: all predicted coding regions of the genome
are sequenced.
2 Whole genome: all DNA regardless of its known function
is sequenced.
3 Targeted capture: only preselected DNA is enriched for
and sequenced. This is often in the form of a set of
known and/or candidate genes added to a screening
panel or it could be a region on a particular chromo-
some. This is the most commonly used type within a
diagnostic context, where only known genes are being
investigated. NGS panels are now validated in many
paediatric dermatology diseases [4–7].
There are a number of different protocols available
depending on the concentration of DNA collected, for
example a total concentration of 3 μg or as low as 200 ng.
This is extremely helpful if there are only small quantities
of material to begin with. Recently adapted protocols
have been optimized to obtain good‐quality sequencing
data from DNA extracted from formalin‐fixed paraffin‐
embedded (FFPE) blocks. This is advantageous as it
means archived pathology samples can be analysed from
skin samples (as well as other tissues). This has previ-
ously been difficult as DNA extracted from FFPE blocks is
often of lower quality and often more fragmented than a
fresh sample.
How NGS works:
1 A ‘library’ is prepared by randomly fragmenting a
genomic DNA sample.
2 Ligation adapters are then added to both ends of each
DNA fragment.
3 Adapter‐ligated fragments are PCR amplified and
subjected to purification.
#80
G C G T G C C C A C C A C
C G C A C G G G T G G T G
#130
 Chapter 2  Molecular Genetics in Paediatric Dermatology 41

4 At this stage the library is loaded onto a flow cell so that 7 Data analysis is then carried out by sequence‐read

STRUCTURE AND PHYSIOLOGY

the DNA fragments can hybridize to the surface of the alignment to a selected reference genome with the use

flow cell via surface‐bound oligonucleotides that are
complementary in sequence to the attached adapters.
5 Each bound fragment goes through an amplification
process to produce a cluster that becomes clonally
identical.
6 Sequencing reagents, including a differently labelled
fluorescent nucleotide for each base, are used to iden-
tify each base.
SECTION 1: DEVELOPMENT,
of specialized software. After alignment, any differ-
ences between patient samples and the reference
genome are identified (Fig. 2.2).
If hunting for new genes on a research basis, the ideal
scenario is to find gene variants in all/most of the affected
individuals that are not present in the reference genome
and other control populations and, if looking for an inher-
ited disease, are present in the parental DNA where the

Library preparation Cluster amplification

Genomic DNA

Fragmentation
Row cell

Adapters
Bridge amplification
cycles
Ligation

Sequencing
library
2 4
1 3

Clusters
NGS library is prepared by fragmenting a gDNA sample and Library is loaded into a flow cell and the fragments hybridize
ligating specialized adapters to both fragment ends. to the flow cell surface. Each bound fragment is amplified into
a clonal cluster through bridge amplification.

(a) (b)

Sequencing Alignment & data anaylsis

A
T
C
2 4 G
1 3
ATGGCATTGCAATTTGACAT
TGGCATTGCAATTTG
AGATGGTATTG
Reads GATGGCATTGCAA
Sequencing cycles
GCATTGCAATTTGAC
ATGGCATTGCAATT
AGATGGCATTGCAATTTG
T A
G C
Reference
Digital image AGATGG TATTGCAATTTGACAT
genoma
Data is exported to an output file

Cluster 1 > Read 1: GAGT...

Cluster 2 > Read 2: TTGA...
Cluster 3 > Read 3: CTAG...
Cluster 4 > Read 4: ATAC... Text file

Sequencing reagents, including fluorescently labelled nucleo- Reads are aligned to a reference sequence with bioinformatics
tides, are added and the first base is incorporated. The flow software. After alignment, differences between the reference
cell is imaged and the emission from each cluster is recorded. genoma and the newly sequenced reads can be identified.
The emission wavelength and intensity are used to identify
the base. This cycle is repeated ”n” times to create a read
length of “n” bases.

(c) (d)
Fig. 2.2  Overview of the workflow of an Illumina next‐generation sequencing (NGS) method. Source: Courtesy of Illumina, Inc.
 42 Section 1  Development, Structure and Physiology of the Skin
STRUCTURE AND PHYSIOLOGY
SECTION 1: DEVELOPMENT,
p15.31 p15.1 p14.1 p13.2 p12 q11.2 q12.2 q13.2
140,207,950 bp 140,207,960 bp
T
Typical representation of the output of NGS, with 'reads' represented as grey horizontal bands aligned with the reference
genome build using Integrative Genomics Viewer (Broad Institute). Each of these is the equivalent to one of the Sanger
sequencing traces shown in Figure 2.1. A heterozygous mutation is demonstrated by the blue cytosine change.
(e)
Fig. 2.2  (Continued)
inheritance can be explained. However, we also know
that diseases can be sporadic and mutations can appear
de novo so this has to be considered during the analysis
phase.
At this point there is still a requirement for DNA varia-
tions within candidate genes to be validated by Sanger
sequencing. It is always important to ensure that any
result is not due to an NGS artefact that has happened by
chance.
Other types of NGS
In the last few years NGS protocols have been adapted to
perform sequencing of RNA in a process known as RNA‐
seq. This has the huge advantage of being able to analyse
the sequence of alternatively spliced mRNA transcripts.
Splicing is the editing of an early mRNA into a mature
form, where introns (noncoding DNA) are removed and
exons (protein‐coding parts of DNA) are joined together.
In this manner a single gene can give rise to different pro-
teins depending on the composition of the exons ligated
together during the splicing stage. Different tissues of the
body can contain differentially spliced forms of the same
mRNA. RNA‐seq can capture this information and addi-
tionally gather quantitative information on how highly a
particular transcript is expressed at a given time point.
There are different types of RNA that have specialized
biological functions and, depending on the precise meth-
ods used, small RNAs, microRNA (miRNA) and transfer
RNA (tRNA) as well as total RNA can be analysed using
RNA‐seq.
Other types of NGS include chromatin immunopre-
cipitation sequencing (CHIP‐seq), which extracts data
on protein interactions with DNA (DNA‐binding sites),
and methylated DNA immunoprecipitation (MeDIP‐seq),
which extracts data on DNA methylation.
q14.1 q14.3 q15 q21.2 q22.2 q23.2 q31.1 q31.3 q33.1 q34 q35.2
41 bp
140,207,970 bp 140,207,980 bp
T
C
C
C
Copy number changes
Copy number mutations or copy number variations
(CNVs) can be challenging to identify when using DNA
sequencing methods, especially if they occur in heterozygous
form. CNVs occur if a copy of all or part of a gene is either
deleted or duplicated by one or more copies. There are a
number of different methods by which to identify CNVs.
Array techniques [8–14]
One preferred method of detection is array‐comparative
genomic hybridization (aCGH). In simple terms aCGH
has RNA oligonucleotides or ‘oligos’ spaced at specific
distances along the human genome that bind DNA
complementary in sequence. In each case a patient DNA
sample under investigation is labelled with a red fluo-
rescent dye and a reference DNA sample is labelled
with a different dye which fluoresces green. Differentially
labelled samples are mixed 50 : 50 and then hybridized
to the array surface. After a time of hybridization, sam-
ples can be analysed for CNVs. In areas of normal copy
number, equal binding of red and green labelled DNA
is assumed. However, in cases of a patient deletion the
software would detect more or all green fluorescence
compared with red in a genomic location depending on
the presence of a homozygous or heterozygous dele-
tion. Conversely, in the case of a patient duplication
there would be a higher detection of red fluorescence
than green, depending on the number of duplicated
copies (Fig. 2.3).
SNP DNA arrays can also be used to read copy number.
These work by fragmentation of the patient DNA and
labelling with fluorescent dye, and then hybridization
onto a solid surface peppered with allele‐specific oligo-
nucleotide probes. These probes are allele‐specific at sites
of known common variation in the population, and are
 Chapter 2  Molecular Genetics in Paediatric Dermatology 43

Ratio plot 143.39 Mbp. 9q34.3, no genes, no CNVs

4.00

STRUCTURE AND PHYSIOLOGY

3.75

SECTION 1: DEVELOPMENT,
3.50
3.25
3.00
2.75
2.50
2.25
2.00
1.75
1.50
1.25
1.00
0.75
0.50
0.25
0.00
–0.25
–0.50
–0.75
–1.00
–1.25
–1.50
–1.75
–2.00
–2.25
–2.50
–2.75
–3.00
–3.25
–3.50
–3.75
–4.00
24.3
24.2
24.1

23
22.3
22.1
21.3
21.2
21.1
13.3
13.2
13.1
12
11.2
11.1

12

13
21.11
21.12
21.13
21.2
21.31
21.32
21.33
22.1
22.31
22.32
22.33
31.1
31.2
31.3
32
33.1
33.2
33.3
34.11
34.13
34.3
Fig. 2.3  Array comparative genomic hybridization ratio plot depicting a deletion of a large part of chromosome 9p (shown in red), and two small areas of
closely related deletion/duplication (red and green). The chromosomal bands are laid out at the bottom of the figure.

therefore able to give information not only on copy
number but also on genotype at these loci, and on large
areas of homozygosity or hemizygosity.
Multiplex ligation‐dependent probe
amplification [15]
Often the results of aCGH require validation by another
method; the gold standard here is multiplex ligation‐
dependent probe amplification (MLPA). There are com-
panies that provide validated and optimized panels with
probes annealing at many points along a certain gene.
MLPA works on a multiplex PCR basis after specific
probes have annealed to the designated DNA regions.
Using specialized analysis software the designed probes
can identify CNVs in the gene under investigation. A
schematic showing the interpretation of MLPA results is
explained in Fig.  2.4. MLPA is the preferred method for
diagnostic reporting where pathological CNVs are known
to be causative of a particular disease.
Quantitative real‐time PCR [16]
Expression analysis of a particular gene can be extremely
useful for validating involvement in a particular disease,
and quantitative real‐time PCR (qRT‐PCR) is often used.
Put simply, this works by obtaining mRNA and using the
retroviral enzyme reverse transcriptase to convert RNA
back to DNA to a form known as complementary DNA
(cDNA). cDNA contains all the relevant information on
expression level and is preferable to work with as it is
more stable than mRNA and therefore less likely to
degrade during the handling process.
It is now possible to extract mRNA directly from blood
using specialized kits, however this is only useful if the
gene of interest is expressed in white blood cells and this
is not always the case. Luckily for dermatologists, skin
can be easily biopsied. Different cell types such as fibro-
blasts and keratinocytes can be extracted from a fresh skin
biopsy and then cultured to obtain a large number of cells
to work with. Additionally, the skin biopsy as a whole can
be used to extract mRNA, resulting in mRNA from all the
cell populations in the skin in one sample.
Two methods are used, differing in how the experiment
technically works: an intercalated dye method such as
SYBR® green, or a probe method such as TaqMan® where
a fluorescent reporter dye is analysed. Both obtain data
on the basis that the amount of cDNA (equating to the
original relative amounts of mRNA) can be quantified as
each round of PCR cycle causes the amount of cDNA to
double during the exponential amplification phase. By
comparing to the expression of a gene that is expressed to
the same level in all cells, known as a ‘housekeeping
gene’, such as glyceraldehyde‐3‐phosphate dehydroge-
nase (GAPDH) or beta‐actin (ACTB), the expression level
of the gene of interest can be calculated. For example, if
 44 Section 1  Development, Structure and Physiology of the Skin

2.5
STRUCTURE AND PHYSIOLOGY
SECTION 1: DEVELOPMENT,

1.5
Peak ratio

0.5

100 150 200 250

(a) Size (bps)

2.5

1.5 Fig. 2.4  Schematic representation of multiplex

Peak ratio

ligation‐dependent probe amplification (MLPA) data.

Blue squares on the right are reference probes showing
1 normal copy number over different chromosomes.
Squares on the left indicate probes for a particular
gene. (a) In this case the gene under investigation
0.5 shows probes in red and above the cut‐off for normal
copy number (depicted by the green lines). This
indicates a duplication of the whole gene. (b) Shows
0 partial deletion of the same gene as five probes are in
green and below the normal cut‐off, but the rest of the
100 150 200 250 gene is of normal copy number as shown by three blue
(b) Size (bps) squares within the lines.

the gene of interest has a significantly lower level of

expression or lacks detectable expression in patient sam-
ples compared to control samples, this can provide fur-
ther evidence that the mutation is causative of the disease
under investigation.

Fluorescence in situ hybridization [17]

Fluorescence in situ hybridization (FISH) is another
method that can be used for copy number variations of
genes or indeed whole chromosomes. This works via the
attachment of fluorescently labelled probes to a specified
chromosomal location in an individual cell where the
chromosomes can be visualized microscopically. Fig. 2.5
shows the presence of three copies of chromosome 21,
which is the karyotype of an individual with Down syn-
drome, in a cell during metaphase of cell division.

Genome‐wide association studies [18]

Sometimes it is extremely challenging to find specific
gene candidates associated with a disease. This is espe-
cially the case for disorders that are likely to be polygenic.
In these cases a genome‐wide association study (GWAS)
may be helpful. This works by analysing the genotype of
a set of patients with a particular condition, for example
Fig. 2.5  Fluorescence in situ hybridization showing three copies of
chromosome 21 during metaphase as depicted by the red fluorescent probe
in a single cell of an individual with Down syndrome. The two control green
probes are hybridized to chromosome 13. Chromosomes are stained in blue.
 Chapter 2  Molecular Genetics in Paediatric Dermatology
psoriasis, compared to a control cohort without clinical
signs or a family history of psoriasis. By genotype in this
example we are interested in single base variations at
locations throughout the genome known as SNPs. If there
is an association with a particular set of SNPs in the dis-
ease cohort compared to the control cohort, this may give
valuable information regarding areas of the genome that
require further investigation.
Other commonly‐encountered techniques
Polymerase chain reaction (PCR)
PCR is a technique whose discovery revolutionized
molecular biology [19,20], earning its inventor Kary
Mullis a Nobel Prize in 1993. It forms the basis of many
other techniques in molecular genetics. It exploits a class
of enzymes known as DNA polymerases, which will copy
double‐stranded DNA from single‐stranded DNA. The
function of PCR is to selectively amplify one area of the
genome, such as the area carrying a mutation of interest,
so that large quantities of DNA just from that area are pro-
duced. Taq polymerase is combined with the DNA tem-
plate (from a patient), two specific oligonucleotide
primers which are designed by the researcher to flank
either side of the area of interest, and other reagents
including base pairs for construction of new DNA. The
reaction involves multiple rounds of increasing the tem-
perature to around 96° C to cause double‐stranded tem-
plate DNA denaturation (separation of the two strands),
lowering of the temperature (variable) to allow the prim-
ers to stick to their relevant complementary strands, and
increasing the temperature again to 72° C which is the
optimum temperature for Taq polymerase function. This
process is usually repeated 35 times and the production of
DNA proceeds exponentially. The DNA produced is
known as the PCR product, and is used then in Sanger
sequencing, genotyping or cloning.
Methods for genotyping specific base
pair changes
There are various methods used for genotyping specific
base pair changes that avoid the need to sequence the
DNA. These rely on the difference in the sequence at the
particular base pair in question, either by using a restric-
tion enzyme which recognizes one of the alleles (wild‐
type or mutant), or by recognition of the differing
properties of the two alleles during changes of tempera-
ture. Examples of such genotyping methods are high‐
resolution melt PCR (HRM), restriction fragment length
polymorphisms (RFLPs) and amplification‐refractory
mutation system (ARMS).
Small interfering RNA [21]
Small interfering RNAd (siRNA) are synthetic RNA
­oligonucleotides which are designed to be complemen-
tary to the RNA transcript of a DNA sequence of interest.
When the DNA is transcribed to RNA in the presence of the
siRNA, the siRNA binds to the specific RNA transcript,
45
creating double‐stranded RNA. Owing to a n ­atural
STRUCTURE AND PHYSIOLOGY
mechanism within cells this double‐stranded RNA is then
SECTION 1: DEVELOPMENT,
degraded by the cell. This therefore prevents translation
of the RNA into protein, and effectively stops or reduces
expression of the protein. This molecular genetic tech-
nique is therefore useful for studying the effects of
removal of the protein product from the cell, and by infer-
ence can help with working out what that gene usually
does. Alternatively, siRNA has been suggested to be used
as therapy for diseases in paediatric dermatology where a
mutation is leading to overexpression of a protein. This is
therefore a type of gene therapy for skin disease and is
being researched in paediatric dermatology conditions.
­References
1 Lander ES, Linton LM, Birren B et  al. Initial sequencing and
analysis of the human genome. Nature 2001;409:860–921.
2 Sanger F, Coulson AR. A rapid method for determining sequences
in DNA by primed synthesis with DNA polymerase. J Mol Biol
1975;94:441–8.
3 Goodwin S, McPherson JD, McCombie WR. Coming of age: ten
years of next‐generation sequencing technologies. Nat Rev Genet
2016;17:333–51.
4 Lai‐Cheong JE, McGrath JA. Next‐generation diagnostics for
inherited skin disorders. J Invest Dermatol 2011;131:1971–3.
5 Takeichi T, Liu L, Fong K, et al. Whole‐exome sequencing improves
mutation detection in a diagnostic epidermolysis bullosa laboratory.
Br J Dermatol 2015;172:94–100.
6 Bhoj EJ, Yu Z, Guan Q et al. Phenotypic predictors and final diagnoses
in patients referred for RASopathy testing by targeted next‐generation
sequencing. Genet Med 2017;19:715–8.
7 Scott CA, Plagnol V, Nitoiu D et al. Targeted sequence capture and
high‐throughput sequencing in the molecular diagnosis of ichthyosis
and other skin diseases. J Invest Dermatol 2013;133:573–6.
8 Rodriguez‐Revenga L, Mila M, Rosenberg C et  al. Structural
variation in the human genome: the impact of copy number variants
on clinical diagnosis. Genet Med 2007;9:600–6.
9 Lee C, Iafrate AJ, Brothman AR. Copy number variations and
clinical cytogenetic diagnosis of constitutional disorders. Nat Genet
2007;39:S48–S54.
10 Carter NP. Methods and strategies for analyzing copy number
variation using DNA microarrays. Nat Genet 2007;39:S16–S21.
11 Shen Y, Wu BL. Microarray‐based genomic DNA profiling technol-
ogies in clinical molecular diagnostics. Clin Chem 2009;55:659–69.
12 Barnes MR. Genetic variation analysis for biomedical researchers: a
primer. Methods Mol Biol 2010;628:1–20.
13 Dumanski JP, Piotrowski A. Structural genetic variation in the
­context of somatic mosaicism. Methods Mol Biol 2012;838:249–72.
14 Hall IM, Quinlan AR. Detection and interpretation of genomic
structural variation in mammals. Methods Mol Biol 2012; 838:225–48.
15 Schouten JP, McElgunn CJ, Waaijer R et al. Relative quantification
of 40 nucleic acid sequences by multiplex ligation‐dependent probe
amplification. Nucleic Acids Res 2002;30:e57.
16 Mocellin S, Rossi CR, Pilati P et al. Quantitative real‐time PCR: a
powerful ally in cancer research. Trends Mol Med 2003;9:189–95.
17 Trask BJ. Gene mapping by in situ hybridization. Curr Opin Genet
Dev 1991;1:82–7.
18 Visscher PM, Brown MA, McCarthy MI, Yang J. Five years of GWAS
discovery. Am J Hum Genet 2012;90:7–24.
19 Mullis K, Faloona F, Scharf S et al. Specific enzymatic amplification
of DNA in vitro: the polymerase chain reaction. Cold Spring Harb
Symp Quant Biol 1986;51:263–73.
20 Saiki RK, Gelfand DH, Stoffel S et  al. Primer‐directed enzymatic
amplification of DNA with a thermostable DNA polymerase.
Science 1988;239:487–91.
21 Sarkies P, Miska EA. Small RNAs break out: the molecular cell
biology of mobile small RNAs. Nat Rev Mol Cell Biol 2014;15:
525–35.