Developmental and Comparative Immunology 51 (2015) 10–21

Contents lists available at ScienceDirect

Developmental and Comparative Immunology

j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Scavenger receptor B protects shrimp from bacteria by enhancing

phagocytosis and regulating expression of antimicrobial peptides
Wen-Jie Bi a,1, Dian-Xiang Li b,1, Yi-Hui Xu a, Sen Xu a, Jing Li a, Xiao-Fan Zhao a,
Jin-Xing Wang a,*
a Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Jinan 250100, China
b Biotechnology Department, School of Biological Sciences and Biotechnology, University of Jinan, Jinan 250022, China

A R T I C L E I N F O A B S T R A C T

Article history: Scavenger receptors (SRs) are involved in innate immunity through recognizing pathogen-associated mo-
Received 29 December 2014 lecular patterns (PAMPs) and in pathogenesis of diseases through interactions with damage-associated
Revised 4 February 2015 molecular patterns (DAMPs). The roles of SRs in invertebrate innate immunity still need to be eluci-
Accepted 5 February 2015
dated. Here we identify a class B scavenger receptor from kuruma shrimp, Marsupenaeus japonicus,
Available online 16 February 2015
designated MjSR-B1. The recombinant MjSR-B1 agglutinated bacteria in a calcium dependent manner and
bound lipopolysaccharide and lipoteichoic acid. After knockdown of MjSR-B1, both the bacterial clear-
Keywords:
ance and phagocytotic ability of M. japonicus against V. anguillarum and S. aureus were impaired, and several
Scavenger receptors
Phagocytosis phagocytosis related genes were downregulated. The expression levels of antimicrobial peptides were
Innate immunity also downregulated. Overexpression of MjSR-B1 led to enhanced bacterial clearance, phagocytosis rate
Marsupenaeus japonicus and upregulation of phagocytosis-related and antimicrobial peptide genes. However, overexpression of
Bacteria mutant MjSR-B1ΔC, which lacks the carboxyl tail of MjSR-B1, had none of these effects. Our results in-
dicate that MjSR-B1 can protect shrimp from bacteria by promoting phagocytosis and by enhancing the
expression of antimicrobial peptides.
© 2015 Elsevier Ltd. All rights reserved.

1. Introduction
A variety of pattern recognition receptors (PRRs) have been iden-
tified, including cytoplasmic proteins such as NOD-like receptors
(NLRs) and the Retinoic acid-inducible gene (RIG)-I-like receptors
(RLRs), and transmembrane proteins such as the Toll-like receptors
(TLRs), C-type lectin receptors (CLRs) and scavenger receptors (SRs)
(Pluddemann et al., 2011). More than 11 types of pattern recogni-
tion receptors have been identified in shrimp (Wang and Wang, 2013).
These PRRs are involved in innate immunity by recognition of
pathogen-associated molecular patterns (PAMPs), which are con-
served structures among microbial species (Janeway and Medzhitov,
2002). Among PRRs, the scavenger receptor was first defined by Gold-
stein and Brown in 1979 by its ability to bind to and internalize
oxidized low-density lipoprotein (oxLDL) (Brown et al., 1979). SRs
comprise a large family of transmembrane cell surface glycopro-
teins that can bind modified low-density lipoproteins (LDLs), multiple
polyanionic ligands and cell wall components (Canton et al., 2013;
Wang and Wang, 2013). In recent years, many scavenger receptors
* Corresponding author. School of Life Sciences, Shandong University, Jinan,
Shandong 250100, China. Tel.: +86 531 88364620; fax: +86 531 88364620.
E-mail address: jxwang@sdu.edu.cn (J.-X. Wang).
1 Equal contributions to this work.
have been discovered and the definition has been broadened to eight
different classes (A–H) (Canton et al., 2013). At the same time, the
emphasis of SR research has broadened from their roles in lipid
metabolism-relevant disorders (Pluddemann et al., 2007) and in host
defense against pathogens in innate immunity (Canton et al., 2013).
SRs have dual cellular roles: they are PRRs of the immune system,
resulting in removal of bacteria by recognition of PAMPs, and also
‘scavengers’ of apoptotic cells and cellular debris by recognizing
damage-associated molecular patterns (DAMPs). A working defini-
tion was recently proposed in a workshop: SRs are cell surface
receptors that typically bind multiple ligands and promote the removal
of non-self or altered self-targets. They often function by mecha-
nisms that include endocytosis, phagocytosis, adhesion, and signaling,
that ultimately lead to the elimination of degraded or harmful sub-
stances (Prabhudas et al., 2014).
Class B scavenger receptors (SR-Bs), such as SR-BI, SR-BII, CD36
and LIMP2 in mammals, have two transmembrane domains flank-
ing an extracellular loop, with both the amino- and carboxyl-
termini located in the cytoplasm (Neculai et al., 2013). SR-Bs mainly
distribute in macrophages, microglia, the microvascular endothe-
lium, and platelets in vertebrates. Through binding to different ligands
(DAMPs or PAMPs), CD36, a member of the SR-B family, partici-
pates in diverse processes, including angiogenesis, atherosclerosis,
metabolism, and sensory perception (Stuart et al., 2005). Further-
more, like other scavenger receptors, SR-Bs form signalosomes,

http://dx.doi.org/10.1016/j.dci.2015.02.001
0145-305X/© 2015 Elsevier Ltd. All rights reserved.
 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21
components of heteromultimeric signaling complexes, with nu-
merous transmembrane receptors, such as TLRs, integrins and
tetraspanins, to participate in host defense against pathogens (Sharif
et al., 2013). According to research on CD36 deficient mice and
human HEK293 cell lines, CD36 may mediate bacterial recogni-
tion, phagocytosis and initiate signal transduction though interaction
with TLR2/6 when challenged by various ligands or bacteria, in-
cluding Gram-positive and Gram-negative bacteria (Baranova et al.,
2008, 2012; Sharif et al., 2013; Triantafilou et al., 2006; Vishnyakova
et al., 2006). CD36 also cooperates with a TLR4/6 heterodimer, but
this occurs following sterile inflammation, such as that mediated
by OxLDL not by PAMPs (Stewart et al., 2010). It has been re-
ported that the C-terminal region of SR-Bs functions as a docking
site for signal transduction (Rahaman et al., 2006), and a non-
sense mutation of CD36 which removed 133 residues at the carboxyl-
terminus of the polypeptide chain in mice blocked the signal
transduction and led to immunodeficiency (Hoebe et al., 2005).
SR-Bs have also been reported in invertebrates. Several SR-B genes
were identified in Drosophila melanogaster and Anopheles gambiae
(Christophides et al., 2004). Drosophila CD36 paralog Croquemort,
a class B member of the SR family, is one of the best characterized
SRs in D. melanogaster. Croquemort is a macrophage receptor that
recognizes apoptotic cells (Franc et al., 1996). It can also act as a
phagocytic receptor of Gram-positive bacteria (Areschoug and
Gordon, 2009; Stuart et al., 2005). A Croquemort homolog,
MjCroquemort, the only SR family member identified so far in
shrimp, was reported in Marsupenaeus japonicus. The tissue distri-
bution and expression patterns of MjCroquemort were analyzed
(Mekata et al., 2011), but the function of Croquemort in shrimp needs
to be clarified.
In this work, we describe identification of a new member of the
SR-B family in kuruma shrimp M. japonicus, designated MjSR-B1. Its
expression was upregulated by Gram-positive and Gram–negative
bacterial challenges. In vitro experiments indicated that MjSR-B1
could bind to and agglutinate both Gram-positive and Gram-
negative bacteria. RNA interference of MjSR-B1 impaired the clearance
of bacteria, reduced the phagocytotic rate of shrimp hemocytes and
decreased the expression level of phagocytosis related and antimi-
crobial peptide (AMP) genes. Moreover, overexpression of MjSR-
B1 facilitated the clearance of bacteria, enhanced the phagocytotic
rate and increased the expression level of phagocytosis related genes
and AMP genes. Hence we report, for the first time to our knowl-
edge, that MjSR-B1 is a phagocytic receptor both of Gram-positive
and Gram-negative bacteria and the receptor can regulate expres-
sion of antimicrobial peptides in shrimp.
2. Materials and methods
2.1. Reagents and microorganisms
Peptidoglycan (PG) and lipoteichoic acid (LTA) from Staphylo-
coccus aureus and lipopolysaccharide (LPS) from Escherichia coli
055:B5 were purchased from Sigma (St. Louis, MO, USA). E. coli and
Vibrio anguillarum were maintained in our laboratory. Bacillus subtilis,
B. megaterum, B. thuringiensis, S. aureus, Klebsiella pneumoniae and
Pseudomonas aeruginosa were gifts from Shandong Agricultural
University.
2.2. Bacterial challenge and tissue collection
Shrimp M. japonicus (individuals weighing 10–15 g) were ob-
tained from an aquatic product market in Jinan, Shandong Province,
China, nurtured in sea water at 21 °C in laboratory tanks and fed
with commercial food. For bacterial challenge experiments, each
shrimp was injected abdominally with 20 μl of S. aureus (2 × 107 CFU)
or V. anguillarum (2 × 107 CFU) by using a microliter syringe (Wang
11
et al., 2009). For negative controls, another group of shrimp was in-
jected with the same volume of phosphate-buffered saline (PBS;
140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4,
pH 7.4). Hemolymph was extracted from the ventral sinus using a
syringe with a 1/10th volume of 10% sodium citrate as anticoagu-
lant buffer, and then immediately centrifuged at 800 × g for 15 min
at 4 °C to isolate the hemocytes. Then, other tissues, including heart,
hepatopancreas, gills, stomach and intestine were also extracted.
Three shrimp were chosen for each experiment in case of individ-
ual differences.
2.3. Gene cloning of MjSR-B1
Total RNA (5 μg) was isolated from hemocytes and other tissues
of shrimp with Unizol reagent (Biostar, China) and used for reverse
transcription of cDNA. cDNA was synthesized according to the in-
structions of the SMART cDNA kit (BD Bioscience Clontech, USA),
using the primers Oligo-anchor R and Smart F (Table 1). The cDNA
was diluted 10-fold and then used as the template for PCR analy-
sis. The full length of MjSR-B1 was amplified with specific primers
(MjSR-B1exF and MjSR-B1exR), which were designed based on the
unigene from the hemocyte transcriptome sequence of M. japonicus
(Table 1).
2.4. Semi-quantitative RT-PCR and quantitative real-time
RT-PCR (qRT-PCR)
The tissue distribution of MjSR-B1 was determined by qRT-PCR
with primers MjSR-B1 rtF and MjSR-B1rtR (Table 1). Actin F and actin
R (Table 1) were used to amplify β-actin as the internal control. The
qRT-PCR was performed as follows: 1 cycle at 95 °C for 10 min, 40
cycles at 95 °C for 15 s and 60 °C for 1 min, and then read at 78 °C
for 2 s. The comparative CT method (2−ΔΔCT method) was used to
analyze the expression pattern. The discrepancy between the CT of
MjSR-B1 and β-actin was calculated to normalize the variation in
the amount of cDNA in each reaction. The hemocytes collected from
0, 2, 6, 12, 24 and 48 h post V. anguillarum or S. aureus challenged
shrimp were used for expression pattern analysis of MjSR-B1 by qRT-
PCR with primers MjSR-B1 rtF and MjSR-B1 rtR. Data were analyzed
by the unpaired t-test and significant difference was accepted at
p < 0.05.
2.5. Recombinant expression and purification of the extracellular
region of MjSR-B1
A pair of primers (MjSR-B1exnomF and MjSR-B1exnomR)
(Table 1) were designed on the basis of the full-length sequence of
MjSR-B1 cDNA to amplify the fragment that encodes the extracel-
lular region of MjSR-B1. The fragment was digested with restriction
enzymes EcoRI and XhoI and then subcloned into the pET-32a(+)
plasmid. The recombinant vector was transformed into compe-
tent E. coli Rosetta cells for protein expression. The recombinant
protein was expressed in inclusion bodies and purified using fol-
lowing method: Briefly, the inclusion bodies were washed twice with
10 ml buffer A (50 mM Tris–HCl, 5 mM EDTA, pH 8.0), and then
washed twice with 10 ml buffer B (50 mM Tris–HCl, 5 mM EDTA,
2 M urea, pH 8.0). Subsequently, the inclusion bodies were dis-
solved in 10 ml buffer C (50 mM Tris–HCl, 5 mM EDTA, 8 M urea,
pH 8.0). The protein was refolded through dialyzed in 1 l dialysate
solution (50 mM NaCl, 5 mM cysteine, 50 mM Tris–HCl, pH 8.0) for
three times (4 °C, 16 h). The solution was then purified with His Bind
resin chromatography (Novagen) according to the manufacturer’s
instruction.
12 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Table 1 2.7. Bacterial binding assay and Western blotting

Sequences of primers used in this study.

Primer Sequence (5′–3′) All eight species of bacteria mentioned earlier were used for
Primers for reverse binding assays. Each bacterium (1 × 107 CFU) was incubated with
transcription 20 μg of recombinant MjSR-B1 in a total volume of 600 μl for 30 min
SMART F TACGGCTGCGAGAAGACGACAGAAGGG at room temperature with gentle rotation. The bacteria were cen-
Oligo anchor R GACCACGCGTATCGATGTCGACT16(A/C/G) trifuged and washed twice with 1 ml PBS, and then eluted with
Primers for
real-time
100 μl 7% SDS solution. After centrifugation, The eluted solution and
quantitative PCR deposited bacteria were collected and used for Western blotting to
β-Actin rtF GCATCATTCTCCATGTCGTCCCAGT detect the bacterial binding ability of MjSR-B1 with the following
β-Actin rtR TACGGCTGCGAGAAGACGACAGAA method: The deposited bacteria were resuspended in 100 μl PBS,
MjSR-B1rtF TGCCCACCTCACAAACTCAC
then 50 μl of SDS–PAGE reduced loading buffer were added. The
MjSR-B1rtR GCACACAACGCATCACACTT
Myosin rtF GTTGAGGTCGGACTTGG mixture was heated at 100 °C for 5 min and centrifuged again, and
Myosin rtR TGACAACCAGGACACCC the supernatants were separated by 12.5% SDS–PAGE. The SDS-
Rab5 rtF TTCCTCCCGTCACTCCAAG eluted solution was treated in the same way. After electrophoresis,
Rab5 rtR AGCCGTGTCCCAAATCTCA the proteins were transferred to nitrocellulose membrane using
Lamp1 rtF TTTTTGGGGGGGAGGGTA
Lamp1 rtR TGACACTCTGGAATCATTGCTTG
transfer buffer (48 mM Tris–HCl, 39 mM glycine, 1.28 mM SDS and
Arp rtF TCAGGAAGAACGACTGGGGT 20% methanol) for Western blotting. Monoclonal anti-polyhistidine
Arp rtR TGTGGATTTGAGGCGAGGTA antibody (1:2000 dilution in TBS containing 1.5% nonfat milk) was
Cru-I1 rtF TGATTCAACCGCAGCCTACA used as primary antibody against His-tagged MjSR-B1; alkaline
Cru-I1 rtR CAGCACTTCTGGTGGGACG
phosphatase-conjugated horse anti-mouse IgG (1:10,000 dilution
Cru-I2 rtF GCGTTTTCGTCTTCGTCCTG
Cru-I2 rtR AATGATTGGTGGTTTCACGGTAG in TBS containing 1.5% nonfat milk) was the secondary antibody.
Cru-I3 rtF CAAGCCCTCCACCACTCTCG
Cru-I3 rtR TTCCTGGGTTGCGGTCACA 2.8. Polysaccharide-binding analysis of recombinant MjSR-B1
Cru-I4 rtF TGCGAAACAGACAGGGATTGC
Cru-I4 rtR CCGAAGACCAGATGACCGAAA
Alf-A1 rtF CTGGTCGGTTTCCTGGTGGC
To test the binding ability of MjSR-B1 to different bacterial com-
Alf-A1 rtR CCAACCTGGGCACCACATACTG ponents, an ELISA assay was performed as described previously (Shi
Alf-B1 rtF CGGTGGTGGCCCTGGTGGCACTCTTCG et al., 2012). Lipoteichoic acid (LTA), peptidoglycan (PG) and lipo-
Alf-B1 rtR GACTGGCTGCGTGTGCTGGCTTCCCCTC polysaccharide (LPS) were used in this assay. Each of these ligands
Alf-D1 rtF GCTTTTTATTTTGGGGGTCACGCTGT
was coated on the wells of flat-bottomed 96-well microliter plates
Alf-D1 rtR CTTTGGCGTGGAACAAGGTAGAGGAT
Alf-E1 rtF TCCTAACCACGCAGTGCTTTGCTAATG at 37 °C for 20 h, and then evaporated at 60 °C for 30 min. Every well
Alf-E1 rtR GCTTTTCGGATTTGCCTTCGATGTTTG was coated with 4 μg ligand in a volume of 50 μl. Then, 100 nM of
Primers for protein purified recombinant MjSR-B1, or the His-tag used as the control,
expression diluted in binding buffer (50 mM Tris–HCl, 50 mM NaCl, pH 8.0) con-
MjSR-B1 exF TACTCAGAATTCCACCTGTGCCGATCTTCATGC
taining 0.1 mg/ml BSA, were added to each coated well of the plates
MjSR-B1 exR TACTCAGTCGACTCACAGTTCCGCCGTGTAGAG
MjSR-B1nomexF TACTCAGAATTCAAGTTCCAAAGCGTCTTCGAC (50 μl/well) and incubated at 37 °C for 3 h. Plates were washed four
MjSR-B1nomexR TACTCAGTCGACTCAGCGGTGGAGCGCCTGAGTGC times with binding buffer (each for 5 min), and then 100 μl mouse
Primers for RNA monoclonal polyhistidine antibody (Sigma, 1:3000 dilution in binding
interference
buffer containing 0.1 mg/ml BSA) was added to each well and in-
dsMjSR-B1 F TAATACGACTCACTATAGGTACGCGGAGTTCCAGCGCGA
dsMjSR-B1 R TAATACGACTCACTATAGGCGTTCTCCTTGTCTCCCT cubated at 37 °C for 2 h. After the plates were washed again four
dsGFP F GCGTAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC times with binding buffer, 100 μl alkaline phosphatase-conjugated
dsGFP R GCGTAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC goat anti-mouse IgG (Sigma, 1:2000 dilution in binding buffer con-
Primers for taining 0.1 mg/ml BSA) was added to each well and incubated at
overexpression
37 °C for 2 h. After another four washes, 50 μl p-nitro-phenyl phos-
MjSR-B1 overexF TAATACGACTCACTATAGGGAGAATGAATGTGAAGATCCAAAT
MjSR-B1 overexR TTAATTCGCGGCCGCCTAATGATGATGATGATGGTGTTCAT phate (1 mg/ml in 10 mM diethanolamine, 0.5 mM MgCl2) was added
AATTCGCCGT to each well of the plates and incubated for 20 min at room tem-
MjSR-B1ΔC TCAATGATGATGATGATGGTGCACGGCCGCCACCACCAGCA perature. The absorbance of each well was measured at 405 nm using
overexR
a plate reader (Bio-Tek instruments). Specific binding was calcu-
lated by subtracting the total binding of the control His-tag protein
from the total binding of MjSR-B1 protein. Each binding assay was
performed three times.

2.6. Bacterial agglutination assay 2.9. RNA interference of MjSR-B1 and bacterial clearance assay

Four species of Gram-positive bacteria (S. aureus, B. subtilis, B.
megaterum, and B. thuringiensis) and four of Gram-negative bacte-
ria (V. anguillarum, E. coli, K. pneumoniae, and P. aeruginosa) were
cultured in LB medium (1% tryptone, 1% NaCl, 0.5% yeast extract)
to the logarithmic phase, harvested by centrifugation at 5000 × g
for 5 min, and then resuspended in TBS to a final OD600 of 0.4. Then
the diluted bacteria (25 μl) were incubated with the same volume
of recombinant MjSR-B1 (concentration from 12.5 to 200 μg/ml),
with or without 10 mM CaCl2, for 1 h at 28 °C. The His-tag ex-
pressed in E. coli with the bared pET-32a(+) vector was used as the
control. Microscopy (Nikon ECLIPSE TE2000-U, Japan) was used to
observe agglutination. All the assays were performed in triplicate.
Primers dsMjSR-B1F and dsMjSR-B1R (Table 1) were used to
amplify a nucleotide fragment from MjSR-B1 as the template to syn-
thesize the double-strand RNA (dsRNA) of MjSR-B1 with T7 RNA
polymerase (Fermentas, Thermo Fisher Scientific, USA). DsRNA of
MjSR-B1 (60 μg) was injected into the abdominal segment of shrimp
and another 60 μg was injected 24 h later. For the control group,
the same dose of dsRNA of green fluorescent protein (GFP) was in-
jected synchronously. After second injection, shrimp hemocytes were
collected for qRT-PCR analysis using primers MjSR-B1rtF and MjSR-
B1rtR to measure the efficiency of the RNA interference of MjSR-
B1. The internal control used in qRT-PCR was β-actin. After
knockdown of MjSR-B1 (24 h of the second injection), 20 μl S. aureus
 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21
or V. Anguillarum (2 × 107 CFU) was injected into shrimp for bacte-
rial clearance assays. The bacterial clearance assays were performed
as follows: after 1 h injection of S. aureus or V. anguillarum, the he-
molymph of each group was collected and gradient diluted. The
1000-fold diluted hemolymph was smeared onto LB-agar plates or
2216E-agar plates. The plates were incubated at 37 °C for about 24 h,
and the number of bacteria on the plates were counted and calcu-
lated as amount per milliliter of shrimp hemolymph (CFU).
2.10. Overexpression of MjSR-B1
Primers MjSR-B1overexF and MjSR-B1overexR (Table 1) were used
to amplify the ORF of MjSR-B1. As a control, primers MjSR-B1overexF
and MjSR-B1ΔCoverexR were used to amplify the sequence of MjSR-
B1ΔC, which lacks the C-terminus of MjSR-B1. Both MjSR-B1overexR
and MjSR-B1ΔCoverexR contain the nucleotide sequence for six ad-
jacent histidines, which were used for detection. The double stranded
DNA containing the MjSR-B1 sequence and a His-tag encoding se-
quence was used as template to transcribe the capped MjSR-B1
mRNA with the T7 RNA polymerase in vitro transcription kit (Ambion,
Inc.) according to the manufacturer’s instructions. Each shrimp was
injected in the abdominal segment with 3 μM MjSR-B1 mRNA. For
the control group, each shrimp was injected synchronously with the
same dose of MjSR-B1ΔC mRNA. After 24 h of mRNA injection, the
hemolymph of each group was collected for Western blot analysis
to measure the efficiency of overexpression, using anti-His-tag mono-
clonal primary antibody. The S. aureus or V. anguillarum (2 × 107 CFU)
were injected into shrimp 24 h post mRNA injection, and bacterial
clearance assays were conducted as described earlier.
2.11. Fluorescent labeling of bacteria and phagocytosis assay
V. anguillarum and S. aureus were labeled with fluorescent
isothiocyanate (FITC) (Sigma, USA) as previously described (Xu et al.,
2014). After being washed twice with PBS, the bacteria were heated
at 70 °C for 30 min, then washed with 0.1 M NaHCO3 and incu-
bated in 0.1 M NaHCO3 containing 0.1 mg/ml FITC for 1 h at room
temperature. Subsequently, the FITC-labeled bacteria were rinsed
with PBS until there was no visible dissociated FITC. Each shrimp
was injected in the abdominal segment with 10 μl FITC-labeled bac-
teria (1 × 109 CFU/ml). The phagocytosis assay was performed as
follows: 30 min after bacterial injection, the hemolymph was col-
lected in a 5 ml syringe containing 1 ml of anticoagulant. Then the
hemolymph was centrifuged at 700 × g for 5 min at 4 °C and resus-
pended 3:1 (v/v) in 1 ml anticoagulant containing 4%
paraformaldehyde. After incubation on ice for 10 min and washing
with PBS twice, the fixed hemocytes were dropped onto poly-l-
lysine coated glass slides and incubated for 1 h. After five washes,
hemocytic phagocytosis was examined under a fluorescence mi-
croscope (Olympus BX51, Japan). The remainders of the fixed
hemocytes were used to examine the phagocytosis ratio by flow
cytometry, using the CELL Quest program (Becton Dickinson, USA).
Phagocytosis percentage was defined as [the hemocytes ingesting
bacteria/all cells observed or tested] × 100%. The assay was per-
formed three times and data were analyzed by one-way ANOVA.
2.12. Real time quantitative PCR analysis for phagocytosis related
genes and antimicrobial peptides genes
After knockdown or overexpression of MjSR-B1, the shrimp were
challenged by V. anguillarum or S. aureus. The hemocytes were col-
lected to extract RNA 1 h after bacterial injection. qRT-PCR was
performed to test the expression level of phagocytosis related genes
and antimicrobial peptide genes. The phagocytosis related genes in-
cluded Myosin (Myosin rtF and Myosin rtR); actin-related protein,
Rab5 (Rab5 rtF and Rab5 rtR); Lamp1 (Lamp1 rtF and Lamp1 rtR);
13
and Arp (Arp rtF and Arp rtR). The antimicrobial peptides were Crustin
I-1 (Cru-I1 rtF and Cru-I1 rtR); Crustin I-2 (Cru-I2 rtF and Cru-I2 rtR);
Crustin I-3 (Cru-I3 rtF and Cru-I3 rtR); Crustin I-4 (Cru-I4 rtF and
Cru-I4 rtR); antilipopolysaccharide factor A1 (Alf-A1) (Alf-A1rtF and
Alf-A1rtR); Alf-B1 (Alf-B1rtF and Alf-B1rtR); Alf-D1 (Alf-D1rtF and
Alf-D1rtR); and Alf-E1 (Alf-E1rtF and Alf-E1rtR).
3. Results
3.1. The cDNA of MjSR-B1 was cloned and identified
The full length cDNA of MjSR-B1 is 2618 bp with an open reading
frame (ORF) of 1524 bp, a 5′ untranslated region (UTR) of 504 bp
and a 3′ untranslated region of 590 bp (GenBank accession no.
KP121407). The ORF of the deduced protein comprises 507 amino
acids. The theoretical molecular mass of MjSR-B1 is 56.87 kDa, and
its isoelectric point is 8.48. The MjSR-B1 has a CD36 domain that
contains two transmembrane regions at the N- and C-terminals of
the protein (SMART analysis: http://smart.embl-heidelberg.de/)
(Fig. S1). BLASTX (http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis
showed that the MjSR-B1 has 38% identity with LIMP2 of tilapia
Oreochromis niloticus, and 37% identity with CD36 of barred knifejaw
Oplegnathus fasciatus. The results of multiple alignments showed
relatively low conservation of the SR-B family (Fig. S2). A three-
dimensional model of the MjSR-B1 was constructed by the on line
software SWISS-MODEL (http://swissmodel.expasy.org/) (Fig. 1A).
We selected some SR-As, SR-Bs and SR-Cs from GenBank for phy-
logenetic analysis using protein sequences; as might be expected,
the selected SRs were divided into three groups, SR-A, SR-B and SR-
C. The SR-Bs were divided into two subgroups. MjCroquemort
belongs to subgroup I, while MjSR-B1 belongs to subgroup II (Fig. 1B).
3.2. Tissue distribution and expression patterns of MjSR-B1
qRT-PCR was performed to analyze the tissue distribution of
MjSR-B1. The results showed that MjSR-B1 transcripts were mainly
detected in hemocytes, hepatopancreas and heart, with almost no
expression in gill and intestine (Fig. 2A). The temporal expression
patterns of MjSR-B1 in hemocytes after bacterial challenge were also
analyzed by qRT-PCR. Fig. 2B showed that the mRNA expression level
of MjSR-B1 was upregulated 2 h and 48 h post V. anguillarum chal-
lenge. When challenged by S. aureus, the expression of MjSR-B1
was dramatically upregulated from 2 h to 48 h after bacterial
challenge (Fig. 2C).
3.3. MjSR-B1 agglutinates bacteria
The extracellular region of MjSR-B1 was expressed in E. coli
Rosetta and purified chromatographically (Fig. 3A). Since the re-
combinant protein constitutes the extracellular region of MjSR-B1
(46.90 kDa) plus a His-tag, the molecular mass was as expected. We
investigated the agglutinating ability of this recombinant MjSR-
B1. MjSR-B1 could agglutinate the eight kinds of bacteria we tested
and the agglutination was calcium dependent (Fig. 3B). The minimal
agglutinating concentration (MAC) for each bacterium is shown in
Table 2.
3.4. MjSR-B1 bound to bacteria and polysaccharides
Eight kinds of bacteria were used in MjSR-B1 binding assays. Re-
combinant MjSR-B1 bound strongly to S. aureus, B. megaterum, V.
anguillarum and P. aeruginosa, and bound weakly to the other four
bacteria tested (Fig. 4A). To clarify whether the bacterial binding
ability of MjSR-B1 was due to binding of cell surface polysaccha-
rides, ELISA assays were performed to detect the binding ability of
MjSR-B1 to peptidoglycan (PGN), lipopolysaccharide (LPS) and
14 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Fig. 1. A three-dimensional model of the MjSR-B1 and phylogenetic tree of SRs from shrimp and other species based on protein sequences. (A) A three-dimensional model
of the MjSR-B1 was constructed by the on line software SWISS-MODEL (http://swissmodel.expasy.org/). The template ID is 4q4b1. EX, extracellular region; TM, transmem-
brane region; CP, cytoplasmic tail. (B) Phylogenetic tree. MEGA 4.0 was used to make a neighbor-joining phylogenetic tree. The black triangle marks MjSR-B1. The bootstrap
is 1000, and the bar shows the relative distance of genetic variation.
 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21 15

Fig. 2. Expression patterns of MjSR-B1. (A) Tissue distribution analysis of MjSR-B1 expression in unchallenged shrimp by qRT-PCR. β-Actin transcription was used as the
control. (B and C) Temporal expression patterns of MjSR-B1 in hemocytes after challenge by V. anguillarum or S. aureus, determined by qRT-PCR. All the assays were per-
formed three times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

Fig. 3. MjSR-B1 agglutinated different bacteria. (A) Expression and purification of the extracellular region of MjSR-B1. SDS–PAGE was used to test the expression of MjSR-
B1 in E. coli. Lane M, protein marker; lane 1, proteins of normal E. coli containing pET-32a-MjSR-B1; lane 2, proteins of E. coli pET-32a-MjSR-B1 after induction by 0.5 mM
IPTG; lane 3, purified recombinant MjSR-B1. (B) Bacterial agglutination by recombinant MjSR-B1. The Gram-negative bacterium V. anguillarum was used for the agglutina-
tion assay. The His-tag from pET-32a(+) was used as the control.
16 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Table 2 that both MjSR-B1 and MjSR-B1ΔC were successfully expressed in

The minimal agglutinating concentrations of MjSR-B1. shrimp hemocytes. In bacterial clearance assays, overexpression of
Microorganisms Minimal agglutinating MjSR-B1 resulted in a significant enhancement of the bacterial clear-
concentration (MAC, μg/ml) ance ability, in contrast to overexpressed MjSR-B1ΔC (Fig. 5E). These
Gram-positive bacteria data suggest that MjSR-B1 plays a vital role in the process of bac-
Staphylococcus aureus 25 terial clearance.
Bacillus subtilis 50
Bacillus megaterum 50
Bacillus thuringiensis 25
3.6. MjSR-B1 mediates phagocytosis in M. japonicus
Gram-negative bacteria
Vibrio anguillarum 50 To investigate the mechanism of how MjSR-B1 facilitates
Klebsiella pneumoniae 12.5 bacterial clearance, phagocytosis assays were performed after MjSR-
Escherichia coli 50
B1 was knocked down or overexpressed. The results showed that
Pseudomonas aeruginosa 25
knockdown of MjSR-B1 significantly decreased the phagocytic rate
for Gram-positive and Gram-negative bacteria (Fig. 6A) whereas
overexpression of MjSR-B1 significantly enhanced hemocyte phago-
lipoteichoic acid (LTA). The data indicate that rMjSR-B1 could bind cytosis of Gram-positive and Gram-negative bacteria (Fig. 6B). In
LPS and LTA in a dose-dependent manner, but did not bind to PGN order to confirm these results, we also analyzed hemocyte phago-
(Fig. 4B). cytosis using flow cytometry, which could analyze more than 104
hemocytes (Fig. 6C). The data show that after knockdown of MjSR-
3.5. MjSR-B1 promotes bacterial clearance in M. japonicus B1, the phagocytotic rate declined significantly compared with the
control (Fig. 6D). After overexpression of MjSR-B1, the phagocy-
To investigate the in vivo function of MjSR-B1, RNAi of MjSR-B1 totic rate of hemocytes increased significantly (Fig. 6E). These data
and bacterial clearance assays were performed. qRT-PCR analysis suggest that MjSR-B1 was responsible for hemocyte phagocytosis
indicated that 24 h after dsMjSR-B1 second injection, the mRNA level of both Gram-positive and Gram-negative bacteria.
of MjSR-B1 in hemocytes declined significantly (Fig. 5A). After MjSR-
B1 knockdown, V. anguillarum or S. aureus were injected into shrimp. 3.7. Expression of phagocytotic related genes is mediated
The bacterial clearance ability of hemocytes was impaired in the by MjSR-B1
MjSR-B1-silenced shrimp; the number of both V. anguillarum and
S. aureus in shrimp increased significantly compared with the control To analyze the mechanism of MjSR-B1 enhancement of phagocy-
shrimp (Fig. 5B). Overexpression of MjSR-B1 and mutant MjSR-B1 tosis, qRT-PCR was performed to test the expression levels of
(Fig. 5C) in shrimp were also performed. Western blotting was used phagocytosis related genes. These include phagosome marker gene
to examine the efficiency of MjSR-B1 overexpression. Fig. 5D shows Lamp1 (Huynh et al., 2007), a master regulator of endocytosis Rab5
(Frittoli et al., 2014), a participant of FcγR or CR3 mediated phagocy-
tosis Arp (May et al., 2000), and a switch for efficient phagocytosis
myosin (Dieckmann et al., 2010). Expression of these genes was ana-
lyzed in MjSR-B1-silenced or MjSR-B1-overexpressed shrimp challenged
by V. anguillarum or S. aureus. The results showed that following the
silencing of MjSR-B1, the expression levels of all the genes tested de-
creased significantly compared with controls (Fig. 7A and B), while only
Arp expression level was increased significantly post V. anguillarum chal-
lenge in the MjSR-B1-overexpression shrimp (Fig. 7C) and all the genes
tested increased significantly post S. aureus challenge in the MjSR-B1-
overexpressed shrimp (Fig. 7D). All of these results indicate that MjSR-
B1 participates in an early stage of bacterial phagocytosis.

3.8. Expression of antimicrobial peptides is mediated by MjSR-B1

To investigate whether MjSR-B1 participates in bacterial

Fig. 4. Recombinant MjSR-B1 binds to different bacteria and polysaccharides. (A) Bac-
terial binding assay of MjSR-B1. Bacteria were incubated with rMjSR-B1 and then
washed with PBS and eluted with 7% SDS. The precipitated bacteria and 7% SDS eluate
were separated by SDS–PAGE and transferred to nitrocellulose membranes for Western
blot analysis. Anti-His-tag monoclonal antibody was used in the Western blot. (B)
Direct binding assay. The polysaccharides LPS and LTA were used for ELISA analy-
sis. The primary antibody was anti-His-tag monoclonal. All the assays were performed
three times and data were analyzed by the unpaired t-test. Significant difference was
accepted at p < 0.05.
clearance by regulating the expression of antimicrobial peptides
(AMPs), the expression of AMPs, including crustins (CrusI-1, CrusI-
2, CrusI-3 and CrusI-4) and antilipopolysaccharide factors (Alf-A1, Alf-
B1, Alf-D1 and Alf-E1), was analyzed by qRT-PCR in MjSR-B1-
silenced or -overexpressed shrimp challenged by V. anguillarum or
S. aureus. The results showed that Crus I-1, Alf-A1 and Alf-E1 were
involved against Gram-negative bacteria because their expres-
sions declined after MjSR-B1 silencing and increased after MjSR-
B1 overexpression (Fig. 8A and C). CrusI-1, CrusI-3, CrusI-4 and Alf-
B1 were involved in anti-Gram-positive bacterial responses (Fig. 8B
and D). These data suggest that MjSR-B1 might participate in the
regulation of the expression of antimicrobial peptides.
4. Discussion
SR-Bs are type III transmembrane receptors with two trans-
membrane regions, an extracellular region and two cytoplasmic tails.
The extracellular domain being heavily glycosylated has specific
 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21 17

Fig. 5. MjSR-B1 enhances bacterial clearance ability in shrimp. (A) Effects of RNAi detected by qRT-PCR. Twenty-four hours after the second injection of dsMjSR-B1, hemo-
cytes were collected for RNA extraction and MjSR-B1 expression was analyzed by qRT-PCR. dsGFP was used as the control. (B) Bacterial clearance in MjSR-B1-knockdown
shrimp. Twenty-four hours after the second dsMjSR-B1 injection, PBS washed V. anguillarum or S. aureus were injected into shrimp. The hemolymph was collected 1 h later,
gradient diluted with PBS and plated on LB-agar plates. The numbers of bacteria were counted after 24 h culture at 37 °C. (C) A schematic view of the structure of the MjSR-
B1 protein and its truncation mutant for overexpression. TM indicates a transmembrane region. (D) Western blot to analyze both MjSR-B1 and MjSR-B1ΔC expression in
hemocytes from mRNA-injected shrimp. Twenty-four hours after mRNA injection into shrimp, hemocytes were collected for Western blotting. Anti-His-tag monoclonal an-
tibody was used as the primary antibody. (E) Bacterial clearance assays were conducted after overexpression of MjSR-B1 or MjSR-B1ΔC. Twenty-four hours after injection
of mRNAs, PBS washed V. anguillarum or S. aureus were injected into shrimp and the hemolymph was collected 1 h later, gradient diluted with PBS and plated on LB-agar
plates for bacterial culture. The bacterial colonies were counted after 24 h culture at 37 °C. MjSR-B1ΔC mRNA was used as the control. All the assays were performed three
times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

ligand binding sites, thus it could mediate ligand recognition (Kar
et al., 2008; Silverstein and Febbraio, 2009). In this study, MjSR-B1
was upregulated in hemocytes after challenge with Gram-positive
and Gram-negative bacteria. The extracellular domain of MjSR-B1
could agglutinate different bacteria, and bind to LPS from Gram-
negative and LTA from Gram-positive bacteria.
Phagocytosis is a highly conserved multi-step process involved
in engulfing and destroying apoptotic bodies, dying tumor cells and
pathogens. The cascades of phagocytosis begin with particle rec-
ognition by PRRs and adhesion of the particle to the phagocyte
surface. Receptor recognition triggers a consecutive progression of
cellular changes, including rearrangement of the cytoskeleton, re-
organization of the plasma membrane, maturation of phagosomes,
and production of cytokines and molecules required for antigen pre-
sentation to the adaptive immune system (Stuart and Ezekowitz,
2008). Pathogen recognition and internalization is mediated by a
variety of phagocytic receptors, including scavenger receptors,
integrins (complement receptors), Fcγ receptor, and C-type lectins
such as mannose binding receptor in mammals (Greenberg and
Grinstein, 2002; Stuart and Ezekowitz, 2005). Multiple receptor types
are co-expressed in single phagocytes and collaborate in the de-
tection and ingestion of particles (Freeman and Grinstein, 2014).
Three types of receptors that are related to phagocytosis have been
identified in humans: pattern-recognition receptors (PRRs), opsonic
receptors, and apoptotic corpse receptors (Flannagan et al., 2012;
Freeman and Grinstein, 2014). In shrimp, several PRRs involved in
phagocytosis have been identified. A β-integrin was reported in
Fenneropenaeus chinensis. β-integrin exists on the membrane of he-
mocytes; it can interact with an opsonic receptor, FcLec4, a C-type
lectin. FcLec4 detects invading bacterial pathogens via the carbo-
hydrate recognition domain (i.e., the C-type lectin domain). Upon
recognition, binding between the N-terminus of the lectin and
β-integrin leads to cytoskeletal reorganization, which induces phago-
some formation to ingest the invading bacteria (Wang et al., 2014).
Calnexin (Cnx) has also been identified as one of the phagocytic re-
ceptors in M. japonicus (Zhang et al., 2014). MjCnx exists on the
surface of shrimp hemocytes. It strongly binds to Gram-negative bac-
teria and to some Gram-positive bacteria. Further study revealed
18 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Fig. 6. MjSR-B1 mediates phagocytosis of bacteria in shrimp. (A) Twenty-four hours after dsMjSR-B1 injection, FITC labeled V. anguillarum or S. aureus (green) were injected
into shrimp. The hemocytes were collected 1 h later and stained with DAPI (blue), and then observed under a fluorescence microscope. Shrimp injected with dsGFP were
used as controls. Scale bar = 20 μm. (a) The phagocytosis rate was calculated according to the images captured by the fluorescence microscope, a total of 1000 cells were
counted. (B) Twenty-four hours after MjSR-B1 mRNA injection, FITC labeled V. anguillarum or S. aureus (green) were injected into shrimp. The hemocytes were collected 1 h
later and stained with DAPI (blue), and then observed under a fluorescence microscope. Shrimp injected with MjSR-B1ΔC mRNA were used as controls. Scale bar = 20 μm.
(b) The phagocytosis rate was calculated according to the images captured by the fluorescence microscope, a total of 1000 cells were counted. (C) Flow cytometry was used
for hemocyte phagocytotic analysis. It can distinguish hemocytes from bacteria, and only the hemocytes were analyzed. Twenty-four hours post dsRNA or mRNA injection,
FITC labeled V. anguillarum or S. aureus were injected into shrimp. The hemocytes were collected 1 h later and fixed with 1% paraformaldehyde, and then measured by flow
cytometry. (D and E) Quantitative analysis of phagocytotic rates based on the data by flow cytometry. The data were analyzed by the unpaired t-test and significant differ-
ence was accepted at p < 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21 19

Fig. 7. Expression levels of myosin, Rab5, LAMP and ARP are mediated by MjSR-B1. After MjSR-B1 knockdown, shrimp were challenged by (A) V. anguillarum or (B) S. aureus.
qRT-PCR was performed to measure the mRNA levels of phagocytosis-related genes in the shrimp 1 h after bacterial challenge. When MjSR-B1 protein was overexpressed,
the expression level of the phagocytosis-related genes was tested 1 h post (C) V. anguillarum and (D) S. aureus challenge. All the assays were performed in triplicate and
data were analyzed by the unpaired t-test at p < 0.05.

that MjCnx had high affinity for PGN, LTA and LPS. MjCnx en-
hances the clearance of V. anguillarum by promoting phagocytosis,
and this ability was impaired by knockdown of MjCnx (Zhang et al.,
2014). There are also some other PRRs identified in shrimp that are
involved in phagocytosis, such as L-type lectin (Xu et al., 2014),
fibrinogen-related protein (Sun et al., 2014) and galectin (Shi et al.,
2014). In this study, the hemocytically expressed MjSR-B1 recog-
nizes LPS and LTA and enhances phagocytosis of invading bacteria.
Therefore, like mammals, shrimp have a multiplicity of phago-
cytic receptors, and these receptors either directly recognize the
particle (e.g., MjSR-B1), or recognize targets coated by opsonic mol-
ecules (e.g., FcLec4). This also indicates that the innate immune
system in shrimp has evolved overlapping mechanisms to combat
some important pathogens.
In a previous report, the COOH-terminal cytoplasmic residues
of CD36 were essential to trigger phagocytic engulfment, and the
COOH-terminal cytoplasmic domain could activate TLR2/6 signal-
ing after induction by S. aureus or LTA, its cell wall component (Stuart
et al., 2005). We also made a truncation mutation of the C-terminal
cytoplasmic domain of MjSR-B1 for overexpression analysis, and
found that bacterial clearance and phagocytosis were impaired with
this mutant, and the expression of downstream genes of the phago-
cytosis cascade and the expression of antimicrobial peptides
significantly declined. The extracellular domain of MjSR-B1 can bind
to LPS from Gram-negative bacteria and LTA from the wall of Gram-
positive bacteria. These results indicate that the extracellular domain
recognizes the invading pathogens and triggers phagocytosis; the
COOH-terminal cytoplasmic domain is essential to signal to the actin
cytoskeleton and trigger engulfment to clear bacteria.
In host immune response, CD36 cooperates with a TLR2/6
heterodimer in the recognition of LTA and diacylglycerides and plays
a role in Staphylococcus aureus infection (Hoebe et al., 2005). CD36
also cooperates with a TLR4/6 heterodimer mediated by OxLDL in
sterile inflammation. The TLR4–TLR6 signaling is propagated by both
the MyD88 and TRIF adaptors, leading to the induction of pro-
inflammatory cytokins (Stewart et al., 2010). Our results showed
that MjSR-B1 participates in the regulation of the expression of AMPs;
the induction of AMPs against bacteria might be through Toll like
receptor pathways.
In conclusion, in this study we identify and characterize MjSR-
B1 in M. japonicus. The extracellular region of MjSR-B1 possesses
the ability to bind and agglutinate bacteria through binding LPS or
LTA. The carboxy-terminal cytoplasmic domain is essential for the
bacterial internalization. MjSR-B1 acts as a phagocytic receptor for
both Gram-positive and Gram-negative bacteria, and as a pattern
recognition receptor to regulate the expression of AMPs.
Acknowledgements
This work was supported by grants from National Natural Science
Foundation of China (Grants 31472303 and 31130056), National Basic
Research Program of China (973 Program, No. 2012CB114405) and
20 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21

Fig. 8. Expression of crustins and antilipopolysaccharide factors is mediated by MjSR-B1. After MjSR-B1 knockdown, shrimp were challenged with (A) V. anguillarum or (B)
S. aureus. qRT-PCR was performed to measure the mRNA levels of the antimicrobial peptides 1 h after the bacterial challenge CrusI-1, CrusI-2, CrusI-3, CrusI-4, Alf-A1, Alf-B1,
Alf-D1 and Alf-E1. The expression levels of AMPs in MjSR-B1-overexpressed shrimp challenged by (C) V. anguillarum or (D) S. aureus. All the assays were performed three
times and data were analyzed by the unpaired t-test. Significant difference was accepted at p < 0.05.

the Ph.D. Program Foundation of the Ministry of Education of China
(Grant 20110131130003).
Appendix: Supplementary material
Supplementary data to this article can be found online at
doi:10.1016/j.dci.2015.02.001.
References
Areschoug, T., Gordon, S., 2009. Scavenger receptors: role in innate immunity and
microbial pathogenesis. Cell. Microbiol. 11, 1160–1169.
Baranova, I.N., Kurlander, R., Bocharov, A.V., Vishnyakova, T.G., Chen, Z., Remaley, A.T.,
et al., 2008. Role of human CD36 in bacterial recognition, phagocytosis, and
pathogen-induced JNK-mediated signaling. J. Immunol. 181, 7147–7156.
Baranova, I.N., Vishnyakova, T.G., Bocharov, A.V., Leelahavanichkul, A., Kurlander, R.,
Chen, Z., et al., 2012. Class B scavenger receptor types I and II and CD36 mediate
bacterial recognition and proinflammatory signaling induced by Escherichia coli,
lipopolysaccharide, and cytosolic chaperonin 60. J. Immunol. 188, 1371–1380.
Brown, M.S., Goldstein, J.L., Krieger, M., Ho, Y.K., Anderson, R.G., 1979. Reversible
accumulation of cholesterol esters in macrophages incubated with acetylated
lipoproteins. J. Cell Biol. 82, 597–613.
Canton, J., Neculai, D., Grinstein, S., 2013. Scavenger receptors in homeostasis and
immunity. Nat. Rev. Immunol. 13, 621–634.
Christophides, G.K., Vlachou, D., Kafatos, F.C., 2004. Comparative and functional
genomics of the innate immune system in the malaria vector Anopheles gambiae.
Immunol. Rev. 198, 127–148.
Dieckmann, R., von Heyden, Y., Kistler, C., Gopaldass, N., Hausherr, S., Crawley, S.W.,
et al., 2010. A myosin IK-Abp1-PakB circuit acts as a switch to regulate
phagocytosis efficiency. Mol. Biol. Cell 21, 1505–1518.
Flannagan, R.S., Jaumouille, V., Grinstein, S., 2012. The cell biology of phagocytosis.
Annu. Rev. Pathol. 7, 61–98.
Franc, N.C., Dimarcq, J.L., Lagueux, M., Hoffmann, J., Ezekowitz, R.A., 1996. Croquemort,
a novel Drosophila hemocyte/macrophage receptor that recognizes apoptotic cells.
Immunity 4, 431–443.
Freeman, S.A., Grinstein, S., 2014. Phagocytosis: receptors, signal integration, and
the cytoskeleton. Immunol. Rev. 262, 193–215.
Frittoli, E., Palamidessi, A., Marighetti, P., Confalonieri, S., Bianchi, F., Malinverno, C.,
et al., 2014. A RAB5/RAB4 recycling circuitry induces a proteolytic invasive
program and promotes tumor dissemination. J. Cell Biol. 206, 307–328.
Greenberg, S., Grinstein, S., 2002. Phagocytosis and innate immunity. Curr. Opin.
Immunol. 14, 136–145.
Hoebe, K., Georgel, P., Rutschmann, S., Du, X., Mudd, S., Crozat, K., et al., 2005. CD36
is a sensor of diacylglycerides. Nature 433, 523–527.
Huynh, K.K., Eskelinen, E.L., Scott, C.C., Malevanets, A., Saftig, P., Grinstein, S., 2007.
LAMP proteins are required for fusion of lysosomes with phagosomes. EMBO J.
26, 313–324.
Janeway, C.A., Jr., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev.
Immunol. 20, 197–216.
Kar, N.S., Ashraf, M.Z., Valiyaveettil, M., Podrez, E.A., 2008. Mapping and
characterization of the binding site for specific oxidized phospholipids and
oxidized low density lipoprotein of scavenger receptor CD36. J. Biol. Chem. 283,
8765–8771.
May, R.C., Caron, E., Hall, A., Machesky, L.M., 2000. Involvement of the Arp2/3
complex in phagocytosis mediated by FcgammaR or CR3. Nat. Cell Biol. 2,
246–248.
Mekata, T., Okugawa, S., Inada, M., Yoshimine, M., Nishi, J., Kono, T., et al., 2011. Class
B scavenger receptor, Croquemort from kuruma shrimp Marsupenaeus japonicus:
molecular cloning and characterization. Mol. Cell. Probes 25, 94–100.
Neculai, D., Schwake, M., Ravichandran, M., Zunke, F., Collins, R.F., Peters, J., et al.,
2013. Structure of LIMP-2 provides functional insights with implications for SR-BI
and CD36. Nature 504, 172–176.
Pluddemann, A., Neyen, C., Gordon, S., 2007. Macrophage scavenger receptors and
host-derived ligands. Methods 43, 207–217.
 W.-J. Bi et al./Developmental and Comparative Immunology 51 (2015) 10–21
Pluddemann, A., Mukhopadhyay, S., Gordon, S., 2011. Innate immunity to intracellular
pathogens: macrophage receptors and responses to microbial entry. Immunol.
Rev. 240, 11–24.
Prabhudas, M., Bowdish, D., Drickamer, K., Febbraio, M., Herz, J., Kobzik, L., et al., 2014.
Standardizing scavenger receptor nomenclature. J. Immunol. 192, 1997–2006.
Rahaman, S.O., Lennon, D.J., Febbraio, M., Podrez, E.A., Hazen, S.L., Silverstein, R.L.,
2006. A CD36-dependent signaling cascade is necessary for macrophage foam
cell formation. Cell Metab. 4, 211–221.
Sharif, O., Matt, U., Saluzzo, S., Lakovits, K., Haslinger, I., Furtner, T., et al., 2013. The
scavenger receptor CD36 downmodulates the early inflammatory response while
enhancing bacterial phagocytosis during pneumococcal pneumonia. J. Immunol.
190, 5640–5648.
Shi, X.Z., Zhong, X., Yu, X.Q., 2012. Drosophila melanogaster NPC2 proteins bind
bacterial cell wall components and may function in immune signal pathways.
Insect Biochem. Mol. Biol. 42, 545–556.
Shi, X.Z., Wang, L., Xu, S., Zhang, X.W., Zhao, X.F., Vasta, G.R., et al., 2014. A galectin
from the kuruma shrimp (Marsupenaeus japonicus) functions as an opsonin and
promotes bacterial clearance from hemolymph. PLoS ONE 9, e91794.
Silverstein, R.L., Febbraio, M., 2009. CD36, a scavenger receptor involved in immunity,
metabolism, angiogenesis, and behavior. Sci. Signal. 2, re3.
Stewart, C.R., Stuart, L.M., Wilkinson, K., van Gils, J.M., Deng, J., Halle, A., et al., 2010.
CD36 ligands promote sterile inflammation through assembly of a Toll-like
receptor 4 and 6 heterodimer. Nat. Immunol. 11, 155–161.
Stuart, L.M., Ezekowitz, R.A., 2005. Phagocytosis: elegant complexity. Immunity 22,
539–550.
Stuart, L.M., Ezekowitz, R.A., 2008. Phagocytosis and comparative innate immunity:
learning on the fly. Nat. Rev. Immunol. 8, 131–141.
Stuart, L.M., Deng, J., Silver, J.M., Takahashi, K., Tseng, A.A., Hennessy, E.J., et al., 2005.
Response to Staphylococcus aureus requires CD36-mediated phagocytosis
21
triggered by the COOH-terminal cytoplasmic domain. J. Cell Biol. 170, 477–
485.
Sun, J.J., Lan, J.F., Shi, X.Z., Yang, M.C., Yang, H.T., Zhao, X.F., et al., 2014. A fibrinogen-
related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus
japonicus. Fish Shellfish Immunol. 39, 296–304.
Triantafilou, M., Gamper, F.G., Haston, R.M., Mouratis, M.A., Morath, S., Hartung, T.,
et al., 2006. Membrane sorting of toll-like receptor (TLR)-2/6 and TLR2/1
heterodimers at the cell surface determines heterotypic associations with CD36
and intracellular targeting. J. Biol. Chem. 281, 31002–31011.
Vishnyakova, T.G., Kurlander, R., Bocharov, A.V., Baranova, I.N., Chen, Z., Abu-Asab,
M.S., et al., 2006. CLA-1 and its splicing variant CLA-2 mediate bacterial adhesion
and cytosolic bacterial invasion in mammalian cells. Proc. Natl. Acad. Sci. U.S.A.
103, 16888–16893.
Wang, X.W., Wang, J.X., 2013. Pattern recognition receptors acting in innate immune
system of shrimp against pathogen infections. Fish Shellfish Immunol. 34,
981–989.
Wang, X.W., Zhang, X.W., Xu, W.T., Zhao, X.F., Wang, J.X., 2009. A novel C-type lectin
(FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white
shrimp. Dev. Comp. Immunol. 33, 1039–1047.
Wang, X.W., Zhao, X.F., Wang, J.X., 2014. C-type lectin binds to beta-integrin to
promote hemocytic phagocytosis in an invertebrate. J. Biol. Chem. 289, 2405–
2414.
Xu, S., Wang, L., Wang, X.W., Zhao, Y.R., Bi, W.J., Zhao, X.F., et al., 2014. L-Type lectin
from the kuruma shrimp Marsupenaeus japonicus promotes hemocyte
phagocytosis. Dev. Comp. Immunol. 44, 397–405.
Zhang, Q., Wang, X.Q., Jiang, H.S., Jia, W.M., Zhao, X.F., Wang, J.X., 2014. Calnexin
functions in antibacterial immunity of Marsupenaeus japonicus. Dev. Comp.
Immunol. 46, 356–363.