Charting The Sustainable Future of Asean in Science and Technolo 2020

Nurul Zawani Alias
Rizana Yusof Editors
Charting
the Sustainable
Future of ASEAN
in Science and
Technology
Proceedings from the 3rd International
Conference on the Future of ASEAN
(ICoFA) 2019 - Volume 2
Charting the Sustainable Future of ASEAN
in Science and Technology
Nurul Zawani Alias Rizana Yusof
•
Editors
Charting the Sustainable

Future of ASEAN in Science
and Technology
Proceedings from the 3rd International
Conference on the Future of ASEAN (ICoFA)
2019 - Volume 2
123
Editors
Nurul Zawani Alias Rizana Yusof
Universiti Teknologi MARA Perlis Universiti Teknologi MARA Perlis
Perlis, Malaysia Perlis, Malaysia
ISBN 978-981-15-3433-1 ISBN 978-981-15-3434-8 (eBook)

https://doi.org/10.1007/978-981-15-3434-8
© Springer Nature Singapore Pte Ltd. 2020
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations,
recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission
or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar
methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are exempt from
the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this
book are believed to be true and accurate at the date of publication. Neither the publisher nor the
authors or the editors give a warranty, expressed or implied, with respect to the material contained
herein or for any errors or omissions that may have been made. The publisher remains neutral with regard
to jurisdictional claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721,
Singapore
Contents
1 Hearing Assistive Technology: Sign Language Translation

Application for Hearing-Impaired Communication . . . . . . . . . . . . . 1
Mohd Nizam Osman, Khairul Anwar Sedek, Nur Zaid Md Zain,
Muhamad Amin Naim Ab Karim and Mushahadah Maghribi
2 Fish Freshness Detector Using Sensory Quality Index Method
and Digital Image Processing Evaluation . . . . . . . . . . . . . . . . . . . . 13
Khairul Naim Abd.Aziz, Shameen Izwan Anthonysamy,
Zamzila Erdawati Zainol, Muhammad Akmal Roslani
and Sharir Aizat Kamaruddin
3 The Impacts of Different Types of Slopes on Soil Fertility
Movement of Harumanis Mango . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Sharifah Norashikin Bohari, Che Ahmad Redzuan Che Romeli,
Norhanani Ahmad, Amirul Ikram Azmi, Nurul Ain Mohd Zaki
and Abdul Rauf Abdul Rasam
4 Quran Indexing Using Cloud Database . . . . . . . . . . . . . . . . . . . . . . 37
Khairul Anwar Sedek, Noriati Roseni binti Ghazali
and Mohd Nizam Osman
5 Geospatial Site Suitability for Sustainable Property Investment . . . . 49
Ernieza Suhana Mokhtar, Wan Nur Azliena Wan Mohd Zaki,
Noraini Nasirun, Fatin Amirah Hanif and Idham Nugraha
6 Analysis of Organophosphorus Pesticides (OPPs) in Paddy Field
Water Using IL-DLLME . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
Sharizal Bin Hasan, Non Daina Masdar, Mohd Lias Kamal,
Norizan Binti Ramli and Nurul Zawani Alias
7 The Potential of Bamboo Vinegar (Gigantochloa albociliata)
as Insecticide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Nurul Zawani Alias, Shafinas Abdullah, Siti Shahirah Shaari,
Jesmond Joel Junik, Mohd Lias Kamal and Non Daina Masdar
v
vi Contents
8 Tensile Strength of Polyester Composite Filled

with Bamboo Fiber . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Noor Syafeekha Mohamad Sakdun, Nur Azrin Azlan,
Nik Farhanim Imran and Hafizah Muhamad Azlan
9 NetGuard: Securing Network Environment Using Integrated
OpenVPN, Pi-Hole, and IDS on Raspberry Pi . . . . . . . . . . . . . . . . 97
Abidah Mat Taib, Muhammad Tholhah Zabri, Nor Azira Mohd Radzi
and Evizal Abdul Kadir
10 Bilingual e-Story Book for Hearing-Impaired Students (BeSH)
Toward Sustainability Learning . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Sharifah Nurulhikmah Syed Yasin, Hayati Adilin Mohd Abd Majid,
Ummu Fatihah Mohd Bahrin, Siti Salbiah Hamzah
and Zeti Darleena Eri
11 The Potential of Antioxidants and Phytochemicals Components
in Fruit Waste (Peel) of Citrus hystrix and Ananas comosus . . . . . . 123
Rohayu Ramli, Nureen Shahirah Ahmad Zaghlul
and Nor Atikah Husna Ahmad Nasir
12 The Effect of Different Animal Dung in Vermicompost
Production Using Eudrilus eugeniae Worm and Spent
Mushroom Substrate as Vermicomposting Medium . . . . . . . . . . . . 137
Norhanani Ahmad, Nurhidayah Mat Sukri
and Noor Zuhairah Samsuddin
13 Biofilm Developed from Acrylated Epoxidized Soybean Oil:
Preparation and Characterization . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Sharifah Nafisah Syed Ismail, Farah Izati Ibrahim, Khuzaimah Nazir,
Noor Aishatun Majid, Nor Mazlina Abdul Wahab,
Marina Mohd Shahabudin and Mithalina Zulaikha Ismail
14 Anti-microbial Properties and Toxicity Test of Stingless Bee
Honey (Trigona itama), Ajwa Date (Phoenix dactylifera L.)
Seeds and Their Combinations . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155
Nurul Syazwina Roslan, Nur Syafiqah Rahim, Zainab Razali
and Mohd Azhar Zulkifli
15 PM2.5 Pollutant Distributions in Years 2016 and 2019
Using GIS Spatial Analyst . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
Noorfatekah Talib, Nur Syahirah Mohamad Sallehuddin,
Nur Amira Mohd Sa’aid and Nurhafiza Md. Saad
16 Sustainable Embedded Technology for Mouse Trap . . . . . . . . . . . . 181
Norfiza Ibrahim, Azmi Abu Seman, Nadia Abdul Wahab,
Aznoora Osman and Muhammad Hazim Firdaus Ismail
Contents vii
17 Determination of Antioxidant from Ubi Gadong Tubers

for Facial Soap Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
Non Daina Masdar, Robiatul Adawiyah Binti Roslan,
Sharizal Bin Hasan and Mohd Lias Kamal
18 Coconut Oil Plasticizer as a Replacement of Petroleum Oil
in Natural Rubber Compound: Physical and Mechanical
Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203
Farhana Othman and Nismahasyirah Alang Ismail
19 Histopathology Alteration of Red Hybrid Tilapia (Oreochromis Spp.)
Caused by Streptococcus Agalactiae Infection . . . . . . . . . . . . . . . . . . . 215
Ain Auzureen Mat Zin, Ruhil Hayati Hamdan,
Mohd Hafiz Jamaludin, Jasni Sabri and Li Peng Tan
20 Ethnobotanical Study on Flowering Plants Along
with Phytochemicals and Antioxidants Analysis on Selected
Plumeria Species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
Nur Illani Abdul Razak, Siti Sumaiyah Syahida Hassan
21 i-Kids Science Courseware Toward Sustainability Education
for Hearing-Impaired Students . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237
Darleena Eri Zeti, Adilin Mohd Abd Majid Hayati,
Nurulhikmah Syed Yasin Sharifah, Salbiah Hamzah Siti
and Raju Rajeswari
22 Phytochemical Screening and Potential DPPH Radical
Scavenging Activity of Banana Peel Extract . . . . . . . . . . . . . . . . . . 249
Nor Atikah Husna Ahmad Nasir, Nurul Atikah Liana Roslly,
Nurul Miza Rosli and Zainab Razali
23 Newly Revised Optimal and Synchronized Timetables for
Greater Kuala Lumpur Using Mixed Integer Programming . . . . . . 259
Noraini Noordin and Saiyidatul Adidah Idris
24 Kinetic Modeling and Half-Life Study on Bioaugmentation of Oil
Sludge Contaminated Soil by Single and Consortia LIBeM
at Different Concentration Levels . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Nur Zaida Zahari and Piakong Mohd Tuah
25 A Comparative Study of the Accuracy of Regularized
and Tension Spline Interpolation Methods to Map the Surface
Water Temperature of Pulau Tuba, Langkawi, Kedah . . . . . . . . . . 285
Sharir Aizat Kamaruddin, Shaidatul Najwa Zainolabdin,
Khairul Naim Abd.Aziz, Muhammad Akmal Roslani,
Nur Syazwana Akmal Mohd Zohir
and Nurdamia Yasmin Mustaffa Al-Bakri
viii Contents
26 Antibacterial and Insect-Repellent Activities of Cananga odorata

Essential Oil . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297
Syarifah Nursyimi Azlina Syed Ismail,
Sharifah Sakinah Syed Soffian, Rosmawati Abdul Aziz
and Nordiana Suhada Mohmad Tahiruddin
27 Dosimetric Characterization of Corn Starch/Polyvinyl Alcohol
(PVA) Blend as Potential Radiotherapy Bolus Material . . . . . . . . . 307
Fairuzdzah Ahmad Lothfy, Salsabila Kamaruddin,
Nik Kamarullah Ya Ali and Norfataha Mohd Daud
28 Dominant Tree Species Estimation for Tropical Forest
Using Pixel-Based Classification Support Vector Machine
(SVM) and Object-Based Classification (OBIA) . . . . . . . . . . . . . . . 319
Nurul Ain Mohd Zaki, Intan Nur Suhaida Mohd Radzi,
Zulkiflee Abd Latif, Mohd Nazip Suratman, Mohd Zainee Zainal
and Sharifah Norashikin Bohari
29 The Potential Area Estimation for Solar Installation Based
on Insolation Pattern Derived from LiDAR Points Cloud Data . . . . 335
Nurhafiza Md Saad, Muhammad Khairil Asyraf Mohd Shukair,
Noraain Mohamed Saraf, Juazer Rizal Abdul Hamid,
Noorfatekah Talib and Abdul Rauf Abdul Rasam
30 Detecting Speed Violation Using Wireless Sensor Network
to Reduce Road Accidents Among Commercial Bus . . . . . . . . . . . . 351
Rashidah Ramle, Haidib Mohd Haider, Muhammad Fakhrul Yusuf,
Norzatul Bazamah Azman Shah, Nur Khairani Kamarudin
and Rafiza Ruslan
31 Data Verification of LiDAR-Derived DEM from Different
Interpolation Techniques . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
Noraain Mohamed Saraf, Khairun Najwa Kamarolzaman,
Nurhafiza Md Saad, Nafisah Khalid, Abdul Rauf Abdul Rasam
and Ainon Nisa Othman
32 An Application of Presumptive Diagnosis for Urinary Tract
Infection via kNN Algorithm Approach . . . . . . . . . . . . . . . . . . . . . 377
Muhammad Nabil Fikri Jamaluddin, Siti Norfahana Abdul Malik,
Shukor Sanim Mohd Fauzi, Tajul Rosli Razak,
Iman Hazwam Abd Halim, Abdul Hapes Mohammed
and Ray Adderley JM Gining
Contents ix
33 The Investigation on the Implementation of Industrialised

Building System (IBS) in Infrastructure Project: A Case Study
in Selangor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 389
Juzailah Nur Yunus, Nur Atiqah Halim,
Raja Nor Husna Raja Mohd Noor, Nurol Huda Dahalan
and Nor Janna Tammy
34 Fuzzy Logic Water Quality Index (FWQI) Model in Determining
the Water Quality Status of River in Penang Island . . . . . . . . . . . . 399
Siti Nor Nadrah Muhamad, Mohd Fazril Izhar Mohd Idris,
Nurul Izzati Husna Wahab and Wan Nurshazelin Wan Shahidan
35 Concrete Performance Using Treated POFA as a Partial
Replacement of Cement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 411
Nik Farhanim Imran, Mohd Afiq Mohd Azham,
Md Rasul Mohamad Nor, Noor Syafeekha Mohamad Sakdun,
Nor Hafida Hashim, Siti Rahimah Rosseli, Hafizah Muhamad Azlan
and Muhd Norhasri Muhd Sidek
36 Characterization of Pectin Extracted from Guava Peels
Using Deep Eutectic Solvent and Citric Acid . . . . . . . . . . . . . . . . . 421
Rizana Yusof, Siti Zawani Ahmad Zaini and Mohd Azhar Azman
37 Mechanical Properties of Silane-Treated Eggshell Powder
on Unsaturated Polyester Composite . . . . . . . . . . . . . . . . . . . . . . . . 435
Nor Mazlina Abdul Wahab, Mohammad Azri Md Hanafiah,
Dalina Samsudin, Mohd Syamaizar Mustafa, Zuliahani Ahmad
and Sharifah Nafisah Syed Ismail
38 Pineapple Leaf Fibre Filled Natural Rubber Composite:
The Effect of Filler Loading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 447
Mohd Syamaizar Mustafa, Sharifah Nafisah Syed Ismail,
Shafeera Mohd Shaipul Amini, Nor Mazlina Abdul Wahab,
Noor Aishatun Majid and Muhamad Naiman Sarip
39 Green Synthesis of Silver Nanoparticles from Ananas comosus
Core Extract and Their Antibacterial Activity . . . . . . . . . . . . . . . . 455
Zainab Razali, Nur Wajihah Masdar,
Nor Atikah Husna Ahmad Nasir, Nur Syafiqah Rahim
and Roejhan Md Kawi
40 Effects of Different Ratios of 45% N, N-Dimethylformamide
(DMF) Solvent in Reaction with Derived 2D Hybrid Perovskite
C6H8N2PbI3 Prepared via Nitrogen-Less Method . . . . . . . . . . . . . . 465
Azliana Ramli, Mohd Nazari Abu Bakar, Suhaila Sepeai,
Ab Malik Marwan Ali, Nafisah Osman
and Wan Izhan Nawawi Wan Ismail
x Contents
41 Detection of Integron and Antibiotic Resistance Genes

of Aeromonas spp. Isolated from Freshwater Fish in Pahang,
Malaysia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 473
Fazlina Fauzi, Ruhil Hayati Hamdan, Maizan Mohamed
and Li Peng Tan
42 Characterization of Untreated and Acid Treated Natural Filler
from L. Oryza Sativa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 487
Iqmal Che Hanah, Mohd Lias Kamal, Noor Aishatun Majid,
Wahida Abdul Rahman, Sharifah Nafisah Syed Ismail,
Nor Mazlina Abdul Wahab, Nur Fairuz Wahida Ibrahim,
Noor Faezah Mohd Sani and Siti Nur Liyana Mamauod
43 Disease Mapping and Health Analysis Using Free and Open
Source Software for Geospatial (FOSS4G): An Exploratory
Qualitative Study of Tuberculosis . . . . . . . . . . . . . . . . . . . . . . . . . . 495
Muhammad Dinie Haqim Azewan and Abdul Rauf Abdul Rasam
44 E-Mosque Tourism: Discovering Mosques via Geodigital
Mapping in Kuala Lumpur, Malaysia . . . . . . . . . . . . . . . . . . . . . . . 507
Nurin Syarafina Mohd Hasmizi, Abdul Rauf Abdul Rasam
and Noraain Mohamed Saraf
45 Sustainable Palm Oil Production Through Optimizing
of Planted Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 519
Wan Nurshazelin Wan Shahidan and Nor Atikah Nadzri
46 Agent-Based Encryption for Password Management
Application . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 529
Nurul Hidayah Ahmad Zukri, Nor Aimuni Md Rashid,
Norkhushaini Awang and Zuhri Arafah Zulkifli
47 A Single Objective Fuzzy Linear Programming for Optimizing
Hand Socks Production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 543
Wan Nurshazelin Wan Shahidan, Nurul ′Ain Rusydiah Mohd Rodzi
and Siti Nor Nadrah Muhamad
48 GeoPark Management and GIS: Geospatial Tree Information
Inventory System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 553
Hanisah Othman, Abdul Rauf Abdul Rasam and Norajlin Jaini
Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 569

Chapter 1
Hearing Assistive Technology: Sign
Language Translation Application
for Hearing-Impaired Communication
Mohd Nizam Osman , Khairul Anwar Sedek, Nur Zaid Md Zain,

Muhamad Amin Naim Ab Karim and Mushahadah Maghribi
Abstract Sign Language (SL) is the most important communication way between
hearing-impaired community and normal persons. However, it is very common that
the normal person does not know the SL. Thus, for assisting the hearing-impaired
community to communicate in a world of spoken languages, there is a need to develop
a translation tool to assist the communication between hearing-impaired community
and normal persons. One of the translation tools available nowadays is Hearing Assis-
tive Technology (HAT). HAT can dramatically improve the communication with
hearing problem and increase the sustainability of social interaction in community.
This paper presents an approach of HAT in the development of the sign language
translation application for hearing-impaired communication by translating the SL
gesture into a textual and audio form. This application integrates with a Microsoft
Kinect Camera Sensor to detect the gesture of SL that is performed by the user who
stands in front of the device. The SL translation application implements Dynamic
Time Warping (DTW) algorithm. It measures the similarity between two sequences,
which was the recorded gesture stored in text file and the current gesture performed
by the user. This paper evaluates the application using a user acceptance test based
on Technology Acceptance Model (TAM) that involved thirty (30) respondents to
determine the effectiveness of the system. The evaluation shows that most of the
participants positively accepted the proposed application. Therefore, this applica-
tion provides insight on the role of HAT which has prepared opportunities for the
hearing-impaired and normal person to compensate and empower the communication
by using an automatic SL translation application.
M. N. Osman (B) · K. A. Sedek · N. Z. M. Zain · M. A. N. A. Karim

Univeriti Teknologi MARA, Perlis Branch, 02600 Arau, Perlis, Malaysia
e-mail: mohdnizam@uitm.edu.my
K. A. Sedek
e-mail: khairulanwarsedek@uitm.edu.my
N. Z. M. Zain
e-mail: nurzaid@uitm.edu.my
M. Maghribi
Politeknik Tuanku Syed Sirajuddin, 02600 Arau, Perlis, Malaysia
© Springer Nature Singapore Pte Ltd. 2020 1

N. Z. Alias and R. Yusof (eds.), Charting the Sustainable Future of ASEAN
in Science and Technology, https://doi.org/10.1007/978-981-15-3434-8_1
2 M. N. Osman et al.
Keywords Hearing assistive technology · Hearing-impaired · Sign language ·

Dynamic time warping · User acceptance test
1.1 Introduction
Assistive Technology (AT) was the term created by the IT people which refer to a
device or solution which mostly contribute to the disability community or people
with deficits, whether in physical, mental, or even emotional functioning (LaPlante
1992; Shinohara and Wobbrock 2011). For many years, there were hundreds or even
more assistive devices are available such as hearing-impaired devices, which help
those people who have hearing problem and wheelchair is provided for those who
cannot walk. Pollack (2005) stated that AT can also provide secure assurance to older
people by assisting their daily activities and can give alert status to their caretaker
in case something happens to the older people. Besides, AT plays an important
role in helping the person with disabilities to become more socially included and
independent (Kbar et al. 2017). Moreover, AT can also empower people to work and
become more socialized in their daily life (Shinoharaand Wobbrock 2011).
In Malaysia, it is estimated that more than 30,000 hearing-impaired people in
the year 2016 are registered with the Jabatan Kebajikan Masyarakat (JKM) (2016).
Through this statistic, it shows the importance of learning sign language as this is
the only language that was used as a communication. Unfortunately, sign language
is not compulsory for Malaysian people during the school time, making most of the
people lack knowledge in the sign language. Besides, sign language also is one of the
languages that is hard to learn (Joseph 2003) which required a lot of commitments
to learn and consume a lot of time. Moreover, lack of knowledge in sign language
can lead to miscommunication between the hearing-impaired person and the normal
person. A study by UNICEF stated that the lack of knowledge also can lead to
stigma against people with disability, and they also feel discriminated by the society
(UNICEF Malaysia 2017).
Nowadays, modern hearing aid technology can help and support the hearing-
impaired community. Many devices or tools were used for alerting, telecommuni-
cation, learning, playing, working, and listening in order to assist people with the
hearing loss problem. For instance, hearing aid microphone with digital wireless
technology together with the digital signal processing algorithm will improve the
hearing aid used by the user (Edward et al. 2012). Besides, the gesture technology
will create a better opportunity for the disabled people such as hearing-impaired as
this technology can assist in their daily life (Sharma and Droch 2015) because it is
easy to use and learn.
Meanwhile, the development of sign language application has grown rapidly
around the world to support the hearing-impaired community. In Malaysia, a web-
based learning course for teaching Malaysian sign language was developed and can
be accessed by the users without cost. This website implements multimedia elements
such as graphic and animation to represent the letters of the alphabet and numbers in
1 Hearing Assistive Technology: Sign Language Translation … 3
sign language (Mokhtar and Anuar 2015). On the other hand, the application based
on Android to support deaf people by using speech-to-image conversation was devel-
oped by Abdallah and Fayyoumi. This application was divided into several parts for
learning, playing, and translating the text into sign language and benefits the normal
persons to improve the communication with deaf people even though they have zero
knowledge in sign language (Abdallah and Fayyoumi 2016).
In order to get better understanding with sign language, which is a language
being used by the hearing-impaired or the disability people, a translation would be
very helpful as it can help to improve the communication and social interaction
skill between the normal and hearing-impaired people. Therefore, the sign language
translation application using kinetic camera sensor was proposed to support the
communication between normal people and hearing-impaired community. The main
purpose of the sign language translation application is to translate the hand gesture
and convert it into a textual and audio form, which will help the communication and
interaction skill, benefiting the normal and hearing-impaired community.
In this paper, the main sections are organized as follows: Sect. 1.2 provides the
methodology of the proposed work. Section 1.3 discusses the result based on the
testing and evaluation conducted. Finally, Sect. 1.4 concludes the paper.
1.2 Methodology
1.2.1 Developing the System Architecture for Sign Language

Translation Application
Figure 1.1 illustrates the system architecture for the sign language translation appli-
cation using kinetic camera sensor. Basically, the system consists of kinetic camera
sensor, computer to run the sign language translation application, and a web server
to store database. Besides, the system involved two types of users. The first user
represents the hearing-impaired person, who will stand in front of the kinetic camera
sensor and perform the gesture of the sign language. Meanwhile, the second user
was a normal person, one who is running the application.
Once the kinetic camera sensor is connected to the computer and run the applica-
tion, the interface of the application acts as a link between hearing-impaired person,
kinetic camera, database, and normal person. Meanwhile, the dynamic time warping
algorithm was implemented to compare the sequences which was the recorded ges-
ture in the database and currently performed gesture and then the similarity between
sequences was measured. If the comparison was successful, the audio and text repre-
senting the gesture performed by the hearing-impaired person will be shown. Besides,
the normal person also can record the new gesture to represent the sign language and
store it in the database.
Fig. 1.1 System architecture of sign language translation application
1.2.2 Model Used for the Development of Sign Language

Translation Application
The Waterfall Model was used to develop the proposed application. The Waterfall
Model emphasizes that a logical progression of steps be taken throughout the Soft-
ware Development Life Cycle (SDLC) (Bassil 2012). In a Waterfall Model, each
phase must be completed before the next phase can begin and there is no overlap-
ping in the phases. Figure 1.2 illustrates the Waterfall Model software development
process.
Requirement Analysis: This is the most important phase (Kazim 2017) which
focused on gathering all information that is needed for the project development. In
this phase, all information, data, and problem statement were identified by reading
articles, journal, and thesis from previous research. On top of that, the current technol-
ogy was observed in order to understand how technology can be implemented during
the project development. Furthermore, the activities included were the identification
of hardware and software requirement, objectives, scope of project, schedule of activ-
ities such as Gantt chart, and the total budget. The result of this phase is feasibility
report and a logical system design.
Design: The logical system design from the previous phase was converted into
physical system design. In this phase, the researcher designed the requirement needed
in the system development. It implicates several tools and techniques for a solu-
tion which included the system components, system architecture, conceptual design,
database conceptual scheme, flowchart, and storyboard. Besides, the main focuses
on the interfaces of the system were designed and the flow of the application was
Fig. 1.2 The waterfall model phases
identified. Basically, the application has two options, which is translation and capture
new gesture. Figure 1.3 shows the flow of the application.
Development: The application was developed using Microsoft Visual Studio,
Notepad++, and C#. Skeleton algorithm was used in the application to produce
the skeletal algorithm of the user who stands in front of the kinetic camera sensor
to capture the coordinate of the sign language performed by the hearing-impaired
person. Then, the Dynamic Time Warping Algorithm (DTW) was implemented to
compare two sequences, which are the gesture performed by the hearing-impaired
person and the text file gesture recorded in the database. DTW was an algorithm
Start
User choose the

available option
True Convert into

Kinetic Camera Check Gesture
Option 1 Translation Capturing Gesture Textual and Audio
Sensor Activate from the Library
form
Output of the
False textual and
audio form
True Capture
Kinetic Camera Edit Text File of Save into Library
Option 2 New Capturing Gesture
Sensor Activate the Gesture application
Gesture
False
End
Fig. 1.3 The flow of the application

used for pattern matching, a database of predefined gestures of each performed at a

previous time is stored (Ahmed et al. 2016).
The application has two options from which the user can choose either the trans-
lation or adding a new gesture into the database. The translation option will activate
the kinetic camera sensor, and the hearing-impaired person needs to stand in front of
the camera to capture the coordinate of the sign language. If the gesture is performed
correctly, the application will display the text represented for the gesture performed,
respectively. Besides, the application also has a speech synthesizer to pronounce the
text of the respective gestures. Meanwhile, the second option will add and define the
new sign language coordinate into the database. The user needs to save the coordinate
in the text file format on the designated path location.
Evaluation: The application was tested whether it meets the requirements of
the users. The application was evaluated to determine the system effectiveness by
conducting a user acceptance test based on Technology Acceptance Model (TAM)
(Venkatesh and Bala 2008) toward the target respondents to ensure that the respon-
dents can perform the tasks, respectively. The target respondents of this study were
the normal people.
A quantitative approach was implemented in data collection based on a set of the
survey questionnaire. A total of thirty (30) survey questionnaires were distributed
and received for the analysis. The questionnaire consists of thirteen (13) questions
and categorized into four (4) parts. The first part comprised of the perceived ease
of use, the second part is focused on the perceived usefulness, and the third part is
about attitude. Finally, the fourth part investigates the intention to use. The data was
analyzed using arithmetic mean technique based on the ranking score value. Then,
overall mean was calculated and classified into three categories, namely, negative,
neutral, and positive based on the range of mean value between zeros to five as shown
in Table 1.1.
Maintenance: After evaluation phase, minor refinement was done to integrate
corrections of bugs and the user’s feedback which was focused mainly on fine-tuning
of system, configuring, installing, and usability issues. It must meet the scope of any
future enhancement, future functionality, and any other added functional features to
cope up with the latest needs.
Table 1.1 Range of mean

Category Range of mean
value
Negative 0.00–1.66
Neutral 1.67–3.33
Positive 3.34–5.00
1.3 Results and Discussion
1.3.1 Interfaces of the Sign Language Translation

Application
This section explains about the interfaces of the proposed application. Once the
kinetic camera sensor is connected to the computer and the application runs, the main
interface of the application will be loaded as shown in Fig. 1.4a. This application
will be run by two types of users, which is the normal person who is running the
application and hearing-impaired person, who will stand in front of the kinetic camera
sensor and performs the sign language gesture. In order to let the application detect
what gesture has been performed by the hearing-impaired person, the normal person
must first upload the file by clicking the “Load Gesture File” button. There are two
types of view, which is the view of the skeletal algorithm in which the user stands in
front of kinetic camera sensor, while on the second view the camera is in the normal
view, so that the user can see clearly on what the gesture has been performed.
To perform the sign gesture, the hearing-impaired person must stand in front of
the kinetic camera sensor. If the gesture is performed correctly, it will show the text of
sign gesture that has been performed. Besides, the application also has a speech syn-
thesizer where it will pronounce the text of the sign gesture performed, respectively.
Moreover, this application also has the function to record and define a new gesture of
sign language. This function can be performed by clicking the “Capture” button and
the application will capture the gesture performed by the hearing-impaired person.
Then, the user needs to click the “Save to File” button to save in the text file format.
Meanwhile, Fig. 1.4b summarizes the button included within the application. The
function of the button is given as follows:
READ/STORE: Read/Store mode button is an indicator which shows whether
the application is in read mode or the new coordinate gesture of sign language is
ready to save in the file (Fig. 1.4).
CAPTURE: Capture the new gesture of sign language performed by the user.
LOAD GESTURE FILE: Upload the recorded gesture file. Inside the text file
contains the coordinate of the recorded sign language. The dynamic time warping
algorithm was implemented in this application where it will compare two sequences,
which was the recorded gesture in the database and current gesture performed by the
hearing-impaired person to measure the similarity between the two sequences.
SAVE TO FILE: Save a new gesture of sign language in the text file format.
1.3.2 User Acceptance Test
To evaluate the user acceptance test on sign language translation application, the study
was tested to thirty (30) respondents. The experiment was conducted by giving the
respondents opportunity to use and explore the system independently. Then they were
Fig. 1.4 Interface of the application in a main interface and b button
required to answer a set of questionnaires, which consist of thirteen (13) questions

and divided into several categories. The study has successfully done to evaluate
the effectiveness of the application and categorized into four components, which
include perceived ease of use, perceived usefulness, attitude, and intention to use.
The participants were required to rate the answer with the scale of 1–5, which was
strongly disagree, disagree, neutral, agree, and strongly agree.
Table 1.2 summarizes the results for the identified criteria and total mean for
each category, respectively. The results showed that the target respondents were
satisfied and positively accepted all functionalities and features provided by the sign
language translation application. This can be indicated by the total mean results for the
Perceived Ease of Use received (PEU) 4.02 and Perceived Usefulness (PU) received
4.20, respectively. On the other side, most of the participants wanted to use the sign
language translation application for communication and improve knowledge in the
sign language based on the total mean results obtained 4.20 for Attitude (AT) and 4.00
for Intention to Use (ITU). Besides, the overall total mean for the user acceptance
test was 4.09 which means positive feedback from the participants. Therefore, this
indicates that the participants have accepted the sign language translation application
as a tool to communicate between hearing-impaired person and normal person.
1.4 Conclusion
This paper which has presented gives some insight on user technology to construct
the application for the hearing-impaired person to communicate with the normal
person. This application was developed to detect and capture the gesture of the hand
performed by hearing-impaired person. The application then translates it into text
and audio form. In order to perform the task, the application was integrated with
the hardware called the Microsoft kinetic camera sensor to detect the sign language
Table 1.2 The user acceptance test results

No. Criteria Score (1–5) Mean Mean category
1 2 3 4 5
Part 1: perceived ease of use (PEU)
1 I found that AT: sign 0 1 0 19 10 4.3 Positive
language translation
application interfaces are
simple and memorable
2 I found that it is not that 0 4 5 13 8 3.8 Positive
complicated to use AT:
sign language translation
application
3 Performing sign language 0 2 7 13 8 3.9 Positive
gesture using AT: sign
application is very easy
4 I think that other normal 0 2 8 11 9 3.9 Positive
people use AT: sign
application without any
problem
5 Overall, AT: sign language 0 0 5 14 11 4.2 Positive
translation application ease
the user to learn sign
language
Total mean (PEU) 4.02 Positive
Part 2: perceived usefulness (PU)
6 AT: sign language 0 3 2 13 12 4.1 Positive
translation application can
improve my knowledge
toward sign language
translation application can
help me
interact/communicate with
people who use sign
language as their
communication
translation application
might be helpful for me to
learn sign language
Total mean (PU) 4.20 Positive
Part 3: attitude (AT)
(continued)
Table 1.2 (continued)

No. Criteria Score (1–5) Mean Mean category
1 2 3 4 5
9 I like the idea of AT: sign 0 1 1 9 19 4.5 Positive
application
10 Generally, I would 0 4 2 10 14 4.1 Positive
encourage my friends to
use AT: sign language
11 I believe (would be) good 1 1 2 15 11 4.1 Positive
idea to use AT: sign
application to improve
communication with
hearing-impaired people
Total mean (AT) 4.20 Positive
Part 4: intention to use (ITU)
12 If I have the access to AT: 2 0 6 9 13 4.0 Positive
sign language translation
application, I would like to
use it to help me
communicate with the
hearing-impaired people
would be one of my
favorite applications to
improve knowledge in sign
language
Total mean (ITU) 4.00 Positive
Overall total mean 4.09 Positive
gesture. Furthermore, the most advantageous of being supported by this application

was that it can easily record and define new gestures to be added into the database.
The recorded gesture will be stored in the form of the text file format which contains
the coordinate of the gesture.
The application was measured using a user acceptance test based on the tech-
nology acceptance model. This test was performed to see the acceptance of normal
persons toward the application. The questionnaire was divided into four (4) com-
ponents. These components consisted of thirteen (13) questions. Thirty respondents
participated in the test. Most of the respondents were satisfied with the functional-
ities provided by the application and found that it was a great idea to develop an
application that focused on the sign language.
In conclusion, the sign language translation application using kinetic camera sen-
sor was positively accepted by the users to assist the normal people to communicate
with the hearing-impaired person. Therefore, the use of hearing assistive technol-
ogy can dramatically improve the lives of people with hearing loss and increase
the sustainability of social interaction skill between hearing-impaired and normal
community.
References
Abdallah EE, Fayyoumi E (2016) Assistive technology for deaf people based on android platform.
Procedia Comput Sci 94:295–301
Ahmed W et al (2016) Vision based hand gesture recognition using dynamic time warping for Indian
sign language. In: 2016 international conference on information science (ICIS), pp 120–125. IEEE
Bassil Y (2012) A simulation model for the waterfall software development life cycle. Int J Eng
Technol 2(5):1–3
Edward AP et al (2012) Strategies for teaching learners with special needs. Pearson
Jabatan Kebajikan Masyarakat (JKM) Laporan Statistik Jabatan Kebajikan Masyarakat 2016. http://
www.jkm.gov.my/jkm/uploads/files/penerbitan/Bukustatistik2016.pdf. Accessed 8 Apr 2019
Joseph P (2003) A study on certain factors influencing language performance of hearing impaired
students. Asia Pac Disabil Rehabil J 14(2):201–208
Kazim A (2017) A study of software development life cycle process models. 8(1):15–23
Kbar G et al (2017) Assistive technologies for hearing, and speaking impaired people: a survey.
Disabil Rehabil Assist Technol 12(1):3–20
LaPlante MP et al (1992) Assistive technology devices and home accessibility features: prevalence,
payment, need, and trends. Advance data from vital and health statistics
Mokhtar SA, Anuar SMS (2015) Learning application for Malaysian sign language: content design,
user interface and usability. In: Proceedings of the 9th international conference on ubiquitous
information management and communication, pp 1–6. ACM, New York, NY, USA
Pollack ME (2005) Intelligent technology for an aging population: the use of AI to assist elders
with cognitive impairment. 26(2):9–24
Sharma V, Droch B (2015) Gesture-controlled user interfaces. J Inf Sci Comput Technol 2(1):133–
135
Shinohara K, Wobbrock JO (2011) In the shadow of misperception: assistive technology use and
social interactions. In: Proceedings of the SIGCHI conference on human factors in computing
systems, pp 705–714. ACM, New York, NY, USA
UNICEF Malaysia (2017) Childhood disability in Malaysia
Venkatesh V, Bala H (2008) Technology acceptance model 3 and a research agenda on interventions.
Decis Sci 39:273–315
Chapter 2
Fish Freshness Detector Using Sensory
Quality Index Method and Digital Image
Processing Evaluation
Khairul Naim Abd.Aziz, Shameen Izwan Anthonysamy,

Zamzila Erdawati Zainol, Muhammad Akmal Roslani
and Sharir Aizat Kamaruddin
Abstract Fish freshness detector (FFD) currently plays an important role in assess-
ing fish for consumers. There are FFDs available out there in the market, but they are
not conveniently accessible by common users. Therefore, it is important to design an
FFD that can deliver accurateness which can be adopted for its users to make instant
purchasing decisions. To achieve that, this paper proposed FFD model based on fuzzy
logic as system, while Rastrelliger kanagurta and Umbrina roncador as fish samples
species for evaluation. The proposed model consists of two evaluation parts, sensory
quality index method (QIM) assessment and digital image processing. Both were
only focusing on the fish eye, which a sensory assessment for QIM and the redness
value (RV) for the image processing. Based on distinct species evaluation against
days of storage and condition after death, the eye sensory QIM for both species starts
to change from clear to dull throughout 12 days in ice storage. R. kanagurta showed
a rapid rate of deterioration compared to U. roncador. The RV distribution recorded
ranges between 81 and 129 for both species. Finally, a fish freshness indicator as
input setting in fuzzy logic inference system based on sensory QIM and RV were
successfully developed in this pilot test.
K. N. Abd.Aziz (B) · S. I. Anthonysamy · Z. E. Zainol · M. A. Roslani · S. A. Kamaruddin

Faculty of Applied Sciences, Universiti Teknologi MARA, Perlis Branch, Arau Campus, Perlis,
Malaysia
e-mail: khairul87@uitm.edu.my
S. I. Anthonysamy
e-mail: shameenizwan@yahoo.com
Z. E. Zainol
e-mail: zamzila396@uitm.edu.my
M. A. Roslani
e-mail: akmalroslani@uitm.edu.my
S. A. Kamaruddin
e-mail: shariraizat@uitm.edu.my
K. N. Abd.Aziz · Z. E. Zainol · M. A. Roslani · S. A. Kamaruddin
Faculty of Applied Sciences, Marine Research and Excellence Centre (MAREC), Universiti
Teknologi MARA, Perlis Branch, Arau Campus, Perlis, Malaysia

14 K. N. Abd.Aziz et al.
Keywords Fish freshness · Quality index method · Fuzzy logic · Redness value
2.1 Introduction
A food is considered fresh when it is in a good and natural condition, as well as fishes
are. As consumers, many usually have no clue on how long the fish displayed for sale
especially, in the supermarket. Some supermarket even puts old fish on their table,
and consumers did not really get for what they have paid (Hakim et al. 2018; Shetty
and Kumar 2016; Cheng et al. 2013). A slight misinterpretation of stale fish will
result in histamine fish poisoning. Consequently, consuming stale fish will increase
health problems (Humaid and Mamdoh 2014).
The main factor of spoilage in fish is due to the activity of psychotropic gram-
negative bacteria, such as Shewanella putrefaciens and Pseudomonas spp. Those
bacteria are commonly known as pathogenic bacteria, whereby it is transmittable to
human via consumption. Pathogenic bacteria will multiply and cause infections after
it produces a type of toxins in the human body (Zad 2013).
Human interpretations are generally subjective, even for experienced and well-
trained personnel. Common consumers hold less information to determine the fish
freshness and usually rely on experience in assuming based on low odor, moist flesh,
sensory assessment and others. In sensory assessment for fish eye, consumers usually
use its redness as an indicator to predict whether the fish condition is fresh or stale.
However, it is inaccurate and the information of assuming fish freshness varies from
one to another when compared to computers which are sensitive to wide range of
higher and lower color frequencies (Hosseini et al. 2008; Kishore et al. 2016; Issac
et al. 2017; Muhamad et al. 2009).
Addressing these issues, FFD has been introduced and established in the industry
for some time; however, most of the methods used to detect the freshness of the fish
require a laboratory practice. There are also FFDs that require fishes’ sample, hence
promotes more bacteria spread. In addition, FFDs are generally expensive, time-
consuming and not always available (Shetty and Kumar 2016; Chen et al. 2017;
Dowlati et al. 2013; Elmasry et al. 2015).
The intention of this study is to design a sensory FFD based on digital image
processing. This pilot test system will enable users to interpret fish freshness without
any contact to the samples. In achieving that, two objectives were outlined. It started
with the classification of sensory quality index method (QIM) for fish freshness on
daily basis, followed by the extraction of redness value (RV) in fish eye against the
days of storage. The data gathered were used to develop a dedicated rule about the
fish species in fuzzy logic inference application.
2 Fish Freshness Detector Using Sensory Quality Index Method … 15
2.2 Methodology
Aside from fresh water fish, marine fish were the most consumed fishes in peninsular
Malaysia. The two samples used for this study were Indian mackerel; Rastrelinger
kanagurta and Yellowfin croaker; Umbrina roncador, since those species are highly
consumed and reasonably low price in the market (Hakim et al. 2018; Humaid and
Mamdoh 2014). The fish samples were taken directly from the fishermen to ensure
the freshness of the fish. It was to ensure that the fish samples were on its day 0 from
the day it died.
The number of 10 samples for each species were tagged and stored in a separate
insulated cool box for 12 days. During the storage period, crushed ice was used and
replaced for every 3 days. The ice was layered in between and thoroughly mixed with
the samples, a thick layer (5 cm) around the sides, top and bottom of the container
(Muhamad et al. 2009; Murakoshi et al. 2013). The process flow for this study is as
shown in Fig. 2.1.
In acquiring the RV data, two stages were considered: the image acquisition and
redness extraction. Acquisition of the image was carried out using a smartphone
camera, iPhone 5 equipped with a built-in 8-megapixels and 1136 × 640 pixels. The
photos were auto-saved in the smartphone’s library in JPEG format (Kishore et al.
2016; Issac et al. 2017; Dowlati et al. 2013).
While for the extraction, the image was processed by cropping the fish eye segment
from the full-scale image obtained. The RV was analyzed using histogram extracted
from ImageJ application. ImageJ will provide the image histogram that consists of
mean value, count, standard deviation and mode of the redness in 8-bit digital number
0–255 range of interval. All data were scrutinized for attribute settings into fuzzy
logic inference system.
QIM
Fresh Fish Assessment Fuzzy
Image Data
From Storage + System
Processing Analysis
Fisherman Image Setup
Collection
Fig. 2.1 The process flow of fish freshness detector (FFD) using fuzzy logic system
Data
QIM + RV
Fuzzification
Fuzzy Inference System

(FIS)
Fish Freshness Defuzzification
Fig. 2.2 The flowchart of fish freshness detector (FFD) using fuzzy logic system
Both fish samples were analyzed by using two different assessments, sensory QIM
and RV. For the sensory changes three parts of the eye, such as surface, eyeball and
eye, were analyzed. The changes in eye characteristics were recorded accordingly
in the QIM form (Cheng et al. 2013; Murakoshi et al. 2013; Karagöz 2013). The
flowchart of the process from input to output for the proposed system is shown in
Fig. 2.2.
The system was set to a specified rule known as Mamdani fuzzy inference system
(FIS) with two inputs (QIM score and RV) and one output (freshness by day). All
recorded data from sensory QIM and RV were inserted into the FIS via membership
function (MF) in MATLAB R2015a software. At the end, the result would indicate
the specific day and freshness level of the fish sample. Each species was expected to
yield out different reading especially in the RV; therefore each species needs different
database and attribute settings in the FIS to produce an accurate output.
2.3 Findings
This study depicted the average value of sensory QIM scores and RV’s extraction of
samples’ digital image. Table 2.1 shows the sensory QIM scores against the day of
storage. The sensory QIM score starts to decrease as day increases for both species.
Organoleptic and other study related to QIM also found that the longer the storage,
the lower the average score of its quality (Hakim et al. 2018; Cheng et al. 2013;
Kishore et al. 2016). The storage method chosen had impact on the samples too,
without any preservatives fish deteriorates faster, and freshness condition changed
rapidly.
Table 2.1 The eye sensory

Score Condition Day
QIM freshness score and days
of storage for R. kanagurta 0–1 Spoiled 12 and above
and U. roncador 2 Very stale 10–12
3 Stale 4–9
4 Fresh 1–3
5 Extremely fresh 0
The QIM score sheet consists of three sensory features analyzed by the panel.
Each feature has the same score range from 0 to 5. The lowest score of 0 indicates
that the fish is at the highest level of damage, while the highest score of 5 indicates
that the fish is in a extremely fresh state. Surface, eyeball and eye are the three sensory
features that have been considered in this QIM analysis.
Comparing changes in the two species studied, R. kanagurta showed a slight dif-
ference compared to U. roncador because both species had different eye anatomy.
This study observed that U. roncador tends to have a narrower shape of pupil
compared to R. kanagurta which is round (Table 2.2).
At initial day 0, R. kanagurta possess a bulging with protruding lens; shiny black
pupil with metallic brown iris and a transparent eye lid. At day 3, the eye slightly
cloudy, and wrinkles started to occur in the iris; clouding of eye cap. At day 6 the
eye started to turn into a dull and brownish color. On day 9, most of the samples had
sunken and dull eyes covered with yellow slime. After day 12, the entire samples
were getting opaque, dull and damaged eyes.
On the other hand for U. roncador, the eye of all samples was initially convex,
very bright and iridescent oval pupil. At day 3, the eye was still clear but loss of
brightness and slightly cloudy. Day 6 showed an obvious change such that there was
iridescence narrow pupil and the color of the eye started to become darker. At day 9
onwards, the eye started to flatten and became opaque.
At day 12, the eye was already sunken, opaque and covered with yellow slime.
This study found that most samples of both species showed dark and dull eyes covered
with a clear jelly-like slime. This is due to bacterial infection produced by the fish
once it undergoes deterioration (Hakim et al. 2018; Humaid and Mamdoh 2014; Ding
et al. 2014). Unfortunately, toward the end of the observations neither R. kanagurta
nor U. roncador fish portray a clearly bloody eye as expected. The observations are
shown in Table 2.2.
In the extraction of RV from fish eyes, the red color band (brightest to the dark-
est) interval was interpreted via pixel reading inside the yellow arc as in Table 2.2.
The mean data recorded were roughly 81–129 and 85–125 for R. kanagurta and
U. roncador, respectively, as the color of eye turned from clear to dark and dull.
The presence of the uncertain red value distribution was likely due to photographic
unforced errors. Even though these aspects can be minimized, it was hard to be
eliminated completely (Issac et al. 2017; Muhamad et al. 2009; Chen et al. 2017;
Murakoshi et al. 2013). The mean of RV of the samples against days of storage was
plotted in Fig. 2.3.
Table 2.2 Eye changes for

Day of Fish species
sensory QIM assessment
storage R. kanagurta U. roncador
within 12 days for both fish
(R. kanagurta and U. Day 0
roncador); samples were
patched with yellow arc for
RV extraction
Day 3
Day 6
Day 9
Day 12
Through the RV recorded, a smooth linear line was constructed to analyze the eye
redness. Figure 2.3 shows a different trend despite their similar scores in the freshness
by sensory QIM assessment. In the period of 12 days, R. kanagurta followed the trend
of the freshness level; however, for U. roncador the trend less likely agreed with the
level of fish freshness recorded. The deterioration changes such as in opaqueness,
140 5
120
Redness Mean Value
4
QIM Score
100
3
80
2
60
40 1
0 2 4 6 8 10 12
Day
Rastrelliger Umbrina QIM
Linear (Rastrelliger) Linear (Umbrina )
Fig. 2.3 The scatter plot of RV and sensory QIM score of R. kanagurta and U. roncador against
days of storage
cloudiness, shapes and conditions (sunken) of the fish eye also contribute to the
uneven RV distribution.
In addition, the photographic unforced errors which derived from the luminance
and translucency were also a leading factor toward the RV distribution. The wetness
that derived from different eye fluid concentration as fish went along the deterioration
affects the way of light reflected and refracted. Apart from that, the reflection and
refraction properties also differ with temperature and humidity content, thus affecting
on the digital image taken (Muhamad et al. 2009; Murakoshi et al. 2013). Besides,
bloody red color in the fish eye may sometimes be fresh fish but mishandling when
transported or many other factors had caused the blood capillary ruptures (Hakim
et al. 2018; Humaid and Mamdoh 2014).
The FIS settings as the main aim of this study were developed based on sen-
sory QIM and RV data gathered. The input for RV in the system was set into the
range according to the species sampled, R. kanagurta and U. roncador, respectively.
Figure 2.4 shows the surface view of rules from MF that had been set into the FIS
for fish freshness detection.
There were three MFs set into the variable, which were low, medium and high.
This would help for easier identification of the value on RV related to the fish on
certain conditions. Those values set were based on the sensory QIM scores. The
output in the system was then set into day of the fish freshness. For that output,
four MF plots were set to differentiate freshness status of the fish. They were known
as extremely fresh, fresh, stale and spoilt respectively, within the day range of 0–
12 days. Finally, using this setting, once an image captures, the FFD will inform its
user the condition of fish by their day after caught and their freshness.
Fig. 2.4 The surface view of rules settings for fish freshness detection (FFD) with sensory QIM
and RV input of a R. kanagurta and b U. roncador
2.4 Conclusion and Recommendations
The quality and freshness of the fish begin to deteriorate as soon as the fish dies
and cannot be stopped but it can only be delayed. The combined stimulus of time
of death, temperature, environment and method of storage had proven to enhance
the effect of the fish deterioration. This study found that the change in reading of
red value (RV) in both fish eye samples was in the range of 80–130 within 12 days.
Apart from that, a freshness indicator for R. kanagurta and U. roncador fish based on
sensory QIM and RV were successfully developed. However, each species recorded
a slight difference reading especially in their RV; therefore each species needs a
different database and attribute settings to produce an accurate output. Overall, this
pilot test on developing FFD based on image processing was capable of producing
a convincing result to assist consumers or common users for instant fish purchasing
decisions.
References
Chen Z, Lin Y, Ma X, Guo L, Qiu B, Chen G, Lin Z (2017) Multicolor biosensor for fish freshness
assessment with the naked eye. Sens Actuators B Chem 252:201–208
Cheng J, Sun D, Zeng X, Liu D (2013) Recent advances in methods and techniques for freshness
quality determination and evaluation of fish and fish fillets: a review. Food Sci Nutr 55(7):1012–
1025
Ding R, Huang X, Han F, Dai H, Teye E, Xu F (2014) Rapid and nondestructive evaluation of fish
freshness by near infrared reflectance spectroscopy combined with chemometrics analysis. Anal
Methods 6:9675–9683
Dowlati M, Saeid S, Omid M, Hadi S, Jamzad M, De M (2013) Freshness assessment of gilthead
sea bream (Sparus aurata) by machine vision based on gill and eye color changes. J Food Eng
119(2):277–287
Elmasry G, Nagai H, Moria K, Nakazawa N, Tsuta M, Sugiyama J, Okizaki E, Nakauchi S (2015)
Freshness estimation of intact frozen fish using fluorescence spectroscopy and chemometrics of
excitation-emission matrix. Talanta 143:145–156
Hakim G, Liviawaty E, Hasan Z (2018) Study of freshness of Mackerel (Rastrelliger kanagurta
(Cuvier, 1816)) at Rancaekek Market, Resik Market, and Tanjungsari Market. World Sci News
114:1–14
Hosseini HG, Luo D, Xu G, Liu H, Benjamin D (2008) Intelligent fish freshness assessment. J
Sensors 2008:8
Humaid SA, Mamdoh TJ (2014) Effect of storage temperature on histamine formation and bacterial
growth in whole three fish species (Rastrelliger kanagurta, Sardinella gibbosa and Lethrinus
lentjan). Life Sci J 11(9):927–937
Issac A, Kishore M, Sarkar B (2017) Computer vision based method for quality and freshness check
for fish from segmented gills. Comput Electron Agric 139:10–21
Karagöz A (2013) Fish freshness detection by digital fish freshness detection by digital image
processing. Dokuz Eylül University
Kishore M, Issac A, Minhas N, Sarkar B (2016) Image processing based method to assess fish
quality and freshness. J Food Eng 177:50–58
Muhamad F, Hashim H, Jarmin R, Ahmad A, Mara UT, Alam S (2009) Fish freshness classification
based on image processing and fuzzy logic. In: Proceedings of the 8th WSEAS international
conference on circuits, systems, electronics, control & signal processing, pp 109–115
Murakoshi T, Masuda T, Utsumi K, Tsubota K, Wada Y (2013) Glossiness and perishable food
quality: visual freshness judgment of fish eyes based on luminance distribution. PLoS ONE
8(3):1–5
Shetty P, Kumar PC (2016) A novel idea for freshness analysis and classification of iced sea fish. J
Electron Commun Eng 11(4):65–69
Zad NSH (2013) Fish quality assessment through the application of chemico-physical, sensory and
microbiological analyses. Doctoral dissertation, Alma
Chapter 3
The Impacts of Different Types of Slopes
on Soil Fertility Movement of Harumanis
Mango
Sharifah Norashikin Bohari, Che Ahmad Redzuan Che Romeli,

Norhanani Ahmad, Amirul Ikram Azmi, Nurul Ain Mohd Zaki
Abstract Soil fertility is the ability of soil to provide all essential nutrients which
are important for the high quality growth of crops. In order to enhance the fertility
of soil, fertilizers are used not only on crops planted at flat areas but also on ones
planted at slope areas. This study looks into the impacts of different types of slopes
on soil fertility movement of Harumanis mango by using Digital Elevation Model
(DEM) which is generated by using UAV technology GIS. The main focuses of this
research are to generate the flow accumulation from the data of: (1) DEM derived
from UAV technology which is utilized in assessing soil fertility movement and (2)
hydrology tool by evaluating the flow of water across different slopes to identify the
soil fertility movement. The sample of soils from each level of slopes such as upper
slope, middle slope and lower slope is obtained in order to determine the value of soil
texture, soil pH, Potassium (K) and soil salinity. Inverse Distance Weighted (IDW)
tool in GIS is also used to gather interpolation of rainfall data. Using regression
method, the relationship between each slope with the value of soil texture, soil pH,
S. N. Bohari (B) · C. A. R. C. Romeli · A. I. Azmi · N. A. M. Zaki

Faculty of Architecture Planning and Surveying Centre of Studies for Surveying Science and
Geomatics, Universiti Teknologi MARA (UiTM), Arau, Perlis, Malaysia
e-mail: shnorashikin@gmail.com
C. A. R. C. Romeli
e-mail: cheahmadredzuan95@gmail.com
A. I. Azmi
e-mail: amirulikram1@gmail.com
N. A. M. Zaki
e-mail: Nurulainzaki@gmail.com
N. Ahmad
Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA (UiTM), Arau, Perlis,
Malaysia
e-mail: Norhanani615@uitm.edu.my
A. R. Abdul Rasam
Faculty of Architecture Planning and Surveying Centre of Studies for Surveying Science and
Geomatics, Universiti Teknologi MARA (UiTM), Shah Alam, Selangor, Malaysia
e-mail: Rauf@uitm.edu.my

24 S. N. Bohari et al.
Potassium, soil salinity and rainfall data is generated. The findings suggested that
the upper slope had the strongest relationship with the four elements compared to
the lower slope. Hence, it can be concluded that the higher the slope, the higher the
fertility of the soil.
Keywords UAV · DEM · Flow accumulation · Soil fertility
3.1 Introduction
Slope is the uneven, rising or falling of land surface in contrast to the even, flat area
(Strandgard et al. 2014). Majority of crops are planted across flat areas but due to the
scarcity of lands, some of them are planted at slope areas (Sakurai et al. 2004). Slope
can be one of the many factors that contribute to health and productiveness of planta-
tion, i.e. the different types of slopes contains different properties of soil which can be
advantageous for the health of crops (Yasin and Yulnafatmawita 2018). The physical
and chemical properties needed for the growth of crops may work best depending on
the productivity of the soil which is also found at slope areas. The interaction of the
soil forming has made the soil to be heterogeneous (Esu 2010). To supply nutrients
to trees consistently, fertilizers are utilized and dispersed on soils where the crops
are planted (Zaman and Pramanick 2014). Nutritional components such as nitrogen
and phosphorus which can be acquired from fertilizers are very significant in the
production and sustainability of plants. At slope areas, nutrients such as phospho-
rus may not be evenly distributed due to the movement from the higher surface to
the bottom, hence fertilizers are needed (Sundqvist 2011). The plant selected as the
focus of this research is Mangifera indica L. It is also known as Harumanis Mango
in Malaysia and is the most popular fruit due to its unique characteristics compared
to other mangoes in the country. Harumanis Mango is mostly produced for the local
market and exported in small quantity in Malaysia (Aslam 2015). The production of
Harumanis Mango is about 17,429.7 metric tonne which is more than RM57 million
and the area of plantation in the entire country is about 5,816.4 ha (Malaysia D of
A. Fruit Crops Statistic 2016). Like any other crops, Harumanis are planted at both
flat grounds and slope areas. The different types of slopes and hydrologic process in
the area Harumanis are planted essentially play a great influence on the fertility and
properties of the soil (Mondal et al. 2016). In view of that, the growth of Harumanis
at different slopes gives impacts on chemical, physical and biological content of the
soil which can also affect the drainage and sediment redistribution at the area.
Since years ago, crop health monitoring by means of ground survey has been
carried out. The technique includes interviews, taking samples of soil by hand and
using remote sensing technology. Firstly, through interviews, farmers have been
enquired by researchers about their crops and all the data collected from the interview
would be referred to make any predictions for the future use (Lemoine et al. 2005).
The second method is by taking samples of soils from each position of slopes such
as upper, middle and lower/flat area in which the crops are planted at and submitting
3 The Impacts of Different Types of Slopes on Soil Fertility … 25
them for laboratory processes (Yasin and Yulnafatmawita 2018). Thirdly, by using
remote sensing technology, this method can be divided into three categories i.e.
ground-based, airborne and satellite. Ground-based operation is conducted by using
handheld remote sensing tool which is generally used for small operational project.
On the other hand, for large areas, satellite operation is used to map the crops, assess
the condition of crops and estimate the acreage of crops (Wojtowicz et al. 2015).
Recently, with the development of modern technology, Unmanned Aerial Vehicle
(UAV) is discovered and industrialized to easily monitor the health of crops. UAV
is one of the geo-information data acquisition technologies utilized and integrated
in various fields such as engineering, cadastral and also agriculture. In agriculture
sector, many types of researches such as mapping the soil properties, water stresses
and its effects on the plantations are conducted and produced. Based on the previ-
ous research, it was discovered that multi-temporal UAV orthomosaic images had
shown a higher change in wheat growth by utilizing image interpretation (Du and
Noguchi 2017). Due to that reason, UAV is seen today as one of the many beneficial
technologies which should be fully employed in order to enhance the agriculture
sector.
3.2 Material and Method
3.2.1 Study Area
The study area selected for this research is Harumanis Mango Farm, UiTM Perlis. It
is located at 6° 27 26 N and 100° 17 02 E in Arau, Perlis, which is the northern
state of Peninsular Malaysia. With the total area of 20 acres, the number of Harumanis
trees planted at the farm is 1000. There are three stages of Harumanis planting starting
from the year 2009, 2013 and lastly 2015. From the total of 1000 Harumanis crops,
currently only 800 trees have been successfully yielded (Fig. 3.1).
3.2.2 Slope from UAV Image
UAV data images of Harumanis Mango Farm, UiTM Perlis captured using DJI Phan-
tom 4 are obtained in January 2019. The total of UAV images taken are 311 images
and are processed using Agisoft Professional software. Afterward, the process of
slope generation is made by using ArcGIS which starts with the production of con-
tour from DEM data sources in 0.1 m contour interval and subsequently Triangular
Irregular Network (TIN) is then produced from the contour. To generate the slope,
TIN is converted into the Raster data format.
Fig. 3.1 Location of study area
3.2.3 Ground Control Point
Ground Control Point also known as GCP is marked at the ground which encompasses
geographic location X, Y and Z. The 6 of GCP are established with permanent features
due to lack of features in the study area. These 6 of GCP are well distributed at the
area and are then collected to observe X-, Y- and Z-coordinates using Geographic
Positioning System (GPS) instrument with static observations for each of GCP.
3.2.4 Soil Sampling
Soil sampling of the study area is taken at different types of slope which are at upper,
middle and lower surfaces. There are 4 soil samples collected from each of the slope
with the depth of 15 cm below the surfaces (Fig. 3.2) and the total soil samples are
12. The soil samples are collected based on the tip of the tree leaves and are taken
using soil probe instrument. The locations of each soil sampling are then identified
by using GPS instrument.
Fig. 3.2 Depth of taken soil samples. Source Orozco et al. (2014)
3.2.5 Rainfall Data
The rainfall data for the month of January 2019 is obtained from daily observation
rainfall data observed by Meteorological Department Malaysia. Station Chuping,
Station Hospital Kangar and Station Taman Negeri Perlis are the three stations nearby
the study area where the data are observed and collected from. The interpolation of
rainfall data in January 2019 is obtained by using IDW method in Spatial Analyst
Tools in ArcGIS.
3.2.6 Flow Accumulation
DEM is used to produce flow direction of this study area by using Hydrology tool in
Spatial Analyst Tool. Fill is created using Fill tool in which DEM layer is selected
as an input surface raster and Fill is selected as an output surface raster. Then, flow
direction is created by using Flow Direction tool in which fill layer is inserted as
input, Flow_Direction as output and all edge cells forced to flow outward are ticked.
Finally, flow accumulation is created by using Flow_Direction data.
3.2.7 Relationship Between Slope with Soil pH, K, Salinity

and Rainfall
The relationship between each type of slope with four elements: soil pH, K, soil
salinity and rainfall is examined by using Minitab software. Using the software, all
responses and predictions such as the values of each slope and the four components
are obtained.
3.3 Analysis and Discussion
3.3.1 Average Slope at Study Area
As shown in Fig. 3.3a on the left side below, the highest slope at the study area is
21.296° and the lowest slope is 0°. From three blocks of Harumanis tree slopes, the
highest slope of Harumanis is at 4.009–21.296, the middle slope is at 2.171–4.009
and the lowest slope is at 0–2.171. Dark green colour represents the lowest slope and
dark red colour represents the highest slope. It is seen from the figure that block 2
contains the highest slopes, block 1 is covered with both hilly and flat surfaces and
block 3 is mostly filled with flat areas. Figure 3.3b on the right side below illustrates
the average slope at soil sample location of Harumanis Mango Farm area. The highest
slope value is 8.362° and the lowest slope is 0°.
3.3.2 Flow Accumulation of Study Area
Figure 3.4 shows the flow accumulation at the study area by using the data of flow
direction. The highest flow accumulation is presented in red colour lines. The result
of this flow accumulation demonstrates that a raster, which is determined by the
Fig. 3.3 a Slope of harumanis mango, b average slope at soil samples

Fig. 3.4 Flow accumulation
weight of each cell during the flow into the downslope cell, accumulates at each
of the cell. The reason for such outcome is because the flow accumulation is based
on the number of cells movement into each cell in the output raster. The highest
number of flow accumulation represents the area of the most concentrated flow and
it is also used to identify the stream channel of the study area. Zero number of flow
accumulation on Fig. 3.5 is described as local topographic highs.
3.3.3 Soil Nutrient, Soil pH, Potassium and Soil Salinity
Figure 3.5a displays the soil texture at the study area. Red colour indicates sandy
loam while blue colour indicates loamy fine sand. Roughly, it can be seen that the
lower slope consists of sandy loam soil texture such as C1, C2, C3 and C4. Meanwhile
the upper slope consists of loamy fine sand soil texture such as A1, A2, A3 and A4.
While the middle slope consists of 50% sandy loam at B2 and B3 and another 50%
Fig. 3.5 a Soil texture content, b soil pH
of loamy fine sand at B1 and B4. Both types of soil texture are considered as coarse-
textured soil and are often poor in fertility. The reason being is that the soils have
greater percentage of macro poses which often results in water losses and nutrient
deficiency in the root zone (Asghari et al. 2011). With bigger sized particles, the soil
allows for good drainage such as water but is not strong enough to hold the amount
of water or nutrients for Harumanis Mango.
Figure 3.5b shows the average soil pH at Harumanis Mango Farm which is from
pH 4.4 until 5.2. The optimal soil pH for Harumanis Mango is between 5.5 until 7.5
but the best soil pH value is between 6 and 7.2 (Sewards 2014). Overall, the soil pH
of Harumanis Mango at the study area is lower than the optimum range. This shows
that the soil in that area need to be supplemented with lime or calcium carbonate
(CaCO3) to increase the pH value (Nutrition 2015). The soil pH value is influenced
by many factors such as DEM and slopes. The DEM of the study area is between
12.017 until 25.408 m which means it is under the sea level measurement. The highest
difference of value shows that the area consists of different terrains and has slopes
from 0° to 21.296° throughout the whole farm but the soil samples obtained from
the slopes are only from 3.099° to 7.421°.
The potassium value is divided into 3 groups which are 0.171–0.362, 0.362–0.553
and 0.553–0.744 mg/kg as shown in Fig. 3.6a. Green colour illustrates the areas that
are low in potassium which are A3, A4, B3 and B4. Bright brown colour represents
the areas with moderate level of potassium which are A1, A2, B2 and C4 and pink
Fig. 3.6 a Potassium, b soil salinity
colour represents the areas with high level of potassium which are B1, C1, C2 and
C3. It is found that the availability of potassium at the lower area is greater than the
higher area. This may be due to the runoff from the high slope to the lower slope
during rainfall. Lack of fertilizers may also be one of the reasons that influence the
results because each of the trees is given the same amount of fertilizers (1.86 kg)
regardless of their positions, i.e. at higher area or lower area.
Figure 3.6b demonstrates the quality of soil salinity which is divided into 3 classes
from the lowest to the highest. Blue colour represents the lowest quality of soil salinity
at range from 0.04 until 0.06. Yellow colour represents as the middle quality of soil
salinity at range 0.06 until 0.09. While red colour represents the highest quality of
soil salinity starting from 0.09 until 0.11. The average soil salinity at Harumanis
Mango Farm, UiTM Perlis is 0.08 and the minimum and maximum soil salinity
values recorded are 0.04 and 0.11, respectively. In similar figure, it has been shown
that the lower slope has the highest quality of soil salinity, the middle slope has
middle quality of soil salinity and the upper slope contains the lowest quality of soil
salinity. This may be due to the influence of rainfall which affects the soil pH at the
study area; higher level of acid at the lower slope as compared to the upper slope.
3.3.4 Relationship of Different Slope Towards Soil Nutrient,

Soil pH, Potassium and Soil Salinity
Figure 3.7 shows the values of R2 for all the three slopes; the lower slope is 0.336,
the middle slope is 0.621 and the upper slope is 0.872. The lower slope has the
weakest relationship with the soil pH, the middle slope shows an average of positive
relationship with the soil pH and the upper slope has the strongest positive relationship
with the soil ph. It is seen that the value of R2 increases with the increasing of slopes
starting from 0.336 at the lower slope, 0.621 at the middle slope and 0.872 at the
upper slope (Tsui et al. 2004). It can be concluded that the soil pH at the lower
slope has been influenced by the water movement from the higher area. The upper
slope contributes to greater runoff as well as greater translocation of surface material
downslope through surface erosion and movements of soil mass.
Figure 3.8 demonstrates the values of R2 between 3 slopes, i.e. lower slope, middle
slope and upper slope with potassium which are, respectively, 0.894, 0.907 and 0.935.
This indication shows a strong relationship between the slopes and potassium; it is
observed that the value of R2 at the upper slope is higher and has the strongest
relationship as compared to the middle and the lower slope. It can be concluded that
Fig. 3.7 Relationship between three slopes with soil pH
Fig. 3.8 Relationship between three slopes with potassium

the more increase in the slope of the study area, the higher the value of potassium in
that area (Aytenew 2015). Besides that, the staff at the plantation of UiTM Perlis has
been using placement method for fertilizers in which the fertilizers are distributed
on the surface of the soil. This technique of dissemination has the tendency to be
easily washed off to the lower area when the rain falls. Furthermore, the types of
soil texture at the study area which are sandy loam and loamy fine sand have also
influenced the result. These two textures of soil are coarse in sizes and have loose
spaces between their particles. Hence, even though they may allow for good water
drainage, they are not strong enough to contain the amount of water or nutrients for
Harumanis Mango.
The values of R2 between 3 slopes, i.e. lower slope, middle slope and upper slope
with soil salinity are, respectively, 0.639, 0.872 and 0.936. This indication shows
that there are differences between the type of slopes and soil salinity. In Fig. 3.9, it
is seen that there is a strong relationship between the slope and soil salinity at the
upper slope compared to the other slopes. This is because, the salt in groundwater
at the higher area is washed off to the lower area due to rainfall based on the result
of flow accumulation. The outcome of that turns the amount of salt in groundwater
or soil higher at the lower area compared to the higher area. Based on the result in
this study, the higher the level of salt in soil, the stronger the acidity at the lower
slope and the lower the level of salt in soil, the weaker the acidity at the upper slope.
Both of these results form a neutral or neutral solution. Besides that, soil salinity
may also be caused by natural processes such as physical and chemical weathering,
evapotranspiration, drought and lack of precipitation. It also happens due to human
activities such as using salt-rich irrigation, inefficient water use, poor drainage and
others which lead to the reduced soil fertility and loss of crop productivity ultimately
(Manuel et al. 2017).
Figure 3.10 displays the value of relationship between each slope with rainfall
which are 0.655 for the lower slope, 0.591 for the middle slope and 0.571 for the
upper slope. The relationship value between the slopes and rainfall shows middle or
average relationship as it can be seen that the values of R2 of each slope are different
from one another. The value of R2 at the lower slope is 0.655 and it is higher than
Fig. 3.9 Relationship between three slopes with soil salinity

Fig. 3.10 Relationship between three slopes with rainfall
the upper slope which is 0.571. This result indicates that the two variables have
average/middle relationship value with each other but the relationship at the lower
slope is stronger compared to the upper slope. This is mainly because the water that
is received at the lower slope from the rainfall also moves from the groundwater to
the lower area. Based on the previous research, the runoff coefficient increases with
the increase in slope. The increased slope results in a decrease of the soil infiltration
rate which then leads to the increase in runoff (Mu et al. 2015).
3.4 Conclusion
In this research, the implementation of the UAV technology and Geographic System
(GIS) to investigate the soil fertility in which Harumanis Mango are planted in at
UiTM Perlis Farm is considered a success as the objectives of the study have been
achieved. Using the dense point cloud classification, the elevation of the study area
is generated to determine the lower and the higher areas. Then, the slopes of the
selected area are generated by using DEM data to classify the value of slopes. This
stage is important to determine the gradient of the slope. Besides that, flow direction
and flow accumulation are also generated by using DEM data to identify the flow
of water in which it moves from areas that have high elevation to low elevation.
The interpolation of rainfall data is also made to examine the amount of rainfall in
January 2019.
In conclusion, the relationship between each type of slopes with elements, i.e.
soil pH, amount of potassium, soil salinity and amount of rainfall data at each of
the location samples are obtained and examined. It is seen that the upper slope has a
stronger relationship with the four elements compared to the lower slope. Hence, it
can be established that the higher the slope, the more influential it is to soil fertility
of the plants. It can also be concluded through this study that the integration of UAV
technology and GIS application in agriculture or plantation may contribute a lot of
benefits not only on the productivity and growth of plantation but also to the officers
or manpower who are in charge of the farms.
References
Asghari S, Abbasi F, Neyshabouri R (2011) Effects of soil conditioners on physical quality and
bromide transport properties in a sandy loam soil. https://doi.org/10.1016/j.biosystemseng.2011.
02.005
Aytenew M (2015) Effect of slope gradient on selected soil physicochemical properties of Dawja
watershed in Enebse Sar Midir district, Amhara national regional state. 74–81. https://doi.org/
10.5251/ajsir.2015.6.4.74.81
Du M, Noguchi N (2017) Monitoring of wheat growth status and mapping of wheat yield’s within-
field spatial variations using color images acquired from UAV-camera system. Remote Sens.
https://doi.org/10.3390/rs9030289
Esu IE (2010) soil characterization, classification and survey. 73–99
Lemoine G, Conway J, Baker J (2005) Agricultural monitoring agricultural the need for better.
https://doi.org/10.1109/ISADS.2005.1452131
Malaysia D of A. Fruit Crops Statistic 2016 (2016) Dep Agric Malaysia 1–180
Manuel R, Machado A, Serralheiro RP (2017) Soil salinity: effect on vegetable crop growth. Manag
Pract Prev Mitigate Soil Salinization. https://doi.org/10.3390/horticulturae3020030
Mondal A, Narasimhan B, Sekhar M, Mujumdar PP (2016) Hydrologic modelling. Proc Indian Natl
Sci Acad 82:817–832
Mu W et al (2015) Effects of rainfall intensity and slope gradient on runoff and soil moisture content
on different growing stages of spring maize. Water (Switz) 7:2990–3008
Nutrition GM (2015) Food for fruit—nutrition management in mangoes tropical horticultural
consulting
Orozco RA, Lee M, Stock SP (2014) Soil sampling and isolation of entomopathogenic nematodes
soil sampling and isolation of entomopathogenic nematodes (steinernematidae, heterorhabditi-
dae). https://doi.org/10.3791/52083
Sakurai K et al (2004) Impact of agricultural practices on slope land soil properties of the moun-
tainous region of Northern Vietnam: a case study in Bac Ha district. Lao Cai Province Southeast
Asian Stud 41:503–518
Sewards J (2014) Backyard Gard
Shareef RS, Mamat AS, Al-Shaheen MR, Aslam, MS (2015) Study of heavy metals in mango
(Mangifera Indica L) in Perlis, Malaysia. Indian Res J Pharm Sci Ind Res J Pharm Sci 2
Strandgard M, Alam M, Mitchell R (2014) Impact of slope on productivity of a self-levelling
processor. Croat J For Enginnering
Sundqvist M (2011) Nitrogen and phosphorus dynamics across an elevational gradient in a Swedish
Subarctic Tundra
Tsui C, Chen Z, Hsieh C (2004) Relationships between soil properties and slope position in a
lowland rain forest of southern Taiwan relationships between soil properties and slope position
in a lowland rain forest of southern Taiwan 1:7–18
Wojtowicz M, Wojtowics A, Piekarczyk J (2015) Application of remote sensing methods in
agriculture. Commun Biometry Crop Sci 11:31–50
Yasin S, Yulnafatmawita Y (2018) Effects of slope position on soil physico-chemical characteristics
under oil palm plantation in wet tropical area, West Sumatra Indonesia. Agrivita 40:328–337
Zaman S, Pramanick P (2014) Chemical fertilizer by ecosystem service of seedling in terms of
carbon storage view project threats to sundarban fishery view project. https://doi.org/10.13140/
2.1.4213.8883
Chapter 4
Quran Indexing Using Cloud Database
Khairul Anwar Sedek , Noriati Roseni binti Ghazali

and Mohd Nizam Osman
Abstract The teaching of Quran touches all aspects of life inclusive of the faith, wor-
ship, morality, laws, reminders, histories, and analogies. It also encourages people
to think. Despite the rich content of the Holy Book, a lot Muslims do not understand
what they read since it is revealed in Arabic, a language which is foreign to the
majority. In Southeast Asian countries, the majority of Muslims speaks in Malay
language and they do not really understand the words of Quran, which are in Arabic.
Most of them read translations. Today, Quran readers may resort to application from
the computers and smartphones to guide the reading and understanding of the teach-
ings of the religion. Unfortunately, there are not many applications written in Malay
language. Thus, it is significant to provide the Malay readers with a support tool to
assist them understanding what they read based on the words from the Quranic index
just by searching an index or topic. This paper presents the design of Quran index
in xloud database which is known as Quran indexing web application (QIwa) using
Firebase Cloud Database and ReactJS web application framework. The main task of
the methodology is to migrate the traditional database into state-of-the-art serverless
database architecture that allows the development of Quran database and application
for both web and mobile applications. In addition, this paper also put forward a pro-
totype of Quran application as a reference tool for the contents of Quran by themes,
sections (juz), and chapters (surah). According to user acceptance test (UAT), this
paper is a proof of the concept of the Malay language Quran indexing based on cloud
database that will later develop the Malay Quran indexing.
Keywords Online quran indexing · Web application · Cloud computing
K. A. Sedek (B) · M. N. Osman

Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, Perlis Branch,
02600 Perlis, Arau, Malaysia
e-mail: khairulanwarsedek@uitm.edu.my
M. N. Osman
e-mail: mohdnizam@uitm.edu.my
N. R. Ghazali
Institut Aminuddin Baki Cawangan Utara, Kementerian Pendidikan Malaysia, Bandar Darulaman,
06000 Jitra, Kedah Darul Aman, Malaysia
e-mail: nrg.gmel@gmail.com

38 K. A. Sedek et al.
4.1 Introduction
Quran is a special revelation for our last prophet, Nabi Muhammad .

It was revealed phase by phase in sequence of 30 divisions (juz), 114 chapters (surah),
and 6,236 verses (Ayah) Ta’a et al. (2017). It is the best and complete guidance from
Allah to Muslims for seeking his pleasure. In fact, the Quran has special features
for everyone who reads it. Our Prophet, Nabi Muhammad said: “The
most special service is to read the Quran and practice it in daily life” (narrated by
Bukhari). In a hadith (Narrated by Tirmidhi), he also said: “I leave to you two things,
if you hold fast to both of them, you will not pervert forever, namely Quran and
my Sunnah” Ta’a et al. (2017). In digital era, digital Quran application is available
on desktops, mobiles, and online applications. There have been various types of
applications developed and abundance of websites about the Quran published online,
providing a quick and easy way for users to recite and learn the Quran (Adhoni and
Siddiqi 2013).
The Quran has been translated into a range of languages around the world which
are easily available in bookstores and applications in online and offline. One of them
is in Malay. Malay language is the lingua franca in Southeast Asia and the number of
Muslims in this region is more than in the Arab world and more than combined France
and Spain Christians (Severino et al. 2010). Therefore, there is a huge potential users
of Quran digital application in Southeast Asia. There are numerous applications built
to facilitate the retrieval of understanding of the Quran such as Quran Bahasa Melayu,
Terjemahan Quran Melayu, and Al-Quran Melayu MP3 (Zahari et al. 2017).
Furthermore, there are various issues that need to be considered when dealing
with Quran translation; such as synonyms in translation and difference in translation
method (Tabrizi and Mahmud 2013) and the performance of multi-script indexing of
translated texts of Quran (Othman and Wahid 2011). Quran index is defined as a few
of verses grouped in related topic, title, and contents to simplify searching-related
issue based on the Quran. It also defined as a group of verses based on same meaning
from verses or the sequence of revealed verses Ta’a et al. (2017).
The indexing of the Quran needs to be stored in database file to enable the Quran
content searchable using digital Quran (Bakar and Rahman 2003). Currently, there
is no digital Quran stored in NoSQL and cloud database. By using this technology,
the possibility to get better query result to Quran content is higher because NoSQL
provides query to semi-structured and un-structured data. NoSQL database is used in
cloud computing to allow the possibility of providing user-friendly query languages
and exhibiting the results efficiently (Holanda and Souza 2016). Therefore, this paper
believes that the development of Quran indexing database could improve the effi-
ciency of Quran indexing storage and query. Therefore, this paper aims to propose
the Quran indexing database in NoSQL cloud database to explore the potential of
Quran indexing using cloud database.
4 Quran Indexing Using Cloud Database 39
4.2 Related Works
Several studies have explored different areas related to Quran indexing. Ta’a et al.
(2017) develops web mobile based using PHP and MySQL database. Ahmad et al.
(2016) explore semantic-based ontology for Malay Qur’an Reader that focuses on
the search techniques of Quran. Adhoni and Siddiqi (2013) build a Quran search API
for learning al Quran. Ta’a et al. (2017) study the relation of Quran and information
technology, in terms of searching for classification of al Quran. Ouda (2015) also
finds the same related issue as to who build “Intelligence System” also “Semantic
Search” for the Quran.
4.2.1 Mobile Web-Based Quran Index Application
The mobile web-based Quran Index application Ta’a et al. (2017) is able to find Quran
verse by theme. The application is suitable for Muslims especially for learning in
the Quran class. Figure 4.1 shows the Quran search page result by theme. The page
shows the search result of the related surah based on the user’s selected theme.
The mobile web-based has Quran index database using MySQL database.
Table 4.1 describes the structure of the Quran index table. The table has six
columns: kd_indexs, kd_surah (verses), kd_kategori (category), rentangayat (verse
description), sebabturun (contextual background of the supposed revelation (asbāb
al-nuzūl)), and tempatturun (place of revelation).
4.2.2 Web-Based Quran Indexing
Herwanto (2017) implements web-based Quran indexing that includes topics,

subtopics, surah, each verses audio, and verse using relational database. The system
provides general theme and subtopics as the branched or part of the topic. The work
implements the Quran web application using PHP, HTML, CSS, and JavaScript. The
work successfully implements the Quran index faster. Three Quran teachers evaluate
the work based on a set of questionnaire questions.
4.2.3 Semantic-Based Ontology for Malay Quran
Ahmad et al. (2016) summarize the search strategies as listed in Table 4.2 that is used
in current lookup on Quran and additionally study the preceding research conducted
on Quran Semantic Search and Quran Ontology-Based Search focusing on Malay
Quran.
Fig. 4.1 Web page of Quran content search
Table 4.1 Structure of the

Field Data type
mobile Quran indexing
Kd_indeks Int(10)
Kd_surah Int(3)
Kd_kategori Int(1)
Rentangayat Varchar(100)
Sebabturun Text
Tempatturun Varchar(100)
Table 4.2 Rating of

Rank Value
evaluation
Strongly agree 5
Agree 4
Not sure 3
Disagree 2
Strongly disagree 1
This evaluation helps the research in addressing the well-known problems and
boundaries in Malay Quran that affect its accessibility. Therefore, this research inves-
tigates the existing issues related to the study of Quran and research the contemporary
search methods used in research on the Quran, specifically the Malay Quran. This
lookup will help researchers recognize and study the current state of affairs of research
on the Quran. Additionally, this paper studies the contemporary search techniques
used in present lookup on the Quran, especially the Malay Quran. This paper pro-
poses new architecture for the Malay Quran indexing. With this architecture, it can
assist research on the Quran, typically on the Malay Quran. This evaluation helps
the lookup in addressing the familiar troubles and boundaries in Quran information
retrieval that have an impact on its accessibility.
4.3 Methodology
This paper develops QIwa in six-phase system development methodology: planning,

information gathering, system analysis, system design and implementation, testing
and evaluation, and documentation. The planning stage involves feasibility study and
defines project’s problem, objective, and scope.
The information gathering stage includes study on the existing Quran indexing
development. This phase reviews related existing work on Quran index from theo-
retical study, journals, books, and articles. The related work is searched by keyword
“Quran Index” + “Web Application” from Google Scholar, Academia, and Research
Gate.
The system analysis phase analyzes the system requirements including user
requirement and system requirements. The system should provide three search cat-
egories: Index list to search the contents by linking the verses one by one. Index
classification that consent about the classification of themes where Quran reader can
choose any themes to search the related verses. Index Juz division that simplifies the
Quran reader to get the whole surah by linking the verse (surah) listed.
The system design involves design of database and application. The database
model uses Firebase data modeling that provides structured and un-structured JSON
data. Figure 4.2 shows the database model of Quran index for Al-fatihah surah, the
first surah in Quran. The data model contains the verse, count (the number of verses in
the surah), id (primary key), juzID (unique ID of Juz), surahID (unique ID of verse),
surahName (verse name), and URL (link to the ayah in image format). Figure 4.3
depicts the site map of QIwa.
Sketching is the method that has been used to see more clearly what the sitemap
is about; the sketches illustrate the interaction of application interface from begin-
ning until the end especially the chosen layout in each screen. Sketch is also very
fast, efficient, and a cheap method to express the developers idea by visualizing the
interaction between each screen and the connection between them. Figure 4.4 shows
the sketching of overall QIwa. The web application starts with frontend that displays
Fig. 4.2 Quran index data model
Fig. 4.3 QIwa site map
all the categories in QIwa. Each category then shows their detail page if a category
is selected.
This paper implements QIwa using ReactJS framework for the frontend of appli-
cation development and Node.js as the backend of the system. Visual Studio code is
used as the integrated development environment (IDE) for coding the Node.js and
Fig. 4.4 The overall user interface design by hand sketching method
ReactJS script. System implementation involves a few steps: data acquisition from
Smart Quran application (“Jabatan Kemajuan Islam Malaysia Smart Quran,” n.d.),
data conversion from csv format to JSON, data migration to Firebase database, and
application development. Figure 4.5 depicts the conversion steps of Quran data from
csv file to JSON (step 1) and from JSON to Firebase database (step 2).
Figure 4.6 shows the QIwa screenshots of the web page as the prototype imple-
mentation. Page 1 shows the main page which contains three main page division:
Quran navigation by Juz at the left panel, Carian Surah (search by verses) at the
center of the page and Carian Tema (Search by Theme) at the bottom of the page.
After user chooses a surah in the home page, the system shows the full verses in a
new page as shown in Page 2.
4.4 Evaluation and Result
For the purpose of testing and evaluation, the range analysis in usability test and
user acceptance test is used to show the statistical method result which is present
each response from the questionnaire that have been collected from the respondents
of both categories. Table 4.2 shows the value and rating of evaluation of the web
application.
Fig. 4.5 The conversion of Quran data from csv file to JSON data file and from JSON to Firebase
database
Fig. 4.6 The implementation of Quran indexing web application
4.4.1 Usability Test
The usability test is a measurement of how easy it is to use the application by

measuring its effectiveness, efficiency, and satisfaction of specified users. This is
achieved specifically through goals in the context of use. This testing is conducted
by eight respondents involving several religious teachers and religious students in
considering the validity and authenticity of the Quran through a few questionnaires
Fig. 4.7 Respondent’s feedback of usability test
to test web applications reliability and suitability as a reference. The usability test
questionnaire that had been represented includes:
Q1 The application is easy to use and understand
Q2 I can easily find Quran index by selected category
Q3 The interface is attractive
Q4 I’m satisfied with the web content: authenticity
Q5 I’m satisfied with the web content: validity
Q6 The presentation and content of this application is stimulating
Q7 Overall, the application can be a support tool to help Malay Quran reader.
Figure 4.7 shows the result of usability evaluation from respondents on web appli-
cation reaction. The evaluation involves eight respondents. It shows that 75% of
the respondents agree that QIwa ease user to use Quran Index. Other than that, all
respondents strongly agree that the web content is suitable for user to use it as a
reference.
The evaluation involves eight respondents. It shows that 75% of the respondents
agree that QIwa ease user to use Quran Index. Other than that, all respondents strongly
agree that the web content is suitable for user to use it as a reference.
4.4.2 User Acceptance Test
User acceptance test (UAT) is a type of system testing that is a process to obtain
the confirmation whether the application meets mutually agreed based upon require-
ment and used as final step before the applications used by real users. In this test,
demographic information of the respondents is itemized such as age, gender, and
their state. The usability test questionnaire and rating are presented here:
Q1 It is easy to use the application
Q2 I read surah well
Q3 I can easily find Quran Index in surah by selected category
Fig. 4.8 The UAT respondent’s feedback
Q4 I’m satisfied with the web content

Q5 Overall, the application is good for Malay Quran reader.
Figure 4.8 shows the UST result. The result shows 73.3% of the respondents
strongly agree that the application is easy to use, and the application is good for
Malay Quran reader.
4.5 Conclusion
The research successfully accomplishes the objectives of the research. It also fulfills
the target users’ requirements through the web application. The efficiency of web
application helps Malay Quran reader to understand the contents of the Quran.
Overall, the result shows that QIwa was acceptable by end users as Quran reference
tool. This is a result from the cloud-based approach for the application and database
development strategy. This paper is an effort to experiment the application of cloud
technology for Quran application development. Through this experiment, this paper
demonstrates the development of Quran indexing using Firebase database, ReactJS
client-side development, and Node.js server-side application.
For future work, this paper suggests enhancing the QIwa performance such as
upgrade to progressive web application, link the index table to additional content
type such as image, audio, and video. Additionally, more enhanced features such as
adding audio translation and interactive session can be introduced. Hopefully, the
application can help Quran reader as an effective reference tool to learn Quran.
References
Adhoni ZA, Siddiqi AA (2013) A programming approach for the digital Quran applications. Int J
Eng Comput Sci IJECS-IJENS 13(05)
Ahmad ND, Bennett B, Atwell ES (2016) Semantic-based Ontology for Malay Qur’an Reader.
In: IMAN’2016 4th International conference on islamic applications in computer science and
technologies. Leeds
Bakar ZA, Rahman NA (2003) Evaluating the effectiveness of thesaurus and stemming methods
in retrieving malay translated Al-Quran documents. In: Sembok TMT, Zaman HB, Chen H, Urs
SR, Myaeng S-H (eds) Digital libraries: technology and management of indigenous knowledge
for global access. Springer Berlin Heidelberg, pp 653–662
Herwanto F (2017) Desain Aplikasi Pengindeksan Dasar-Dasar Hukum Al Quran Berbasis Web
(UNversitas Muhammadiyah Surakarta). http://eprints.ums.ac.id/id/eprint/51549
Holanda M, Souza JA (2016) Query languages in NoSQL databases. Handbook of research on
innovative database query processing techniques, pp 415–437. https://doi.org/10.4018/978-1-
4666-8767-7.ch015
Jabatan Kemajuan Islam Malaysia Smart Quran (n.d.) Accessed 6 Aug 2019, from Smart Quran
website: http://www.islam.gov.my/smart-quran
Othman R, Wahid FA (2011) Issues in evaluating the retrieval performance of multiscript translations
of Al-Quran. http://myrepositori.pnm.gov.my/handle/123456789/3093
Ouda K (2015) QuranAnalysis: a semantic search and intelligence system for the quran (PhD thesis).
Master’s thesis, University of Leeds, Leeds, UK
Severino RC, Thomson E, Hong M (2010) Southeast Asia in a new era: ten countries. One Region
in ASEAN, Institute of Southeast Asian Studies
Ta’a A, Abed QA, Ahmad M (2017) Al-Quran ontology based on knowledge themes. J Fundam
Appl Sci 9(5S):800–817
Tabrizi AA, Mahmud R (2013) Issues of coherence analysis on English translations of Quran. In:
2013 1st international conference on communications. Signal processing, and their applications
(ICCSPA), 1–6. https://doi.org/10.1109/ICCSPA.2013.6487276
Zahari NHAHB, Bidin SNBBS, Syamsuddin SNBW (2017) Development of Al-Quran android
application from year 2013–2016: the highlight. Int J Acad Res Bus Soc Sci 7(6):183–195
Chapter 5
Geospatial Site Suitability
for Sustainable Property Investment
Ernieza Suhana Mokhtar, Wan Nur Azliena Wan Mohd Zaki,

Noraini Nasirun, Fatin Amirah Hanif and Idham Nugraha
Abstract Determination of suitable location for investment with relevant price by

considering surrounding facilities is challenging due to conventional assessment,
which considering past experiences from friend’s advice or family members has
caused uncertainty in estimating the value of the property in Malaysia. Therefore,
this study aims to (i) determine the set of criteria that influence property valuation
and (ii) map a potential location for investment. Selection of criteria from previ-
ous studies was carried out in this study. The analytical hierarchy process (AHP),
which is one of the multi-criteria decision analysis (MCDA) was used to assign the
weight of selected criteria that influenced the property valuation and finally are inte-
grated into Geographical Information System (GIS). Several criteria were determined
as significantly affecting the property valuation, such as existing services, schools,
government building, public defence, place of interest, healthcare and accessibility.
However, the combination of the criteria was tested to choose significant criteria
in Perlis’s property environment. This study is beneficial for future developmental
planning and helps the investor in locating a potential location as well as improvises
a sustainable planning decision-making.
E. S. Mokhtar (B) · W. N. A. Wan Mohd Zaki

Faculty of Architecture, Planning & Surveying, Centre of Studies for Surveying Science &
Geomatics, Universiti Teknologi MARA, Arau, Perlis, Malaysia
e-mail: erienas81@gmail.com
W. N. A. Wan Mohd Zaki
e-mail: azlienazaki@gmail.com
N. Nasirun
Faculty of Business Management, Universiti Teknologi MARA, Arau, Perlis, Malaysia
e-mail: noraininasirun@gmail.com
F. A. Hanif
Perlis State Economic Division, Padang Besar, Malaysia
e-mail: fatin@perlis.gov.my
I. Nugraha
Department of Urban and Regional Planning, Universitas Islam Riau, Pekanbaru, Indonesia
e-mail: idham.nugraha@eng.uir.ac.id

50 E. S. Mokhtar et al.
Keywords Site suitability · Sustainable property investment · GIS · Analytical

hierarchy process
5.1 Introduction
Property is defined as ownership of things, including land and any permanent fea-
ture attached to the building protected by the law (Render 2017), while the process
of estimating the value is called as property valuation (Kara and Oosterom 2018).
Investing in property is a crucial decision to be made because it involved the future
value that may be affecting in many years to come. Sustainable Development Goals
(SDG) Report 2017 highlighted some issues that need to be addressed related with
the human settlement, such as the ability to own a house, improving infrastructures
in certain areas and pollution issues (United Nations 2019). This report identifies the
need for the price valuation for owning a property according to the location, infras-
tructure and services available for the area. As reported by Ganeshwaran (2019), high
property price is a major hurdle for the Malaysian citizens to own new house and it
results to about 73% unsold properties, which is reported by Bank Negara Malaysia.
The property value depends on several paramaters and becomes inconsistent due
to the several factors such as demographics, income status, environment and existing
facilities, which affect the value of the property (Li and Pgrni 2015; Trojanek 2010).
Conventional methods have been used by practitioners such as comparable method,
profit method and multiple regression method to identify the property price (Pagourtzi
et al. 2003). Sometimes, most of the decision-makers decide by past experiences in
property investment, friend’s advice or family needs (Nur Ezra et al. 2018). However,
the existing method is time-consuming and costly in the process (Bohari et al. 2015)
due to site investigation, hardcopies production and report studies. Furthermore, the
professional valuers experience difficulties in performing accurate valuation due to
the lack of comparable information (Boshoff 2015).
Due to the limitation of the current technology that is implemented in Malaysia, it
leads to the gap between supply and demand caused chaos in the value of the property.
Therefore, the needs of developing computerised valuation and proper database are
necessary in property investment (Nur Ezra et al. 2018). The GIS capabilities with
MCDA method in constructing the existing spatial data change the way of analysis
to see a big picture of the situation (Cervelló-Royo et al. 2016; Codosero et al. 2018;
Gatheru and Nyika 2015; Siejka 2017). The analysis is reviewed through the attribute
data, especially procedures for multi-criteria and multi-objective location analysis
in GIS (Rikalovic et al. 2014). Several criteria have been taken into consideration
in property valuation (Table 5.1) which are supported by multivariate regression
model (Gatheru and Nyika 2015) and AHP (Bozdağ et al. 2016; Bunruamkaew
and Murayama 2011; Bunyan Unel and Yalpir 2019; Cervelló-Royo et al. 2016).
However, the practices caused uncertainty valuation, which leads to the symptom of
error in valuation (Achu et al. 2015; Boshoff 2011; Kucharska-Stasiak 2014).
5 Geospatial Site Suitability for Sustainable Property Investment 51
Table 5.1 List of the criteria

Author Criteria used
used in each study
accordingly to authors Li and Pgrni (2015) • Access to transport (road)
• Schools
• Hospitals
• Police stations
• Access to railway
• Land—use type
• Govt. buildings
Abidoye and Chan (2016) • School
• Shopping mall
• Work place
• Central business district
• Public transport
• Highway
Heyman et al. (2018) • Accessibility to transport
• Recreation—place of interest
• Externalities (pollution, noise)
• Amenities (schools, services)
• Social (demographic, economy)
AHP approach is a rating index and has been applied in Malaysia to evaluate build-
ing performance (Khalil et al. 2016), quality of commercial building location (Safian
and Nawawi 2012), Waqf development (Allah Pitchay et al. 2014) and decision on
purchasing a residential property (Hassanudin Mohd Thas and Sakaran 2016). How-
ever, most of these studies are based on the price of the property and focused only on
the commercial area on the valuer perspective. Hence, this paper intended to identify
significant criteria on appropriately used on-site suitability of property valuation at
Perlis, Malaysia, to improve on decision-making of the investor using GIS. All of the
selected criteria are used to promote the involvement of the public in evaluating their
own with the available data by considering the spatial elements and human needs.
5.2 Study Area
Perlis state is known as the smallest state located at northern peninsular Malaysia.
The focus area of this study is Kangar with a total area of 2,619.4 ha (Fig. 5.1).
The population of the city based on the Department of Statistic Malaysia 2015 cen-
sus collection is 87,180. This study area was selected based on the conclusion of
the discussion between executives in the Economic Planning Unit. The executives
mentioned that Perlis is having a hard time in persuading investors to invest as the
potential of the state is not as big as other states. In realising the Eleventh Malaysia
Planning which is to handle the needs of people, Kangar was chosen to test the idea
of this project to see how it could help in development planning through property
valuation.
Fig. 5.1 Selected study area, Kangar, Perlis, Malaysia
5.3 Methodology
The methodology of this study consists of four phases, such as the selection of
criteria, data acquisition, data processing and result and analysis (see Fig. 5.2).
5.3.1 Geospatial Data Preparation
Kangar base map is obtained from a scanned image of a topographic map of Perlis,
2011. The map is registered in the coordinate system of WGS 1984. The buildings,
rivers, roads, irrigation and highway were digitised on the top of the base map for
analysis purposes. Then, the digitised features were projected to Kertau RSO in
shapefile format. Along the digitising process, the metadata is created where the
information of the features is being stored. By referring to the Google Earth, the
information on the point of interest was executed and was imposed on the spatial
datasets by creating the attribute table in a GIS environment.
Fig. 5.2 The methodology of this project
5.3.2 Identification and Classification of Property Criteria
Previous studies (Hassanudin Mohd Thas and Sakaran 2016; Ismail and Buyong
1998; Mariadas et al. 2019) have stated that external factors such as location, facilities,
services and accessibility influence the property value. Therefore, in this study, about
seven (7) criteria were tested and were grouped into three (3) different sets such as
distance to (i) school, (ii) available services, health and social care, public defence,
government building, place of interest and accessibility (Abidoye and Chan 2016;
Li and Pgrni 2015). The selection of the criteria depends on the data availability
surrounding Kangar, Perlis.
Euclidean distance tool is used on the selected criteria to estimate the actual
distance between the source of data, which is shown in intensity tone colour and
raster format (Heyman et al. 2018). The cell distance was then applied in weighted
overlay analysis. After that, the weight of the criteria was established using the AHP
method (Cervelló-Royo et al. 2016; Li and Pgrni 2015) that was developed by Saaty
(2008) into specific rank. Due to the fact that there is no actual standard for selection
of criteria in evaluating the suitable place of investment, the trials and errors approach
has been carried out because the AHP is dealing with inconsistent judgement (Saaty
2008). The distance for each of the criteria in the form of a raster is classified using
natural break method into five (5): classes in higher suitability (1), high suitability
(2), medium suitability (3), lower suitability (4), and low suitability (5) (Li et al.
2018) as stated in Table 5.2.
5.3.3 Calculation of Weight Value and Consistency Ratio

for Selected Criteria
Pairwise comparison and the normalised matrix are used in the AHP method. The
ranking was suggested on a scale of 1–9, which indicates one as equally essential and
nine as extremely important compared to the other criteria (Table 5.3). Although the
range of spatial classification is given in Li and Pgrni (2015), the proposed distance
is not applicable to be used in the selected study area. The consistency ratio (CR)
is also not provided in the study as it is required to show the consistency of the
combination of the criteria for land suitability analysis. It has been mentioned by
Al-shabeeb (2016), where the calculation of the CR is needed where if the CR is less
than 0.1, it represents the consistency ratio of the selected criteria.
The CR is calculated to determine the judgement error using Eqs. (5.1–5.2), that
was obtained from the study by Unel and Yalpir (2014). The computed CI (Eq. 5.1) is
divided by random index (RI), which is stated in Table 5.4 depending on the number
of selected criteria (n). After assigning the value of importance on each criteria
relation, the final value in those relations is used to construct the standard matrix as
Table 5.2 Classification

Criteria Layer classification Ranking
criteria
Distance to school 0–347 1
347–640 2
640–987 3
987–1444 4
1444–2331 5
Distance to available 0–335 1
services 335–638 2
638–998 3
998–1502 4
1502–2381 5
Distance to health and 0–153 1
social care 153–287 2
287–434 3
434–577 4
577–803 5
Distance to public 0–53 1
defence 53–87 2
87–117 3
117–144 4
144–180 5
Distance to government 0–328 1
building 328–617 2
617–951 3
951–1389 4
1389–2082 5
Distance to place of 0–291 1
interest 291–506 2
506–723 3
723–980 4
980–1537 5
Access to transport 0–61 1
(accessibility) 61–154 2
154–293 3
293–522 4
522–950 5
the final weight. The final weight obtained from the AHP process is applied to the
overlay process using different sets to the groups of the criteria (Table 5.5).
λ−n
CI = (5.1)
n−1
CI
CR = (5.2)
RI
Table 5.3 AHP scale of

AHP scale of importance Description
importance (Saaty 2008)
1 Equal importance
2 Equal to moderate
3 Moderate importance
4 Moderate to strong
5 Strong importance
6 Strong to very strong
7 Very strong importance
8 Very strong to extreme
9 Extreme importance
5.4 Result and Analysis
5.4.1 Determination of the Criteria Weight and AHP Analysis
Table 5.6a–c present the pairwise comparison matrix for a different group of the four
(4), five (5) and seven (7) criteria, respectively. The rank of each criterion is based
on author perspective and the value of consistency index (CI) and consistency ratio
(CR). Normalised matrix is a continuation of the pairwise comparisons where all
the value of the normalised matrices are gained from the pairwise comparison table.
From Table 5.6a–c, the value of weight, λmax , CI and CR were computed. Referring
to Table 5.7, the combination of the criteria in set 1 and set 2 shows CR = 0.016 and
CR = 0.087, respectively, which is less than 0.1. This value presents a consistent
ratio for determination of suitable place for property investment. However, although
the set 3 is considered more than essential criteria, it does not promise the right
combination as the value of CR is 0.140.
5.4.2 Site Suitability Analysis and Mapping
The final output is created through three different layers that show the zone of each
higher, high and medium suitability (Fig. 5.3). Based on Fig. 5.3a–c, there are slight
differences in the area of zoning. The colours are indicating the classes of the potential
of the site that will give high to low attention to attract the investor outside of Perlis.
The red colour represents the area in categories of higher suitability, yellow as high
suitability while the blue is medium suitability in different sets of selected criteria
on spatial based. Although the pattern presented in Fig. 5.3 is quite similar, however
in terms of the area and CR, the criteria of set 1 and 2 is much more influenced
as compared to the set 3. It means that decision-making to find interested place is
Table 5.4 Random index (RI) for different numbers of criteria (Al-shabeeb 2016)
Number of criteria (N) 1 2 3 4 5 6 7 8 9 10
Random consistency indices (RI) 0 0 0.58 0.9 1.12 1.24 1.32 1.41 1.45 1.49
5 Geospatial Site Suitability for Sustainable Property Investment
57
Table 5.5 Set of tested

Set Criteria Number of criteria
groups of property valuation
criteria Set 1 Distance to school 4
Distance to available services
Distance to health and social care
Distance to public defence
Set 2 Distance to school 5
Distance to government building
Set 3 Distance to school 7
Distance to government building
Distance to place of interest
Access to transport
(accessibility)
not depending on the numbers of criteria, but the criteria that meet the demand and
supply based on the surrounding residence needs (Table 5.8).
The suitability maps are significant for the property investors, which will be able
to support and lead to their decision-making on property investment. The results with
high suitability indicator indicate suitability area with good facilities and services
provided surrounding the places. The transparent business can be implemented if the
location in different levels of concentration is revealed to the organisations, investors
and companies. The maps can be used to control the market price in certain areas by
considering the selected criteria as shown in this research.
5.5 Conclusion
In the first objective is to determine the criteria that influence the property valuation
from critical review. Based on three journal articles that were conducting similar
research, ten criteria are identified to give impact on a property valuation of location-
based. However, only seven criteria are used in this study, as some of the data listed are
limited to have. The seven criteria are schools, accessibility, government buildings,
existing services, public defence, healthcare, and place of interest. The AHP method
was used with the complimentary of pairwise comparisons and normalised matrix,
which calculate all the possible relations between criteria. AHP concept does help the
analysis to be prior, which is primarily based on client needs and expert judgement.
Table 5.6 (a) Pairwise comparison matrix for four (4) criteria. (b) Pairwise comparison matrix for
five (5) criteria. (c) Pairwise comparison matrix for seven (7) criteria
(a)
Criteria (A) (B) (C) (D)
Distance to school (A) 1.00 2.00 8.00 4.00
Distance to available services (B) 0.50 1.00 3.00 7.00
Distance to health and social (C) 0.13 0.33 1.00 2.00
care
Distance to public defence (D) 0.25 0.14 0.50 1.00
(b)
Criteria (A) (B) (C) (D) (E)
Distance to school (A) 1.00 2.00 8.00 4.00 8.00
Distance to available services (B) 0.50 1.00 3.00 7.00 5.00
Distance to health and social (C) 0.13 0.33 1.00 2.00 8.00
care
Distance to public defence (D) 0.25 0.14 0.50 1.00 2.00
Distance to government (E) 0.13 0.20 0.13 0.50 1.00
building
(c)
Criteria (A) (B) (C) (D) (E) (F) (G)
Distance to school (A) 1.00 2.00 8.00 4.00 8.00 8.00 2.00
Distance to available services (B) 0.50 1.00 3.00 7.00 5.00 6.00 7.00
Distance to health and social (C) 0.13 0.33 1.00 2.00 8.00 2.00 5.00
care
Distance to public defence (D) 0.25 0.14 0.50 1.00 2.00 1.00 2.00
Distance to government (E) 0.13 0.20 0.13 0.50 1.00 2.00 1.00
building
Distance to place of interest (F) 0.13 0.17 0.50 1.00 0.50 1.00 3.00
Access to transport (G) 0.50 0.14 0.20 0.50 1.00 0.33 1.00
(Accessibility)
It refines the decision-making process compared to simple judgement. The results

indicate that the five criteria are significant enough to locate a suitable site in property
valuation. However, the combination of the criteria is depended on the requirement
of the client in location searching for the property .
Table 5.7 Computed value for different set of selected criteria of weight, λmax , CI, RI and CR
Set Criteria Weight λmax CI RI CR
1 Distance to school 0.510 4.235 0.078 0.900 0.087
Distance to available services 0.320
Distance to health and social care 0.100
Distance to public defence 0.070
Distance to government building 0.040
Distance to government building 0.050
Distance to place of interest 0.060
Access to transport (accessibility) 0.050
This study can be improved by getting a response from the subject expert regarding
the combination of selected criteria. Furthermore, the criteria of negative impact need
also to be considered to providing an accurate result on the selection of a suitable
place.
The results of this study can provide some inputs to consider when someone
to decide to own the property. Furthermore, the respected authorities can plan the
infrastructure and services needed before the decision of the location of the develop-
ment area. Proper planning in deciding the right investment property is seen as wiser
because the input of valuation comes from various parties. Through these indicators,
the community can plan their investment better and indirectly, the human settlement
issues address by SDG can be reduced gradually.
Fig. 5.3 The suitable location mapping based on combination four (a), five (b) and seven (c) criteria
Fig. 5.3 (continued)
Table 5.8 Percentage of the

Criteria Categories Area in Percentage
land that falls into each
value hectares (%)
category of value
4 criteria Higher 31.678 15
suitability
High 98.363 46
suitability
Medium 81.568 39
suitability
Sum 211.609 100
suitability
High 95.5118 69
suitability
Medium 7.693 6
suitability
Sum 138.198 100
suitability
High 99.119 72
suitability
Medium 38.001 3
suitability
Sum 172.398 100
References
Abidoye RB, Chan APC (2016) A survey of property valuation approaches in Nigeria. Prop Manag
34(5):364–380. https://doi.org/10.1108/PM-07-2015-0035
Achu K, Wan Chin L, Burhan B, Nordin MF (2015) Factors affecting client influence on property
valuation in Malaysia: do client size and size of value adjustment matter? Jurnal Teknologi
75(10):39–49. https://doi.org/10.11113/jt.v75.5271
Al-shabeeb AR (2016) The use of AHP within GIS in selecting potential sites for water harvesting
sites in the Azraq Basin—Jordan. J Geogr Inf Syst 08(01):73–88. https://doi.org/10.4236/jgis.
2016.81008
Allah Pitchay A, Kameel Mydin Meera A, Yusuf Saleem M (2014) Priority of
Waqf development among Malaysian Cash Waqf donors: an AHP approach. J Islam
Financ 3(1):13–22. Accessed https://ikr.inceif.org/bitstream/INCEIF/1374/1/priority_waqf_
development_malaysian_cash_waqf_donors_AHP_approach_yusuf_saleem.pdf
Bohari SN, Saad SNM, Marzukhi F, Rahim A, Darim ADA (2015) Residential property valuation
using GIS. In: Proceedings 2015 IEEE 11th international colloquium on signal processing and its
applications, CSPA 2015, Mar 2015, pp 131–134. https://doi.org/10.1109/CSPA.2015.7225632
Boshoff D (2011) The development approach to valuation : an acceptable method the development
approach to valuation : an acceptable method. In: Construction industry development board 8th
annual conference at: Pretoria, South Africa, pp 1–11
Boshoff D (2015) The development approach to valuation : an acceptable method the development
approach to valuation : an acceptable method. ResearchGate
Bozdağ A, Yavuz F, Günay AS (2016). AHP and GIS based land suitability analysis for Cihanbeyli
(Turkey) county. Environ Earth Sci 75(9). https://doi.org/10.1007/s12665-016-5558-9
Bunruamkaew K, Murayama Y (2011) Site suitability evaluation for ecotourism using GIS & AHP:
a case study of Surat Thani Province, Thailand. Proc Soc Behav Sci 21:269–278. https://doi.org/
10.1016/j.sbspro.2011.07.024
Bunyan Unel F, Yalpir S (2019) Valuations of building plots using the AHP method. Int J Strat Prop
Manag 23(3):197–212. https://doi.org/10.3846/ijspm.2019.7952
Cervelló-Royo R, Guijarro F, Pfahler T, Preuss M (2016) An analytic hierarchy process (AHP)
framework for property valuation to identify the ideal 2050 portfolio mixes in EU-27 countries
with shrinking populations. Qual Quant 50(5):2313–2329. https://doi.org/10.1007/s11135-015-
0264-3
Codosero M, Naranjo M, Castanho RA, Cabezas J (2018) Land valuation sustainable model of
urban planning development: a case study in Badajoz, Spain. Sustainability 10:1–18. https://doi.
org/10.3390/su10051450
Ganeshwaran (2019) House prices beyond affordability of most Malaysians. The Star Online 1–4
Gatheru SW, Nyika D (2015) Application Of geographic information system in property valuation.
Int J Sci Technol Res 4(08):61–71
Hassanudin Mohd Thas, Sakaran TKC (2016) Prioritisation of key attributes influencing the decision
to purchase a residential property in Malaysia: an analytic hierarchy process (AHP) approach.
Int J Housing Mark Anal 9(4):1–24. https://doi.org/10.1108/MRR-09-2015-0216
Heyman A, Law S, Berghauser Pont M (2018) How is location measured in housing valuation?
A systematic review of accessibility specifications in hedonic price models. Urban Sci 3(1):3.
https://doi.org/10.3390/urbansci3010003
Ismail S, Buyong T (1998) Residential property valuation using geographic information system.
Bull Geoinformation 2:249–266
Kara A, Oosterom PVAN (2018) 3D data for better property value estimation in the context of
LADM valuation information model 3D data for better property value estimation in the context
of LADM valuation information model. In: Proceedings of the 6th international FIG workshop
on 3D cadastres, pp 549–570
Khalil N, Kamaruzzaman SN, Baharum MR (2016) Ranking the indicators of building performance
and the users’ risk via analytical hierarchy process (AHP): case of Malaysia. Ecol Ind 71:567–576.
https://doi.org/10.1016/j.ecolind.2016.07.032
Kucharska-Stasiak E (2014) Uncertainty of property valuation as a subject of academic research.
R Estate Manag Valuat 21(4):17–25. https://doi.org/10.2478/remav-2013-0033
Li L, Pgrni P (2015) Land valuation systems using GIS technology case of Matara urban council
area, Sri Lanka. Plan Res J Sel Pap South Asia Urban Forum 2015(December):7–16. https://doi.
org/10.4038/bhumi.v4i2.6
Li Z, Fan Z, Shen S (2018) Urban green space suitability evaluation based on the AHP-CV combined
weight method: a case study of Fuping county, China. Sustainability (Switzerland), 10(8). https://
doi.org/10.3390/su10082656
Mariadas PA, Abdullah H, Abdullah N (2019) Factors influencing the first home purchase decision
of middle-income earners (M40) in Selangor, Malaysia. E-Bangi 16(1):1–11
Nur Ezra M, Hishamuddin MA, Tuti Haryati J (2018) Valuer’s behavioural uncertainties in property
valuation decision making. Plan Malays 16(1):239–250
Pagourtzi E, Assimakopoulos V, Hatzichristos T, French N (2003) Real estate appraisal: a
review of valuation methods. J Prop Invest Financ 21(4):383–401. https://doi.org/10.1108/
14635780310483656
Render MM (2017) The concept of property. Univ Pittsburgh Law Rev 78(4). https://doi.org/10.
5195/lawreview.2017.497
Rikalovic A, Cosic I, Lazarevic D (2014) GIS based multi-criteria analysis for industrial site
selection. Procedia Eng 69:1054–1063. https://doi.org/10.1016/j.proeng.2014.03.090
Saaty TL (2008) Decision making with the analytic hierarchy process. Int J Serv Sci 1(1):83. https://
doi.org/10.1504/IJSSCI.2008.017590
Safian EEM, Nawawi AH (2012) Combining AHP with GIS in the evaluation of locational char-
acteristics quality for purpose-built offices in Malaysia. In: 6th international real estate research
symposium (IRERS) 2012 globalisation of real estate: transformation and opportunities, pp 1–16.
INSPEN 2nd Campus, Selangor, Malaysia
Siejka M (2017) The role of spatial information systems in decision-making proceses regarding
investment site selection. R Estate Manag Valuat 25(3):62–72
Trojanek M (2010) The application of income approach in property valuation in Poland. Econ Sociol
3(2):35–47. https://doi.org/10.14254/2071-789X.2010/3-2/4
Unel FB, Yalpir S (2014) Determination of the locational, physical and legal status of parcels using
the AHP method and GIS in real estate valuation. WIT Trans Inf Commun Technol 63:369–378.
https://doi.org/10.2495/CEEIT140461
United Nations (2019) The sustainable development goals report 2019. United Nations. https://doi.
org/10.29171/azu_acku_pamphlet_k3240_s878_2016
Chapter 6
Analysis of Organophosphorus Pesticides
(OPPs) in Paddy Field Water Using
IL-DLLME
Sharizal Bin Hasan, Non Daina Masdar, Mohd Lias Kamal,
Norizan Binti Ramli and Nurul Zawani Alias
Abstract The application of organophosphorus pesticides (OPPs) is extensively

used to combat the pest attack and massively used including in paddy field. The
OPP is an effective pesticide with broad killing spectrum that exhibits less envi-
ronmental persistence, but the residue is highly toxic to us. Hence, in this work,
determination of four types of OPPs compound, that is, parathion-methyl (PM),
azinphos-methyl (AM), diazinon (D), and malathion (M) in paddy field water sam-
ples at four location in Perlis state was done. Sample extraction was carried out
using ionic liquid dispersed liquid–liquid microextraction (IL-DLLME). Two types
of ionic liquid, 1-butyl-3-methylimidazolium bromide [BMIM][Br] and 1-butyl-3-
methylimidazolium chloride [BMIM] [Cl], were used as an extraction solvent. The
effect of extraction time (ET), centrifugation time (CT), and concentration (C) on
the ILs was investigated. Sample analysis was carried out using high-performance
liquid chromatography with photodiode detector (HPLC-PDA). The result showed
that 1 h of ET and 10 min of the CT were optimum parameters in this work. The
linear correlation (R2 ) of the OPPs standard was 0.9979, 0.9988, 0.9988, and 0.9993
for AM, PM, M, and D, respectively. The LOD and LOQ values for [BMIM] [Br]
range from 0.01 to 1.71 µg/L and 0.03 to 1.42 µg/L, respectively, while LOD and
LOQ values for [BMIM] [Cl] range from 2.9 to 10.4 µg/L and 13.7 to 20.59 µg/L,
respectively. The concentration of the analyte ranges from 3.7 to 16.8 ppm, 17.5
S. B. Hasan · N. D. Masdar (B) · M. L. Kamal · N. B. Ramli · N. Z. Alias

Faculty of Applied Sciences, Universiti Teknologi MARA, Perlis Branch, 02600 Arau, Perlis,
Malaysia
e-mail: daina@uitm.edu.my
S. B. Hasan
e-mail: sharizal187@uitm.edu.my
M. L. Kamal
e-mail: mohdlias@uitm.edu.my
N. B. Ramli
e-mail: norizan.ramli.92@gmail.com
N. Z. Alias
e-mail: zawani299@uitm.edu.my

66 S. B. Hasan et al.
to 69.9 ppm, and 2.8 to 58.1 ppm in Beseri, Mata Ayer, and Arau water samples,
respectively.
Keywords Ionic liquid · Organophosphorus · DLLME · HPLC · Pesticides
6.1 Introduction
Pesticide use in agricultural activities increased coherence with the increase in food
demand after the Second World War (Mee Kin and Guan Huat 2010). Using of pes-
ticides increased the protection of crops against pests but could decrease the quality
of crops (Sparks 2013). OPPs are the most common class of pesticides used since
1970s, when organochlorine pesticides were banned by the World Health Organi-
zation (Asensio-Ramos et al. 2011). According to the United States Environmental
Protection Agency (US-EPA), the OPPs are classified as high to moderate toxic and
possibly generate toxic risks during long-term exposure and can also degrade into
more toxic compound than the primary pesticide (Mohd Sharif et al. 2015). The
release of OPPs into the environment, either from agricultural or non-agricultural
purposes can easily contaminate the groundwater and vulnerable drinking water
sources (Agudelo et al. 2012). According to Nakano et al. (2004) the magnitude
of the pesticide on loss solubility depends on their medium, that is, paddy water.
Figure 6.1 shows the chemical structure of OPPs compound which is investigated in
this work.
Azinphos-methyl (AM) Parathion-methyl (PM)
Malathion (M) Diazinon (D)
Fig. 6.1 Chemical structure of OPPs compound

6 Analysis of Organophosphorus Pesticides (OPPs) in Paddy Field … 67
Direct analysis of OPPs in environmental and biological samples using modern

and powerful instrumental techniques is not always possible due to low concentration
and high matrix interferences. Therefore, an efficient, sensitive, and rapid analytical
method is recommended to trace and determine OPP residues in water samples.
Various methods based on microextraction have been developed to overcome the
drawbacks of classical solvent extraction that involves the use of large volumes of
organic solvents and long extraction times. Dispersive liquid–liquid microextraction
(DLLME) has emerged as an alternative method for sample preparation (Ahmad
et al. 2015). In this method, a mixture of extraction solvent and disperser solvent
is rapidly injected into an aqueous sample, resulting in the formation of a cloudy
solution. The DLLME procedure that is convenient to operate and extract could
be completed in a few seconds. Hence, it is considerably important to select an
extraction solvent with higher density than water, high extraction capability, and
good chromatography’s behavior (He et al. 2010). Currently, room temperature ionic
liquids (RTILs) are preferred as replacement to the use of highly toxic chlorinated
solvents. The use of RTILs as extraction solvent is important, especially in analytical
chemistry studies. ILs have negligible vapor pressure, good solubility in organic
and inorganic compounds, non-flammable, high thermal stability, wide temperature
range as a liquid phase (Umecky et al. 2005). IL is also known as green solvent
due to less emission to the atmosphere compared to other organic solvents. Some of
the unique properties of RTIL are: it is non-molecular solvent, has negligible vapor
pressure, and high thermal stability (Hawkins et al. 2015). Figure 6.2 shows the
chemical structure of the RTIL used with different cations (bromide and chloride).
Several chromatographic methods have been widely employed for the separation
and quantification of OPPs residues in water samples, including high-performance
liquid chromatography using UV/VIS detection (Hawkins et al. 2015). HPLC is an
efficient and rapid analytical tool that is capable of separating various types of com-
pounds for both qualitative and quantitative analyses (Bakry et al. 2011). Therefore,
the main objective of this study was to utilize [BMIM] [Br] and [BMIM] [Cl] as
1-butyl-3-methylimidazolium 1-butyl-3-methylimidazolium
bromide [BMIM] [Br] chloride [BMIM] [Cl]
Fig. 6.2 Chemical structure of RTILs extractant solvent

extractant solvent to extract azinphos-methyl, malathion, diazinon, and parathion–

methyl compound in the paddy field water samples using DLLME. Some of the
parameters related to DLLME were proposed and optimized.
6.2 Experimental
6.2.1 Reagent and Solution
The standard OPPs, such as azinphos-methyl, parathion-methyl, diazinon, and

malathion, were obtained from GmbH, Germany. The purity of the pesticide’s stan-
dard was greater than 99%. The standard OPPs were diluted with methanol to
100 ppm concentration stock solutions. For DLLME analysis, a range of standard
mixture stock solution containing 4–50 µL was prepared in adequate dilution with
methanol to a concentration of 0.08–1 ppm standard solution and kept at a temperature
of 4 °C in the chiller. Methanol, acetone, and nitric acid used in the experiment were
of HPLC grade with more than 90% purity. All the chemicals were purchased from
Sigma-Aldrich, Malaysia. Butyl-3-methylimidazolium bromide [BMIM] [Br] and
1-butyl-3-methylimidazolium chloride [BMIM] [Cl] used as an extraction solvent
were of synthesis grade for analysis. The standard mixture was injected manually into
reversed-phase C18 column with methanol–water in the mobile phase ratio 72:28
(v/v). The flow rate was constant at 0.5 mL/min throughout the analysis.
6.2.2 Instrumentation
The analytes were determined using Water Acquity HPLC combined with a pho-
tometer diode array (PDA) spectrometer (Waters, USA). The HPLC was operated at
254 nm wavelength throughout the analysis. In this study, SUPELCO reversed-phase
C18 column (4.6 mm × 150 mm, 5 µm particle size) was used. Isocratic elution was
performed with methanol/water in the mobile phase ratio 72:28 (v/v). The flow rate
of the instrument was maintained at 0.5 mL/min throughout the analysis.
6.2.3 Sample Preparation
The paddy field water samples were obtained from three locations in Perlis state,
which were Beseri, Mata Ayer, and Arau. For each location, the composite samples
were collected randomly at a few points in the paddy field and mixed, then sealed and
stored at 4 °C. The OPPs were extracted from the water samples using an ionic liquid
Fig. 6.3 Dispersed liquid–liquid microextraction. a Sample solution in a centrifuge tube; b cloudy
solution immediately formed after addition of extraction; c dispersed fine droplets of analyte settled
at the bottom of centrifugal tube
by following the DLLME procedure (Pinto et al. 2010). A 5.0 mL paddy water sample
was spiked with 2 mL of 0.5 ppm of OPPs standard mixture in 10 mL centrifugal
tubes at conical bottom. A 1.2 mL of methanol as disperser solvent containing 124 mg
of ionic liquid [BMIM] [Cl], a solvent extractor, was rapidly injected into the sample
solution. The reaction results in cloudy solution after gentle shake for 30 s. The
sample mixture was centrifuged at 4000 rpm for 10 min. The enriched analyte in the
ionic liquid [BMIM] [Br] phase was drawn by 50 µL microsyringe and analyzed
using HPLC-PDA. These procedures were repeated using [BMIM] [Cl]. Figure 6.3
shows the sample changes solution during the extraction process.
6.3.1 Sample Niche and Analysis of Standard Mixture
Figure 6.4 shows the map of water sample collection in three location areas in Perlis
state, that is, Beseri, Mata Ayer, and Arau. The samples collected area is nearby to
paddy-related activities such as paddy milling industries and anthropogenic activi-
ties, which were considered to be contributing to the water contamination. Figure 6.5
shows the HPLC chromatogram of organophosphates pesticides (OPPs) compound
in 1.0 ppm standard solution and its retention time. Four OPPs compounds in stan-
dard solution were successfully separated: 5.288, 5.805, 6.343 and 10.196 min for
azinphos-methyl, parathion methyl, malathion, and diazinon, respectively.
Fig. 6.4 Geographical images of paddy field water sampling location
6.3.2 Method Validation
The limit of detection (LOD) was evaluated by injecting six different concentration
of OPPs standards ranging from 0.08 to 1.5 ppm and 5.0 to 50.0 ppm for [BMIM]
[Br] and [BMIM] [Cl], respectively. The limit of detection (LOD) is the lowest con-
centration whose signal-to-noise ratio and limit of quantification (LOQs) the lowest
concentration can be quantified at the calibration curve is greater than 3 of LOQ,
as summarized in Tables 6.1 and 6.2. The results show that the LOD values range
from 0.01 to 1.25 µg/L and 2.9 to 10.4 µg/L; while the LOQs values range from
0.03 to 1.13 µg/L and 13.7 to 20.59 µ/L for [BMIM] [Br] and [BMIM] [Cl], respec-
tively. The highest recovery of [BMIM] [Br] was 101.9%, with percent RSD of 7.4%,
while the highest recovery for [BMIM] [Cl] was 73.3% with percent RSD 5.8%. The
[BMIM] [Br] solvent shows highest percent recoveries compared to [BMIM] [Cl];
hence [BMIM] [Br] is found as a suitable extractant solvent in this work. The linearity
Fig. 6.5 The HPLC chromatogram of OPPs compound in standard mixture solution
Table 6.1 Analytical performance data of OPPs using IL [BMIM] [Br] extractant solvent
Location OPPs Linearity R2 LOD LOQ Recovery RSD
(µg/L) (%) (n
= 3)
Beseri Azinphos-methyl 0.08–1.5 0.9951 0.01 0.03 101.9 7.4
Parathion-methyl 0.08–1.5 0.9966 1.17 2.1 89.7 2.95
Malathion 0.08–1.5 0.9899 0.93 1.42 89.2 5.12
Diazinon 0.08–1.5 0.9874 0.45 0.7 82.4 4.34
Mata Azinphos-methyl 0.08–1.5 0.9932 0.19 0.24 99.6 13.2
Ayer Parathion-methyl 0.08–1.5 0.991 1.25 1.3 88.3 6.7
Malathion 0.08–1.5 0.9935 0.95 1.09 93.2 9.8
Diazinon 0.08–1.5 0.9953 0.50 0.7 79.9 2.94
Arau Azinphos-methyl 0.08–1.5 0.9972 0.21 0.35 99.7 10.5
Parathion-methyl 0.08–1.5 0.9897 0.14 0.29 93.2 1.9
Malathion 0.08–1.5 0.9983 0.94 1.05 84.5 4.7
Diazinon 0.08–1.5 0.9912 0.41 1.13 87.0 7.2
information was able to provide the direction of the method used and reliable results
are obtained. The linear correlation (R2 ) of the OPPs standard obtained was 0.9979,
0.9988, 0.9988, and 0.9993 for azinphos-methyl, parathion-methyl, malathion, and
diazinon, respectively, with average determination coefficient of more than 0.99.
Table 6.2 Analytical performance data of OPPs using IL [BMIM] [Cl] extractant solvent
Location Compound Linearity R2 LOD LOQ Recovery RSD
(µg/L) (%)
(n =
3)
Beseri Azinphos-methyl 5.0–50 0.9826 8.7 20.59 45.5 19.9
Parathion-methyl 5.0–50 0.993 5.3 21.8 69.0 4.7
Malathion 5.0–50 0.9989 6.2 24.9 32.7 6.8
Diazinon 5.0–50 0.983 4.1 16.7 29.6 2.5
Mata Azinphos-methyl 5.0–50 0.9921 9.2 29.4 56.7 14.2
Ayer Parathion-methyl 5.0–50 0.986 5.2 22.4 73.3 5.8
Malathion 5.0–50 0.995 6.4 25.1 30.4 4.9
Diazinon 5.0–50 0.978 3.2 17.9 27.6 2.1
Arau Azinphos-methyl 5.0–50 0.9979 10.4 28.5 50.3 15.3
Parathion-methyl 5.0–50 0.945 4.7 20.8 65.0 4.2
Malathion 5.0–50 0.960 7.2 24.9 34.9 6.2
Diazinon 5.0–50 0.989 2.9 13.7 28.8 1.9
DLLME is a ternary system containing analyte of water-immiscible extraction

solvent and water-miscible disperser solvent. A mixture of the dispersed and extrac-
tion solvent is rapidly introduced into the solution, and the equilibrium is quickly
reached due to the great contact between the droplets of the extraction solvent and
the aqueous sample.
The effect of extraction time. The extraction solvent is collected at the bottom
of the tube after the centrifugation using RTILs. In this study, the extraction time,
centrifugation time, and RTILs ion used were compared, and the experiments were
conducted in triplicate and the means are given as the results. The extraction time is
one of the important parameters in the extraction process as an interval time of the
cloudy solution formation. Subsequently, the equilibrium state could be achieved, and
the extraction time is minimized. The effect of extraction time of 1, 5, 12, and 24 h on
the OPPs compound using [BMIM] [Br] and [BMIM] [Cl] in three locations of paddy
field water samples were investigated and observed. DLLME is an equilibrium-type
extraction, and the optimal extraction efficiency is obtained when equilibration is
established.
Figures 6.6 and 6.7 show the concentration of the OPPs in different extraction
time using [BMIM] [Br] and [BMIM] [Cl] as extractant solvent. Longer extraction
time had no significant effects on extraction efficiency, especially in the presence
of extractant. Most of the extractions in all samples are achievable in 1 h time.
Prolonging the extraction time until 24 h did not exhibit significance in extraction
yield. In Mata Ayer samples, the concentration of all pesticide residues has been
managed to be extracted in 1 h using [BMIM][Br] as extractant solvent. For example,
concentration of PM after 1 h extraction is 60 ppm, while for other extraction times,
the concentration is less than 10 ppm. In 1 h, extraction using [BMIM][Cl] shows
(a) 100 AM
PM
Concentration (ppm)
80 M
D
60
40
20
0
1 5 12 24
Extraction time (hr)
(b) AM
60
Concentration (ppm)
PM
M
40 D
20
0
1 5 12 24
(c) 20
AM
Concentration (ppm)
PM
M
10 D
0
1 5 12 24
Fig. 6.6 Comparison concentration of OPPs analyte in paddy field water sample using [BMIM]
[Br] in a Beseri, b Mata Ayer, and c Arau
the concentration for PM as 25 ppm. Other extraction times produce only below
8 ppm. The presence of ionic liquids extractant helps to expedite the extraction. The
sample residue is trapped by extractant, which produces large surface area between
extracting solvents droplet and the aqueous phase. Thus, the transfer of the analytes
from the aqueous phase to extraction phase is fast (He et al. 2009).
The effect of centrifugation time. Figures 6.8 and 6.9 show the concentration of
the OPPs compound in different centrifugation time using [BMIM] [Br] and [BMIM]
[Cl] in 10–30 min analysis. 10 min is found as suitable centrifugation time for both
extractants solvent. In this study, shorter centrifugation time is possible to extract
the pesticide residue in the sample. As per Mata Ayer location, the concentration
of AM is 150 ppm, which is extracted using [BMIM] [Br] in 10 min centrifugation
time, while other times are less than 50 ppm. Meanwhile, in the same location, the
concentration of AM is 80 ppm using [BMIM] [Cl]. According to Rezaee et al.
(2010), centrifugation is a process when their density is separated by mechanical
(a)
80 AM
Concentration (ppm)
PM
60
M
40 D
20
0
1 5 12 24
(b) AM
40
Concentration (ppm)
PM
M
20
D
0
1 5 12 24
(c) AM
30
Concentration (ppm)
PM
20 M
D
10
0
1 5 12 24
Fig. 6.7 Comparison concentration of OPPs analyte in paddy field water sample using [BMIM]
[Cl] in a Beseri; b Mata Ayer; and c Arau
means and acceleration results in separation of IL extraction phase from the aqueous
(Rezaee et al. 2010). Only as much as 30 ppm extracted in longer centrifugation
time. According to Moussavi et al. (2013), long centrifugation time resulted in heat
generation, leading to dissolve the parts of IL phases and loss of extraction effi-
ciency. In addition, centrifugation time promotes breakdown of the cloudy solution
formed and deposited the sediment phase. Yet too short centrifugation time leads to
incomplete dissolution. However, longer centrifugation had no significant effect on
the extraction efficiency for IL-DLLME (Hernández et al. 2015).
(a) 10
Concentration (ppm)
40
20
20 30
0
AM PM M D
Centrifugation time (min)
(b)
10
Concentration (ppm)
200
20
100 30
0
AM PM M D
(c)
Concentration (ppm)
40
10
30
20
20
30
10
0
AM PM M D
Fig. 6.8 The concentration of OPPs compound in paddy field water sample of different
centrifugation time at a Beseri, b Mata Ayer, and c Arau using [BMIM] [Br]
6.4 Conclusion
In this work, an ionic liquid dispersed liquid–liquid microextraction (IL-DLLME)

for the determination of OPPs residue in three sampling niches was successfully
carried out. The presence of extractants, [BMIM] [Br] and [BMIM] [Cl], helps to
accommodate the extraction. The result demonstrates that the proposed method, IL-
DLLME has recoveries and reproducible. The method presented in this research can
be applied to determine different groups of pesticide residues. This implies that this
method has the potential to be used as sample preparation for analytical work.
(a)
10
Concentration (ppm)
20
15 20
10 30
5
0
AM PM M D
(b)
10
Concentration (ppm)
80
20
60
30
40
20
0
AM PM M D
(c)
10
Concentration (ppm)
30
20
20
30
10
0
AM PM M D
Fig. 6.9 The concentration of OPPs compound in paddy field water sample of different
centrifugation time at a Beseri, b Mata Ayer, and c Arau using [BMIM] [Cl]
References
Agudelo CRM, Jaramillo ML, Peñuela G (2012) Comparison of the removal of chlorpyrifos and
dissolved organic carbon in horizontal sub-surface and surface flow wetlands. Sci Total Environ
431:271–277. http://doi.org/10.1016/j.scitotenv.2012.05.045
Ahmad W, Al-Sibaai AA, Bashammakh AS, Alwael H, El-Shahawi MS (2015) Recent advances in
dispersive liquid-liquid microextraction for pesticide analysis. TrAC: Trends Anal Chem 72:181–
192. https://doi.org/10.1016/j.trac.2015.04.022
Asensio-Ramos M, Ravelo-Pérez LM, González-Curbelo MÁ, Hernández-Borges J (2011) Liq-
uid phase microextraction applications in food analysis. J Chromatogr A 1218(42):7415–7437.
https://doi.org/10.1016/j.chroma.2011.05.096
Bakry FA, Hasheesh WS, Hamdi SAH (2011) Biological, biochemical, and molecular parameters
of Helisoma duryi snails exposed to the pesticides Malathion and Deltamethrin. Pestic Biochem
Physiol 101(2):86–92. https://doi.org/10.1016/j.pestbp.2011.08.004
Hawkins CA, Rud A, Guthrie ML, Dietz ML (2015) Rapid quantification of imidazolium-based ionic
liquids by hydrophilic interaction liquid chromatography: methodology and an investigation of
the retention mechanisms. J Chromatogr A 1400:54–64. https://doi.org/10.1016/j.chroma.2015.
04.047
He L, Luo X, Jiang X, Qu L (2010) A new 1,3-dibutylimidazolium hexafluorophosphate ionic liquid-
based dispersive liquid-liquid microextraction to determine organophosphorus pesticides in water
and fruit samples by high-performance liquid chromatography. J Chromatogr A 1217(31):5013–
5020. https://doi.org/10.1016/j.chroma.2010.05.057
He L, Luo X, Xie H, Wang C, Jiang X, Lu K (2009) Ionic liquid-based dispersive liquid-liquid
microextraction followed high-performance liquid chromatography for the determination of
organophosphorus pesticides in water sample. Anal Chim Acta 655(1–2):52–59. https://doi.org/
10.1016/j.aca.2009.09.044
Hernández F, Ibáñez M, Portolés T, Cervera MI, Sancho JV, López FJ (2015) Advancing towards
universal screening for organic pollutants in waters. J Hazard Mater 282:86–95. https://doi.org/
10.1016/j.jhazmat.2014.08.006
Mee Kin C, Guan Huat T (2010) Headspace solid-phase microextraction for the evaluation of
pesticide residue contents in cucumber and strawberry after washing treatment. Food Chem
123(3):760–764. https://doi.org/10.1016/j.foodchem.2010.05.038
Mohd Sharif S, Abu Bakar NF, Naim MN (2015) Deposition of fine iron oxide particles in tap water
using electrophoretic deposition (EPD) technique. J Water Process Eng 7:123–130. https://doi.
org/10.1016/j.jwpe.2015.06.005
Moussavi G, Hosseini H, Alahabadi A (2013) The investigation of diazinon pesticide removal
from contaminated water by adsorption onto NH4 Cl-induced activated carbon. Chem Eng J
214:172–179. https://doi.org/10.1016/j.cej.2012.10.034
Nakano Y, Miyazaki A, Yoshida T, Ono K, Inoue T (2004) A study on pesticide runoff from paddy
fields to a river in rural region—1: field survey of pesticide runoff in the Kozakura River, Japan.
Water Research 38(13):3017–3022. https://doi.org/10.1016/j.watres.2004.02.013
Pinto MI, Sontag G, Bernardino RJ, Noronha JP (2010) Pesticides in water and the performance
of the liquid-phase microextraction based techniques. A review. Microchem J 96(2):225–237.
https://doi.org/10.1016/j.microc.2010.06.010
Rezaee M, Yamini Y, Faraji M (2010) Evolution of dispersive liquid-liquid microextraction method.
J Chromatogr A 1217(16):2342–2357. https://doi.org/10.1016/j.chroma.2009.11.088
Sparks TC (2013) Insecticide discovery: an evaluation and analysis. Pestic Biochem Physiol
107(1):8–17. https://doi.org/10.1016/j.pestbp.2013.05.012
Umecky T, Kanakubo M, Ikushima Y (2005) Effects of alkyl chain on transport properties in 1-
alkyl-3-methylimidazolium hexafluorophosphates. J Mol Liq 119(1–3):77–81. https://doi.org/10.
1016/j.molliq.2004.10.011
Chapter 7
The Potential of Bamboo Vinegar
(Gigantochloa albociliata) as Insecticide
Nurul Zawani Alias , Shafinas Abdullah , Siti Shahirah Shaari,

Jesmond Joel Junik, Mohd Lias Kamal and Non Daina Masdar
Abstract The use of insecticides has become indispensable in modern agriculture.

However, synthetic insecticides such as organochlorine insecticides, organophos-
phate insecticides and carbamates insecticides do pose a potential risk and unwanted
side effects to humans and other life forms. Meanwhile, the use of organic insecti-
cides which is based on plant’s extracts is safer to the ecosystems and human. This
study aims to produce organic insecticides from bamboo vinegar. The bamboo vine-
gar was produced from bamboo (Gigantochloa albociliata) by pyrolysis method, and
the chemical constituents of the bamboo vinegar were determined using gas chro-
matography mass spectrometry (GC-MS). Then, the effectiveness of the bamboo
vinegar as insecticide was evaluated against Drosophila melanogaster (fruit flies). It
was found that the percentage yield of bamboo vinegar is (39.43 ± 0.37%) and bam-
boo tar is (19.25 ± 0.22%). The major compounds in bamboo vinegar were phenol
derivatives (40.75%) and acetic acid (8.45%). The test against fruit flies indicated
that pure bamboo vinegar (100% v/v) exhibits equivalent insecticidal properties with
commercial insecticide in eliminating D. melanogaster with 2.37 mortality/min for
pure bamboo vinegar and 4.40 mortality/min for commercial insecticide, and the time
difference in terminating fruit flies is only 2 min. This shows that bamboo vinegar
has potential as insecticides.
N. Z. Alias (B) · S. Abdullah · S. S. Shaari · J. J. Junik · M. L. Kamal · N. D. Masdar

Faculty of Applied Sciences, Universiti Teknologi MARA Perlis Branch, Arau Campus, 02600
Arau, Perlis, Malaysia
e-mail: zawani299@uitm.edu.my
S. Abdullah
e-mail: sshafi6359@uitm.edu.my
S. S. Shaari
e-mail: shahirah_shaari@yahoo.com
J. J. Junik
e-mail: Jesmondjoel94@gmail.com
M. L. Kamal
N. D. Masdar
e-mail: zdaina2013@gmail.com

80 N. Z. Alias et al.
Keywords Bamboo · Insecticides · Drosophila melanogaster · Pyrolysis
7.1 Introduction
Bamboo is a native plant that grows faster than other woody plants and can be
abundantly found in Asian country. It is a multipurpose woody plant with various
industrial and domestic uses and is a source of food. The bamboo species that will
be used in this study is Gigantochloa albociliata, also known as “buluh madu” in
Malaysia. G. albociliata undergoes pyrolysis to produce charcoal and a mixture of
by-product called bamboo vinegar and bamboo tar. Pyrolysis is a thermochemical
decomposition of organic material at high temperature under air less atmosphere. It
will produce a mixture of by-product and also a large number of chemical compounds,
of which some of the chemicals can be used in agriculture (Zaman et al. 2017). In
2015, Wang et al. conducted a research on eliminating pests that cause harm to tea
leaves using bamboo charcoal by-product as an organic insecticide. The bamboo
charcoal by-product showed a positive sign where the insects they used as a sample
were eliminated. This is because bamboo charcoal contains phenolic compound
as the active compound that acts as insecticidal to eliminate insects (Wang et al.
2015). Bamboo vinegar is a type of wood vinegar which consists of water (80–90%)
and the minor proportions consist of more than 200 species of organic compounds
(Theapparat et al. 2018). Previous studies reported that wood vinegar has many
uses such as insect repellant and soil or foliar fertilizer (Mungkunkamchao et al.
2013). It can also inhibit fungi from the wood (Velmurugan et al. 2009). Some of
the researches have showed that wood vinegar enhances harvest yield in many plant
species by enhancement of seed germination, plant growth, fruit size, fruit weight
and the quality the fruits and vegetables. Furthermore, wood vinegar can also inhibit
plant pathogenic fungi and bacteria. It also significantly increases soil health due
to its soil microbial activity (Wang et al. 2019). It contains pesticidal, antioxidant,
antimicrobial and plant growth enhancing properties. Wood vinegar has been used
for many years in agriculture to increase crop and soil productivity and quality in
Japan (Grewal et al. 2018).
Insecticides are essential for crop protection in agricultural field so as to maintain
the crops in good condition. It acts as killers to destroy, reduce and kill any species of
insect that may affect agricultural crops in agricultural field (Mfarrej and Rara 2018).
Insecticides are divided into two types, which are synthetic and organic insecticides.
Synthetic insecticide is a man-made, meanwhile organic insecticide is derived from
natural materials such as plant extracts (Tappert et al. 2017). Synthetic insecticides
such as organochlorine insecticides, organophosphate insecticides and carbamates
insecticides do pose a potential risk and unwanted side effects to humans and other
life forms. Meanwhile, organic insecticide gives a promising alternative to the use of
conventional synthetic insecticides because it is environmentally friendly, has lower
development costs, safer to ecosystems and human life (Mfarrej and Rara 2018).
Although wood vinegar has been reported to have insect repellant and pesticides
7 The Potential of Bamboo Vinegar (Gigantochloa albociliata) … 81
properties, there is a limited study investigating on wood vinegar specifically bamboo

vinegar as an insecticide. Therefore, this study aims to produce organic insecticides
from bamboo vinegar and to test the effectiveness of the bamboo vinegar as insecti-
cide toward Drosophila melanogaster (fruit flies). The natural insecticides produced
will be an alternative to synthetic insecticide and will reduce the reliance on synthetic
insecticide.
7.2 Materials and Methods
The bamboo (G. albociliata) was obtained from bamboo farm in UiTM Perlis. Then
it was cut into small pieces and ground using grinder.
7.2.2 Extraction of Bamboo Vinegar and Bamboo Tar
Raw bamboo (500 g) was dried in oven at a temperature of 105 °C for 24 h. Then, the
dried bamboo (25 g) was heated at high temperature (200–250 °C) in a tightly closed
test tube (pyrolysis process). The heating process was completed by the indication of
white smoke produced. The smoke will flow through the condenser and condensed to
form three layers of liquid, which were bamboo vinegar, bamboo tar and oil (Tong and
Feng 2016). The upper layer was oil, while the middle layer was bamboo vinegar and
the bottom layer was bamboo tar. The three layers were separated using separating
funnel. The bamboo vinegar was extracted using diethyl ether (20 mL). Then the
extracted bamboo vinegar was concentrated using rotary evaporator. The extraction
process was carried out in triplicate.
7.2.3 The Extraction of Phenol Derivatives from Bamboo Tar
Sodium hydroxide, NaOH (2 M, 20 mL), was added into the bamboo tar. The mixed
solution was stirred continuously. Then the three layers of solution were formed
which were residue oil layer, precipitate (phenol derivatives) and water layer. The
precipitate will be separated using gravitational filtration. After that, the precipitate
was mixed with 6 M of hydrochloric acid (HCl, 50 mL) drop by drop with continuous
stirring to produce oily phenol derivatives. Then, the extracted phenols were mixed
with bamboo vinegar (Ge and Jin 1996).
7.2.4 Determination of Chemical Compounds Using GC-MS
The major constituents in the enhanced bamboo vinegar were determined using GC-
MS (Agilent) equipped with capillary column Agilent HP-5MS (30 m × 0.25 mm ×
0.25 µm). The conditions of the GC-MS were as follows: the temperature injection
port maintains at 260 °C, the oven programmed at 80 °C for 3 min and Helium
was used as the carrier gas with 1 µL injection volume in splitless mode (Wang et al.
2015).
7.2.5 The Mortality Test of Bamboo Vinegar Toward

Drosophila Melanogaster
The test was conducted in the laboratory by luring the male fruit
flies (D. melanogaster) using female hormone. Five types of jar test with differ-
ent concentration of bamboo vinegar 20, 40, 60, 80 and 100% (v/v) were prepared.
Ten male fruit flies were tested against each concentration of bamboo vinegar. The
positive control used was a commercial insecticide. The results were analyzed using
Microsoft Excel (Microsoft Office Professional Plus 2016).
7.3.1 Bamboo Vinegar and Bamboo Tar
Bamboo vinegar was observed in a brown liquid form with smoky smell, while the
bamboo tar was found in dark brown concentrated oily solution with a strong smoky
smell. The extractions were conducted in triplicate. Table 7.1 showed the average per-
cent yield of bamboo vinegar and bamboo tar produced from G. albociliata (25.2294
± 0.1244 g). The average weight of bamboo vinegar obtained is 9.9491 ± 0.0451 g,
while the average weight bamboo tar obtained is 4.8569 ± 0.0319 g. Then, the per-
centage yield of bamboo vinegar is 39.43 ± 0.37%, while the average percentage
yield of bamboo tar is 19.25 ± 0.22%. This shows that bamboo vinegar is the major
product for pyrolysis process (Wang et al. 2015).
Table 7.1 Percentage yield

Product Bamboo vinegar Bamboo tar
(%) of bamboo vinegar and
bamboo tar Weight of extract (g) 9.9491 ± 0.0451 4.8569 ± 0.0319
Weight of bamboo (g) 25.2294 ± 0.1244
Percentage yield (%) 39.43 ± 0.37 19.25 ± 0.22
Table 7.2 Relative

Peak no. RT/min Compounds Area (%)
percentage quantities of the
compounds identified by 1 10.517 Phenol 11.57
GC-MS in the bamboo 2 12.483 Mequinol 14.87
vinegar
3 12.945 4-Methyl phenol 2.85
4 15.455 4-Ethyl phenol 11.46
5 23.745 Acetic acid 8.45
7.3.2 Chemical Composition of Enhanced Bamboo Vinegar
GC-MS was used to determine the major chemical compositions in bamboo vine-
gar. Table 7.2 shows that five major compounds were identified, which are phenol
(1) (11.57%), mequinol (14.87%) (2), 4-methyl phenol (2.85%) (3), 4-ethyl phenol
(11.46%) (4) and acetic acid (8.45%) (5). These compounds are essential in produc-
ing a potent insecticides. According to Bilehal et al. (2014), bamboo vinegar contains
more than 43 compounds of natural ingredients, including polyphenolic, phenolic,
organic acids, alcohols, ketones and some carcinogenic agents.
Peaks with retention time below 7 min were not studied because diethyl ether
elutes at 7 min mark. The total percentage of phenol derivatives found is 40.75%. This
result is almost similar with Theapparat et al. (2015), which reported that the total per-
centage of phenols concentration in Dendrocalamus asper (bamboo) to be 30.97%,
which consists of phenol, 2-methylphenol, 3-methylphenol, 4-methylphenol,
2-ethylphenol, 2,6-dimethylphenol, 2,5-dimethylphenol, 2,3-dimethylphenol, 4-
propyl-2-methoxyphenol, 4-methyl-2-methoxyphenol, 4-ethyl-2-methoxyphenol,
guaiacol, eugenol and syringol. The production of phenols in the bamboo vinegar
was due to the pyrolysis process of lignin, while the production of acetic acid is due
to the pyrolysis process between cellulose and hemicellulose in bamboo (Theapparat
et al. 2015).
7.3.3 The Mortality Test of Bamboo Vinegar Toward

Drosophila Melanogaster
In this study, the bamboo vinegar was tested against D. melanogaster by using
five different concentrations (20, 40, 60, 80 and 100% v/v). The bamboo vinegar
was diluted with distilled water. The effectiveness of bamboo vinegar toward D.
melanogaster is tested by observing their mortality rate (mortality/min) at different
concentration of bamboo vinegar.
Figure 7.1 indicates that the mortality of fruit flies increased slowly with times
and concentration. The mortality rate of fruit flies was the highest using 100% v/v
of bamboo vinegar, which is 2.37 mortality/min. The mortality rate for 80% (v/v) is
1.71, while for 60% (v/v) it is 1.45 mortality/min. Then, the mortality rates continue to
12
y = 2.37x y = 1.71x y = 1.45x
10
y = 1.11x
8
Mortality
y = 0.80x
6
0
0 1 2 3 4 5 6 7 8 9 10
Time (min)
20% 40% 60%
80% 100% Linear (20%)
Linear (40%) Linear (60%) Linear (80%)
Linear (100%)
Fig. 7.1 The mortality rate of bamboo vinegar toward D. melanogaster at concentrations of 20,
40, 60, 80 and 100% (v/v)
decrease for 40% and 20% (v/v), which are 1.11 and 0.80 mortality/min, respectively.
Thus, it can be concluded that the mortality rate of fruit flies increased with the
increasing concentration of bamboo vinegar. This is because the concentration of
phenol derivatives in the pure bamboo vinegar (100% v/v) is higher which directly
increase the lethality of solution toward the fruit flies. This result agrees with Tong
and Feng (2016), which reported the effectiveness of bamboo tar consisting mainly
of phenols (43.63%) in controlling three types of aphids.
Figure 7.2 shows that the time taken for the commercial insecticide to terminate
all fruit flies is 2 min compared to bamboo vinegar which take 4 min to kill all 10 fruit
flies. Although the mortality rate for commercial insecticide is 4.40 mortality/min
which is higher than mortality rate for bamboo vinegar, 2.37 mortality/min, the time
difference is small which is 2 min. Therefore, bamboo vinegar has comparable effect
with commercial insecticide in terminating fruit flies.
7.4 Conclusion
The produced bamboo vinegar was analyzed using GC-MS to give phenols deriva-
tives (40.75%) and acetic acid (8.45%) as the major constituents. Wood vinegar which
consists of the same major constituents has been reported to have insect repellant
and pesticides properties but there is a limited study on wood vinegar or bamboo
14
y = 4.40x y = 2.37x
12
10
Mortality
8
6
4
2
0
0 1 2 3 4 5 6
Time (min)
Bamboo vinegar Commercial insecticide
Linear (Bamboo vinegar) Linear (Commercial insecticide)
Fig. 7.2 The mortality rate of D. melanogaster in 10 mL of bamboo vinegar (100% v/v) and 10 mL
of commercial insecticide
vinegar as an insecticide. Therefore, this study shows that bamboo vinegar has high
potential as insecticides. The mortality rate of fruit flies for pure bamboo vinegar is
2.37 and for commercial insecticide it is 4.40 mortality/min. Nevertheless, the time
difference in terminating fruit flies is only 2 min. Therefore, pure bamboo vinegar
(100% v/v) exhibits equivalent insecticidal properties with commercial insecticide
in eliminating D. melanogaster.
References
Bilehal D, Li L, Kim YH (2014) Gas chromatography-mass spectrometry analysis and chemical

composition of the bamboo-carbonized liquid. Food Anal Methods 5(1):109–112
Ge Y, Jin H (1996) Recovery process for phenolic compounds from coal-derived oils by ions of
soluble metal salts. Fuel 75(14):1681–1683
Grewal A, Abbey L, Gunupuru LR (2018) Production, prospects and potential application of
pyroligneous acid in agriculture. J Anal Appl Pyrol 135(18):152–159
Mfarrej MFB, Rara FM (2018) Competitive, sustainable natural pesticides. Acta Ecol Sin 39(2):145–
151
Mungkunkamchao T, Kesmala T, Pimratch S, Toomsan B, Jothityangkoon D (2013) Wood vinegar
and fermented bioextracts: natural products to enhance growth and yield of tomato (Solanum
lycopersicum L.). Sci Hortic 154:66–72
Tappert L, Pokorny T, Hofferberth J, Ruther J (2017) Sublethal doses of imidacloprid disrupt sexual
communication and host finding in a parasitoid wasp. Sci Rep 7:1–9
Theapparat Y, Chandumpai A, Faroongsarng D (2018) Physicochemistry and utilization of wood
vinegar from carbonization of tropical biomass waste. In: Sudarshana P, Nageswara-Rao M,
Soneji JR (eds) Tropical forests-new edition. IntechOpen
Theapparat Y, Chandumpai A, Leelasuphakul W, Laemsak N (2015) Pyroligneous acids from
carbonization of wood and bamboo: their components and antifungal activity. J Trop For Sci
27(4):517–526
Tong SM, Feng MG (2016) Aphidicidal activity of a novel botanical insecticide made by alkalization
of bamboo tar. Crop Prot 87:85–89
Velmurugan N, Han SS, Lee YS (2009) Antifungal activity of neutralized wood vinegar with water
extracts of Pinus densiflora and Quercus serrata saw dusts. Int J Environ Res 3(2):167–176
Wang P, Maliang H, Wang C, Ma J (2015) Bamboo charcoal by-products as sources of new
insecticide and acaricide. Ind Crops Prod 77:575–581
Wang Y, Qiu L, Song Q, Wang S, Wang Y, Ge Y (2019) Root proteomics reveals the effects of wood
vinegar on wheat growth and subsequent tolerance to drought stress. Int J Mol Sci 20(943):1–23
Zaman CZ, Pal K, Yehye WA, Sagadevan S, Shah ST, Adebisi GA, Marliana E, Rafique RF, Johan
R (2017) Pyrolysis: a sustainable way to generate energy from waste, pyrolysis. In: Samer M
(ed). IntechOpen
Chapter 8
Tensile Strength of Polyester Composite
Filled with Bamboo Fiber
Noor Syafeekha Mohamad Sakdun, Nur Azrin Azlan, Nik Farhanim Imran
and Hafizah Muhamad Azlan
Abstract The natural fiber-reinforced polymer (NFRP) has attracted substan-

tial importance as potential structural material. To ensure sustainability and eco-
efficiency of the next generation of polymer composites, the combination of natu-
ral fibers such as jute, hemp, flax, bamboo and sugarcane bagasse requires special
attention in the industry nowadays. The type of polymer resin used in this study is
unsaturated polyester resin. The aim of this study is to obtain the tensile strength of
polyester composite filled with bamboo fiber and determine the optimum percentage
of bamboo fiber added into the polymer composites. Five samples of polyester com-
posites containing different percentages of bamboo fiber starting from 2, 4, 6 and
8% volume fiber and one control sample were prepared. The fiber arrangement in
the composites was scattered in random directions. From the finding, the maximum
tensile load recorded was 1480.78 N for control sample but among volume fraction
between 2 and 8% of fiber content, composite which contained 6% of bamboo fiber
is the best performance in tensile strength as it has recorded the highest tensile load
value which is 1241.94 N. Besides, the break pattern for each sample of polyester
composites was compared. There are several factors that can influence the tensile
strength of polyester composites such as the existence of the voids and the fiber
arrangement in the composite which affects the matrix-fiber bonding.
Keywords Tensile strength · Polyester composites · Bamboo fibers
N. S. Mohamad Sakdun (B) · N. A. Azlan · N. F. Imran · H. Muhamad Azlan

Faculty of Civil Engineering, Universiti Teknologi MARA, Cawangan Pulau Pinang, Bukit
Mertajam, Malaysia
e-mail: syafeekha518@uitm.edu.my
N. A. Azlan
e-mail: nurazrin94@gmail.com
N. F. Imran
e-mail: farhanim4611@uitm.edu.my
H. Muhamad Azlan
e-mail: hafizahazlan@uitm.edu.my

88 N. S. Mohamad Sakdun et al.
8.1 Introduction
Fiber-reinforced polymer (FRP), also known as composite material, consists of

high strength fiber-reinforced embedded in polymer matrix. It was introduced in
the twenty-first century and has been used widely in many industries such as con-
struction, marine, transportation and chemical plant industry. The usage of FRP
composites continues to grow at an impressive rate as these offer many significant
advantages, such as high stiffness, high tensile strength properties, low weight, easy
to use, adaptableness to curved surfaces and corrosion proof (Nilanjan and Raipriti
2016). These advantages make FRP suitable as material in order to be used in civil
structures or infrastructures for restoration or firming up the elemental constituent
through its applications as bridge decks and structures, external cladding, structural
repair and refurbishment, modular buildings, and all-FRP residential and commercial
structures.
The addition of fiber in FRP composites (FRPC) is developed by using synthetic
fiber or natural fiber. Commonly, the synthetic fibers such as glass, Kevlar and carbon
fiber were used as fiber in FRP and known as synthetic fiber-reinforced polymer
(SFRP). These fibers provide high mechanical properties, but they are costly and
can be harmful to the environment (Arpitha et al. 2014). Thus, in recent years, the
natural fibers have attracted substantial importance as potential structural material
and many studies have made to prove that the natural fiber can be alternative to the
synthetic fiber (Begum and Islam 2013). The natural fibers such as jute, hemp, flax,
bamboo and sugarcane bagasse are used to form the natural fiber-reinforced polymer
(NFRP) since these composites offer many advantages toward the environment and
cost (Agarwal et al. 2015). Development of NFRP can be a sustainability material
in the construction industry especially in infrastructure engineering element such as
bridge road element and barrier for pedestrian walkway to protect pedestrian from
moving vehicles.
Bamboo tree belongs to a grass family known as Bambusoideae and it grows
quickly and mature in a short period of time (Md Shah et al. 2016). Bamboo fiber
is a cellulosic fiber that is extracted from bamboo plant. It offers many advantages
such as elastic, environment-friendly, biodegradable product and having strength
comparable to the glass fiber. It is highly durable and has substantial tensile strength
(Imadi et al. 2014). Furthermore, natural fibers are renewable raw materials and
recyclable (Taj et al. 2007).
In this study, we focused on tensile performance of bamboo fiber-reinforced poly-
mer and found the optimum percentage of bamboo fiber content in polymer composite
as the reinforcing material.
8 Tensile Strength of Polyester Composite Filled with Bamboo … 89
8.2 Methodology
8.2.1 Raw Material
Raw materials used to produce the polymer composites are thermoset unsaturated
polyester resin, bamboo fiber and hardener. The unsaturated polyester type used in
this study is 9505-GP and the hardener type is MEKPO 60 and was supplied by
Echemo Trading Sdn. Bhd., Malaysia. Bamboo fiber in the form of parallel fibers
was extracted from bamboo stalk which was obtained from Penang, Malaysia. The
bamboo was sun-dried to eliminate the moisture and cut to approximately 4 cm
length. Note that the bamboo fiber does not undergo any biochemical treatment as a
reinforcing material.
8.2.2 Preparation of the Polyester Composites
The composites were fabricated in a custom-made demountable mold of size 300 mm

× 250 mm × 5 mm made from high-tensile steel plates. The preparation of polymer
mixture was done by mixing the unsaturated polyester resin and hardener in the ratio
10:1 as recommended by the manufacturer of the products, Echemo Trading Sdn.
Bhd., Malaysia. The polyester mixture was stirred for several minutes and added
with bamboo fiber according to volume fraction specified before the mix become
hardened. Out of five samples prepared, four of them were filled with bamboo fiber
starting from 2, 4, 6 and 8% volume of bamboo fiber content. One sample was
prepared as a control sample. Before pouring the composite mixture into the mold,
coat the mould using releasing agent to remove dirt to ensure smooth surface of
composite samples. The composite mixture was then carefully poured into the mold
and leveled using scraper to agitate the fiber in the mixture and to eliminate air
bubbles trapped in the samples before hardened. The mold then was covered using
steel plate and clamped, forcing out the excess resin. The composite was then left to
cure for about 24 h or until it completely hardened in room temperature. After that
the sample was removed from the mold, cut off the excess resin, remove flashing and
weigh the samples.
Tensile samples were prepared by cutting to smaller size of 200 mm × 25 mm
× 5 mm, as shown in Fig. 8.1, according to BS EN ISO 527-5:2009 (2009). The
cutting process was done using vertical bending saw machine. For each composition
of samples, five samples have been tested for tensile testing and for tensile strength
determination. Both ends of each sample were overlapped with aluminum tabs leav-
ing the parallel length exposed to 150 mm in length and marked with four equal
lengths.
Fig. 8.1 Size of tensile sample
8.2.3 Testing of Samples
Tensile testing was conducted at a speed of 1 mm/min using universal testing machine
(UTM) 100 kN and fitted with self-tightening grips. Prior to UTM operation, the test
sample was installed vertically, securely placed within the grips and loaded in tension
until the sample fails. The load and displacement data were obtained by using data
logger to be analyzed. Although this study focuses on the tensile strength of polyester
filled with specified volume fraction of bamboo fiber, the break pattern of each test
samples also will be studied.
8.3 Results and Discussions
8.3.1 Tensile Strength
The mean tensile load for all samples with different percentage of bamboo fiber
content was compared and illustrated in Fig. 8.2. This comparison is performed to
find which volume fraction of bamboo fiber in composite is more effective in terms of
tensile strength. From the graph shown, control sample has the highest mean tensile
value which is 1480.78 N, followed by 6% of fiber content 1241.935 N, 8% of fiber
content 1174.49 N, 2% of fiber content 1165.07 N and the lowest mean strength
recorded is 397.085 N for 4% fiber content. The strength of composite showed
decreasing trend when added with 2% of fiber but it also showed that the strength
has increased when reinforced with 6% of fiber. This is due to better fiber–matrix
bonding that attributed to uniform stress distribution. Several factors may influence
the strength of composites, such as strength of fiber and matrix chosen, fiber volume
fraction and fiber–matrix interfacial bonding (El-Shekeil et al. 2012). However, the
4% fiber content in composites that recorded the lowest strength showed the uneven
arrangement of fiber and lack of fiber’s ability to transfer the load on one another in
the matrix composites.
Fig. 8.2 Mean tensile load (N) applied versus bamboo fiber content (%)
8.3.2 Optimum Percentage of Bamboo Fiber in Polyester

Composites
The optimum content of fiber in composites can also be used to identify which sample
has the best strength among the volume fractions tested in this study. In this finding,
the sample reinforced with 6% of bamboo fiber is considered to have the best tensile
strength compared to 2, 4 and 8% of fiber. However, the strength recorded slightly
lower than control sample and this indicates that the control sample has better strength
in terms of stress distribution in matrix composite (Özturk 2010). Meanwhile, for
the lowest strength of composites filled with bamboo fiber, the reduction in tensile
strength was caused due to non-uniform diameter of fiber and poor dispersion of
fibers with matrix (Agarwal et al. 2015).
8.3.3 Break Pattern
Based on the experimental work done, the break pattern was studied once it failed.
There are several types of break lines observed for all samples tested. The first break
pattern is horizontal break line as shown in Fig. 8.3, which occurred most in many
samples. This was due to the less arrangement of fiber in the failure region. The
second break pattern is diagonal break line as shown in Fig. 8.4 due to lack of
ability of fiber distribution load on one another and thus causes the region weak in
fiber-matrix bonding.
One factor to cause the failure of the sample was due to the improper arrangement
of fiber in the matrix composite. Although the fiber was added randomly in the
polyester composites, most of the break line occurred when the arrangement of fiber
is in horizontal direction compared to the fiber which was placed vertically to the
Fig. 8.3 Horizontal break

pattern
Fig. 8.4 Diagonal break

pattern
width of the sample. This is because fiber in vertically direction can grip more fiber-
matrix bonding. The other factor that contributes to the failure of the samples was
because of the fracture that happened due to occurrence of air bubbles inside the
sample, and thus caused the existence of void in sample and allowed the stress to
focus at that spot. The existence of voids such as air bubbles may cause due to
improper way of mixing the raw material during casting process. Thus, it allows air
to enter the mixture and create the voids.
Furthermore, the third break pattern that occurred on several samples happened
at the region of glued aluminum tabs, as shown in Fig. 8.5. This type of break
occurred probably because of misconduct during installation of the sample in the
self-tightening grips. Most of the samples breaks within the gauge length, but some
Fig. 8.5 Break at the end tab
of the specimens failed at the end tab. Improper gripping installation cannot ensure
that the specimen can be held at the maximum load without slippage of failure in the
grip section. The best break point of each sample should occur in the region marked
as Sects. 8.2 and 8.3, as shown in Fig. 8.1.
Besides, some of the samples with fiber content were not fully broken. The con-
dition of the samples, as shown in the Fig. 8.6, shows the example of the composite
samples that did not completely fail. From the observation, bamboo fiber in the com-
posite still holds two pieces of broken sample before it failed. This type of break
pattern showed ductile failure where the sample is trying to resist the crack. Thus,
Fig. 8.6 Samples did not fully break due to arrangement of bamboo fiber and still hold two pieces
of the broken sample
this condition allows giving a warning before the sample completely failed, and most
of the fibers hold the broken sample in vertical direction.
8.4 Conclusion
Based on the findings discussed in this paper, varying fiber content added in polyester
resin can be studied to determine which composites indicate the best matrix-fiber
interfacial bonding. Control sample shows the highest tensile strength recorded,
which is 1480.78 N. This is because as more fibers are added into matrix composite,
the value of tensile strength is reduced. However, for comparison all composite
samples were tested under tensile testing, and sample composition with 6% fiber
content has the better strength in tensile compared to 2, 4 and 8% fiber content
added. Also, the break pattern for all samples was studied once it failed to know
where the location of failure is most occurred. Most of the samples were broken
within the gauge length regions of 2 and 3 marked on the sample and the failure was
observed in horizontal breaking line.
8.5 Recommendation
Further investigations on the performance of BFRP need to be done to improve

the knowledge on this composite material. Some recommendations may need to be
considered and are stated as follows:
i. Use different size of fiber such as longer length and arrange proper placement of
fiber in the mix to increase the bond between fiber and polymer. Variation in size
and improper arrangement of fiber will create more void and poor dispersion of
fibers with polymer matrix.
ii. Use different type of resin such as epoxy or vinylester resin as the core material.
Different type of polymer will give different result on tensile strength. This is
because each polymer has different mechanical properties and benefits.
iii. Add powder form bamboo fiber as filler in the BFRP to reduce void in the sample.
The powder form enhances the bonding between fiber and matrix. Thus, the FRP
will be hardly broken due to tensile strength exhibit by the fiber itself.
Acknowledgements The authors would like to acknowledge the Final Year Project student, aca-
demic, friends and Universiti Teknologi MARA, Cawangan Pulau Pinang, Malaysia for their
valuable assistance to complete this research.
References
Agarwal R, Ramachandran M, Ratnam SJ (2015) Tensile properties of reinforced plastic material

composites with natural fiber and filler material. ARPN J Eng Appl Sci, 2217–2220
Arpitha GR, Sanjay MR, Yogesha B (2014) Review on comparative evaluation of fiber reinforced
polymer matrix composites. Adv Eng Appl Sci Int J, 44–47
Begum K, Islam MA (2013) Natural fiber as a substitute to synthetic fiber in polymer composites.
Res J Eng Sci, 46–53
BS EN ISO 527-5:2009 (2009) Determination of tensile properties of plastic
El-Shekeil YA, Sapuan SM, Abdan K, Zainudin ES (2012) Influence of fiber content on the mechani-
cal and thermal properties of Kenaf fiber reinforced thermoplastic polyurethane composites. Mater
Des 40:299–303
Imadi SR, Mahmood I, Kazi AG (2014) Bamboo fiber processing, properties and applications.
Biomass Bioenergy, 27–46
Md Shah AU, Sultan MTH, Jawaid M, Cardona F, Abu Talib AR (2016) Bamboo composites review.
BioResources 11(4):10654–10676
Nilanjan T, Raipriti S (2016) Durability and case study of fiber reinforced polymer (FRP). IOSR J
Mech Civil Eng, 53–62
Özturk S (2010) Effect of fiber loading on the mechanical properties of Kenaf and Fiberfrax fiber-
reinforced phenol-formaldehyde composites. J Compos Mater 44:2265–2288
Taj S, Munawar MA, Khan S (2007) Natural fiber-reinforced polymer composites. Proc Pakistan
Acad Sci 44(2):129–144
Chapter 9
NetGuard: Securing Network
Environment Using Integrated
OpenVPN, Pi-Hole, and IDS
on Raspberry Pi
Abidah Mat Taib, Muhammad Tholhah Zabri, Nor Azira Mohd Radzi
and Evizal Abdul Kadir
Abstract Owing to online dependency, almost all personal gadgets are connected to
the internet. Socializing, working, satisfying hobbies in sports and entertainment all
over the world are no longer a problem for ASEAN countries’ users. Unfortunately,
some of these users are unaware that they are exposed to threats since their personal
online activities could be scrutinized and tracked by malicious parties. Besides, the
users are potentially becoming victims of phishing and also the man-in-the-middle
(MiTM) attack. In safeguarding the internet users, online activities need to be secured.
Not everybody is well versed technically on the subject. Trainings or buying special
devices for that purpose is costly and time-consuming, which is unappreciated by
layman person. This paper discussed NetGuard, an integrated tool that hides the
user’s internet protocol (IP) by masking it with OpenVPN server deployed in another
country, secure users from being tracked by an attacker on internet and blocks any
domain name system (DNS) request for known tracking and advertising domain by
using Pi-Hole project. NetGuard was tested and its feedbacks were documented.
The result showed respondents satisfactions with the NetGuard’s ability to maintain
secrecy online and the network performance was not significantly degraded. As a
whole, its usage possibly reduces the digital gaps especially between the ASEAN
countries.
A. M. Taib (B) · M. T. Zabri

Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, 02600 Arau,
Perlis, Malaysia
e-mail: abidah@uitm.edu.my
M. T. Zabri
e-mail: tholhahzabri@gmail.com
N. A. M. Radzi
Academy of Language Studies, Universiti Teknologi MARA, 02600 Arau, Perlis, Malaysia
e-mail: norazira202@uitm.edu.my
E. A. Kadir
Faculty of Engineering, Universitas Islam Riau, Pekanbaru 28284, Riau, Indonesia
e-mail: evizal@eng.uir.ac.id

98 A. M. Taib et al.
Keywords NetGuard · Raspberry Pi · Intrusion detection system (IS) ·

Man-in-the-middle · OpenVPN · Pi-Hole
9.1 Introduction
In this sophisticated era, there has been significant advancement of technology over
the past few decades. These advancements have been of great help in people’s
daily life. One of the advancements that brought significant changes in people’s
way of communicating and gaining information is the internet. It was said that the
world is at your fingertips. Almost all our daily activities involved internet access
via mobile phones, computers or other gadgets. Although this advancement may
offer a great opportunity for people to improve, it is said that too much of internet
usage and daily exposure to mobile technologies might have some effects to the brain
(Findlay 2014). Aside from that, the internet provides an amazing facility for search-
ing any information related to everyone from every corner of the world. There are
so many things that they could gain and access on the internet. Nevertheless, every
change must have their drawbacks too. In this case, information that can be accessed
through the internet has no limits. Some information can be accessed by people
and hackers through man-in-the-middle (MITM) technique (Komal and Shriniwas
2013). Imagine that a person’s data is being sniffed out by some hackers and that
information was used with malicious intent (Saric et al. 1998). Then, this will make
others felt insecure about their online activities and their data (Komal and Shriniwas
2013). Despite that, no one could have done anything about it. Hence, they would
need something that would make their network secure and take responsibility for
their data’s privacy and security (data integrity). Unfortunately, ordinary people and
many citizens are not aware of security threats that they are exposed to. Thus, the
government, employers or parents need to play their roles in inculcating healthy and
secure computer network activities. Furthermore, Malaysia is among the countries
that are building ahead with the Industrial Revolution 4.0. It should keep abreast
with sustainable education or facilities to improve the knowledge and skills among
network or internet users toward secure internet usage.
9.1.1 Security Threats
When browsing the internet, people tend to visit forums and social media. Some of
these sites often contain advertisements in the form of popup windows and banner like
within the site. In addition, online advertisements will also drain network resources
(Parmar et al. 2015). This could sometimes make the visitors felt very distressed.
Furthermore, some of the ads also contain malicious viruses that will be downloaded
to their computer, hence infecting the system. This might not seem serious at first
9 NetGuard: Securing Network Environment Using Integrated … 99
but then the visitor’s system will be getting slower and slower for the time being and
by the time they wanted to take any actions, they might lose their data.
Nethead, Cybernaut or Netizen is a term used to label people who spend a lot of
time on the internet. The internet is a playground for them, but some of the information
exchanged on the internet is not safe and may be exposed to unwanted people (Hosner
2004). Information and data exchange from the network can be sniffed by unwanted
people as the data is not fully secured (Saric et al. 1998). Thus, having a safe and
secure network environment is what these kinds of people are seeking for. Netizen
sometimes connects to the internet by using public networks as it is convenient for
them and free of charge. But, is this safe for them? Data flow during online activities
using the public wireless fidelity (Wi-Fi) is more exposed to data leaking rather than a
private network. Hackers often use Wi-Fi access to gain information and monitoring
data traffics (Wan Alias 2015). There is a possibility that every site the users visited,
every input they filled in the search box and every link they checked on the website
could be tracked by the third-party companies which would do profiling on them.
Hence, the tendency of annoying advertisements that related to the user’s interest to
pop up on the user’s devices is high.
An advertisement is a great way for a site admin to generate some money by
using visitors to view their ads. Also, it can cover the cost of their site. However, this
event sometimes could cause problems and annoying situations for visitors. The ads
sometimes cover the content, thus making it hard for the readers to read. Besides,
some of the ads also contain malware that could cause harm to the visitors’ system.
Some advertisements also could expose hackers to the victim’s browser (Chandar
2018). Thus, this is a serious problem that needs to be handled.
Hacking activities are common news nowadays. Many people practice it in a
good and a bad way. Network attacks from outside are the most common attacks that
most of the people need to handle (Nadiammai and Hemmalatha 2014). Some of the
attacks are distributed denial of service (DDoS), port scanning attack, spamming and
many more. To handle these kind of cases, the end-users need a device or software
to monitor their network traffic. A virtual private network (VPN) can be used to
secure a connection to the internet (Metz 2003). There are several free VPN services
available that the network users may have acquired for that purpose. Nevertheless,
a study by Robinson and Cole (2017) discovers that free VPN not only secures the
connection but also contains malware which monitors all users’ sensitive data without
their permissions. So, choosing the right VPN is vital. Although there are various
products out there which can be bought to handle these kinds of attacks, not many
people could afford it. Thus, coming up with a tool that is simple, easy to use and
less expensive is crucial.
Considering the level of economy and intellectuality of people in the Southeast
Asia region (ASEAN) that fall in various range and the existing of a huge digital gap
in some regions or countries, this proposed tool should be effective, inexpensive and
affordable to be acquired by student or ordinary network users. To confirm the need
for this tool, a preliminary survey was conducted before the development of the tool.
9.1.2 Preliminary Survey
This survey was conducted to review the awareness among the public regarding
internet access, its threat and vulnerability and to find out whether the user is aware
of the risks when they are connected to public Wi-Fi. An online survey that has
been conducted before the development of NetGuard has managed to get feedback
from 111 respondents. The title of the survey is “Online Surfing using Public Wi-Fi
Connection, is it SAFE/SECURED?” The main purpose of the survey is to show the
reality of the knowledge and skills of internet users in the present day.
Most of the respondents are students with a percentage of 79.3% of the total
number of respondents. Most likely this survey was conducted in the university’s area
since public Wi-Fi can be found a lot there. Meanwhile, 12.6% of the respondents are
employees from the private sectors. In addition, another 8.1% of respondents came
from the government sector and self-employed. Figure 9.1 shows their responses
regarding the activities of their internet usage.
Of the respondents 66.7% often use public Wi-Fi connection and 76.6% of them
worry whether their connection is safe or not; 95.5% acknowledge that online adver-
tisements are annoying and disturbing them while online surfing. Unfortunately,
69.4% admit that they do not know how to protect themselves against network attacks.
The findings confirmed that people often connect to the internet using public Wi-Fi
but they do not realize the risk of it. Due to the unencrypted network in the public
Wi-Fi, they are exposed to threats like data stealing and manipulation by hackers
and many more that cause loss of trust or fiscal. Having a device that could secure
network connection, block online advertisement and protect the user from any net-
work attack as well as easy to handle and inexpensive is essential. Thus, this paper
presents the safeguarding technique and discusses the implementation of NetGuard
as a solution to the problem statement.
Fig. 9.1 User’s network activities

9.1.3 Safeguard and Countermeasure
Among the techniques that have been already developed to safeguard the mentioned
threats above are virtual private network (VPN), ad-blocker and intrusion detection
system (IDS). However, the problem is each one of them needs to be installed on
every user’s system and they all are working independently. As for novice users,
this will surely give them a headache to install and set up the features inside their
networks. After identifying the problem statement, it is realized that implementing
a simple tool that can be used by nontechnical users to secure their network activity
is critical.
Therefore, this paper proposes a solution using a Raspberry Pi. Raspberry Pi is
a well-known small-single board computer which commonly used by tinkers, pro-
grammers and computer students for general-purpose computer development (Gay
2014). The Raspberry Pi has been embedded with three main features to guard a net-
work. That explains how NetGuard has got its name. To achieve a secure network,
NetGuard is programmed to encrypt all the data flow through it by encrypting the
packet through a VPN connection and stopping advertisement that flow into the net-
work, thus making the network ads-free. As for protecting the network from inside
and outside attacks, NetGuard is programmed as network intrusion detection system
(NIDS) using Suricata IDS. The rest of the paper will discuss the NetGuard’s features
and system architecture, related work, methodology, result and analysis. Finally, the
conclusion presents the concluding remarks.
9.2 NetGuard Features and System Design
NetGuard comprises three main features: network encryption via OpenVPN, imple-
menting Pi-Hole to block advertisement and preventing potential intrusion using
Suricata IDS. These features are conceptually shown in the NetGuard’s system design
depicted in Fig. 9.2. It is a formal description and representation of a system, organizes
in a way that supports reasoning about the structures and behaviors of the system.
A system architecture can comprise system components and the expand systems are
developed, which will work together to implement the overall system. Additionally,
it may include a composite design of the system, the connection between the system
and other components inside.
9.2.1 Network Encryption via OpenVPN
OpenVPN is an open-source software application that implements VPN techniques

between devices. It is a crossed-platform software and can be installed and run in
different kind of operating systems (OS) (Skendzic and Kovacic 2017). OpenVPN
Fig. 9.2 System design
uses the OpenSSL library for the encryption for both the data and control channels.
OpenSSL is a software library that secures communications over computer net-
works against eavesdropping for an application that uses it. Regarding the OpenSSL
library, OpenVPN uses the OpenSSL to do all the encryption and authentication for
the connection made. Thus, it uses all the ciphers available in the OpenSSL pack-
age. Also, OpenVPN could use hash-based message authentication code (HMAC)
which is a specific type of message authentication code (MAC) consisting of a cryp-
tographic function and secret cryptographic key. This is to add an extra layer of
security to the connection. Besides, some of the authentication methods used by
OpenVPN to authenticate peers with each other are pre-shared keys, certificate-based
and username/password-based. In addition, OpenVPN can run on both user datagram
protocol (UDP) and transmission control protocol (TCP), which is convenient for
the user to choose which type of connection that suits them the best.
In another word, OpenVPN is the solution for a security professional when they
need to use public or free Wi-Fi as their main connection to the internet in which
OpenVPN configurations were done for both servers and clients (Jodoin 2013). By
using OpenVPN on a Raspberry Pi, a portable device secure connection to the internet
can be set up economically to protect from hacker’s activities that tried to capture
the data from the user or to decrypt it.
9.2.2 Implementing Pi-Hole to Block Online Advertisement
Advertisement and popups can sometimes be an annoying thing that happens when
browsing the internet. These online advertisements that appeared on certain websites
seem like normal ads, but they are disturbing the user by distracting their attention to
their work or even making them click on the ads. If the ads contained harmful program
or malware, it may result in spreading the malware or infecting the computer system
or other PCs in the network. That is why some of the users’ systems are gradually
slow and do not function as they are supposed to. The ads could be manipulated by
the hackers to provide them with a backdoor to computer users’ system.
The advertisement can also sometimes be a problem if it pops up unwanted or
inappropriate content. An advertisement is a great way for a site admin to generate
some money by using visitors to view their ads. Moreover, it can also cover the cost
of their site. However, this event sometimes could cause a problem and annoying
situation for visitors. The ads sometimes cover the content, thus making it hard for the
readers to read. Besides, some of the ads also contain malware that could cause harm
to the visitors’ system. Some advertisements also could expose hackers to victims’
browser (Chandar 2018). Thus, this is a serious problem that needs to be handled.
For example, universities nowadays are increasingly adopting online learning and
courses as part of the curriculum (Jobber and Lancaster 2009), and it will become a
problem for students to learn online if annoying ads were popping up.
Advertisement blocker or Adblock is an extension needed by the user to restrict
advertisement from popping up while they are surfing the internet. Some of the tools
are free and available for users to install them to their browsers’ extension. Some of
them are pre-installed inside antivirus which will help the user to avoid seeing those
ads that might annoy. Moreover, some Adblock also comes with settings that allow
a certain site to be whitelisted or control its behavior using the Adblock. Adblock is
helpful for users that always have a problem with ads popping up and disturbing them
while surfing. Although there are many advertisement blocker tools and extensions
being developed out such as Adblock Plus, Nano Adblocker and Disconnect, but not
all of the internet users are familiar of installing or even using an extension for the
web browser. This will make it hard for normal internet users such as the elderly,
people who surf only to read news or youngster which use it only to read random
articles online. People will only ignore the ads and not prevent it because of their
lack of expertise in information technology (IT).
As an alternative to overcome the advertisement problem, NetGuard adopts a
technique by Salmela and Schapper (2018) that created Pi-hole which acts as a
domain name system (DNS) sinkhole for blocking advertisement. It prevents adver-
tisement, popups and irrelevant message from entering user’s network and preventing
them from any unwanted malware attacks inside the online advertisement. All these
features are implemented inside Raspberry Pi, an embedded device with network
capability which acts as a router that rejects any DNS request regarding ads and
popups.
9.2.3 Preventing Intrusion Using Suricata IDS
Suricata IDS is open-source software that performs IDS and intrusion prevention
software (IPS) on the installed device. It was developed by open information secu-
rity foundation (OISF). Suricata is fast and has a robust network threat detection
engine. Its network threat engine is adequate of real-time IDS, inline IPS, network
security monitoring and useful for offline packet capture processing. These features
are quite powerful as to monitor a network security in any event. Suricata operates by
inspecting the network traffic and packets that flow inside the network. The inspec-
tion uses powerful and extensive rules and signature language that is already being
set during the installation of Suricata. Additionally, the user is also capable of adding
their own set of rules to suit their needs. Suricata increases the efficiency of network
traffic analysis by processing the workload in different task simultaneously (Day and
Burns 2011).
9.2.4 Related Works
In the work by Lales and Carranza (2013), a Raspberry Pi (a cheap microcom-

puter) was used as a VPN server to a home network that provides a secure connec-
tion between a home network and the public network. They use OpenVPN as their
main VPN connection which is then set up inside Raspberry Pi. Remote access VPN
is a connection that establishes when an individual host connects to a private net-
work from a single device from another network. In addition, a study conducted by
Poonia et al. (2017) investigates the performance of the Raspberry Pi and the net-
work resources when implementing Snort IDS on Raspberry Pi Model-3, Raspberry
Pi Model-B+ and Raspberry Pi Model-B. They found that Raspberry Pi Model-3 is
superior among other models on the basis of CPU performance, memory manage-
ment and power consumption. Hence, the proposed NetGuard uses Suricata IDS on
Raspberry Pi Model-3 B.
Another work by Sforzin et al. (2017) also implements IDS on the Raspberry
Pi. They claimed that all the distributed systems such as the internet of things (IoT)
and devices that are being used daily are connected. This will cause a problem and
challenge to secure the flaws that might exist inside one of the devices. If one of the
devices is attacked by hackers, this will bring harm to user’s network. They propose
a solution by implementing IDS which is Snort on the Raspberry Pi to monitor and
log incoming and outgoing data packet from and into the networks. The requirement
that they set for their project is that the IDS should be portable, has a minimum
configuration to avoid complexity, ease of use so the user only needs to turn on the
device to secure the network and to make it versatile, and available anywhere. Owing
to its portability, NetGuard also secure the network from any attacks by implementing
IDS on Raspberry Pi but using Suricata instead of Snort.
9.3 Methodology
The research approach in this study consists of information gathered from literature
to determine the problem statement and also conducting a preliminary survey to
support the claim regarding the needs of the special tool for safeguarding the net-
work activities. Then, to develop and implement the NetGuard involves requirement
analysis at the beginning until testing and recording the result at the end.
9.3.1 Development of NetGuard
Requirement Analysis: Before the development phase, all required hardware and
software for the project were determined. Table 9.1 lists the details of the hardware
and software requirements for this project.
Setup and Installation: First, the Raspberry Pi 3 B was equipped with Raspbian,
a Linux OS of Raspberry Pi. After the OS installation was done, remote connection
features were then set up to ease users’ job to maintain the Raspberry Pi and to create
the bridge connection between public Wi-Fi access and their devices.
Then, OpenVPN configuration was set up to the Raspberry Pi. The connection
for the VPN was set up to be auto connecting if there is an active connection to the
internet. This step is to simplify the user’s job by auto connecting to the OpenVPN
server. Next, Pi-Hole project was then installed inside the Raspberry Pi 3 B to block
any DNS request regarding an online advertisement or tracking site. This ensures that
users would not be disturbed by any annoying online advertisement, thus creating an
ad-free environment. Subsequently, Suricata IDS was installed on the Raspberry Pi
3 B, then setting it up to enable monitoring service and set up the rules for the IDS
inside the Raspberry Pi.
Implementation: When the Raspberry Pi is turned on, OpenVPN, Pi-Hole and
IDS that is already implemented inside the Raspberry Pi will automatically start after
the Raspbian OS boot up. The data flow through the Raspberry will be encrypted by
the OpenVPN. Then, the Pi-Hole features inside the Raspberry Pi will monitor the
incoming and outgoing traffic queries and make sure there is no site tracker or any
advertisements being push into the network. To make sure that the network and the
devices inside the Raspberry Pi network is secured, the IDS will detect any attack or
intrusion to the network and notify the user. System architecture in Fig. 9.3 shows
the logical implementation of NetGuard.
As shown in Fig. 9.3, the data packet that flows from the user is not secure; the data
packet then is encrypted by the Raspberry Pi that prevents any outside attacks to the
user’s data packet. After that, an advertisement that is requested will be denied by the
Table 9.1 Hardware and software requirements

No Hardware item Description
1 Raspberry Pi The main hardware for the project where all the features required for
NetGuard have been implemented
2 RJ45 cable To connect the client laptop to the Raspberry Pi
No Software item Description
1 Raspbian operating system The operating system for the Raspberry Pi
2 Pi-Hole Software that acts as DNS sinkhole and is installed on the
Raspberry Pi
3 OpenVPN Used to encrypt the network traffic
4 Suricata IDS Used as an IDS in this project
Fig. 9.3 Logical diagram of NetGuard implementation
Pi-Hole and the network will be free from any site trackers and online advertisements.
During the process of securing the user’s data packet, OpenVPN will encrypt the
packet while Pi-Hole will monitor the network for any advertisement request from
the user to the internet. Then, Suricata IDS will help to monitor the network from
any anomaly attacks from the outside.
9.3.2 Testing
Figure 9.4 presents the experimental testbed for NetGuard testing. A wireless router
provides a connection to the internet. The attacker’s laptop and the NetGuard are
directly connected to the wireless router. The NetGuard then provides a secure net-
work connection to the user’s laptop. In this testing, the attacker will try to access
the user’s laptop to see whether the IDS will be triggered by the action or not. After-
ward, a network performance test was conducted using Iperf3 to see whether the
implementation of NetGuard will degrade the network performance as a whole.
Next, the NetGuard capability of blocking the advertisement was tested to see the
total number of advertisements that have been blocked during the surfing time of
the user when implementing NetGuard to the network. The results from the testing
were analyzed and discussed based on the NetGuard’s capability to block advertise-
ment and bad queries as well as whether applying NetGuard affect the networks’
performance.
9.4 Results and Analysis
During the testing of the NetGuard, the user browses a few websites to see whether
the NetGuard is capable of blocking popups and advertisement that is trying to enter
the network. Figures 9.5 and 9.6 are the results for the advertisement that has been
blocked by the NetGuard.
Fig. 9.4 Experiment testbed
Fig. 9.5 Interface for number of advertisements blocked

Fig. 9.6 DNS queries of visited website over time
Figure 9.5 shows the number of queries blocked by the Pi-Hole during the imple-
mentation of NetGuard to the network. During the test, as 4,573 queries are made
by the user in the network, 1,455 bad queries are managed to be blocked. The result
showed the total queries which were requested by the advertisement and also to
show what was blocked by the Pi-Hole in one day. This showed that the Pi-Hole
has managed to handle the advertisement that wanted to enter the user’s network.
Figure 9.6 shows the graph of the number of advertisements that have been blocked
by the Pi-Hole over time, per day.
Based on Fig. 9.6, the green line indicates the DNS request by the network while
the blue line indicates the number of blocked advertisement queries that request
to enter the network. This result shows that the NetGuard increasingly blocked the
advertisement that is trying to enter the network.
Next, the network performance test was done to the NetGuard to monitor the effect
of using NetGuard. The test was done to see whether the NetGuard will slow down
the network because of the OpenVPN and Pi-Hole features. The testing was done
using Iperf3. Iperf3 can test the network with both TCP and UDP packet connection.
Table 9.2 displays the result of the network performance test that measures the
network speed without the NetGuard and when applying the NetGuard.
As depicted in Table 9.2, the results of the speed for the network that used Net-
Guard are almost the same. The slight drop when applying the NetGuard could be
due to the processing and protection that have been performed by the NetGuard to
the network. These results are presented in Fig. 9.7a, b for the TCP connection and
UDP connection, respectively. The X-axis indicates the number of trials for the tests
while the Y-axis indicates the speed of the network for the performance tests.
As shown in Fig. 9.7, both results for TCP and UDP connection are almost the
same. Although it seems like there is drop in network performance due to the Net-
Guard processing to the network, the t-test that was run on the results has proved that
Table 9.2 Result of network performance test

Trial Network speed without using Network speed when using
NetGuard (Mbps) NetGuard (Mbps)
TCP UDP TCP UDP
1 4.36 1.1 4.26 1.09
2 3.80 1.12 3.50 1.11
3 3.36 1.15 3.28 1.13
4 4.41 1.11 4.35 1.12
5 4.35 1.13 4.26 1.12
(a) (b)
Fig. 9.7 Network performance before and after using NetGuard a TCP connection b UDP
connection
there is no statistical difference in the network speed when applying the NetGuard or
vice versa. Thus, it can be inferred that the NetGuard does not interfere with network
performance so much. When implementing the NetGuard into the network, the user
can surely know that the NetGuard will not drop its performance of the network
despite the features and tools that have been working inside the NetGuard to make
the network more secure.
9.5 Conclusion
As been highlighted in this paper, an unencrypted network could expose users to

packet sniffing and MiTM attacks, site tracker and advertisement in certain websites
and phone applications that require an effective solution which is manageable and
affordable. The implementation of OpenVPN, Pi-Hole and Suricata IDS inside the
Raspberry Pi to form a NetGuard has met these criteria and successfully proven that
the NetGuard can secure the network connection, block bad queries from entering
the network and also detect any intrusion that is being launched there. It is capable of
protecting the device and the user from outside attacks without affecting the network’s
performance. Besides, NetGuard could be produced with affordable price, since it
is built with inexpensive devices and based on open sources software, for users to
enjoy and benefit the internet while having secure connection. The discussed paper is
an effort to improve and share knowledge and skills in technologies among ASEAN
countries. Thus, reduce the digital gaps among its people.
References
Chandar H (2018) Six signs you are being hacked | New Straits Times | Malaysia General Business
Sports and Lifestyle News. https://www.nst.com.my/opinion/letters/2018/04/355376/six-signs-
you-are-being-hacked
Day D, Burns B (2011) A performance analysis of Snort and Suricata network intrusion detection
and prevention engines. In: Fifth international conference on digital society, Gosier, Guadeloupe,
pp 187–192
Findlay H (2014) Mobile technologies transforming the brain and impacting various aspects of
societal life. J Healthc, Sci HumIties 5(2):93–113
Gay W (2014) Raspberry Pi hardware reference. Technology in action. https://www.raspberrypi.
org/
Hosner C (2004) OpenVPN and the SSL VPN Revolution. Security 10–38. http://www.sans.org/
reading-room/whitepapers/vpns/openvpn-ssl-vpn-revolution-1459
Jobber D, Lancaster G (2009) Selling and sales management. Bus Horiz 50(3):185–191
Jodoin E (2013) SOHO remote access VPN. Easy as Pie, Raspberry Pi. SANS Institute Reading
Room, 41
Komal N, Shriniwas S (2013) A new approach towards the onion router network using an attack
dependent on cell-counting. Int J Emerg Technol Adv Eng 3(7):500–507
Lales C, Carranza A (2013) Using the Raspberry Pi to establish a Virtual Private Network (VPN) con-
nection to a home network. http://www.asee.org/documents/zones/zone1/2014/Student/PDFs/
226.pdf
Metz C (2003) IEEE Internet Comput 7(1):87–91
Nadiammai GV, Hemalatha M (2014) Effective approach toward intrusion detection system using
data mining techniques. Egypt Inform J 15(1):37–50
Parmar A, Dedegikas C, Toms M, Dickert C (2015) Adblock plus efficacy study. Technical
Report, Simon Fraser University. https://www.sfu.ca/content/sfu/genericdept/eryn/drag-a-pdf/_
jcr_content/main_content/download/file.res/Adblock.Plus.Study.pdf
Poonia P, Kumar V, Nasa C (2017) Performance evaluation of network based intrusion detection
techniques with Raspberry Pi—a comparative analysis. Int J Eng Res Technol (IJERT) 5(10):1–6.
ISSN: 2278-0181. In: ICCCS—2017 conference proceedings, Published by, www.ijert.org
Robinson and Cole (2017) Virtual Private Network (VPN) Providers: How Private Are They?
JDSUPRA. http://jdsupra.com/legalnews/virtual-private-network-vpn-providers-35789
Salmela J, Schapper C (2018) Block Ads network-wide with A Raspberry Pi-hole. https://piphole.net
Saric S, Perakovic D, Bara D (1998) Problem of information security traffic on internet. Promet—
Traffic—Traffico 10(1–2):61–66
Sforzin A, Marmol FG, Conti M, Bohli JM (2017) RPiDS: Raspberry Pi IDS—a fruitful intrusion
detection system for IoT. RPiDS: Raspberry Pi IDS a fruitful intrusion detection system for IoT,
pp 440–448
Skendzic A, Kovacic B (2017) Open source system OpenVPN in a function of Virtual Private
Network. IOP Conf Ser: Mater Sci Eng 200(1):012065
Wan Alias WNH (2015) Lima minit godam data agensi kerajaan | BHplus | Berita Harian. https://
www.bharian.com.my/node/52812
Chapter 10
Bilingual e-Story Book
for Hearing-Impaired Students (BeSH)
Toward Sustainability Learning
Sharifah Nurulhikmah Syed Yasin, Hayati Adilin Mohd Abd Majid,

Ummu Fatihah Mohd Bahrin, Siti Salbiah Hamzah and Zeti Darleena Eri
Abstract Bilingual e-Story book for hearing-impaired (HI) students (BeSH) is

a development of specialized courseware to facilitate them in enhancing Bahasa
Melayu reading and comprehension skills. This is due to their slow performance
in understanding and independent reading that leads to less motivation and low
academic achievement at school. To date, there is no Bahasa Melayu storybook in
a multimedia application that comes with sign language assistance in Malaysian
schools. Whilst Braille equipment is created for visually impaired (VI) students, this
courseware is a novelty created for the HI students. The enhancement in teaching
technique is much needed to increase their competencies in reading effortlessly and
enjoyably. Thus, the objective of this project is to design new courseware based on
the requirement of HI disability which is to assist the students with their first lan-
guage. The theory used in this innovation is assistive courseware which is supported
by the exclusive design of the courseware interface. The enhancement is based on the
inclusion of bilingual methodology. The main language for the deaf would be the sign
language while the second language is Bahasa Melayu (or other mother tongues).
The project was assessed using Nielsen 10 heuristics. The data was collected from
the experts who are the teachers in Sekolah Pendidikan Khas Kuala Terengganu and
UiTM multimedia courseware lecturers. The result shows that the courseware has
the possibility to increase the attention and retention of the students in their learning
S. N. Syed Yasin (B) · U. F. Mohd Bahrin · S. S. Hamzah · Z. D. Eri

Faculty of Computer and Mathematical Sciences, Universiti Teknologi Mara (UiTM), Terengganu
Branch, Kuala Terengganu Campus, Shah Alam, Malaysia
e-mail: nurulhikmah@uitm.edu.my
U. F. Mohd Bahrin
e-mail: ummufatihah@tganu.uitm.edu.my
S. S. Hamzah
e-mail: salbiah452@tganu.uitm.edu.my
Z. D. Eri
e-mail: zetid415@tganu.uitm.edu.my
H. A. Mohd Abd Majid
Faculty of Hotel and Tourism Management, Universiti Teknologi Mara (UiTM), Terengganu
Branch, Dungun Campus, Shah Alam, Malaysia
e-mail: whofrance10@gmail.com
112 S. N. Syed Yasin et al.
process. It is hoped that the results of this project would contribute to the improve-
ment of interface design for HI multimedia courseware and increase the demand of
usage and the sustainability of lifelong learning among hearing-impaired students.
Keywords Hearing impaired · Multimedia courseware · Bilingual courseware ·

Storybook
10.1 Introduction
The introduction of computers and related information technologies has tremen-

dously helped human beings in every aspect of life. Everything has become more
convenient and accessible due to technology across almost all sectors, including
education. One of the tools used widely in educational settings is a multimedia prod-
uct, courseware. Multimedia technology through interactive courseware has rapidly
advanced in the current Malaysian education perspective for delivering course mate-
rial to students (Kamaruddin 2015). The courseware contains multimedia elements
such as video, animation, text, graphics, and audio which are used by teachers or
trainers as educational software materials. The multimedia courseware is used as
tutorials for self-learning programs or students with the coach’s assistance (Ariffin
and Faizah 2010; Dandashi et al. 2016). Nowadays, courseware can be used as an
alternative to assist and support the process of teaching and learning. It could cre-
ate an effective learning process for students at school especially for special needs
students like hearing impaired or dyslexia.
HI students do not use oral language for communication purposes as they have
lost the ability to perceive sounds. They are individuals with mild or severe hearing
impairment to the extent that impacted their communication (Egaga and Aderibigbe
2015). Technology has enabled HI students to communicate in an instructional
environment with their hearing colleagues, enabling synchronous communication
between all students. The innovation benefited them in many aspects including boost
in their learning and self-esteem (Shepherd and Alpert 2015).
In conjunction to understanding, Beal-Alvarez and Cannon (2014) stated that
the use of technology has been proven to demonstrate the ability of learners to
write, think, and speak through limited studies. In addition, they have also become
more interested, actively participate in the classroom, and have a greater rate of
retention than other peers in traditional online and onsite classes (Shepherd and Alpert
2015). This is supported by Fitzpatrick and Neild (2017) that mobile devices and
laptops are part of the technology used that have been remarkably recognized not only
enhancing access but also increase the educational, social, emotional, and behavioral
performance for students who are deaf and unable to hear. This concurrently can
sustain more enjoyable learning and great performance among them. If this effort
persistently practices, it may give some notable achievement among HI students in
Asia and also in other developing countries.
10 Bilingual e-Story Book for Hearing-Impaired Students (BeSH) … 113
Therefore, this study focuses on designing e-storybook courseware for hearing

impaired based on hearing-impaired (HI) user requirements in Sekolah Kebangsaan
Pendidikan Khas Kuala Terengganu (SKPKKT). A number of teachers were inter-
viewed regarding the problems in the learning process and reading progress. The
finding of the interview supported the finding of Page (2018), which stated that
students who are deaf or having hearing problems demonstrated obvious poorer
performance on reading skills. The preliminary information obtained from the inter-
view has actually given important insights to achieve the aim of the study which is
to develop e-storybook courseware for hearing impaired.
10.1.1 Problem Statement
On the basis of teachers’ observation in SKPKKT, HI students take extra time to

understand the text in the storybooks. As a result, the teachers have to assist the
students by repeating the sentences of the storybook multiple times. After the reading
session is completed, the students are given some comprehension questions to answer
based on the storybook to measure their level of understanding.
The reading materials for Bahasa Isyarat Komunikasi (BIK) and storybooks are
based on regular storybooks available in the market. To date, there are very limited
regular storybooks that contain the provision of sign languages for the HI readers.
Therefore, the teachers in SKPKKT have made some innovation by converting the
storybooks into HI-friendly storybooks by simplifying the sentences and adding the
sign language in a form of hand figures for each of the words (refer Figs. 10.1 and
10.2). However, due to a limited number of sign language storybooks available at
the school, the students are not allowed to borrow the books for further reading.
As a result, they cannot make full use of the books to reinforce their reading skill
comprehension after school hours.
Extra effort is needed to assist the HI students in reading and comprehension
because they are considered to have verbal communication disorder. They may have
problems with sentence making, grammar, pronouns, verbs, concepts, and other
requirements of the language (Ahmad and Shahid 2019). As HI students are not able
to hear, they are visual-oriented people (Razalli et al. 2018) and depend mostly on
what they see. In order to improve their learning and reading skills, visual aids such
as text with images should be used.
Thus, the purpose of this study is to propose a reading and comprehension course-
ware exclusively for HI students. This courseware includes all multimedia elements
which are text, image, audio, video, and animation with interactive features in order to
extend the students’ visual ability and improve their self-learning skills. In addition,
the courseware is designed by applying the bilingualism features. The objectives of
this courseware are to design and develop a courseware to accommodate HI students
and teachers in learning, reading, and teaching the basic Bahasa Melayu and sign
languages, and to evaluate the functionality and usability of BeSH.
Fig. 10.1 The original

storylines
10.2 Literature Review
10.2.1 Hearing Impaired
There are many leading causes of deafness. The work (Siti Zaharah and Nor Azan
2010) stated that someone whose any part of ears is damaged resulting in hearing
loss is referred to as a deaf or hearing-impaired person. Some people are born deaf
due to a hereditary condition or had congenital problems such as those associated
with rubella. Others may become deaf as a result of injury, illness, or exposure to
excessive noise.
The biggest problem faced by deaf people is that they are not able to communicate
verbally with other people. They are very dependent on interpreters, who help them
in communication because not everyone is able to use sign language, especially
children (Siti Zaharah and Nor Azan 2010). Besides, hearing-impaired students have
poor self-motivation. Because of that, teachers need a special learning approach to
teach them. It is very important to encourage them to learn proactively by arousing
their sense of independence.
Fig. 10.2 The innovated

storylines with simplified
sentences and sign language
10.2.2 Multimedia Courseware for Hearing Impaired
Multimedia courseware is a learning software that integrates and utilizes various

media elements to create a more efficient and smarter application (Aris et al. 2006).
A live class conducted over the internet that is coordinated with distance learning is
also included in multimedia courseware. Multimedia courseware can include material
for websites, instructor-led classes, and self-directed computer-based training (CBT)
that offer interactive tutorials.
Courseware can also improve the effectiveness and the speed of the teaching and
learning process if it is suitable and well-conducted (Parvez et al. 2019). Computer-
based learning such as courseware can assist students in learning a topic. Several
studies have concluded that technology is vital to improve students’ performance
(Parvez et al. 2019; Gentry et al. 2005). More importantly, the multimedia courseware
and game-based assessment can lower test anxiety and increase engagement with the
topic presented (Kiili and Ketamo 2018).
Gentry et al. (2005) stated that multimedia courseware can offer a multilingual
approach to teaching literacy to HI students. Multimedia helps more because it offers
printed text for reading, images for additional information, video and animation for
more additional information. This kind of package may help to bridge the gap between
text and sign language.
10.2.3 Bilingualism
Bilingualism is a phenomenon where a person can speak or understand two or more

languages. On the other hand, bimodal bilingualism is a competency of mastering
at least one oral language and one sign language (Lucas and Valli 1992; Mercure
et al. 2018). HI students are categorized as a bilingual or bimodal bilingual person
(Lucas and Valli 1992). Currently, the study in bilingualism has reached several
cross-disciplinary like cognitive, linguistic, problem-solving, and communication
disorders (Altarriba and Heredia 2018). The study in bilingualism usually measures
the cognitive and behavioral performance of the samples.
Most of HI students learn to communicate in sign language before they learn to
read and write. Normally they learn sign language of a particular spoken language. For
example, they learn Malay sign language and use the Malay language as their native
language. A study by Mercure et al. (2018) stated that the bimodal bilingual person
uses his visual ability more in communication compared to a unimodal bilingual and
monolingual person. Therefore, teaching HI students by applying texts and images
is one of the appropriate methodologies to optimize their communicative ability.
10.3 Results
The examples of the BeSH interfaces are shown in Figs. 10.3, 10.4, 10.5, 10.6,
10.7 and 10.8. These interfaces were designed to be simple and follow the bilin-
gualism concept due to HI students’ difficulty to understand and comprehend long
Fig. 10.3 The main page displays the title of the story and the choices of activities
Fig. 10.4 Bilingual reading mode with text and video of sign language related to the storyline
Fig. 10.5 Animation with text to enhance the comprehension of HI students
sentences (Page 2018) (refer Figs. 10.3 and 10.6). Besides, reading mode interfaces
were designed based on the needs of the bilingual concept. The HI students were
required to read and watch the sign language simultaneously to enhance the reading
comprehension and language acquisition (refer Figs. 10.4 and 10.8). Interface in
Fig. 10.5 shows the use of animation as an additional tool to gain the understanding
Fig. 10.6 Selections of interactive activities
Fig. 10.7 Example of interactive activity
of HI students. Interactive quizzes were provided as well to provide the assessment

feature in this courseware.
Fig. 10.8 Text and sign language dictionary
10.3.1 Results for User Testing
The courseware was tested by evaluating the performance and understanding of HI

students in using the courseware. For this courseware evaluation, the HI students were
required to use BeSH for reading and answering the comprehension questions and
quizzes provided. The achievement was evaluated based on the number of attempts
the HI students took to answer the quizzes correctly. The samples were three students
from Sekolah Kebangsaan Pendidikan Khas Kuala Terengganu. The result is shown
in Table 10.1.
The ‘/’ in Table 10.1 indicates that the students managed to answer the compre-
hension questions correctly. The ‘1’ in the table shows the number of mistakes or
wrong attempts done by the students before they manage to find the correct answer.
Based on the results, there were only nine mistakes from 15 questions done by the
three students. It was also found that the students only took one single wrong attempt
to find the correct answer. Hence, it can be concluded that all students managed to
score the correct answer despite only a few attempts done.
10.3.2 Results for Expert Evaluation
Heuristic evaluation (HE) is one of the most well-known interface evaluation. HE

involves only the experts, not the users. Rather, the experts apply the information and
knowledge that they have to evaluate the standards, procedures, and assess to a system
or courseware (Georgsson et al. 2016; Quinones and Rusu 2018). Based on the HE
120
Table 10.1 Attempts made by students

Type of games Jom Pilih! Lengkapkan! Mari Susun!
Number of questions 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5
Student 1 / / 1 / 1 / / / 1 / / / / / /
Student 2 / / 1 1 1 / 1 / 1 / / / / / /
Student 3 / / / / / / 1 / / / / / / / /
S. N. Syed Yasin et al.
Table 10.2 Heuristics evaluation (based on Quinones et al. 2018) results

ID Name E1 E2 E3
H1 Visibility of courseware status 0 0 0
H2 Match between system and the real world 0 0 0
H3 User control and freedom 0 0 0
H4 Consistency and standards 0 0 0
H5 Error prevention 1 1 0
H6 Recognition rather than recall 0 0 0
H7 Flexibility and efficiency of use 2 0 0
H8 Aesthetic and minimalist design 1 0 0
H9 Help users recognize, diagnose, and recover from errors 0 0 1
H10 Help and documentation 1 1 1
carried out by the teachers of HI learners and multimedia experts, they were satisfied
with HE items H1–H4 and H6 (refer Table 10.2). However, the items H5 (error
prevention), H7 (flexibility and efficiency of use), H8 (aesthetics and minimalist
design) and H9 (help users recognize, diagnose, and recover from errors) received
several comments from the experts. Overall, the experts claimed that the courseware
is good, significant, and practical, but needs minor changes to prevent errors and
increase flexibility. Moreover, the courseware needs more interfaces that provide
sign language together with the text.
10.4 Conclusion
Our findings suggest that multimedia courseware can be an interesting tool or reading
material that can help HI students in reading comprehension. The finding is supported
by the interface that is specially designed for bilingual needs. The design includes
all multimedia elements that help HI students to comprehend more in their reading.
The most important elements included in the design are text, image, video, and
animation, while the sound is also included for HI students with hearing aid. The
experts that evaluated the courseware conclude that the courseware is beneficial and
appropriate to be implemented in reading classes for HI students although it needs
several additional features. For future work, the reading courseware for HI students
shall include text or word tracer so that the students are aware of which word is being
read in the sign language video. This feature is expected to give more positive effects
on reading skill development among HI students.
Acknowledgements The authors would like to thank Sekolah Kebangsaan Pendidikan Khas Kuala
Terengganu (SKPKKT) for giving us full cooperation toward the completion of this study. All the
guidelines and resources are very beneficial for the success of this study.
References
Ahmad I, Shahid H (2019) Study of the problems in expressive language learning faced by hearing
impaired children. Acad Res Int 10(1)
Altarriba J, Heredia R (2018) An introduction to bilingualism: principles and processes, 2nd edn.
New York, Routledge
Ariffin AM, Faizah M (2010) Guidelines of Assistive Courseware (AC) for hearing impaired
students. In: Proceedings of KMICe
Aris B, Ahmad MH, Kok BS, Ali MB, Harun J, Tasir Z (2006) Learning “goal programming” using
an interactive multimedia courseware: design factors and students’ preferences. Malays Online J
Instr Technol (MOJIT) 3(1):85–95
Beal-Alvarez J, Cannon JE (2014) Technology intervention research with deaf and hard of hearing
learners: levels of evidence. Am Ann Deaf 158(5):486–505. https://doi.org/10.1353/aad.2014.
0002
Dandashi A, Karkar A, Jaam JA (2016) Cognitive technology for children with hearing impairments.
In: IEEE global engineering education conference (EDUCON)
Egaga PI, Aderibigbe SA (2015) Efficacy of information and communication technology in
enhancing learning outcomes of students with hearing impairment in Ibadan. J Educ Pract
6(30):202–205
Fitzpatrick M, Neild R (2017) Assistive technology in the classroom. Benefits deaf and hard of
hearing students. Gallaudet University Laurent Clerc National Deaf Education Center
Gentry MM, Chinn K, Moulton R (2005) Effectiveness of multimedia reading materials when used
with children who are deaf. Am Ann Deaf 149(5):394–403
Georgsson M, Staggers N, Weir C (2016) A modified user-oriented heuristic evaluation of a mobile
health system for diabetes self-management support. Comput, Inform, Nursing 34(2):77–78
Kamaruddin N (2015) Understanding patterns of interactive courseware use within malaysian
primary smart schools. Malays Online J Educ Technol 3(1):49–56
Kiili K, Ketamo H (2018) Evaluating cognitive and affective outcomes of a digital game-based
math test. IEEE Trans Learn Technol 11(2)
Lucas C, Valli C (1992) Language contact in the American deaf community. Academic Press Inc,
New York
Mercure E, Kushnerenko E, Goldberg L, Bowden-Howl H, Coulson K, Johnson M, MacSweeney M
(2018) Language experience influences audiovisual speech integration in unimodal and bimodal
bilingual infants. Dev Sci, Wiley
Page TA (2018) Outcomes and considerations for children who are deaf or hard of hearing: assess-
ment and intervention for preschool and primary students. ProQuest Dissertations Publishing,
The University of North Carolina at Chapel Hill
Parvez K, Khan M, Iqbal J, Tahir M, Alghamdi A, Alqarni M, Alzaidi AA, Javaid N (2019) Mea-
suring effectiveness of mobile application in learning basic mathematical concepts using sign
language. Sustain, MDPI, Open Access J 11(11):1–20
Quinones D, Rusu V (2018) A methodology to develop usability/user experience heuristics. Comput,
Stand & Interfaces 59:109–129
Razalli AR, Anal A, Mamat N, Hashim T (2018) Effects of bilingual approach in malay language
teaching for hearing impaired students. Int J Acad Res ProgIve Educ Dev 7(4):109–121
Shepherd CM, Alpert M (2015) Using technology to provide differentiated instruction for deaf
learners. J Instr Pedagog 16
Siti Zaharah M, Nor Azan MZ (2010) Courseware accessibility for hearing impaired. In: Proceedings
of international symposium in information technology. Kuala Lumpur, Malaysia
Chapter 11
The Potential of Antioxidants
and Phytochemicals Components in Fruit
Waste (Peel) of Citrus hystrix and Ananas
comosus
Rohayu Ramli, Nureen Shahirah Ahmad Zaghlul
Abstract Asians love to have Citrus hystrix (Kaffir lime) and Ananas comosus
(pineapple) in their dishes, drink and even enjoy it raw. However, the peels of these
fruits are massively being discarded and time consuming to be degraded. Realiz-
ing their potential in antioxidants and phytochemicals compound, the aim of this
research is to extract the peels by using Soxhlet or maceration techniques and to
compare the combination effect of both peels at three different ratios (1:1, 1:2,
and 2:1). DPPH scavenging activity was used to determine the antioxidant activ-
ity, meanwhile phytochemicals compound was analyzed using GC-MS analysis. At
100 mg/mL, C. hystrix peel showed 92.87% of inhibition higher than the percentage
of inhibition for A. comosus peel, which scored for 89.10%. The highest combination
of DPPH scavenging activity was identified at ratio 1:1, which is 63.14%, followed by
ratio 1:2 (57.18%) and ratio 2:1 (48.84%). In a nutshell, the potential of antioxidant
is reduced when both peels were combined. This is because certain components in
both peels might reduce the potential and affect each other. However, there is no
significant difference for all concentrations (p > 0.05) based on one-way ANOVA
analysis. On phytochemicals screening toward C. hystrix peels, compounds such
as citronellal, linalool, citronellol, terpinen-4-ol, iso Pulegol, and α-cubebene were
identified. Meanwhile, benzene, 1,3-bis (phenoxyphenoxy), 2-furancarboxaldehyde,
5-methyl-, 2-furancarboxal-dehyde, 5-(hydroxymethyl)-, and 4H-pyran-4-one, 2,3-
dihydro-3, 5-dihydroxy-6-methyl were found in A. comosus peel. These components
proved that both peels of C. hystrix and A. comosus are potentially useful as antioxi-
dant. However, the single effect of each peel achieved a significantly greater potential
versus the combination effects.
R. Ramli (B) · N. S. Ahmad Zaghlul · N. A. H. Ahmad Nasir

Faculty of Applied Sciences, Universiti Teknologi MARA, Shah Alam, Perlis, Malaysia
e-mail: rohayuramli.85@gmail.com
N. S. Ahmad Zaghlul
e-mail: Atikahusna3@gmail.com
N. A. H. Ahmad Nasir
e-mail: nureenzaghlul@yahoo.com

124 R. Ramli et al.
Keywords Citrus hystrix · Ananas comosus · DPPH scavenging activity ·

Phytochemicals
11.1 Introduction
According to Food and Agriculture Organization (FAO), global fruit production

includes 124.73 million metric tons (MMT) of citrus, 114.08 MMT of bananas,
and 25.43 MMT of pineapples (Sagar et al. 2018). The crops that have been grown
luxuriantly led to a huge production and complying with the increasing demand had
caused a massive amount of agro-industrial wastes every year (Roda et al. 2014). The
fruit wastes have become one of the main sources of municipal solid waste (MSW)
which has been a critical environmental issue (Ibrahim et al. 2017). If these residues
are handled without proper disposal procedure then that may cause pollution and
harmful effect on human and animal health (Sadh et al. 2018).
It has been previously reported that fruit residues can be reused as antioxidant as
they possess important sources of polyphenols (Wijngaard et al. 2009). Antioxidants
are chemical compounds that can scavenge-free radicals in the body (Tow et al.
2011) whereas free radicals are the products of cellular metabolism (Phaniendra
et al. 2015). In excessive amount, free radicals may affect human health by causing
chronic diseases, including cancer, hypertension, heart attack, and diabetes (Ghafar
et al. 2010). Rahman et al. (2012) proposed that when the generation of free radicals
and active intermediates in a system exceeds the system’s ability to neutralize and
eliminate them, oxidative stress resulted.
Antioxidants can be classified into natural and synthetic (Jiang and Xiong 2016).
There is an increasing interest (Ranjbar Nedamani et al. 2014) and demand for
natural antioxidants due to safety concerns for synthetic antioxidants like butylated
hydroxytoluene (BHT), butylated hydroxyanisole (BHA), propyl gallate (PG), and
tertiary butylhydroquinone (TBHQ) (Ghafar et al. 2010; Embuscado 2015). Synthetic
antioxidants used in long term may cause adverse effects in humans and may not
contribute to additional nutritional benefits (Embuscado 2015) as they are toxic and
may turn out to carcinogenic effects to body and nature (Putri et al. 2018).
Citrus peels contain significant amount of phenolic compounds, especially pheno-
lic acids and flavonoids which highly contribute to antioxidant properties (Oboh and
Ademosun 2012). Pineapple (A. comosus) wastes are found to have potential uses
as raw materials that can be converted into value-added products. The identified and
quantified major phenolics in pineapple peels possess antioxidant activities from its
high amount of polyphenols and ascorbic acid as stated by Emmanuel et al. (2016),
which contribute to the antioxidant activity of the fruit (Hatam et al. 2013). More-
over, the peel waste contains considerable amount of antioxidant properties such as
phenolic compound, ferulic acid, and vitamins A and C as an antioxidant (Mozef
et al. 2017).
Improper handling of method and infrastructure of important food commodities
especially in the horticultural sector leads to the huge losses and waste especially
11 The Potential of Antioxidants and Phytochemicals Components … 125
when there are massive production and growth (Sagar et al. 2018). For example, 75%
of peeled skin, core, and crown end are not used and are discharged as wastage in
pineapple canneries causing problems of disposal and pollution (Hajar et al. 2012).
Most of the untreated and underutilized agro-industrial wastes are disposed either
by burning, dumping, or unplanned landfilling (Sadh et al. 2018). Waste disposal is
usually prone to microbial spoilage and it causes serious environmental problems
(Ketnawa et al. 2012). This is the point for the utilization of fruit and vegetable wastes
into the research of natural antioxidant.
Even though C. hystrix and A. comosus possess antioxidant properties, however,
there has been limited study regarding the antioxidant activity on combination of C.
hystrix and A. comosus peels compared to their single effects. Using the inexpensive
or residual sources from food agricultural industries has been focused to study the
effect of antioxidants (Afsharnezhad et al. 2017). Hence, this study is conducted to
provide information on antioxidant effect of both samples as combination may come
up with various interactions toward each other, thus possible varying effects often
different from the former could occur. The observed effect can be either synergism,
antagonistic, or additive.
Researchers had developed many ways in using the fruit waste. Previously, usage
of fruit residues always related to processing into animal food and as composting
fertilizer (Diaz-Vela et al. 2013). Citrus peel, the primary waste which contains
molasses, pectin, and limonene, is usually dried, mixed with dried pulps, and sold as
cattle feed (Rafiq et al. 2018). Fermented pineapple waste with higher acidity was
preferable to fresh waste as described by Upadhyay et al. (2013). Pineapple waste
also may be modified into production of paper, banknotes, and cloth (Ketnawa et al.
2012). The available of bioactive compounds in the fruit wastes is also beneficial in
contributing to the antioxidant properties. There is potential to create an antioxidant
product from the information known as bioactive compound in waste that is much
more or similar with the fresh fruit available.
Thus, this study aims to extract C. hystrix (Kaffir lime) and A. comosus (pineapple)
peels each in different method and determine the antioxidant activities singly and in
combination by using DPPH assay. Gas chromatography-mass spectrometry (GC-
MS) was used to identify the phytochemical components in both peels.
11.2.1 Raw Materials and Sample Preparation
Citrus hystrix and A. comosus fruits were bought from local market. The fruit’s peels
were washed under running water thoroughly and were cut into small pieces before
being dried.
126 R. Ramli et al.
11.2.2 Sample Extraction
Citrus hystrix peels was extracted by using Soxhlet extraction method (Mya et al.
2017). 25 g of Kaffir lime (C. hystrix) peels were dried under shade at approximately
35–36 °C (AccuWeather 2019) and extracted with methanol 1:10 wt/v by refluxing
in a Soxhlet extractor at 70 °C for 6 h. Meanwhile, for A. comosus peels, the samples
were extracted by using maceration extraction technique by Emmanuel et al. (2016).
20 g of peels were soaked in 200 mL methanol for 72 h. Both extraction samples
were then filtered using Whatman No. 1 filter. The complete removal of solvent from
extracts was done by using glass rotary evaporator at 40 °C. The extracts were stored
at 4 °C for further use. The extracts were weighed and calculated by using Eq. (11.1):
Yield (%) = weight of extract obtained/weight of peels × 100% (11.1)
11.2.3 Phytochemical Screening Using Gas

Chromatography-Mass Spectrometry (GC-MS)
For C. hystrix peels, helium gas was used as the carrier gas at a constant flow of
3.0 mL/min. The oven temperature was initially set for 70 °C for 5 min and then
increased gradually with a rate of 5 °C/min up to 310 °C as the injection tempera-
ture. Mass spectrometer was operated with electron ionization system with ionizing
energy of 70 eV at a 250 °C ion source temperature. Individual volatile compounds
were identified by comparing their retention indices and mass spectra to the spectra
libraries (Dertyasasa and Tunjung 2017). For A. comosus peels, helium gas was used
at a constant flow of 1.2 mL/min. The injection volume was 1 μL at a split ratio of
1:5, and the injector temperature was set to 250 °C. The temperature program was as
follows: isothermal hold at 100 °C (2 min) and constant raise to 320 °C (4 °C/min)
with a final hold time of 10 min. Transfer line and ion source were set to 250 and
230 °C, respectively (Steingass et al. 2015).
11.2.4 Determination of Antioxidant Activity (AA) Through

DPPH Method
The activity of both C. hystrix and A. comosus peels was tested on five different con-
centrations (100, 10, 1, 0.1, and 0.01 mg/mL) through DPPH assay. The combination
of both samples at the highest concentration (100 mg/mL) was also tested.
Citrus hystrix peels

1.25 mL of DPPH solution and 1 mL sample were mixed and incubated at room
temperature for 30 min. The samples were prepared in triplicate. Afterwards, the
Table 11.1 Samples ratios

Samples Ratio Volume of samples
(C. hystrix peels:A. comosus
peels)
1:1 200 μL C. hystrix peels +
200 μL A. comosus peels
absorbance of the mixture was measured by using a spectrophotometer at 510 nm.

For the control, the procedure was repeated by using DPPH solution only without
any sample (Wijaya et al. 2017). The antioxidant activity of the sample was measured
as a decrease in the absorbance and calculated by using Eq. (11.2):
Radical Scavenging Activity (%) = 1 − (A1 /A0 ) × 100% (11.2)
*A1 absorbance of sample

A0 absorbance of control
Ananas comosus peels

The mixture was prepared with 2 mL of DPPH methanol solution mixed with different
aliquots of extract solutions (100, 10, 1, 0.1, and 0.01 mg/mL) (Morais et al. 2015).
The mixture was left to stand for 30 min at room temperature before the absorbance
was read at 517 nm. An ascorbic acid solution of different concentrations (100, 10, 1,
0.1, and 0.01 mg/mL) was used as an analytical standard (Loh et al. 2011). Scavenging
activity was calculated by using Eq. (11.2). The samples were also prepared in
triplicate.
Combination Citrus hystrix peels and Ananas comosus peels

Combination test between C. hystrix peels and A. comosus peels for antioxidant
activity (DPPH assay) were conducted by using ratio 1:1, 1:2, and 2:1 (Tan and Gan
2016). The highest concentration of each extract was chosen for the test. The samples
were prepared in triplicate. The volume of sample and the ratio were listed as follows
(Table 11.1).
11.2.5 Statistical Analysis
The data obtained were analyzed by using GraphPad Prism version 8.1.1; analysis of
variance (ANOVA) to test on the significant differences between the concentration
of extracts on the percentage of inhibition of DPPH in single and combination effect.
128 R. Ramli et al.
Table 11.2 The percentage

Peel samples Mass of Mass of Percentage
yield of extracts
dried powder crude extract yield (%)
(g) (g)
Citrus 25.00 5.40 21.60
hystrix
Ananas 20.00 4.00 20.00
comosus
11.3.1 Percentage Yield of Extraction
Once extraction is completed, the weight of the extract is obtained in order to calculate
the percentage yield of extraction. Percentage yield of C. hystrix peels that has
been obtained through Soxhlet extraction method is 21.6% (Table 11.2). Meanwhile,
percentage yield of A. comosus peels by using maceration method is 20%.
11.3.2 Phytochemical Components in Peels
There are 37 components determined from the C. hystrix peels through GC-MS
analysis. Only six compounds with the highest peak area are chosen to be discussed.
The compounds are citronellol, iso Pulegol, terpinen-4-ol, linalool, α-cubebene, and
citronellal. Md Othman et al. (2016) supported the data with the findings in previ-
ous study indicating that these are the components of essential oil of C. hystrix in
Malaysia. The compounds are depicted in Table 11.3.
Table 11.3 The summarized compounds found in C. hystrix peels using GC-MS
Retention time (RT) Area (%) Name of compounds Activity
13.313 18.90 Citronellol Cytotoxicity, antioxidant,
antibacterial (Dertyasasa and
Tunjung 2017)
8.238 11.49 iso Pulegol nm
11.662 5.72 terpinen-4-ol Aromatic agent (lemon-like odor)
(Nor 2015)
9.107 2.20 Linalool Analgesic-like activity on mouse
(Dertyasasa and Tunjung 2017),
Aromatic agent (floral, sweet odor)
16.497 1.87 α-cubebene Nm
10.942 1.27 Citronellal Cytotoxic, antibacterial (Dertyasasa
and Tunjung 2017)
Components citronellal and citronellol are the most dominant compounds other
than limonene found in peel of C. hystrix as previously mentioned by Agouillal et al.
(2017). In addition, terpinen-4-ol is identified as the principal component. Linalool
compound is found from essential oil using automatic steam distillation process at
controlled temperature (Md Othman et al. 2016). Each compound has a different
boiling point and polarity, resulting in different retention times and mass spectra
which are then used to identify a single compound (Dertyasasa and Tunjung 2017).
Iso Pulegol and α-cubebene are labeled nm (not mentioned) as there is no reported
data found on that compound even though they are among the highest peak area
collected. Ayucitra et al. (2016) stated that previous researchers did investigate on C.
hystrix peels compounds extraction, different solvents and polarity; however, there
are still many information that were not reported regarding the C. hystrix compound
peels. Hence, the fundamental theory of which bioactive compounds inside C. hystrix
peels responsible for antioxidant activity is not yet fully understood.
There are 45 components found in A. comosus (pineapple) peels. Only four
with the highest peak area will be discussed. The compounds include ben-
zene, 1,3-bis (phenoxyphenoxy), 2-furancarboxal-dehyde, 5-(hydroxymethyl)-, 2-
furancarboxaldehyde, 5-methyl-, and 4H-pyran-4-one, 2,3-dihydro-3, 5-dihydroxy-
6-methyl. To be compared with the previous findings, the components found of
methanol maceration of A. comosus peels were reported for the first time, different
from previous studies. The compounds are listed in Table 11.4.
Compounds in residue of A. comosus like peel, core, and crown are limitedly
reported in previous study. Only few researchers did investigate on the waste com-
pounds on A. comosus. It can be seen that the main volatile compounds identified in
the distillate of pineapple processing by simple hydrodistillation were (Z)-3-hexen-
1-ol, methyl octanoate, 2-phenyl-1-ethanol, 2-methyl-3-buten-2-ol, and 1-hexanol
(Barretto et al. 2013) and the findings of methanolic extract consist of alkaloids,
flavonoids, saponins, tannins, steroids, cardiac glycosides, and carbohydrates (Kafeel
et al. 2016).
Table 11.4 The summarized compounds found in A. comosus peels using GC-MS
Retention time (RT) Area (%) Name of compounds Molecular formula
0.128 9.49 Benzene, 1,3-bis (phenoxyphenoxy) C30 H22 O4
14.536 3.86 2-Furancarboxaldehyde, C8 H12 O4
5-(hydroxymethyl)-
5.249 0.73 2-Furancarboxaldehyde, 5-methyl- C6 H6 O2
11.342 0.22 4H-Pyran-4-one, 2,3-dihydro-3, C6 H8 O4
5-dihydroxy-6-methyl-
130 R. Ramli et al.
11.3.3 Analysis of Oxidative Scavenging Activity Using

DPPH Assay
Ascorbic acid is a vitamin C, referred as standard for determining the antioxidant

activity of C. hystrix peels and A. comosus peels and their combination (Okoh et al.
2014). One-way ANOVA was conducted in order to determine the significant differ-
ence. Ascorbic acid was tested at the absorbance of 517 nm. Figure 11.1 shows the
inhibition (%) of ascorbic acid toward DPPH at different concentration. The result
revealed that maximum concentration (100 mg/mL) of ascorbic acid displayed the
highest percentage of inhibition (93.74%) followed by the concentration of 10 mg/mL
(92.40%), 1 mg/mL (83.57%), 0.1 mg/mL (75.90%) and concentration 0.01 mg/mL
(63.59%). As the concentration reaches to 100 mg/mL, it has the highest ability to
scavenge-free radical as stated by Pehlivan (2017).
For C. hystrix peels, concentration of 100 mg/mL also exhibit the highest per-
centage of inhibition (92.78%) against DPPH followed by 10 mg/mL (87.44%),
1 mg/mL (81.32%), 0.1 mg/mL (75.88%) and the lowest percentage of inhibition
is shown by the concentration 0.01 mg/mL (51.50%). The percentage of inhibition
shows concentration-dependent fashion as the antioxidant activity increases when
the concentration of C. hystrix peels increase (Loganayaki et al. 2013). Figure 11.2
shows the percentage of inhibition affected by different concentration of C. hystrix
peels as compared to ascorbic acid.
The inhibition percentage of C. hystrix peels against DPPH at concentration
100 mg/mL shows slightly different compared to the concentration 100 mg/mL of
ascorbic acid. It is proved that C. hystrix peels have antioxidant activity that is almost
close to ascorbic acid and potential to be one of natural antioxidant. This can be related
to the high content of vitamin C (Lv et al. 2015) and the presence of phenolic com-
pounds rich in C. hystrix peels that contribute to the slightest different of percentage
of inhibition (Rafiq et al. 2018). One-way ANOVA test also indicates that there is
no significant difference between the percentage of inhibition of C. hystrix peels and
ascorbic acid (P > 0.05).
Ascorbic acid
Percentage of inhibition (%)
100
80
60
40
20
0
100 10 1 0.1 0.01
Concentration (mg/mL)
Fig. 11.1 The percentage inhibition of different concentration of ascorbic acid

Citrus hystrix peels vs Ascorbic acid

100
80
60
40
20
0
100 10 1 0.1 0.01
Citrus hystrix Ascorbic acid
Fig. 11.2 Percentage inhibition of different concentration of C. hystrix peels compared with
ascorbic acid
The oxidative scavenging activity of A. comosus peels also shows concentration-

dependent fashion (Fig. 11.3). The results of inhibition percentage against DPPH
also recorded lower than the C. hystrix peels and ascorbic acid at all concentrations.
Concentration of 100 mg/mL shows DPPH free radical contributed for 89.10%,
followed by 10 mg/mL (85.40%), 1 mg/mL (71.97%), 0.1 mg/mL (35.79%) and
least concentration (0.01 mg/mL) accounted for 31.41%. This result determined that
the highest concentration possesses the greatest oxidative scavenging activity. This
finding is in accordance with Emmanuel et al. (2016).
The DPPH inhibiting properties of pineapple peels extract are strongly dependent
on the high amount of antioxidants present in the peels. Generally, the antioxidant
ability of pineapple peels can be attributed to the high phenolic, flavonoid, and
vitamin C content of the peels (Lu et al. 2014). The absorbance of DPPH of ascorbic
acid which is much lower than A. comosus peels proves better antioxidant activity
of ascorbic acid. This is supported by Loganayaki et al. (2013) as the lower the
Ananas comosus peels vs Ascorbic acid

100
80
60
40
20
0
100 10 1 0.1 0.01
Ananas comosus Ascorbic acid
Fig. 11.3 Percentage inhibition of different concentration of A. comosus peels compared with
ascorbic acid
132 R. Ramli et al.
Fig. 11.4 The percentage

inhibition of combination of 80 63.14%
C. hystrix and A. comosus 70 57.18%
48.84%
peels 60 1:1 ratio
50
40 2:1 ratio
30 1:2 ratio
20
10
0
% inhibition
absorbance toward DPPH, the higher the scavenging ability of that substance. One-
way ANOVA also shows that there is no significant difference between the percentage
of inhibition of A. comosus peels and ascorbic acid (P > 0.05).
11.3.4 Oxidative Scavenging Activity of Combination of Both

Extracts
For the combination of both extracts, the highest concentration (100 mg/mL) with
greatest percentage of inhibition for each extract was chosen. The oxidative scav-
enging activity can be seen from Fig. 11.4. Ratio 1:1 exhibits 63.14% percentage of
inhibition, followed by ratio 1:2 (57.18%) and lastly ratio 2:1 with 48.84%.
It is shown that the combination of single effect of each component (ratio 1:1) is
much higher compared to the other combination ratio. A 200 μL from each extract
gives the highest percentage of inhibition (63.14%) followed by ratio 1:2 with value
57.18% and ratio 2:1 with value 48.84%. Each phytochemical inside both compo-
nents such as vitamin C, phenolic, and flavonoid may contribute to the result of ratio
1:1 (Watson et al. 2014). When 200 μL C. hystrix peels combine with 400 μL of A.
comosus peels in ratio 1:2, the effect is lower than ratio 1:1 but higher than ratio 2:1.
The peels of A. comosus show greater effect compared to Citrus hystrix. It is proved
that greater volume of A. comosus might slow or counter the effect of C. hystrix
(Ranjbar Nedamani et al. 2014).
For the ratio 2:1, 400 μL C. hystrix peels combine with 200 μL of A. como-
sus peels. Even though C. hystrix peels exhibit the highest percentage of inhibition
against DPPH when tested alone, but doubling the amount with the combination of
A. comosus peels shows the lowest antioxidant activity. The doubling of the same
components might increase the effect of certain substance but it might also reduce
the effect or no changes for certain substances. An increase or decrease in the con-
centration of one or more compounds may influence these interactions and decrease
the antioxidant activity (Ranjbar Nedamani et al. 2014).
However, there is no significant difference on the inhibition of different ratios
between C. hystrix and A. comosus peels since P-value is >0.05 (ANOVA one-way).
Ranjbar Nedamani et al. (2014) stated that when compounds with antioxidant proper-
ties are combined, they will have various interactions toward each other, thus possible
varying effects often different from the former could occur. Single component could
give different effects but combination can be positive, negative, or no effects as sin-
gle. In a nutshell, single effect of C. hystrix peels and A. comosus peels is much more
effective rather than in combination.
11.4 Conclusion
In conclusion, C. hystrix and A. comosus peels do have the potential to be sources

of natural antioxidant derived from waste. The oxidative scavenging activity for
both samples is directly proportional to the concentration. Single effect of each peel
has more ability to scavenge-free radicals compared to combination as tested using
DPPH assay as the value for C. hystrix peels is 92.87% while A. comosus peels
is 89.10%. This shows that each peel has its own capability to be antioxidant. In
combination, ratio 1:1 (C. hystrix peels:A. comosus peels) has the highest value
(63.14%) for percentage of inhibition, followed by ratio 1:2 (57.18%) and lastly
ratio 2:1 (48.84%).
References
AccuWeather (2019) AccuWeather Arau, Malaysia. https://www.accuweather.com/en/my/arau/

229834/march-weather/229834
Afsharnezhad M, Shahangian S, Panahi E, Sariri R (2017) Evaluation of the antioxidant activity of
extracts from some fruit peels. Casp J Environ Sci 15(3):213–222
Agouillal F, Taher ZM, Moghrani H, Nasrallah N, El Enshasy H (2017) A review of genetic
taxonomy, biomolecules chemistry and bioactivities of Citrus hystrix DC. 14(March):285–305
Ayucitra A, Irawaty W, Jonathan K, Hartono CD, Nugraha AT (2016) Optimization of phenolic
compounds extraction from Averrhoa bilimbi and Citrus hystrix peel using statistical design of
experiment 11(23):13783–13789
Barretto LCDO, Moreira JDJDS, Santos JABD, Narendra N, Santos RARD (2013) Characterization
and extraction of volatile compounds from pineapple (Ananas comosus L. Merril) processing
residues. Food Sci Technol (Campinas), 33(4):638–645
Dertyasasa ED, Tunjung WAS (2017) Volatile organic compounds of kaffir lime (Citrus hystrix
DC.) leaves fractions and their potency as traditional medicine. Biosci Biotech Res Asia 14(4)
Diaz-Vela J, Totosaus A, Cruz-Guerrero AE, De Lourdes Pérez-Chabela M (2013) In vitro evaluation
of the fermentation of added-value agroindustrial by-products: cactus pear (Opuntia ficus-indica
L.) peel and pineapple (Ananas comosus) peel as functional ingredients. Int J Food Sci Technol
48(7):1460–1467
Embuscado ME (2015) Spices and herbs: natural sources of antioxidants—a mini review. J Funct
Foods 18:811–819
Emmanuel EU, Onagbonfeoana ES, Adanma OC, Obinwanne C, Faith A, Ndukaku OY (2016) In
vivo, in vitro antioxidant and hypolipidemic activity of methanol extract of pineapple peels in
wistar rats. Int J Biosci (IJB) 8(6):64–72
134 R. Ramli et al.
Ghafar MF, Prasad KN, Weng KK, Ismail A (2010) Flavonoid, hesperidine, total phenolic contents
and antioxidant activities from citrus species. Afr J Biotechnol 9(3):326–330
Hajar N, Zainal S, Nadzirah KZ, Roha AMS, Atikah O, Elida TZMT (2012) Physicochemical prop-
erties analysis of three indexes pineapple (Ananas Comosus) peel extract variety N36. APCBEE
Procedia 4:115–121
Hatam SFH, Suryanto E, Abidjulu J (2013) Aktivitas Antioksidan Dari Ekstrak Kulit Nanas (Ananas
comosus (L) Merr). J Pharmacon 2(01):7–12
Ibrahim UK, Kamarrudin N, Suzihaque MUH, Abd Hashib S (2017) Local fruit wastes as a potential
source of natural antioxidant: an overview. In: IOP conference series: materials science and
engineering, vol 206, no 1
Jiang J, Xiong YL (2016) Natural antioxidants as food and feed additives to promote health benefits
and quality of meat products: a review. Meat Sci 120:107–117
Kafeel H, Sheikh D, Baqir Naqvi SS, Ishaq H (2016) Antidepressant activity on methanolic extract
of Ananas comosus linn peel (MeACP) by using forced swim and tail suspension apparatus in
mice. Sci Int (Lahore) 28(3):2525–2531
Ketnawa S, Chaiwut P, Rawdkuen S (2012) Pineapple wastes: a potential source for bromelain
extraction. Food Bioprod Process 90(3):385–391
Loganayaki N, Siddhuraju P, Manian S (2013) Antioxidant activity and free radical scavenging
capacity of phenolic extracts from Helicteres isora L. and Ceiba pentandra L. J Food Sci Technol
50(4):687–695
Loh FS, Awang RM, Omar D, Rahmani M (2011) Insecticidal properties of Citrus hystrix DC leaves
essential oil against Spodoptera litura fabricius 5(16):3739–3744
Lu XH, Sun DQ, Wu QS, Liu SH, Sun GM (2014) Physico-chemical properties, antioxidant activity
and mineral contents of pineapple genotypes grown in China. Molecules 19(6):8518–8532
Lv X, Zhao S, Ning Z, Zeng H, Shu Y, Tao O, Liu Y (2015) Citrus fruits as a treasure trove of active
natural metabolites that potentially provide benefits for human health. Chem Cent J 9(1):1–14
Md Othman S, Hassan M, Nahar L, Basar N, Jamil S, Sarker S (2016) Essential oils from the
Malaysian citrus (Rutaceae) medicinal plants. Medicines 3(2):13
Morais DR, Rotta EM, Sargi SC, Schmidt EM, Guntendorfer E, Eberlin MN, Visentainer JV (2015)
Antioxidant activity, phenolics and UPLC—ESI (–)—MS of extracts from different tropical fruits
parts and processed peels 77:392–399
Mozef T, Andayani DGS, Risdian C, Andriyani R, Primadona I, Saraswaty V (2017) Pineapple
peel wastes as a potential source of antioxidant compounds. In: IOP conference series: earth and
environmental science, vol 60, p 012013
Mya MM, Aung ZZ, Nwe CT, Oo AW, Htay TM, Thaung S, Maung M (2017) Larvicidal, ovicidal
and repellent effect of Citrus hystrix DC (Kaffir lime) fruit, peel and internal materials extracts
on Aedes aegypti mosquitoes 4(1):34–43
Nor OM (2015) Volatile aroma compounds in Citrus hystrix oil. J Trop Agric Food Sci 27(2):225–
229
Oboh G, Ademosun AO (2012) Characterization of the antioxidant properties of phenolic extracts
from some citrus peels. J Food Sci Technol 49(6):729–736
Okoh S, Asekun O, Familoni O, Afolayan A (2014) Antioxidant and free radical scavenging capacity
of seed and shell essential oils extracted from abrus precatorius (L). Antioxidants 3(2):278–287
Pehlivan FM (2017) Vitamin C: antioxidant agent. www.intechopen.com/books/vitamin-c/vitamin-
c-an-antioxidantagent
Phaniendra A, Jestadi DB, Periyasamy L (2015) Free radicals: properties, sources, targets, and their
implication in various diseases. Indian J Clin Biochem 30(1):11–26
Putri DA, Ulfi A, Purnomo AS, Fatmawati S (2018) Antioxidant and antibacterial activities of
Ananas comosus peel extracts. Malays J Fundam Appl Sci 14(2):307–311
Rafiq S, Kaul R, Sofi SA, Bashir N, Nazir F, Ahmad Nayik G (2018) Citrus peel as a source of
functional ingredient: a review. J Saudi Soc Agric Sci 17(4):351–358
Rahman T, Hosen I, Towhidul Islam MM, Shekhar HU (2012) Oxidative stress and human health.
Adv Biosci Biotechnol 2012:997–1019
Ranjbar Nedamani E, Sadeghi Mahoonak A, Ghorbani M, Kashaninejad M (2014) Antioxidant

properties of individual vs. combined extracts of rosemary leaves and oak fruit. J Agric Sci
Technol 16:1575–1586
Roda A, Faveri D, Marco D, Dordoni R, Lambri M, De Faveri DM (2014) Vinegar production from
pineapple wastes-Preliminary saccharification trials. Chem Eng Trans 37:607–612
Sadh PK, Duhan S, Duhan JS (2018) Agro-industrial wastes and their utilization using solid state
fermentation: a review. Bioresour Bioprocess 5(1):1–15
Sagar NA, Pareek S, Sharma S, Yahia EM, Lobo MG (2018) Fruit and vegetable waste: bioactive
compounds, their extraction, and possible utilization. Compr Rev Food Sci Food Saf 17(3):512–
531
Steingass CB, Glock MP, Schweiggert RM, Carle R (2015) Studies into the phenolic patterns of
different tissues of pineapple (Ananas comosus [L.] Merr.) infructescence by HPLC-DAD-ESI-
MS (n) and GC-MS analysis. Anal Bioanal Chem 407(21):6463–6479
Tan HF, Gan CY (2016) Polysaccharide with antioxidant, α-amylase inhibitory and ACE inhibitory
activities from Momordica charantia. Int J Biol Macromol 85:487–496
Tow WW, Premier R, Jing H, Ajlouni S (2011) Antioxidant and antiproliferation effects of
extractable and nonextractable polyphenols isolated from apple waste using different extraction
methods. J Food Sci 76(7)
Upadhyay A, Lama JP, Tawata S (2013) Utilization of pineapple waste: a review. J Food Sci Technol
Nepal 6(2004):10–18
Watson RR, Preedy VR, Zibadi S (2014) Polyphenols in human health and disease. https://www.
sciencedirect.com/book/9780123984562/polyphenols-in-human-health-and-disease
Wijaya YA, Widyadinata D, Irawaty W, Ayucitra A (2017) Fractionation of phenolic compounds
from kaffir lime (Citrus hystrix) peel extract and evaluation of antioxidant activity. Reaktor
17(3):111
Wijngaard HH, Rößle C, Brunton N (2009) A survey of Irish fruit and vegetable waste and by-
products as a source of polyphenolic antioxidants. Food Chem 116(1):202–207
Chapter 12
The Effect of Different Animal Dung
in Vermicompost Production Using
Eudrilus eugeniae Worm and Spent
Mushroom Substrate
as Vermicomposting Medium
Norhanani Ahmad, Nurhidayah Mat Sukri and Noor Zuhairah Samsuddin
Abstract The purpose of this study is to evaluate the effect of different animal dung
in vermicompost production using Eudrilus eugeniae worm and spent mushroom
substrate (SMS) as a vermicomposting medium. The experiment was carried out
for 40 days in completely randomized design (CRD) on four replicates for each
treatment. The treatments were T1 (6 SMS + 3 cow dung + 1 chopped banana
trunk (CB)), T2 (6 SMS + 3 goat dung + 1 CB), T3 (6 SMS + 3 chicken dung
+ 1 CB) and T4-Control (6 SMS + 0 animal dung + 1 CB). Data on pH, EC,
vermicompost biodegradability coefficient, worm population and reproductive rate
were observed. Results showed that the pH of vermicompost after vermicomposting
ranges from 7.34 to 6.82 and the EC value was decreased ranging from 32 to 88%.
The vermicompost biodegradability coefficient was greater in T4 (0.82), followed
by T1 (0.37), T2 (0.36) and T3 (0.13). The population of the worm was higher in
T4 (178.75 worms) as compared to T2 (153.75 worms), T1 (153.25 worms) and
T3 (10 worms). Results revealed that chicken dung is not a suitable medium to be
used as part of a mixture in the vermicomposting medium since it has prevented the
reproduction of E. eugeniae worms. Meanwhile, medium with or without cow dung
can be used for vermicompost production since the growth rate and the number of
the worm were greater in both mediums.
Keywords Eudrilus eugeniae · Spent mushroom substrate · Vermicompost
N. Ahmad (B) · N. M. Sukri · N. Z. Samsuddin

Universiti Teknologi MARA Cawangan Perlis, 02600 Arau, Perlis, Malaysia
e-mail: norhanani615@uitm.edu.my
N. M. Sukri
e-mail: hidayahsukri92@gmai.com
N. Z. Samsuddin
e-mail: zuhairah445@uitm.edu.my

138 N. Ahmad et al.
12.1 Introduction
Recycling is not only practised in industrial and domestic affair but can also be
carried out in the agricultural industry. Agricultural wastes such as animal excreta,
plant debris and mushroom planting substrate need to be managed properly to avoid
pollution. Lately, agricultural waste from animals and plants, such as cow dung (Garg
et al. 2006), goat dung (Nath et al. 2009), rice straw (Sharma and Garg 2018), palm
oil mill effluent (Singh et al. 2011; Li et al. 2017) and oil palm empty fruit bunch
(Sabrina et al. 2009), has been extensively studied with the purpose to recycle these
materials to become valuable materials in the future that can be reused by plant as
compost or organic fertilizer. In Malaysia, several studies had been conducted in order
to manage agricultural waste efficiently. However, this practice varies according to
the types of waste.
Mushroom production in Malaysia has been increasing every year and is expected
to reach up to 183.6 metric tons per day in 2020 (MOA 2010). More substrates are
being produced each day and it is estimated that about 5 kg of mushroom block
are needed to produce 1 kg of mushrooms (Williams et al. 2001). This substrate
contains rubber sawdust, rice bran and hydrated lime (Rasib et al. 2015). Since this
substrate could not be reused for the next cultivation, this substrate will become a
waste and is called as spent mushroom substrate (SMS). A spent mushroom substrate
is a substrate of agricultural waste that was left after several cycles of mushroom
harvesting. This material can be found dumped and stacked in an open field. This
material can be disposed through burning, but it will pollute the environment and
impair the surrounding environment. Therefore, serious action needs to be taken
to increase mushroom production by 2020, together with practicing the concept of
zero waste management by turning this SMS into valuable products (Ministry of
Agriculture (MOA) 2012). Therefore, a study needs to be taken to utilize this waste
into a high-quality product such as vermicompost.
Vermicompost is a product that resulted from the process of composting an organic
matter that used earthworms as the main agent to accelerate the composting pro-
cess together with microorganisms. Even though microbes are part of important
agents that are responsible for biochemical degradation of organic matter, the types
of worm that are used during the decomposing process are very crucial. This to
ensure that the worms supplied into the medium can perform their task in com-
posting. In Malaysia, vermicompost producers commonly use red worm (Lumbricus
rubellus), blue worm (Perionyx excavatus), tiger worm (Eisenia fetida) and African
night crawlers (Eudrilus eugeniae). The use of worm in vermicomposting depends
on the availability of worm in the market and on the organic waste (Garg et al. 2005).
African night crawler or E. eugeniae was introduced in Malaysia by the Depart-
ment of Agriculture in 1998. This earthworm was used to help in the decomposing
of rice straw that was abundant in the northern region of Peninsular Malaysia. Apart
from composting rice straw, this worm has recently been studied by Lim and Wu
(2016) in the decomposing of palm oil mill by-product. However, the potential use
of this worm in vermicomposting of SMS mixed with different animal dung is still
12 The Effect of Different Animal Dung in Vermicompost Production … 139
not fully discovered. Therefore, the aim of this study is to evaluate the effect of dif-
ferent animal dung in vermicompost production using E. eugeniae worm and spent
mushroom substrate (SMS) as vermicomposting medium.
This study was conducted at Vermicompost House, Plantation Unit, Universiti

Teknologi MARA (UiTM), Perlis Branch, Malaysia. Spent mushroom substrate
(SMS) was collected from local farmers at Kampung Kubang Chenok, Kubang Pasu,
Kedah. Animal dung such as cow dung, goat dung and chicken dung were collected
from the animal farm of Plantation Unit Farm, UiTM Perlis Branch. In order to let
the dung decompose partially and to avoid the effect of thermophilic stage of com-
posting, animal dung (cow dung, goat dung and chicken dung) and SMS were soaked
in water for two weeks by changing the water every day for pre-composting process.
Then, this material was dried under the open sun for two days to remove some water
in the substrate.
This experiment was conducted in a plastic aquarium size 5 L of volume. Each
aquarium was filled with 1 kg of medium mixture that was previously prepared
consisting of SMS, animal dung and chopped banana trunk (CB) in a volume ratio of
6:3:1, respectively. Three different types of animal dung were used in this mixture,
which are cow dung, goat dung and chicken dung, and each type was compared with
one controlling variable (without animal dung). The moisture content of the medium
was adjusted to 25–30% during the study period by spraying adequate amount of
distilled water. The list of treatments was T1 (6 SMS + 3 cow dung + 1 chopped
banana trunk (CB), T2 (6 SMS + 3 goat dung + 1 CB), T3 (6 SMS + 3 chicken dung
+ 1 CB) and T4-Control (6 SMS + 0 animal dung + 1 CB). All these treatments
were replicated four times in completely randomized design (CRD).
African night crawler earthworms (E. eugeniae) were used in this study. These
worms were obtained from the Department of Agricultural, Tambung Tulang, Perlis,
Malaysia. About 25 g of earthworms (10 worms) were placed in each aquarium as
recommended by Ndegwa et al. (2000). The moisture of the medium was kept in
between 25 and 30% and watering was done by spraying the medium using distilled
water every day. The aquariums were then placed in vermicompost house for 40 days.
The pH of vermicomposting medium was measured using a Hanna Instrument,
HI9921, and pH meter (in 1:10, w/v deionized water). Electrical conductivity (EC)
was measured using an EC meter (Hanna Instrument, HI8733). Biodegradability
coefficient (Kb) was calculated using the equation by Diaz et al. (1996). Biodegrad-
ability coefficient indicates the organic matter (OM) contents: OM% = (100 −
Ash content%). Biodegradability coefficient (Kb) was calculated using the following
equation (Diaz et al. 1996):
(O Mi − O M f )
Kb = × 100 (12.1)
O Mi(100 − O M f )
140 N. Ahmad et al.
where
OMf the organic matter content at the end of the process
OMi the organic matter content at the beginning of the process.
After 40 days, the worms in the aquarium were removed and weighed. Worm
reproductive rate was measured using the formula by Manyuchi and Phiri (2013) and
the data were analysed by using one-way ANOVA. The significant difference between
means was tested using the least significant difference (LSD). A Tukey’s t-test was
also performed to observe the changes occurring before and after vermicomposting.
12.3.1 PH and EC
The chemical characteristics such as pH and EC are presented in Table 12.1. Overall,
all parameters in each medium mixture showed significant difference (P < 0.05) as
an effect of treatments. The pH value in each medium mixture varied in different
types of animal dung, which indicates the difference in the degree of mineralization
in each medium mixture. Initially, the pH value recorded was higher in the SMS
without animal dung (T4) followed by a mixture of chicken dung (T3), goat dung
(T2) and cow dung (T1) of 7.95 7.82, 7.56 and 7.40, respectively. However, after
the vermicomposting process, the pH had significantly decreased (P < 0.05) in all
treatments, towards the neutral pH condition ranging from 7.34 to 6.82. The decrease
in pH might occur due to the production of carbon dioxide, ammonium, nitrate and
other intermediate organic acids during the waste decomposition process (Singh and
Suthar 2012). This result is comparable to Eklind and Kirchmann (2000) in which
they found out that the pH of compost had decreased due to the H + -release during
nitrification. Ndegwa et al. (2000) stated that changing in pH might be directly related
to the reduction of volatile solids and the growth of earthworm biomass. It might
also occur due to the bioconversion of the organic materials into various intermediate
types of organic acids.
The electrical conductivity (EC) is related to the degree of salinity of the com-
posting products. A higher EC indicates greater total soluble salts (such as sodium)
in the compost and may possibly give phytotoxic/phytoinhibitory effects (e.g. low
germination rate, withering) on the growth of plants (Lin 2008). Excessive salin-
ity can prevent roots from absorbing water efficiently due to the higher osmotic
pressure around the roots. Different source of treatments produced different EC in
the vermicompost medium in each treatment before vermicomposting. The medium
mixture that consists of chicken dung showed greater EC (3.30 dS m−1 ) followed by
goat dung (2.52 dS m−1 ) cow dung (2.09 dS m−1 ) and mushroom medium residue
(1.29 dS m−1 ). The greater EC in the chicken dung medium was caused by the
presence of a large number of mineral salts such as phosphate and ammonium ions
Table 12.1 The chemical characteristics of the initial and final stage vermicompost mixture from different treatments
Treatments T1: Cow dung T2: Goat dung T3: Chicken dung T4: Without animal dung
Initial Final t-test Initial Final t-test Initial Final t-test Initial Final t-test
pH 7.40 7.07 a 7.56 6.82 a 7.82 7.23 a 7.95 7.34 a
EC 2.09 0.75 a 2.52 0.82 a 3.30 0.41 a 1.29 0.74 a
Note a show significantly different at the 5% significance level

12 The Effect of Different Animal Dung in Vermicompost Production …
141
142 N. Ahmad et al.
(Gómez-Brandón et al. 2008). As the vermicomposting progressed, the EC of all ver-

micomposting medium mixtures decreased up to 88% in SMS with chicken dung,
68% in SMS with goat dung, 64% in SMS with cow dung and 32% in SMS without
any animal dung. After vermicomposting, the EC in all treatments recorded less than
1 dS m−1 showing that all medium had reached up to low-saline condition level. The
lower EC showed that this vermicompost is safe to be used or applied directly to the
plant.
12.3.2 Biodegradability Coefficient
Biodegradability is the capability of a material to be composed by bacteria or other

living organisms. In this study, the biodegradability coefficient (Kb) was calculated
to measure the organic matter conversion during composting. This variable has also
been observed by Singh and Suthar (2012) in herbal pharmaceutical industrial waste.
The biodegradability coefficient was calculated for different treatments ranging from
0.13 to 0.82 (Fig. 12.1). Each treatment recorded a significant difference (P < 0.05)
in biodegradability coefficient except (T1) SMS in cow dung and (T2) SMS in goat
dung. The higher biodegradability coefficient was recorded in (T4) SMS mixture
without animal dung (0.82), followed by (T1) SMS in cow dung (0.37), (T2) SMS
in goat dung (0.36) and (T3) SMS in chicken dung (0.13).
The biodegradability coefficient in different treatments showed that the addition of
animal dung in SMS mixture will reduce the organic matter conversion by E. eugeniae
worms as compared to without using any animal dung. This clearly indicates that
the addition of animal dung does not significantly lead to higher biodegradability
Fig. 12.1 Biodegradability 1.00

coefficient of
Vermicompost biodgradibility coefficient
vermicomposting medium 0.90 c

using Eudrilus eugeniae 0.80
worms
0.70
0.60
b
value
0.50 b
0.40
0.30 a
0.20
0.10
0.00
T1 T2 T3 T4
Treatment
compared to SMS without animal dung. These results are supported by previous
studies which also found out that the addition of parthenium with cow dung did not
significantly affect the biodegradability of organic matter (Yadav and Garg 2011).
Greater biodegradability coefficient in SMS without animal dung showed that this
medium mixture is able to decompose faster by E. eugeniae worms and thus, this
mixture has the potential to be used as the main medium mixture in vermicompost
production. Lower biodegradability coefficient in the mixture of SMS with chicken
dung showed that longer time was needed by E. eugeniae worms to convert the
medium mixture and thus chicken dung might not be suitable to be used as a medium
mixture for vermicompost production using E. eugeniae worms. According to Singh
et al. (2011), earthworms modify physico-chemical and biological status of medium,
gradually reduce its C:N ratio, increase the surface area exposed to microorganisms
and make them more favourable for microbial activity and its further degradation.
12.3.3 Worm Population and Reproductive Rate
After 40 days of vermicomposting, the number of E. eugeniae worms and the total
number of cocoons produced had significantly (P < 0.05) increased in all medium
mixtures except for SMS in chicken dung mixture (Table 12.2). This condition indi-
cates that chicken dung is not suitable to be added into SMS in vermicomposting
mixture for worm reproduction. The number of worms had greatly increased in (T4)
SMS mixture without animal dung, followed by (T1) mixture with cow dung and (T2)
mixture with goat dung. The number of worms had increased reaching in between
141.0, 153.35 and 178.75 of worms from initially 10 worms each in the mixture of
goat dung, cow dung and the mixture without animal dung, respectively. The total
number of cocoons was also found to increase in parallel with the increasing num-
ber of worms. This result correlates with a study by Viljoen and Reinecke (1989)
that found E. eugeniae worms were able to produce an average of 1.3 cocoons per
worm per day with 84% of cocoon hatched. Each cocoon was able to hatch about
2.7 worms per cocoon as compared to P. excavatus (blue worm) that hatched 1.1
Table 12.2 The initial and final number of E. eugeniae worms in each vermicomposting medium
after 35 days of vermicomposting
Parameters T1 T2 T3 T4
Initial number 10.00 10 10 10
Final number 153.35 153.75 10 178.75
Total cocoons 148.5 141.00 0.00 169.75
t-test a a ns a
Note T1: Cow dung; T2: Goat dung; T3: Chicken dung; T4: Mushroom medium residue
a Show significantly different at the 5% significance level before and after vermicomposting
ns Show not significantly different at the 5% significance level before and after vermicomposting
144 N. Ahmad et al.
worms per cocoon and E. fetida (tiger worm) that hatched 3.5 worms per cocoon
(Graff 1982). Singh et al. (2011) stated that the population of earthworm is also
influenced by the soil physical condition as it seems to increase the earthworm popu-
lation until the food becomes a limiting factor. Yadav and Garg (2011) also mentioned
that the growth of the earthworm E. fetida is related to population density and food
rationing. The result of the present study indicates that (T4) SMS mixture without
any animal dung is the most favourable condition for the growth of African night
crawler earthworm (E. eugeniae).
12.4 Conclusion
The study indicates that mushroom medium residue (SMS) is one of the potential
agricultural waste materials that can be used as a medium in vermicomposting. The
result also showed that chicken dung was not a suitable medium to be used as part
of mixture in vermicomposting medium since it prevented the reproduction of E.
eugeniae worms. However, animal dung such as cow dung and goat dung can be
mixed together with SMS since the reproduction of worms and number of cocoons
were found greater in both medium mixtures. Further study also needs to be taken
to evaluate the major nutrient in each vermicompost mixture as organic fertilizer.
References
Diaz LF, Savage GM, Eggerth LL, Golueke CG (1996) Solid waste management for economically
developing countries. ISWA, Vienna
Eklind Y, Kirchmann H (2000) Composting and storage of organic household waste with different
litter amendments. II: nitrogen turnover and losses. Bioresour Technol 74(2):125–133
Gómez-Brandón M, Lazcano C, Domínguez J (2008) The evaluation of stability and maturity during
the composting of cattle manure. Chemosphere 70(3):436–444
Garg VK, Chand S, Chhillar A, Yadav A (2005) Growth and reproduction of Eisenia foetida in
various animal wastes during vermicomposting. Appl Ecol Environ Res 3(2):51–59. https://doi.
org/10.15666/aeer/0302_051059
Graff O (1982) Vergleich der Regenwurmarten Eisenia foetida und Eudrilus eugeniae hinsichtlich
ihrer Eignung zur Proteingewinnung aus Abfallstoffen. Pedobiologia
Garg P, Gupta A, Satya S (2006) Vermicomposting of different types of waste using Eisenia foetida:
a comparative study. Biores Technol 97(3):391–395
Li Q, Deng M, Coombes AJ (2017) Evaluation of spent mushroom compost as a container medium
for production of seedlings of two oak species. Nat Environ Pollut Technol 16(2):529–534
Lim SL, Wu TY (2016) Characterization of matured vermicompost derived from valorization of
palm oil mill byproduct. J Agric Food Chem 64(8):1761–1769
Lin C (2008) A negative-pressure aeration system for composting food wastes. Biores Technol
99(16):7651–7656
Manyuchi MM, Phiri A, Muredzi P, Chitambwe T (2013) Comparison of vermicompost and
vermiwash bio-fertilizers from vermicomposting waste corn pulp
Ministry of Agriculture (MOA) (2012) Dasar Agromakanan Negara (DAN). Jabatan Penerbitan,
Malaysia
MOA (2010) Dasar Agromakanan Negara 2011–2020. Kementerian Pertanian Malaysia dan Industri
Asas Tani, Malaysia
Nath G, Singh K, Singh DK (2009) Chemical analysis of vermicomposts/vermiwash of different
combinations of animal, agro and kitchen wastes. Aust J Basic Appl Sci 3(4):3672–3676
Ndegwa PM, Thompson SA, Das KC (2000) Effects of stocking density and feeding rate on
vermicomposting of biosolids. Biores Technol 71(1):5–12
Rasib NAA, Zakaria Z, Tompang MF, Rahman RA, Othman H (2015) Characterization of biochem-
ical composition for different types of spent mushroom substrate in Malaysia. Malays J Anal Sci
19(1):41–45
Sabrina DT, Hanafi MM, Mahmud TMM, Azwady AN (2009) Vermicomposting of oil palm empty
fruit bunch and its potential in supplying of nutrients for crop growth. Compos Sci Util 17(1):61–
67
Sharma K, Garg VK (2018) Comparative analysis of vermicompost quality produced from rice
straw and paper waste employing earthworm Eisenia fetida (Sav.). Biores Technol 250:708–715
Singh D, Suthar S (2012) Vermicomposting of herbal pharmaceutical industry waste: earthworm
growth, plant-available nutrient and microbial quality of end materials. Biores Technol 112:179–
185
Singh RP, Embrandiri A, Ibrahim MH, Esa N (2011) Management of biomass residues generated
from palm oil mill: vermicomposting a sustainable option. Resour Conserv Recycl 55(4):423–434
Viljoen SA, Reinecke AJ (1989) Life-cycle of the African nightcrawler, Eudrilus eugeniae
(Oligochaeta). Afr Zool 24(1):27–32
Williams BC, McMullan JT, McCahey S (2001) An initial assessment of spent mushroom compost
as a potential energy feedstock. Biores Technol 79:227–230
Yadav A, Garg VK (2011) Vermicomposting–an effective tool for the management of invasive weed
Parthenium hysterophorus. Biores Technol 102(10):5891–5895
Chapter 13
Biofilm Developed from Acrylated
Epoxidized Soybean Oil: Preparation
and Characterization
Sharifah Nafisah Syed Ismail, Farah Izati Ibrahim, Khuzaimah Nazir,

Noor Aishatun Majid, Nor Mazlina Abdul Wahab,
Marina Mohd Shahabudin and Mithalina Zulaikha Ismail
Abstract The demand for bio-based coating has increased greatly in order to solve
the environmental issues. Thus, this research aims to synthesize AESO through acry-
lation process by introducing acrylic acid, which is an unsaturated monomer, into
oxirane groups of ESO. Then, AESO reacted with trimethylolpropane triacrylate as
a monomer and 3-(triethoxysilyl)-propylamine as the curing agent to produce AESO
film with varying formulation of TMPTA:amine in the ratio 70:30, 50:50 and 30:70,
respectively. The viscosity, FTIR, VOC and pencil hardness tests were conducted.
The viscosity of AESO was found within the desirable range and was higher com-
pared to ESO. Based on the successfulness of esterification process, FTIR revealed
the appearance of hydroxyl group in AESO structure at peak 3618 cm−1 . In addition,
AESO film with sample ratio 30:70 showed the appearance of hydroxyl group at
peak 3459.6 cm−1 . Moreover, the result revealed that AESO has lower VOC than
AESO film which was 4%. AESO film with ratio 30:70 agent had high scratching
resistance with pencil grade 2H and indicated that the film had better properties than
S. N. Syed Ismail (B) · F. I. Ibrahim · K. Nazir · N. A. Majid · N. M. Abdul Wahab ·

M. Mohd Shahabudin · M. Z. Ismail
Faculty of Applied Sciences, Universiti Teknologi MARA (UiTM) Perlis Branch, 02600 Arau,
Perlis, Malaysia
e-mail: sh.nafisah22@gmail.com
F. I. Ibrahim
e-mail: izati.ibrahim13@gmail.com
K. Nazir
e-mail: khuzaimahnazir@uitm.edu.my
N. A. Majid
e-mail: mareen.deen@gmail.com
N. M. Abdul Wahab
e-mail: mithalinazulaikha@gmail.com
M. Mohd Shahabudin
e-mail: normazlina@uitm.edu.my
M. Z. Ismail
e-mail: aishatun@uitm.edu.my

148 S. N. Syed Ismail et al.
the others. Overall, AESO is suitable to replace petroleum-based film, and it has to
be used as biofilm.
Keywords Biofilm · Bio-based coating · Vegetable oil · Acrylated epoxidized

soybean oil · Epoxidized oil · Volatile organic content
13.1 Introduction
In recent years, using vegetable oils as renewable resources has become a growing
trend especially in chemical productions. The growing interest is to produce biopoly-
mers. Recently, more environmental-friendly manufacturing procedures have been
introduced for polyurethane production using bio-renewable sources. Production
of epoxy resin-based vegetable oil friendly is rather environment-friendly and has
become as promising raw materials for manufacturing of bio-based film because of its
biodegradability, recyclability, good processability and high transparency (Raj et al.
2012). In spite of its numerous advantages, there are several drawbacks that epoxy
resin-based vegetable oil faces. One of the problems with epoxy resin is the low pro-
duction of polymer crosslinking and tends to produce low thermal and mechanical
properties, which makes the usage of epoxidized soybean oil (ESO) loss attractive
(Espana et al. 2012).
To eliminate this problem, acrylated epoxidized soybean oil (AESO) has been
identified to produce thin biofilm from the reaction of ESO with acrylic acid via
acrylation process. AESO has the ability to be crosslinked with active functional
group to produce AESO thin film that is less expensive and have good mechani-
cal strength. Moreover, high demand for biodegradable film nowadays has created
many researches to look into potential resources to be used to eliminate or reduce the
dependent on petroleum-based products. Epoxy resins from petroleum oil are pro-
duced by the reaction of bisphenol-A and epichlorohydrin (EPC) that harms human
and environment. The chemical also acts as endocrine disruptor which can disrupt
the physiological function that can have a negative biological effect on humans (Chu
et al. 2014). A development on AESO has been done by previous researchers to
reduce the moisture sensitivity and enhance gas permeability of starch-based film
(Xiaoyan et al. 2019). In this work, ESO was reacted with acrylic acid that acts as
ring-opening reagent in order to produce AESO thin film by using thermal technique.
13.2.1 Materials
Epoxidized soybean oil (ESO) with 6 OOC value was supplied by Green Energy
Products. Acrylic acid was used as the base material and it was supplied by E. Merck.
13 Biofilm Developed from Acrylated Epoxidized Soybean Oil … 149
Table 13.1 Formulation of

Sample Ratio mixture of TMPTA:TESPA
mixture in sample 1, sample 2
and sample 3 1 70:30
2 50:50
3 30:70
Triethylamine as catalyst and hydroquinone as inhibitor were supplied by Sigma-

Aldrich. 3-(Triethoxysilyl)-propylamine (TESPA) and trimethylolpropane triacry-
late (TMPTA) as monomer and curing agent, respectively, were also supplied by
Sigma-Aldrich.
13.2.2 Preparation of Acrylated Epoxidized Soybean Oil

(AESO)
Acrylated epoxidized soybean oil (AESO) was synthesized by mixing 150 g of

epoxidized soybean oil with 118 g acrylic acid in the presence of triethylamine as
catalyst and 2 g of hydroquinone as an inhibitor. Then, the acrylation process was
conducted in an oil bath at temperature 80 °C for 5 h in the reaction vessel equipped
with Liebig condenser using mechanical stirrer at 400 rpm.
13.2.3 Preparation of AESO Films
AESO thin film was prepared by the addition of AESO with 3-(triethoxysilyi)-
propylamine (TESPA) and trimethylolpropane triacrylate (TMPTA). Prior to sample
curing, glass slides were used as substrate. The solution was stirred at room temper-
ature until homogenous. The prepared resin was dropped onto glass slides until all
substrate surfaces were covered with the resin. The solution was cured in an oven
at 150 °C for 24 h to produce cured thin film. The formulation for each resin sample
was shown in Table 13.1.
13.2.4 Viscosity Test
The viscosity test for AESO was carried out by using Brookfield digital viscometer
with a spindle number 3 and small sample adapter. The standard method for this test
was referred to ASTM D2196.
13.2.5 Fourier Transform Infrared Spectroscopy (FTIR) Test
In this study, the structural properties of ESO and AESO were characterized using
Perkin Elmer Fourier transform infrared spectroscopy (FTIR). The standard method
followed ASTM D7588.
13.2.6 Volatile Organic Compound (VOC) Test
Volatile organic compound (VOC) test was carried out in accordance to ASTM
D2369 standard on the AESO film coatings. It was used to measure volatile matters
which was not fully consumed in the film coating and might harm the atmosphere
when it was exposed under tropical environment. The volatile content was removed
by heating process and left with only non-volatile content in the film. The weight
percent of volatile content of the sample was determined by heating at 120 °C in the
oven for 2 h with 5 g of fatty acid. Then, the sample from oven was placed in the
desiccator and was let to be cooled. Desiccator was used to avoid the sample which
absorbed the surrounding moisture. After cooling was done, the heated sample (m1 )
was weighed. The percentage of solid content stayed in the sample after the heating
process was calculated by using the formula as shown in Eq. (13.1):
V OC, % = (m 2 − m 1 )/m 2 × 100 (13.1)
13.2.7 Pencil Hardness Test
Pencil hardness test has been used to determine the scratch hardness of particular
coated film. According to ASTM D3363, the pencil hardness has been tested from
the softest lead, which is 6B, to hardest, which is 9H.
13.3.1 Viscosity Test
The effect of grafting of acid value on ESO and on the viscosity is shown in Table 13.2.
The viscosity of AESO showed higher value than ESO which was 835.96 cP com-
pared to 329.62 cP. The increase in viscosity might be due to increase of molecular
weight caused by the formation of acrylate group during reaction (Lu et al. 2005).
Table 13.2 Viscometer reading (cP) every one minute

Time (min)/Sample 1 2 3 4 5 Average
Epoxidized soybean oil (ESO) 338.3 331.1 331.1 323.7 323.9 329.62
Acrylated epoxidized soybean oil 839.8 839.8 837.4 832.6 830.2 835.96
(AESO)
13.3.2 FTIR Analysis
Based on FTIR spectra result in Fig. 13.1 of ESO, the O–H group is found at peak
3321.6 cm−1 , while peak at 2925.64 cm−1 belongs to the stretching of CH2 group
and the peak at 1740.8 cm−1 corresponds to the C=O stretching. The most important
peak that could be observed in the FTIR result is at 836.36 cm−1 which belongs to
epoxy ring. Then, for the FTIR spectra result of AESO, there was a shifted peak at
3618 cm−1 which confirms that there is an opening of epoxy ring that allowed the
formation of OH functional group on the sample. CH2 peak appears at 2927.42 cm−1
and C–H peak appears at 2848 cm−1 . It could be seen that peak 1653.2 cm−1 is an
ester C=O functional group while peak at 1547.77 cm−1 is C=C functional group.
The acrylic reacted and is attached at the opening of epoxy ring, which resulted in
vinyl peak at 983.26 cm−1 and it forms more broadened ester group at 1653 cm−1 .
Then, there is C–O functional group at peak 1056.88 cm−1 . However, there is peak
of epoxy group at 816.72 cm−1 which indicates those functional epoxy groups have
not being converted into acrylate (Wang et al. 2008).
ESO
AESO
Fig. 13.1 FTIR spectra for ESO and AESO

70:30
70:30
50:50
30:70
Fig. 13.2 FTIR spectra for different ratio of TMPTA and TESPA
For cured thin film, the FTIR results based on different ratio of TMPTA to TESPA
applied are shown in Fig. 13.2. TMPTA acts as monomer source while proplyamine
acts as curing agent. Good coating properties are shown at ratio 30:70 and the solution
has good adhesion toward plywood.
Owing to the addition of TMPTA, wavenumber of the functional group presented
in the resin shifted to the higher wavenumber. For example, in AESO, the C=O bond
at 1653 cm−1 is shifted earlier into 1728–1731 cm−1 , as shown in Table 13.3. The
shift in wavenumber of functional group present in AESO-TMPTA film coatings
shows that there is an interaction between AESO and TMPTA as more carbonyl
functionality from copolymer is added into the mixture (Syed et al. 2013). Sample
with ratio 30:70 shows better properties since the presence of hydrogen bonding at
3459 cm−1 . This result is in agreement with the study by Xu et al. (2017).
Table 13.3 Functional group exists in the different formulation of film coating
Ratio of TESPA:TMPTA O–H C–H C=O C=C C=C–H
Alkene (vinyl)
70:30 – 2925 1728 – –
50:50 – 2922 1736 – 3140
30:70 3459.6 2925 1731 1400 –
3
2.54
2.5
Percentage (%) 1.94
2
1.5
0.5 0.33
0
70/30 50/50 30/70
Ratio of TMPTA:TESPA
Fig. 13.3 Graph of VOC’s percentage for AESO and AESO-TT/TR film coatings
13.3.3 Determination of Volatile Organic Content (VOC)

for Film Coatings
Based on the VOC result in Fig. 13.3, it is revealed that all the formulations do
not give adverse effects on human health as each coating’s value is less than 3% of
VOC’s regular hazard limit and this result can be supported by Mohd et al. (2013).
Low value of VOC shows that coating is less toxic and it gives no harm to the
environment. Therefore, MSO resins have high solid content and can be classified
as environmentally friendly.
13.3.4 Pencil Hardness
Pencil hardness testing was conducted to determine the scratch hardness of AESO
film coating that was applied to the surfaces of object in order to give protection,
provide safety and avoid from corrosion of surface occurred. The AESO films were
tested by holding the pencil at 45° angle to the film surface. The edge of blunted lead
was pressed on the film and scratched with very low forces. The testing was started by
using the hardest grade to the softest grade of pencils. Table 13.4 shows the result of
Table 13.4 Results of pencil

Sample Pencil hardness
hardness test for AESO film
70:30 5B
50:50 2B
30:70 2H
scratches on the sample films. Based on the result shown in Table 13.4, it was found
that the hardness of the pencil increases with the increase of TMPTA. The grade of
pencil for AESO sample with ratio 30:70 is 2H, where it has the highest hardness.
Moreover, ratio at 50:50 is 2B and it is harder than the first sample. Then, the AESO
film sample with ratio of 70:30 is 5B and the hardness is the lowest between other
samples. This indicates that the film resulted in the lowest scratch resistance among
others. The inconsistency in hardness of 50:50 and 70:30 films are caused by low van
der Waal’s forces, which led to low adhesion between coating samples and plywood
substrate (Shailesh et al. 2008).
13.4 Conclusion
In conclusion, AESO was successfully synthesized from ESO with acrylic acid to
produce film. The chemical characterization revealed the presence of hydroxyl and
ester group, which indicated that the esterification process has occurred. Biofilm with
ratio 30:70 showed good properties in terms of VOC and hardness value, and it can
compete with petroleum-based film.
References
Chu XM, Shaojie L, Zhao FQ (2014) Preparation of acrylated epoxidized soybean oil with excellent
properties. Appl Mech Mater 662:7–10
Espana JM, Sanchez NL, Boronat T, Fombuena V, Balart R (2012) Properties of bio-based epoxy
resins from epoxidized soybean oil (ESBO) cured with maleic anhydride (MA). J Am Oil
Chemists’ Soc 89(11):2067–2075
Lu J, Khot S, Richard PW (2005) New sheet molding compound resins from soybean oil. I. Synthesis
and characterization. Polymer 46:71–80
Mohd AF, Yhaya F, Basri NS, Kamarun D, Othman MR, Zakaria A, Hambali RA (2013) Thermal
and physical properties; and surface morphology of waterborne maleinized epoxidized soybran
oil films for coatings application. Mater Sci Eng 812:46–52
Raj MA, Wuzella G, Aust N, Kandelbauer A, Muller U (2012) Photocrosslinkable modified
vegetable oil-based resin for wood surface coating application. Prog Org Coat 74(4):697–704
Shailesh KD, Sinha TJM, Dutta P, Khanna AS (2008) Formulation and performance study of low
molecular weight, alkyd-based waterborne anticorrosive coating on mild steel. Prog Org Coat
62(2):183–192
Syed ISN, Mohd AF, Mohamed R, Yhaya F, Fauzi R, Kamarun D (2013) Epoxidation of palm oil
catalyzed by titanium-grafted silica catalyst. Adv Mater Res 812:30–37
Wang H, Rong M, Zhang M, Hu J, Chen H, Czigany T (2008) Biodegradable foam plastics based
on castor oil. Biomacromol 9(2):615–623
Xiaoyan G, Long Y, Zengshe L, Hongsheng L, Ying C, Ling C (2019) Developing acrylated epox-
idized soybean oil coating for improving moisture sensitivity and permeability of starch-based
film. Biol Macromol 125:370–375
Xu X, Chen L, Guo J, Cao X, Wang S (2017) Synthesis and characteristics of tung oil-based
acrylated-alkyd resin modified by isobornyl acrylate. R Soc Chem 7:30439–30445
Chapter 14
Anti-microbial Properties and Toxicity
Test of Stingless Bee Honey (Trigona
itama), Ajwa Date (Phoenix dactylifera
L.) Seeds and Their Combinations
Nurul Syazwina Roslan, Nur Syafiqah Rahim, Zainab Razali

and Mohd Azhar Zulkifli
Abstract Most of bacterial cause infect have mutated into multidrug-resistance

bacteria where current treatment or drugs are becoming less effective against them.
It is an urge to seek the alternative remedies in solving the drug-resistance bacterial
issues. Therefore, this study focused on identifying the anti-bacterial properties of
stingless bee honey, Ajwa date seeds extract alone and their combinations through
disc diffusion assay against Staphylococcus aureus and Staphylococcus epidermidis.
The toxicity of both samples was identified using brine shrimp lethality assay. From
the result, the sample of stingless bee honey alone showed the best inhibition against
S. epidermidis with diameter of 10.17 ± 0.29 mm, and Ajwa date seeds exhibit the
best inhibition with diameter of 9.67 ± 0.58 mm against S. aureus at concentration
of 100 µg/ml. However, 1:2 combinations (stingless bee honey:Ajwa date seeds)
showed the highest zone of inhibition compared to alone with diameter of 15.33 ±
0.58 mm and 14.33 ± 0.58 mm against S. aureus and S. epidermidis, respectively.
The toxicity of stingless bee honey and Ajwa date seeds was determined to be toxic
with LC50 values of 254.474 and 391.918 µg/ml, respectively, which indicates that
the presence of bioactive compounds in both samples helps to inhibit the bacterial
growth. For combination, all ratios exhibited the same percent of mortality with a
value of 40%. As conclusion, this study proved that the combination of stingless bee
honey and Ajwa date seeds exhibits anti-microbial properties that can act against drug
resistance bacteria related to skin. Both samples are proven to have high potential of
becoming new sources to combat skin infections bacteria agent.
Keywords Stingless bee honey · Ajwa date seeds · Combinations · Anti-microbial

test · Toxicity test
N. S. Roslan · N. S. Rahim (B) · Z. Razali · M. A. Zulkifli

Universiti Teknologi Mara Perlis, Kampus Arau, 02600 Arau, Perlis, Malaysia
e-mail: syafiqahrahim@perlis.uitm.edu.my
N. S. Roslan
e-mail: nurulawina@gmail.com
Z. Razali
e-mail: zainab215@uitm.edu.my

156 N. S. Roslan et al.
14.1 Introduction
Over the ensuing millennia, a vast amount of organic substances have been used in
many kinds of drugs, especially for medicinal use. Natural substances attained from
plants, animal and microorganism have already proven their potential in medici-
nal use, and these probably have been recorded for thousands of years in human
history (Kusari et al. 2012). Natural products give significant clues in recognizing
and evolving synergistic drugs that researchers have largely abandoned for so long
(Kusari et al. 2012). Honey and date seeds are the examples of natural substances
that are widely known for their functions in treating many types of diseases internally
and externally.
Stingless bee honey, Trigona itama, is said to be the most commonly available and
utilized stingless bee honey in Malaysia (Ismail 2018). This valuable bee product has
traditionally been consumed directly and used in numerous medical practices. The
most significant contributor to the therapeutic properties of honey is phenolic acids
such as benzoic, cinnamic and flavonoids. The phytochemical components in honey
that contribute to the anti-bacterial effects are flavonoids, phenolic substances, anti-
bacterial peptides and also the presence of hydrogen peroxide which enhanced the
production of cytokines for the inflammatory response to kill the bacteria (Mandal
and Mandal 2011).
Phoenix dactylifera L., commonly known as Ajwa date palm, is a flowering plants
species in the palm family of Arecaceae. There are many medicinal properties that
can be produced from the date palm fruit, seeds or pits which can be used in treating
diseases (Basuni and Al-Marzooq 2010). These findings demonstrate that the date
fruits, date seeds and palm shell can be considered as a good source of natural
antioxidants, as well as their contributions toward the anti-microbial effects (Afiq
et al. 2013). Studies have proved that palmitic, stearic, oleic, linoleic and linolenic
acids have antibacterial activities. Lauric acid has been proved to have the presence
of bactericidal properties and can be used as a natural treatment against gram-positive
bacteria, Propionibacterium acnes. As stated from the previous report, the phenolic
compounds from date seeds are considered to act as antioxidants, anti-carcinogenic,
anti-microbial, anti-mutagenic, anti-inflammatory agents and they can also reduce
the risk of cardiovascular disease (Bentrad et al. 2017).
The present study was conducted to elucidate the action of anti-microbial prop-
erties in the combination of both natural sources against skin infectious bacteria;
besides, both samples are always sustainable to be obtained.
14 Anti-microbial Properties and Toxicity Test … 157
14.2 Method
14.2.1 Extraction of Ajwa Date Seeds, Phoenix dactylifera L.
Ajwa date seeds (Phoenix dactylifera L.) were bought from the dates store and the
seeds were collected. The date seeds were cleaned by tap water right after removing
the flesh. The seeds were dried at 50 °C for at least three days and were grinded finely
until it turns into powder. 12 g of powder were soaked into 0.96 l of 80% methanol
and then was shaken using the incubator shaker for about 1 h. The extracts were
filtered using Whatmann filter paper number 4 and were placed in rotary evaporator
at 50 °C to remove the solvent. The balance water content from the extract was
removed through lyophilization process or freeze-dry. The extraction method was
referred to Al-Farsi and Lee (2011) with slight modification.
14.2.2 Anti-bacterial Activity Evaluation
Preparation of Bacteria. S. aureus and S. epidermidis were obtained from Micro-

biology Laboratory 5 in UiTM Perlis branch, Arau. A loopful of bacterial broth was
streaked onto the nutrient agar medium and was incubated overnight at 37 °C. Sin-
gle colony was then taken for further preparation of inoculums to 0.5 McFarland
standards.
The concentration of the bacteria was adjusted through serial dilution. A single
colony of bacteria sample was inoculated into a container of sterile nutrient broth.
The container was then loosely capped and was incubated overnight at 37 °C. The
concentration of the bacteria was adjusted to 5 × 106 colony forming unit per milliliter
(CFU/ml) which corresponds to value of absorbance of 0.8–1.0. The value of 0.5
McFarland standards ranging from 0.8 to 1.0 was measured using spectrophotometer
at 625 nm.
Disc Diffusion Assay. Broth culture S. aureus and S. epidermidis were prepared
under log phase to get the standard inoculum concentration of 5 × 106 CFU/ml. The
Mueller Hinton Broth agar plates that were prepared were inoculated with 100 µl of
broth culture of S. aureus and S. epidermidis from the standard inoculum. The broth
was spread with sterile glass rod onto the agar plates. Sterile discs with 6 mm in
diameter were impregnated with five different concentrations of date seeds extracts
and pure honey in five different concentrations (100, 10, 1, 0.1 and 0.01 µg/ml).
The agar then was incubated overnight at 37 °C. 10 mg of gentamycin was used as
positive control and ethanol was used as the negative control. The zones of inhibition
of the plates were measured and followed with the calculation of mean zones of
inhibition (mm).
14.2.3 Cytotoxicity Test
Brine Shrimp Lethality Assay. A quantity of 1000 mg of A. salina cysts were

hatched in 15 ppm of sea water at room temperature. 9 ml of seawater of 15 ppm
was added to the dish and ten samples of hatched A. saline nauplii were transferred
to each of the specimen dish using Pasteur pipette. The samples of Ajwa date seeds
extract and stingless bee honey were diluted to get the final concentration of 100, 10,
1, 0.1 and 0.01 µg/ml. The combinations of stingless bee honey and Ajwa date seeds
were also prepared according to ratio 1:1, 2:1 and 1:2 and further diluted into 100, 10,
1, 0.1 and 0.01 µg/ml. Next, 1 ml of each of the samples was added to each container
dish containing 9 ml of 15 ppm seawater and ten brine shrimps. The mixture was let
to incubate at room temperature. Finally, the number of brine shrimps that remain
alive and dead was counted manually and the value of LC50 and the toxicity class of
each sample were determined after 24 h incubation. The LC50 value was compared
with Meyer’s toxicity index.
The anti-bacterial result on zone of inhibition of stingless bee honey (T. itama) and
Ajwa date (Phoenix dactylifera L.) for mean ± SD was compared using descriptive
statistics. The statistical analysis was performed by using Statistical Package for
Social Science (SPSS 2.0). Comparison of honey and date seeds extracts for their
mean of inhibitions was analyzed using one-way analysis of variance (ANOVA).
Mean inhibitions of the different honey solutions and Ajwa date seeds are considered
significantly different for P value <0.05 (Ewnetu et al. 2013).
14.3.1 Anti-bacterial Activity
Disc diffusion assay of samples was conducted against S. aureus and S. epidermidis
for dermal skin infectious bacteria.
Disc Diffusion Assay toward S. aureus and S. epidermidis. The susceptibility
of the stingless bee honey, Ajwa date seeds and both combinations against S. aureus
and S. epidermidis using disc diffusion method under five different concentrations
are 100, 10, 1, 0.1 and 0.01 µg/ml.
As only few studies were done toward the comparison of the anti-bacterial effect of
stingless bee honey and Ajwa date seeds against S. aureus and S. epidermidis, thus this
study was further done by comparing the susceptibility of both anti-bacterial agents
against both bacteria. By referring to Table 14.1, stingless bee honey showed greater
Table 14.1 Comparison between zone of inhibition of stingless bee honey and Ajwa date seeds
alone against S. aureus and S. epidermidis
Samples Concentration Zone of inhibition (mm) Zone of inhibition (mm)
(µg/ml) against S. aureus against S. epidermidis
Stingless bee 0.01 6.83 ± 0.29 7.17 ± 0.29
honey 0.1 7.25 ± 0.25 7.83 ± 0.29
1 7.25 ± 0.25 8.33 ± 0.58
10 7.83 ± 0.76 9.67 ± 0.29
100 8.00 ± 0.00 10.17 ± 0.29
Ajwa date 0.01 7.25 ± 0.43 7.17 ± 0.29
seeds 0.1 7.67 ± 0.29 7.58 ± 0.14
1 8.08 ± 0.14 8.17 ± 0.29
10 8.75 ± 0.43 8.42 ± 0.14
100 9.67 ± 0.58 9.17 ± 0.29
Streptomycin 10 25.33 ± 0.58 23.33 ± 0.58
(positive
control)
Ethanol 10 0.00 ± 0.00 0.00 ± 0.00
(negative
control)
zone of inhibitions against S. epidermidis compared to S. aureus, respectively, in all

concentrations. S. epidermidis is generally less invasive than S. aureus and this might
be one of the factors that lead the anti-bacterial properties of honey to act against the
wall of the bacteria by inhibiting the bacterial growth. This action commonly results
from the binding to the 16S subunit of the bacteria’s ribosomal RNA and disrupts
the protein-proofreading function of the bacteria (Jones et al. 2015).
However, Ajwa date seeds showed greater zone of inhibition against S. aureus
in all concentrations. This showed that the sample of Ajwa date seeds is more sus-
ceptible toward S. aureus compared to S. epidermidis. A study was done by Tayel
et al. (2018) on the bioactivity and applications of plant seeds’ extracts to fight
resistant strains of S. aureus using nine types of plant extracts, which are Alium
ampeloprasum, Allium cepa, Brassica juncea, Lycium shawii, Nigella sativa, Oci-
mum basilicum, Peganum harmala, Phyllanthus emblica and Portulaca oleracea.
The crude extracts of L. shawii and P. emblica seeds proved to be the most active
anti-microbials against S. aureus strains as both seeds proven to contain remark-
able amounts of active phytochemicals same as Ajwa date seeds which are alkaloids,
phenolic compounds, tannins and flavonoids. P. emblica seeds were exceedingly rich
sources of phenolic compound and flavonoids. The electron scanning micrographs
of S. aureus cells after exposure to the plant seeds’ extracts showed that bacterial
cells were shrunk, diminutive and dehydrated after 3 h and the entire cells were fully
lysed or disrupted after 6 h of exposure to P. emblica and L. shawii extracts.
Table 14.2 Zone of

Samples Concentration Zone of inhibition
inhibition between the
(µg/ml) (mm)
combinations of stingless bee
honey and Ajwa date seeds Combinations Ajwa date 13.33 ± 0.58
against S. aureus seeds:Stingless
bee honey (1:1)
Stingless bee 13.33 ± 0.58
honey:Ajwa date
seeds (2:1)
honey:Ajwa date
seeds (1:2)
Streptomycin 10 25.33 ± 0.58
(positive control)
Ethanol (negative 10 0.00 ± 0.00
control)
Streptomycin as positive controls are susceptible toward both bacteria; however,

greater zone of inhibition showed against S. aureus. As cited from Fair and Tor
(2014), virtually S. epidermidis are more susceptible to vancomycin and rifampin.
Penicillin G, semi-synthetic penicillinase-resistant penicillin and cephalosporins also
are believed to be more effective for the treatment of S. epidermidis infections instead
of streptomycin.
Since there were few studies done concerned on the combination effect of Ajwa
date seeds—Phoenix dactylifera L., and stingless bee honey—T. itama, thus this
study was conducted so as to further focus on the anti-microbial effect produced by
both combinations when compared to both samples alone. Based on Table 14.2, 1:1
ratio exhibits higher zone of inhibition compared to Ajwa date seeds and stingless
bee honey alone with zone of inhibition of 13.33 ± 0.58 mm. Meanwhile, 1 µg/ml
of stingless bee honey and 2 µg/ml of Ajwa date seeds (1:2) showed the highest
zone of inhibition with diameter of 15.33 ± 0.58 mm compared to 1:1 and 2:1 ratio
with zone of inhibition 13.33 ± 0.58 mm, respectively. As referred to bar graph in
Fig. 14.1, 100 µg/ml of Ajwa date seeds alone showed a better zone of inhibition
compared to stingless bee honey alone. However, 1:1 and 2:1 ratios showed the
same diameter of zone of inhibition which is 13.33 ± 0.58 mm. This showed that
combinations of stingless bee honey with Ajwa date seeds are not able to boost up
the anti-bacterial properties present in stingless bee honey. Two important enzymes
known to contribute to the major biological activities of honey are bee-origin glucose
oxidase and floral-origin catalase (Zainol et al. 2013). As referred to Zainol et al.
(2013), these enzymes are crucial in determining the level of peroxide activity in
honey which underlies numerous biological functions including the anti-bacterial
potency. A high amount of active glucose oxidase will hydrolyze glucose to produce
hydrogen peroxide (H2 O2 ) resulting in oxidative stress which is beneficial in con-
trolling bacterial colonization (Zainol et al. 2013). In contrast, a high catalase level
18
15.33
Zone of inhibition (mm)
16
13.33 13.33
14
12 9.67
10 8
8
6
4
2
0
Stingless bee Ajwa date Ajwa date Stingless bee Stingless bee
honey alone seeds alone seeds:Stingless honey:Ajwa honey:Ajwa
bee honey date seeds date seeds
(1:1) (2:1) (1:2)
Concentration of 100 μg/ml
Fig. 14.1 Bar graph of zone of inhibition between the combination of Ajwa date seeds and stingless
bee honey in ratio of 1:1, 2:1 and 1:2, 100 µg/ml of stingless bee honey and Ajwa date seeds alone
against S. aureus
together with high antioxidant capacity will destroy H2 O2 and serve as the princi-
ple guarding mechanism in order to conserve the nutritional value of honey (Zainol
et al. 2013). As to complement this statement, Ajwa date seeds are known with its
highly rich in phenolic content and antioxidant properties (Khalid et al. 2017); thus,
these properties are considered as one of the factors that might not boost up the
anti-bacterial properties in stingless bee honey. Meanwhile, Ajwa date seeds showed
an increment regarding the anti-bacterial effect toward S. aureus since the diameter
of zone of inhibition for 1:2 ratio increased into 15.33 ± 0.58 mm. This depicts that
the more sample of date seeds used will increase the anti-bacterial effects toward the
bacteria. Standard zone of inhibition of Streptomycin was shown in Table 14.3 as
reference to the susceptibility of the sample used, Ajwa date seeds and stingless bee
honey and also the Streptomycin used in this study.
For combinations, 1:1 ratio exhibits higher zone of inhibition compared to Ajwa
date seeds alone and stingless bee honey alone with diameter of 13.33 ± 0.58 mm.
Meanwhile, 2 µg/ml of stingless bee honey and 1 µg/ml of Ajwa date seeds (2:1)
showed the highest zone of inhibition with diameter of 14.33 ± 0.58 mm. As referred
to bar graph in Fig. 14.2, 100 µg/ml of stingless bee honey alone showed a better
zone of inhibition compared to stingless bee honey alone against S. epidermidis.
As for comparison with 1:1 ratio, both 2:1 and 1:2 ratios showed an increment in
zone of inhibition with diameter of 14.00 ± 0.00 mm and 14.33 ± 0.58 mm, respec-
tively. From here, it stated that more samples of Ajwa date seeds and stingless bee
honey used will exhibit higher anti-bacterial effect against S. epidermidis. However,
1:2 ratio of 1 µg/ml of Ajwa date seeds and 2 µg/ml of stingless bee honey showed
better inhibition compared to 2:1 ratio of 2 µg/ml of Ajwa date seeds and 1 µg/ml
of stingless bee honey. The effectiveness of Ajwa date seeds inhibited the growth of
Table 14.3 Zone of

Samples Concentration Zone of inhibition
inhibition between the
(µg/ml) (mm)
combinations of stingless bee
honey and Ajwa date seeds Combinations Ajwa date 13.33 ± 0.58
against S. epidermidis seeds:Stingless
bee honey (1:1)
honey:Ajwa date
seeds (2:1)
honey:Ajwa date
seeds (1:2)
Streptomycin 10 23.33 ± 0.58
(positive control)
Ethanol (negative 10 0.00 ± 0.00
control)
16 14 14.33
13.33
14
12 10.17
10 9.17
8
6
4
2
0
Stingless bee Ajwa date Ajwa date Stingless bee Stingless bee
honey alone seeds alone seeds:Stingless honey:Ajwa honey:Ajwa
bee honey date seeds date seeds
(1:1) (2:1) (1:2)
Concentration of 100 μg/ml
Fig. 14.2 Bar graph of zone of inhibition between the combination of Ajwa date seeds and stingless
bee honey in ratio of 1:1, 2:1 and 1:2, 100 µg/ml of stingless bee honey and Ajwa date seeds alone
against S. epidermidis
gram-positive and gram-negative bacteria and showed its excellent phytochemicals

profile which placed the Ajwa dates at top among other date varieties (Khalid et al.
2017). The presence of anti-microbial properties in date palm was most probably
due to the presence of antioxidant compounds, phenolic compounds, tannins, alka-
loids, flavonoids and steroids (Bhat and Al-Daihan 2012). All of these compounds
had been proven to be able to inhibit the growth of microorganisms and fight against
bacterial infections (Bhat and Al-Daihan 2012).
14.3.2 Brine Shrimp Lethality Assay
The present study was conducted in order to test for the in vivo brine shrimp lethal-
ity assay (BSLA) of the stingless bee honey and Ajwa date seeds extracts as well
as to correlate the cytotoxicity results with the presence of bioactive compounds
that could be accounted for their pharmacological effects with their known phar-
macological activities. This method was determined based on the ability to kill the
Atermia nauplii after being introduced to extracts within 24 h. LC50 value indicates
at which concentration the extracts can kill half of the nauplii populations. Based
on Meyer’s toxicity index, the crude extract is toxic (active) if the LC50 value is less
than 1000 µg/ml, and if the LC50 value is above 1000 µg/ml, then it is non-toxic
(inactive) (Hamidi et al. 2014). The LC50 value was calculated using the average
value of the sample (three times) and the data was performed using SPSS probit
regression. From the results of the data, the LC50 value was taken at 0.5000, which
represents the value of concentration at which 50% of the nauplii’s populations was
killed.
The percentage of mortality for stingless bee honey in concentrations of 0.01,
0.1, 1, 10 and 100 µg/ml was found to be 10, 20, 30, 40 and 50%, respectively, as
shown in Table 14.4. The median lethal concentration (LC50 value) of stingless bee
honey was 254.474 µg/ml. Based on the results, stingless bee honey was found to be
highly active at 1000 µg/ml compared to other concentration with percent mortality
of 50%. This finding indicates the presence of bioactive compound of the stingless
bee honey that leads to the anti-bacterial properties. The toxicity of honey might also
be due to the purity of the sample used as the samples of honey used were from pure
samples where all the chemical properties are present.
A study was done by Yazan et al. (2016) on the in vitro cytotoxicity of stingless bee
honey against human cancer cell line. The study done on the known pure compounds
from stingless bee honey are kaempferol, apigenin, caffeic acid, phenethyl ester
(CAPE) and narigenin. According to Yazan et al. (2016) all of these compounds
are derived from phenolic acid in stingless bee honey. Each of the compounds has
been tested on cancer cells and it is clarified that each compound from the phenolic
acid can be cytotoxic to the cancer cell (Yazan et al. 2016). The crude extracts from
propolis and honey had higher cytotoxic activities than bee pollen, but the activity
Table 14.4 Result of toxicity of stingless bee honey on brine shrimps

Samples Concentration Percentage LC50 (µg/ml) Toxicity class
(µg/ml) mortality (%)
Stingless bee 0.01 10 254.474 Toxic
honey 0.1 20
1 30
10 40
100 50
Table 14.5 Result of toxicity of Ajwa date seeds on brine shrimps

Samples Concentration Percentage LC50 (µg/ml) Toxicity class
(µg/ml) mortality (%)
Ajwa date seeds 0.01 10 391.918 Toxic
0.1 20
1 30
10 40
100 50
was dependent upon the extraction solvent, bee species and cell line (Yazan et al.
2016). As stated, these compounds of phenolic acid have cytotoxic effects on few
cancer cells in human which includes ChaGo-I (lung bronchus carcinoma cell line),
KATO-III cell (human gastric carcinoma cell lines) and BT474 (ductal carcinoma
cell lines), respectively (Yazan et al. 2016). This indicates that the stingless bee honey
can be effective as anti-bacterial agents due to the bioactive compound present in the
sample. Various polyphenols present in stingless bee honey have been proven to curb
the development of many diseases where they perform this action via several specific
mechanisms such as regulation of a specific gene expression or altering metabolic
pathways by means of promoting or blocking specific pathways (Hossen et al. 2017).
Another study done by Yazan et al. (2016) on the chemo-preventive properties
and toxicity of stingless bee honey stated that based on the density, the daily intake
of stingless bee honey for human is 189.33 mg/kg and the honey were proven to be
not toxic to the animals as there was no reduction in body weight of the rat tested
in the study.
The percentage of mortality for 0.01, 0.1, 1, 10 and 100 µg/ml of date seeds
extract was 10, 20, 30, 40 and 50%, respectively. The percentage of mortality depicts
the percent number of dead brine shrimps in total of 100% which is equivalent to
ten number of brine shrimps. A report done by Takaeidi et al. (2014) suggested
that the date seeds are free from any toxic effects. As referred to Meyer’s toxicity
index, the Ajwa date seeds extracts were found to be toxic (active) as the LC50 value
was 391.918 which is below 1000 µg/ml. The median lethal concentration (LC50 )
indicates high presence of bioactive compound of Ajwa date seeds at concentration of
100 µg/ml as the percent mortality of nauplii is 50% which is the highest. This might
be due to the presence of phenolic compound in Ajwa date seeds such as oleic acid
and gallic acid. The bioactive compound present in Ajwa date seeds indicates that it
has the potent to act against skin infections bacteria. Previous study has proven that
the bioactive compound present in Ajwa date seeds is known with its highly rich in
phenolic content and antioxidant properties (Khalid et al. 2017) and these properties
are the factors that boost up the anti-bacterial effect in Ajwa date seeds. As stated by
Kchaou et al. (2016) the date seeds showed the presence of benzoic acid, cinnamic
acid and flavonoids, and strong anti-microbial activities against gram-positive and
gram-negative bacteria, which most potently against E. coli.
14.4 Conclusion
As conclusion, Ajwa date seeds, stingless bee honey and both combinations
have a potential to act as anti-bacterial agents toward dermal and skin infection
associated bacteria which are S. aureus and S. epidermidis. The highest zone of
inhibition for both samples alone was showed at concentration of 100 µg/ml with
diameter of 9.67 ± 0.58 mm for Ajwa date seeds against S. aureus and 10.17 ±
0.29 mm for stingless bee honey against S. epidermidis. Meanwhile, the result of
combinations between Ajwa date seeds and stingless bee honey showed a highest
zone of inhibition at 1:2 ratio with boost up the zone of inhibition to 15.33 ± 0.58 mm
against S. aureus and 14.33 ± 0.58 mm against S. epidermidis. Besides that, the result
of cytotoxicity test on both stingless bee honey and Ajwa date seeds were observed
to be toxic as the LC50 value is above 1000 µg/ml. This condition proves both plants
are toxic and trigger the penetration to the cell wall of bacteria in order to reduce the
bacterial growth.
References
Afiq MA, Rahman RA, Man YC, Al-Kahtani HA, Mansor TST (2013) Date seed and date seed oil.
Int Food Res J 20(5):2035
Al-Farsi M, Lee C (2011) Usage of date (Phoenix dactylifera L.) seeds in human health and animal
feed. In: Nuts and Seeds in Health and Disease Prevention, pp 447–452
Basuni AMM, Al-Marzooq MA (2010) Production of mayonnaise from date pit oil. Food Nutr Sci
2:3–8
Bentrad N, Gaceb-terrak R, Benmalek Y, Rahmania F (2017) Studies on chemical composition and
antimicrobial activities of bioactive molecules from date palm (Phoenix dactylifera L.) pollen
and seeds. Afr J Tradit, Complement Altern Med 14(3):242–256
Bhat RS, Al-Daihan S (2012) Antibacterial properties of different cultivars of Phoenix dactylifera
L. and their corresponding protein content. Ann Biol Res 3:4751–4757
Ewnetu Y, Lemma W, Birhane N (2013) Antibacterial effects of Apis mellifera and stingless bee hon-
eys on susceptible and resistant strains of Escherichia coli, Staphylococcus aureus and Klebsiella
pneumoniae in Gondar, Northwest Ethiopia. BMC Complement Altern Med 13(1)
Fair RJ, Tor Y (2014) Antibiotics and bacterial resistance in the 21st century. Perspect Medicin
Chem 6, PMC-S14459
Hamidi M, Jovanova B, Panovska T (2014) Toxicological evaluation of the plant products using
Brine Shrimp (Artemia salina L.) model. Maced Pharm Bull 60(1):9–18
Hossen MS, Ali MY, Jahurul MHA, Abdel-Daim MM, Gan SH, Khalil MI (2017) Beneficial
roles of honey polyphenols against some human degenerative diseases: a review. Pharmacol Rep
69(6):1194–1205
Ismail S (2018) Physicochemical characteristics of Malaysian stingless bee honey from
Trigona Species. https://www.researchgate.net/publication/327230967_Physicochemical_
Characteristics_of_Malaysian_Stingless_Bee_Honey_from_Trigona_Species. Accessed 4 Dec
2018
Jones PV, Huey S, Davis P, McLemore R, McLaren A, Hayes MA (2015) Biophysical separation
of Staphylococcus epidermidis strains based on antibiotic resistance. Anal 140(15):5152–5161
Kchaou W, Abbès F, Mansour RB, Blecker C, Attia H, Besbes S (2016) Phenolic profile, antibacterial
and cytotoxic properties of second grade date extract from Tunisian cultivars (Phoenix dactylifera
L.). Food Chem 194:1048–55
Khalid S, Khalid N, Khan RS, Ahmed H, Ahmad A (2017) A review on chemistry and pharmacology
of Ajwa date fruit and pit. Trends Food Sci Technol 63:60–69
Kusari S, Hertweck C, Spiteller M (2012) Chemical ecology of endophytic fungi: origins of
secondary metabolites. Chem Biol 19(7):792–798
Mandal MD, Mandal S (2011) Honey: its medicinal property and antibacterial activity. Asian Pac
J Trop Biomed 1(2):154–160
Takaeidi MR, Jahangiri A, Khodayar MJ, Siahpoosh A, Yaghooti H, Rezaei S, Mansourzadeh Z
(2014) The effect of date seed (Phoenix dactylifera) extract on paraoxonase and arylesterase
activities in hypercholesterolemic rats. Jundishapur J Nat Pharm Prod 9(1):30
Tayel AA, Shaban SM, Moussa SH, Elguindy NM, Diab AM, Mazrou KE, Ghanem RA, El-
Sabbagh SM (2018) Bioactivity and application of plant seeds’ extracts to fight resistant strains
of Staphylococcus aureus. Ann Agric Sci 63(1):47–53
Yazan LS, Muhamad Zali MFS, Ali RM, Zainal NA, Esa N, Sapuan S, Syed Alwi SS (2016)
Chemopreventive properties and toxicity of Kelulut honey in Sprague Dawley rats induced with
Azoxymethane. In: Zainol MI, Yusoff KM, Mohd Yusof MY (eds) BioMed research international
Zainol MI, Mohd Yusoff K, Mohd Yusof MY (2013) Antibacterial activity of selected Malaysian
honey. BMC Complement Altern Med 13(1):129
Chapter 15
PM2.5 Pollutant Distributions in Years
2016 and 2019 Using GIS Spatial Analyst
Noorfatekah Talib, Nur Syahirah Mohamad Sallehuddin,

Nur Amira Mohd Sa’aid and Nurhafiza Md. Saad
Abstract The relationship between PM2.5 pollutant distribution and urbanization,

population and meteorological factors has been investigated using geographic infor-
mation system (GIS) as an analysis tool. The study is focused on how the variation
of PM2.5 in year 2016 and 2019 and also the factors that contribute to the PM2.5
distribution in Malaysia. The main objective of this study was to analyze the spatial
variability of the pollutants by taking Peninsular Malaysia as a study area that con-
sists of 47 monitoring station, and focus on the study area for factors that contribute
to the pollutants in Selangor as a case study, by identifying the area of high concen-
tration of PM2.5 pollutants and their relationship with urbanization, population and
meteorological factors. A correlation test was performed to establish the relationship
between PM2.5 pollutants, urban area, population density and temperature in Selan-
gor station. Land use map was generated using remote sensing tool, Erdas Imagine,
which performs land use classification by identifying the urbanization in study area.
The main finding of this study is the comparison between spatial and non-spatial
analysis approaches, which indicated that the correlation analysis and the inversed
distance weighted analysis using the average of level of PM2.5 pollutants by group
of few monitoring stations are relatively suitable methods for assessing the health
effect of PM2.5 pollutants distribution.
Keywords Pollutants · PM2.5 · Analysis · Distribution
N. Talib (B) · N. S. M. Sallehuddin · N. A. M. Sa’aid · N. Md. Saad

Universiti Teknologi MARA, Perlis, Malaysia
e-mail: fatekah@gmail.com
N. S. M. Sallehuddin
e-mail: syahiera23@gmail.com
N. A. M. Sa’aid
e-mail: amirasaaidi16@gmail.com
N. Md. Saad
e-mail: nurhafizamsaad.uitm@gmail.com

168 N. Talib et al.
15.1 Background of Study
15.1.1 Introduction
The rapid growth of cities like Selangor can be attributed to a large rural–urban
migration. Urbanization and the growth of population have large negative impact to
the quality of the air, soil and water. Air pollution can be categorized as one of the
most serious problem to the world. The observation found that the activities made
by human-like huge industrialization, construction, vehicular activities induced by
amount of fuel consumption and all other activities like urbanization tend to cause air
pollution (Kanakiya et al. 2015). Air quality in Malaysia has reduced gradually due
to population growth, industrial activities and urbanization; it might contain a lot of
pollutants with non-point sources and this source can be from the emission of motor
vehicles, industrial factories, and not to forget tobacco smoke (Zakaria et al. 2018).
According to the EIA guideline for the pollution control one should be aware that the
environmental issues are now a growing concern and pollution prevention should be
viewed as an important process. Air pollution monitoring project proponent should
include the monitoring program for ambient air quality, gas and hazardous emission
noise with the applicable regulation to the EIA report (Document et al. 1987).
Monitoring stations show the level of air pollution for a point at the observation
location. The GIS spatial analysis was performed in order to identify the level of
PM2.5 pollution in the Peninsular Malaysia. Spatial interpolation was carried out
to estimate the concentration values at the study area using known point’s concen-
tration. Spatial distribution has been analyzed using GIS technique, and it has been
applied by various researchers (Kumar et al. 2016). Researchers have carried out the
study of spatial interpolation method and spatial autocorrelation to estimate PM2.5
distribution and its relationship with meteorological factor and industrial activities.
Thus, IDW spatial interpolation has been carried out with monitored air quality data
and spatial autocorrelation technique using meteorological data. Higher concentra-
tion of PM2.5 will contribute to the effect on the respiratory organs, resulting in heart
diseases, lung diseases, tuberculosis and hemoptysis (Abdul Hamid et al. 2018). Air
pollution levels vary at different positions of monitoring stations in the city due to
higher population, industrial activities and traffic densities. From previous study, the
most suitable GIS mapping method for the prediction is by using inverse distance
weighted. IDW shows the smoothest prediction surface transitions (Galkina 2014).
15 PM2.5 Pollutant Distributions in Years 2016 and 2019 … 169
Fig. 15.1 Location of study area
15.2 Study Area and Datasets
15.2.1 Study Area
The first study area that had been chosen is Peninsular Malaysia for showing the
variation of PM2.5 pollution, as shown in Fig. 15.1. Peninsular Malaysia is located
at the coordinate of 3° 8 0 N, 101° 41 0 E with the area of 131,587 km2 . There
are about 47 monitoring stations for air pollution in Peninsular Malaysia. The total
population is 32.5 million. However, to identify the relationship between PM2.5
with urbanization, population density and meteorological factors, the area selected
is Selangor because this is strategically located with residential and industrial areas.
Also Selangor has the highest index level and at the same time had undergone a very
rapid urbanization process every year. Selangor is located at 3° 20 0 N, 101° 30 0
and has the area of 8,104 km2 . This state consists of five monitoring stations for air
pollution and the nearest two stations are located in Wilayah Persekutuan. Selangor
consists of Petaling Jaya, Klang, Shah Alam, Gombak, Hulu Langat and Sepang,
with a population of around 3.98 million in year 2000 (Abdullah et al. 2012).
15.2.2 Satellite Images
Satellite images of years 2016 and 2019 have been used to generate land use map
using the process of unsupervised classification. The image can be downloaded free
170 N. Talib et al.
in USGS Explorer website by choosing the study area and check the image charac-
teristics such as 10% cloud and 10% land cover. The downloaded satellite images
cover the area of Selangor. Landsat 8 OLI image was chosen due to its accuracy than
Landsat 7 image.
15.2.3 Station Coordinate for Pollutants Station
There are 47 stations available in Peninsular Malaysia and operated by Department

of Environment Malaysia. For the state of Selangor, there are six stations available
and the nearest from this state is in Wilayah Persekutuan, Kuala Lumpur, and others
are located in Batu Muda, Cheras and Putrajaya.
15.2.4 Pollutant Data
Pollutants data are provided by the Department of Environment Selangor in Excel

format. In addition, in situ data from website are also recorded starting from August
2018 where the value of PM2.5 calculation is based on air pollutant index (API)
data. The use of PM2.5 in calculating the air pollutant index (IPU) is in line with
most developed states. Thus, it will enhance the efforts of the Malaysian Government
toward the preservation of the environment. Data are required in hours due to spread
hours by each pollutant, where the pollutants spread are higher around at 3 pm. Thus,
hourly data is required to get accurate outcome at the end of these studies.
15.3 Data Processing
15.3.1 Images Pre-processing
There are several stages of pre-processing such as radiometric correction and geo-
metric correction. Both corrections are done to get a clear image, reduce error and
improve the accuracy of the satellite images. Geometric correction was done to ensure
that the image is located in accurate map location for all features in the data. Radio-
metric corrections are conducted to improve the consistency of the brightness value,
which involves the consistency of relative spatial of the image.
15.3.2 Images Post-processing
The first unsupervised classification has been done to identify and classify the land
use in Selangor. This is to clarify the urban areas, vegetations, open spaces, water
bodies and forested areas. The five classes are water bodies, dense forest, vegetation,
urban area and open space as shown in Fig. 15.2. The actual classification before
re-code is 10. Then after re-code process the classes are reduced to five. From these
five classes, it can be related to the PM2.5 pollutants in that area.
Fig. 15.2 Methodology workflow

172 N. Talib et al.
15.3.3 Extraction by Mask and Zonal Statistical Analysis
This process involves extraction of the selected area for the study using ArcGIS
software. It is possible to select a specific area from raster data using another layer as
template where the extension limits the extent of the output raster. The output raster
will maintain its attribute table, bounded by the extension imposed. The result is
produced after indicating the input raster, the raster entity or entity; later these have
been used to define the areas to extract and name the location of the output raster. Each
extraction location will be calculated using zonal statistical analysis. New attribute
table of area zonal statistic will be produced, and the area was calculated based on
the land use classes. Each land use describes different area covered.
15.3.4 Digitization
Digitization is the process to create a new shape file from the base map where the
process of converting the geographic data into a vector data by tracing the features
is done. During the process of digitizing, features from the traced map or image are
captured with its coordinates in point, line or polygon, but in this study to digitize
map of Peninsular Malaysia and administrative boundary of Selangor, the trace uses
polygon format. Before starting digitizing of Peninsular Malaysia and Selangor make
sure the projection of the shape file is in right projection to make it overlay with the
station that will be created in geo database system.
15.3.5 Create Geo-referenced Database Station
This stage involves building of geo-referencing database in ArcMap. This process

is performed in order to get the right position of PM2.5 pollution and then geo-
coding is performed, where it is the process of getting the tabular data from the
data sources, then comparing it to the geographic layers such as shape file and lastly
displaying the address matches in ArcGIS. ArcGIS is the platform to create shape
file from the tabular data file. The data collection for the study is in Excel file that
need to be exported first before going to the further processing. This process involves
converting the real coordinates from tabular data or data acquisition in Excel into
spatial data. It assigns coordinates to each pixel in the raster images. Common frames
and coordinate system are developed to define the position within the information.
Thus, the process here was performed in order to get the right position of PM2.5
station into map.
15.3.6 Create Spatial Interpolation
Here, the data involve creating spatial interpolation using inverse distance weighted
interpolation analysis technique. Spatial interpolation is a procedure of estimating the
value of the variable under study at unsampled locations, using the point’s observation
within the same region. The process was done using ArcMap because it was a simple
step. An inverse distance weighted interpolation analysis technique was used in this
study to analyze spatial patterns of air pollutants of PM2.5 and the variations in
PM2.5 in Peninsular Malaysia. The closer the point is to the center of the location,
the more influence or weight it has in the average process.
15.3.7 Correlation Coefficient
This stage involves processing the correlation coefficient where it determines the
relationship between two parameters. The parameters involved in this processing
stage are index of PM2.5 with urbanization, population density and meteorological
factors. It will use simple equation to produce the result of the coefficient. The first
thing that needs to be done in this step is to make a plot in the most illustrative way
that is possible. There are two random variables x and y that displays the values in a
scatter plot. This process involves in finding the correlation coefficient between two
variables from the collected data by using Excel and the correlation function. The
results show how strongly two variables are related to each other.
15.3.8 Linear Regression
Based on the extraction data of land use, population density and meteorological data,
the points are then filtered and selected to remove the unrelated and outliers’ points
in order to come out with a good relationship. After getting the best points, the
linear relationship is generated using linear regression analysis, which is available
on Microsoft Excel and the linear relationship will be produced as an output.
15.4.1 Land Use Classification
Land use map is created to identify the development and changes in land use that
contributes to the climax change. The actual classes are 10 but later re-coded into
five classes. The RMSE error for the process of geometric correction was less than
174 N. Talib et al.
Fig. 15.3 Land use classification of Selangor for years 2016 and 2019
0.5. As a result, the land use classification map has been created and is shown in
Fig. 15.3. It represents the land use by the process of unsupervised classification and
the percentage of each land use of Selangor in years 2016 and 2019.
15.4.2 Zonal Statistical Result and Analysis
After undergoing the process of land use classification, zonal statistical analysis of
land use area was performed. Table 15.1 shows the classification percentage area in
years 2016 and 2019. The urbanization areas percentage is shown in Table 15.2.
Table 15.1 Percentage area of classification in Selangor for years 2016 and 2019
Classification Area (ha) Percentage (%)
2016 2019 2016 2019
Water bodies 560.00 40079.52 2 5
Dense forest 4536.11 342307.69 41 42
Vegetation 8257.00 222171.44 33 27
Urban area 2270.73 210391.97 22 26
Open space 146.16 1791.28 2 0
Table 15.2 Urbanization

Location Urban area (ha)
area table of Selangor for
years 2016 and 2019 2016 2019
Kuala Selangor 560.00 620.00
Petaling Jaya 4536.11 4628.91
Shah Alam 8257.00 9287.82
Klang 2270.73 15282.08
Banting 146.16 161.80
Cheras 405.29 643.10
Putrajaya 124.24 159.34
15.4.3 Concentration of PM2.5 Pollutant in Peninsular

Malaysia
From the results of 2016, Fig. 15.4 shows the map of PM2.5 concentration and it
shows the detailed results of 2016 and 2019. In 2016, PM2.5 shows the highest con-
centration in Shah Alam where the value is 79.8497 followed by Indera Mahkota,
Kuantan Pahang. Among these stations, it can be concluded that Selangor has a higher
concentration where all stations located in Selangor had the highest index; Petaling
Jaya, Shah Alam, Klang, Banting Cheras, and Putrajaya showing an unhealthy index
at level 60 for PM2.5 compared to other stations in Peninsular Malaysia. This is
Fig. 15.4 Concentration of PM2.5 pollutant distribution in Peninsular Malaysia for years 2016 and
2019
176 N. Talib et al.
because Selangor can be related as a developed state with working people, urbaniza-
tion development and highest population density. In year 2019, we found the result
of PM2.5 pollutant distribution for each station in Peninsular Malaysia and also the
result for each index in all stations in Peninsular Malaysia. From the concentration
map in year 2019, PM2.5 shows the highest concentration in Selangor and widely
distributed to all stations compared to year 2016. The highest concentration stations
are Petaling Jaya, Shah Alam and Indera Mahkota.
15.4.4 Concentration of PM2.5 Pollutant for Selangor
Fig. 15.5 presents the concentration of PM2.5 pollutant at all stations in Selangor for
2016 and 2019. In 2016, Petaling Jaya has the highest concentration with the value of
79.993 and was also experienced in Shah Alam station. The lowest index recorded
for Selangor in 2016 is in Banting, Cheras and Kuala Selangor with the value of
55 while the stations for Klang and Putrajaya show intermediate index value of 65.
Petaling Jaya and Shah Alam experienced an awareness level of PM2.5 pollutant
distribution because of industrial activities in the area. Overall, in 2016 the value
for PM2.5 pollutant in Selangor was still under healthy level and has a good living
environment but still need to be alert about the pollutant.
In 2019 the level of PM2.5 pollutant has become worse because all stations in
Selangor have the highest index, which is from 78 to 100, compared to level 80 in
2016 for Petaling Jaya and Shah Alam. In 2019 the pollutant level becomes worst
Fig. 15.5 Concentration of PM2.5 pollutant distribution in Selangor for years 2016 and 2019
and dangerous because Klang also showed unhealthy index. Klang has the highest
concentration with the value of 100 and the highest value of 98 was also experienced
in Petaling Jaya followed by Shah Alam. The lowest index of PM2.5 pollutant was
recorded in Banting and Cheras where the value recorded was 78. For stations Kangar,
Taiping and Batu Pahat the level is still stating healthy level index.
There is possibility of increase in index of pollutant due to land use changes and
increase in the level of population density. There are no changes in index in Selangor
because after it reached more dangerous level, the public awareness to maintain good
environment is rising and the effort from authority to enhance the quality of air is at
maximum. Overall, for the years 2016 and 2019, PM2.5 is most polluted in the areas
that have the highest population density and urbanization activities.
15.4.5 Correlation Coefficient Analysis
Correlation analysis was done to identify the relationship between two parameters,
which is between PM2.5 pollutant and population, followed by temperature and
urbanization activities. The correlation coefficient ranges are from −1 to 1. The
correlation coefficient relationship depends on its values; for example, the value close
to −1 shows a negative linear relationship, value of 0 shows no linear relationship
and lastly, the value close to 1 shows a perfect and strong positive relationship. The
result of correlation coefficient (r) is shown in the graph and listed in the table. The
regression line was calculated from the value of the correlation coefficient.
Based on the observation of three factors that contribute to the PM2.5 pollutant
distributions, as shown in Figs. 15.6, 15.7 and 15.8, it has been proven that population
shows the highest relationship where the r-square is close to +1 and the value is
equal to 0.8988. The relationship with population increased dramatically from 2016
to 2019 due to high population density and the difference in the values is 0.6027,
where it increased with a very high value in 4 years. Next is the urbanization factor
where it shows increase in value from 0.5692 to 0.7478 in 2016 and 2019 due to
rapid development in Selangor and its economy status. For temperature, the value
still displays an increasing value but not so drastic like the factor of population and
Fig. 15.6 Graph PM2.5 versus population in years 2016 (left) and 2019 (right)
178 N. Talib et al.
Fig. 15.7 Graph PM2.5 versus temperature in years 2016 (left) and 2019 (right)
Fig. 15.8 Graph PM2.5 versus urbanization in years 2016 (left) and 2019 (right)
Table 15.3 Relationships

Factors R-squared
between PM2.5 pollutants for
two years 2016 2019
Population 0.2961 0.8988
Temperature 0.4044 0.5739
Urbanization 0.5692 0.7478
urbanization where the difference in 4 years is 0.1695. Table 15.3 shows the details
of relationship between each parameter for 2 years in 2016 and 2019.
15.5 Conclusion
In brief, it can be concluded that all objectives were achieved. From the results it
shows that the factors—urbanization, population and meteorological—have huge
impact on the PM2.5 pollutants. This can be proven from the result of objective
number one, which is generating the land use maps. In addition, the maps explain
the land use changes from 2016 to 2019; the vegetation has become low and urban
area has become highly concentrated in Selangor. This study shows that there is
a significant link between PM2.5 pollutant and the urbanization, population and
meteorological factors. It supports the theory, which implies that PM2.5 pollutant
with urbanization and population are conceptually related. The spatial distribution of
PM2.5 in Klang district displayed a highly clustered pattern pollution type. Clustered
means PM2.5 pollutants rates are concentrated in a certain area.
References
Abdul Hamid H, Hanafi Rahmat M, Aisyah Sapani S (2018) The classification of PM10 concen-
trations in Johor based on seasonal monsoons. IOP Conf Ser: Earth Environ Sci 140(1). https://
doi.org/10.1088/1755-1315/140/1/012028
Abdullah AM, Samah MAA, Tham YJ (2012) An overview of the air pollution trend in Klang
Valley, Malaysia. Open Environ Sci 6:13–19. https://doi.org/10.2174/1876325101206010013
Document G, Assessment EI, Located I, Gazetted W, Approved EIA, Sites I (1987) Guidance
document for the preparation of environmental impact assessment (EIA) report—Establishment
of industries located within gazetted and EIA approved industrial sites, pp 1–21
Galkina EI (2014) Comparison of interpolation methods for estimating spatially aggregated
pollution exposure. IEEE Sci Vis 13–14
Kanakiya RS, Singh SK, Shah U (2015) GIS application for spatial and temporal analysis of the
air pollutants in urban area. Cloud Publ Int J Adv Remote Sens GIS 4(1):1120–1129. https://doi.
org/10.23953/cloud.ijarsg.102
Kumar A, Gupta I, Brandt J, Kumar R, Dikshit AK, Patil RS (2016) Air quality mapping using
GIS and economic evaluation of health impact for Mumbai City, India. J Air Waste Manag Assoc
66(5):470–481. https://doi.org/10.1080/10962247.2016.1143887
Zakaria UA, Saudi ASM, Abu IF, Azid A, Balakrishnan A, Amin NA, Rizman ZI (2018) The
assessment of ambient air pollution pattern in Shah Alam, Selangor, Malaysia. J Fundam Appl
Sci 9(4S):772. https://doi.org/10.4314/jfas.v9i4S.43
Chapter 16
Sustainable Embedded Technology
for Mouse Trap
Norfiza Ibrahim , Azmi Abu Seman , Nadia Abdul Wahab ,

Aznoora Osman and Muhammad Hazim Firdaus Ismail
Abstract The mouse trap with sustainable embedded technology (MoTrap) is

designed to help people in reducing and solving mouse problem at home. Currently,
most people use hazardous rat poison and traditional mouse trap which is not really
effective and safe to overcome this problem. The objectives of this study are to iden-
tify the required internet of things (IoT) components for the MoTrap, to develop a
sustainable mouse trap with embedded technology that is suitable for both smart-
phone and personal computer, and to evaluate the functionality and user acceptance
of the MoTrap. There are multiple functions provided such as the user can get noti-
fication after the mouse has been trapped through smartphone, view the live image
from the mouse trap and also view the videos that were recorded in cloud storage.
The development consists of six phases which are analysis, design, development,
testing, implementation and maintenance. Two types of testing were conducted to
evaluate this technology, including functionality test and technology acceptance test.
There were 30 respondents participated during the technology acceptance test. From
this test, the mean score values for all items are more than 3.5 (using 5-point Likert
scale), and therefore, it can be concluded that most of the respondents agreed that
mouse trap with embedded technology is useful and effective as an alternative tool
to control mouse problem at home.
Keywords Embedded technology · Internet of things · Mouse trap
N. Ibrahim (B) · A. A. Seman · N. A. Wahab · A. Osman · M. H. F. Ismail

Universiti Teknologi MARA Cawangan Perlis, Kampus Arau, 02600 Arau, Perlis, Malaysia
e-mail: norfiza@uitm.edu.my
A. A. Seman
e-mail: azmi384@uitm.edu.my
N. A. Wahab
e-mail: nadiawahab@uitm.edu.my
A. Osman
e-mail: aznoora@uitm.edu.my
M. H. F. Ismail
e-mail: hazimfirdausya@gmail.com

182 N. Ibrahim et al.
16.1 Overview of Study
16.1.1 Introduction
The “internet of things” (IoT) is the new wave in the era of computing. Kevin Ashton
is the first person that developed the term internet of things in 1999 (Gubbi et al.,
2012). In addition, everyday objects in our life have the networked interconnection
and often equipped with ubiquitous intelligence. By integrating IoT in the embedded
system, it will increase the ubiquity of the internet. Owing to the rapid advance in the
technologies, IoT open large opportunities for the development of new applications
that could help to improve our lives. Expert analysis technology has predicted that
within the next decade, the internet will be one of the needs in human basic life.
16.1.2 Background of Study
Mouse is a small rodent, characteristically having a pointed snout, small rounded ears,
a body-length scaly tail and a high breeding rate. The best-known mouse species is
the common house mouse (Mus musculus). The house mouse originated in Asia but
are now found all over the world, particularly where people are present. However, in
most places mouse has become one of the most dangerous animals to human. Thus,
a mouse trap was invented to help people to catch the mice in their house. Mouse
trap history is not an established subject of research in the history of material culture.
This ignorance allowed Michael Behe (Dagg, 2011) to claim the ubiquitous flat snap
trap as an example for a system that apparently cannot have evolved.
16.1.3 Research Problem
Today, mouse is one of the major problems at home. This is because homes have
food and shelter that available for their reproduction. When they enter the house,
they will be able to do a lot of damage in no time. Mice will make their entry
points throughout the house by grinding floors, walls, and furniture such as through
the back wall or through the bottom of the table to build their home behind the
closet (AllAnimalControlcom, 2018). Mice are also very productive. Therefore, their
population increases rapidly if they have sufficient food, water and shelter (Lupo,
2018).
Everyone knows mice cause a lot of damage to our home and also spread many
types of diseases. As a result, this condition can be unsafe for our family and can
lead to the spread of infectious diseases. Examples of rodent-related diseases are
hantavirus, lymphocytic choriomeningitis, tuberculosis and outbreaks (National Pest
Management Association, 2014).
16 Sustainable Embedded Technology for Mouse Trap 183
In addition, mice are also known to be the spread of more than 35 diseases and
can be transmitted directly to humans through direct contact with living and dead
mice. Urine, saliva and mouse bites can also make you a victim of these diseases.
For the mouse trap, however, it is unable to be made in a simple way and still
functions at the same time. Recently, many animals have been trapped for research
and laboratory experiments to produce these mouse traps. But at home, people often
simply trap the mice to kill and get rid of them. However, the mouse managed to
avoid the trap and freely crawled inside the house without any obstacle. This shows
that the existing mouse trap that has been used for many years are not necessarily
effective (Lee, 2019).
When the mouse trap is not working properly, the rat poison will be used to kill the
mouse immediately. When rat poison is introduced, it will automatically harm their
families especially children. These toxins can cause children to experience internal
bleeding, coma, anemia, bleeding nose, bleeding gums, bleeding urine and bleeding
stools (McClure, 2010). Rat poisons contain many chemicals and one of them is
called warfarin. These chemicals prevent blood from freezing and are known as anti-
coagulants. If people continue to use rat poison as their alternative to kill mice, they
can indirectly endanger their children as well.
16.1.4 Objectives
The aim of this study is to develop a sustainable mouse trap using embedded
technology and the objectives of this research are:
1. To identify the required internet of things (IoT) components for the mouse trap
with embedded technology (MoTrap).
2. To develop a MoTrap that is suitable for both smartphone and computer.
3. To evaluate the functionality and user acceptance of the MoTrap.
16.2 Related Works
16.2.1 Platform
In information technology, any hardware or software used to host an application or

service is known as a platform. Platform applications usually consist of hardware,
operating system and program coordination with a set of instructions for a particular
processor or microprocessor. In this case, the platform creates the basis to make sure
the object code to be executed successfully.
NodeMCU. NodeMCU is from the ESP8266 family, being one of the least
demanding to utilize, and it is not vital to utilize another gadget of the Arduino
Fig. 16.1 NodeMCU
sort, since it, as of now, has the fundamental handling capacity to execute its appli-
cations. In addition, it still has the coordinate association to WiFi, without the ought
to introduce modern gadgets, not at all like the Arduino UNO, which does not have
this capability and needs other associations (Bento, 2018). The WiFi prerequisite is
vital for sparing parts; moreover, it includes interfacing to other gadgets, as already
detailed, the NodeMCU, as of now has the coordinates WiFi. The estimate neces-
sity was considered for way better coupling in boxes or little gadgets, other than
considering the weight, in this case the NodeMCU has the measures of 2.5 cm ×
5.1 cm. In expansion, NodeMCU in Fig. 16.1 employments coordinate references
to its libraries, without the got to utilize extra libraries, the way of association and
utilize is the you would like as it were selected the gadget sort on the stage.
Besides, this prerequisite includes the memory in which the factors are put away,
among other values amid the execution of the code and that information are vital for
the execution of the program.
Laser diode module. Recently, one of the foremost energizing improvements in
broadcast communications has been the use of laser light. The utilization of laser
light is broadly in exchanging data over long separations. Among the components
that cause the use of laser light is the need of space accessible in swarmed metropoli-
tan cities and rising taken a toll of living, as well as the fast advancement in the
internet of things (IoT) that calls for the least costly and effective communication
framework (Bambey et al., 2016). Also, propels within the field of semiconduc-
tor lasers have permitted the use of lasers for flag transmission, which decreases
the required broadcast rights and buried cables. Hence, with the advancement of
applications in space innovation, and the expanding significance of remote sensor
systems, laser communication has gotten to be an extraordinary subject of inquiry
about and advancement. Figure 16.2 shows the model of laser sensor that is used in
the development of MoTrap.
Servo Motor. Servo engine is an electronic engineer which comprises DC engine,
equip, potentiometer and a circuit. The circuit in conjunction with the potentiometer
makes the servo turn as required. The equip instrument interior to the servo engine
requires a tall input speed of the deck engine and at its yield, the slower speed is
Fig. 16.2 Laser diode

module
produced as required, which can be used for all intents and purposes throughout.
During the development, we have used the SG90-9 g small-scale servo which may
be a servo engine rotational control position. It is less and weighs 9 g and contains
a tall yield control. This servo engine can pivot around 180° and it turns 90 in each
course (Chattopadhyay et al., 2016).
Based on Fig. 16.3, servo motor comes with a three horns and equipment. A
metal hook is joined to each of the servo engines. When an individual enters, and the
section sensor esteem goes tall the point of the section lock changes to 90°, that is,
it opens. Essentially, when the exit door sensor esteem goes tall, the exit entryway
Fig. 16.3 Components of

servo motor
Fig. 16.4 Smartphone

camera
servo latch’s point gets to be 180° since it’s within the inverse heading. The yield of
the servo engines is joined to PWM pins of the Arduino.
Smartphone Camera. A smartphone may be a versatile phone with highly pro-
gressed features. A typical smartphone incorporates a high-resolution touch screen
show, WiFi network, web browsing capabilities and the capacity to acknowledge
modern applications. The larger part of these gadgets runs on any of these well-
known versatile working frameworks: Android, Symbian, iOS, BlackBerry OS and
Windows Portable. Usually, the smartphone has the camera and its functionalities
such as video recording and still photography are an essential component of recording
surgical and clinical subtle elements. Recordings have an imperative part in exper-
tise exchange (Gupta et al., 2015). In expansion, Fig. 16.4 shows the picture of the
smartphone and his camera.
16.2.2 Embedded Technology
For generations, many people including researchers and scientists have tried so many
ways in creating effective mouse traps. A mouse trap is an animal trap designed
specifically to catch rats. To create a mouse trap that uses IoT, a lot of technologies
need to be used. Technology can be defined as scientific knowledge used for practice
or application purposes, whether in everyday life or in industrial use. An analysis was
made on the embedded technology that is used in imaging applications discussed in
the previous section. The related works are compared according to variables such as
the technology used, field of the applications, the displays used and method to use.
Table 16.1 shows the content analysis of the related works or researches that utilizes
laser diode module, servo motors and camera modules.
Table 16.1 Content analysis of the related works

Related works Technology Features Camera Servo Laser
used module motor diode
module
FPGA-based Camera module Face detection ✓
implementation
of the
Viola-Jones
face detection
algorithm
(2017)
Visitor counter Servo motor Monitor and ✓
with automated control the
entry and exit entry and exit
(2016) of door
Collision Camera Control and ✓ ✓
avoidance module, laser avoid the
system for diode module collision of
useful UAV objects
applications
(2016)
Transceiver Laser diode Use the laser ✓
prototype for module transceiver as
Arduino-based the
laser communication
communication
(2018)
16.3 Construction
Construction phase involves activities such as designing and developing to make a

better envision of the mouse trap. As for the overview of the construction part, the
deliverables outcome from the development phase is the experimental design which
is shown in Fig. 16.5. By adding the internet of things (IoT) components into the
mouse trap, we hope that the device helps people to catch the mouse more effectively
and efficiently.
The components use laser diode module that will detect the mouse as it passes the
red line laser. After that, the use of servo motor is to close the door automatically after
the mouse enters the trap. Meanwhile, camera will capture the image of the mouse
once the mouse enters the trap. Finally, it will display the message and the image
of the mouse in the smartphone and notify the user using the Blynk application.
Figure 16.6 shows the prototype of the MoTrap that consists of four segments which
are top, back, side and front.
Fig. 16.5 Experimental design of MoTrap
16.4 Finding
The mouse trap is evaluated by using the technology acceptance testing with 30
respondents. There are four criteria being evaluated, which are technology, function,
safety and usefulness. After using and experiencing the MoTrap prototype, all the
respondents were given a survey regarding this technology. Figure 16.7 illustrates
the mean scores for each category that have been calculated from each item in each
category using 5-point Likert scale.
For the technology category, the mean score is 4.1. Therefore, it can be said that
most of the respondents were satisfied with this technology and how it works to catch
the rats. As for the ease of use category, the mean score is 4.0 which indicates that
most respondents agreed that MoTrap is functioning well and effective. The mean
score for safety category is 2.41. Although almost half of the respondents agreed that
this technology is safe, this also shows that MoTrap should be improved with more
security features to enhance this technology. Usefulness is the last category evaluated
Fig. 16.6 MoTrap prototype
Fig. 16.7 Mean for category

in TAM testing 4.5 4.1 4.0 3.9
4.0
3.5
3.0
2.41
2.5
2.0
1.5
1.0
0.5
0.0
TECHNOLOGY EASE OF USE SAFETY USEFULNESS
and the mean score for the category is 3.91. This score indicates that respondents
found that MoTrap is useful to combat mouse problem in residential areas.
16.5 Conclusion
MoTrap is designed to help people in reducing and solving mouse problem at res-
idential areas. The objectives of this study are to identify the required internet of
things (IoT) components for the MoTrap, to develop a sustainable mouse trap with
embedded technology that is suitable for both smartphone and personal computer,
and to evaluate the functionality and user acceptance of the MoTrap. There are mul-
tiple functions provided such as users can get notification after the mouse has been
trapped through smartphone, view the live image from the mouse trap and also view
the videos that were recorded in cloud storage.
This study consists of six phases, which are analysis, design, development, testing,
implementation and maintenance. Two types of testing were conducted to evaluate
this technology, including functionality test and technology acceptance test. There
were 30 respondents who participated during the technology acceptance test. From
this test, the mean score values for all items are more than 3.5 (using 5-point Likert
scale), and therefore, it can be concluded that most of the respondents agreed that
mouse trap with embedded technology is useful and can be accepted as an alternative
tool to control mouse problem at home.
By using the MoTrap, it will help in eliminating the rat’s problem at residential
areas. As for the city council, they can utilize this technological solution as part of
the strategic planning in improving their cities. Furthermore, the authorities such as
the Ministry of Health (MOH) can imply and use this technology in solving the rat’s
problems in the country. With this advance technology, the authorities will have an
easier task in improving the cleanliness of the city and country.
References
AllAnimalControlcom (2018) Aallanimalcontrolcom. https://www.aallanimalcontrol.com/wildlife/

what-kinds-of-damage-do-mice-cause-in-homes.html
Bambey S, Lim E, Corley-Jory K, Taheri P (2016) A cost-efficient transceiver prototype for arduino-
based laser communication. In: 2016 IEEE 7th annual information technology, electronics and
mobile communication conference (IEMCON), pp 1–5. IEEE
Bento AC (2018) IoT: NodeMCU 12e X Arduino Uno, results of an experimental and comparative
survey. Int J Adv Res Comput Sci Manag Stud 6(1)
Chattopadhyay A, Mukherjee B, Rudra P, Chakraborty D (2016) A study of a visitor counter with
automated entry and exit. Int J Comput Sci Eng 4(6)
Dagg JL (2011) Exploring mouse trap history. Evol: Educ Outreach 4(3):397. https://doi.org/10.
1007/s12052-011-0315-8
Gubbi J, Buyya R, Marusic S, Palaniswami M (2012) Internet of things (IoT): a vision, architectural
elements, and future directions. Futur Gener Comput Syst 29. https://doi.org/10.1016/j.future.
2013.01.010
Gupta SK, Kumar A, Sharma A, Agrawal S, Katiyar V (2015) Android smartphone as an alternative
to operating microscope camera for recording high definition surgical videos: setup and results.
J Mob Technol Med 4(3):39–42
Lee S (2019) DIY. What to do when mice have invaded your home. Life Hacker. https://lifehacker.
com/what-to-do-when-mice-have-invaded-your-home-1786347063
Lupo LJ (2018) The Spruce. 4 destructive things a rat or mouse will do in your house. https://www.
thespruce.com/destructive-things-rats-and-mice-do-2656747
McClure R (2010) Rat poisons endanger 10,000 children every year in the U.S. Environmen-
tal Health News. Scientific American. https://www.scientificamerican.com/article/rat-poisons-
endanger-10000-children/
National Pest Management Association (2014) Health hazards posed by rodents. A focus on select
infectious disease. https://www.pestworld.org/news-hub/pest-health-hub/health-hazards-posed-
by-rodents/
Chapter 17
Determination of Antioxidant from Ubi
Gadong Tubers for Facial Soap Bar
Non Daina Masdar, Robiatul Adawiyah Binti Roslan, Sharizal Bin Hasan
and Mohd Lias Kamal
Abstract Dioscorea hispida or ubi gadong is considered as one of the most unuti-
lized yam species due to a poisonous alkaloid called dioscorin compound. In contrast,
the ubi gadong extract contains a phenolic compound that can act as antioxidant, anti-
hypertensive, and immunomodulatory for common diseases. Hence, in this study, the
properties of phenolic compound presence in ubi gadong tubers’ extract are investi-
gated. The ubi gadong sample is subjected to Soxhlet and MSPD extraction method.
The ferric reducing antioxidant power (FRAP) method was used to determine the
antioxidant activity and gallic acid reduction for total phenolic content (TPC) anal-
ysis. The elemental content was analyzed using inductively coupled plasma atomic
emission spectroscopy (ICP-OES). The percent yield of TPC ranges from 10.2 to
18.16% in both methods. The FRAP assay is ranging from 0.015 to 0.33 (mM Fe
(II)/10 g) with the correlation coefficient of 0.9974. Only Hg metal is detected in the
samples with a concentration of 0.08 mg/kg. The extract then was formulated as the
main ingredient of rejuvenating facial soap bar.
Keywords Dioscorea hispida · Ubi gadong · Yam · Dioscorin · Phenolic ·

Antioxidant
N. D. Masdar (B) · R. A. B. Roslan · S. B. Hasan · M. L. Kamal

Faculty of Applied Science, Universiti Teknologi MARA, Perlis Branch, 02600 Arau Perlis,
Malaysia
e-mail: daina@uitm.edu.my
R. A. B. Roslan
e-mail: robiatulroslan95@gmail.com
S. B. Hasan
e-mail: sharizal187@uitm.edu.my
M. L. Kamal

194 N. D. Masdar et al.
17.1 Introduction
Dioscorea Hispida Dennst known as ubi gadong is a monocotyledon plant. In South-

East Asia, the plant is scarcely cultivated, and grows practically confined to its area of
natural occurrence. Dioscorea sp. was reported to have multiple biological activities
such as antioxidant, anti-fungal, anti-mutagenic hypoglycemic, and immunomodu-
latory effect. According to Ashri et al. (2014), more than 1137 species of ubi gadong
research works were reported. Some species of ubi gadong tubers were found to
contain substantial amounts of phenolic compounds that were potentially used as
an antioxidant (Theerasin and Baker 2009). Unfortunately, Ubi Gadong tubers have
limited applications due to its toxicity. According to Sonthanasamy et al. (2016) even
though ubi gadong is an abundant species in many tropical countries, it only can be
used as food or and particular medicine after the poison decorin is removed.
Traditionally, the ubi gadong tubers are detoxified using flowing water for more
than seven days for safe consumption (Hudzari et al. 2011). The development of
technology has facilitated that the removal of toxin in ubi gadong tubers can be
done by extraction with methanol. Hartanto and Estyaniyana (2002) state that three
accessions ubi gadong tubers extract was found nontoxic. The extracts from ubi
gadong were usually used in soap bar making. Currently, a homemade soap bar is
abundantly produced with no proper good manufacturing procedure (GMP) standards
and documentation. The effectiveness of this soap bar only relies on consumer’s
feedback and review not through intensive research and development (R&D).
Nowadays, there are too many downstream cosmetic products that have been man-
ufactured and sold to consumers directly through the net. With advanced technology,
the cosmetic industry has innovatively developed with proper standard operational
procedure and manufacturing standards. Hence, the product is now more competitive
and reliable. For example, the facial cleanser is available in various types, which are
liquid, gel, foam, and soap bar. Currently, ubi gadong extract cosmetic is not only
used as cleanser but also to reduce wrinkles and pigmentation. According to Lim
(2016), the ubi gadong tubers extract was found to exhibit potent antioxidant, anti-
cancer, and hypoglycaemic properties. The phenolic compounds found in ubi gadong
tubers are potential as an antioxidant for antiwrinkle due to the synergic effect of a
wide range of biomolecules.
Therefore, in this study, the ubi gadong tubers are extracted using Soxhlet extrac-
tion and matrix solid-phase dispersion (MSPD) extraction. The properties of ubi
gadong tubers extract is characterized in terms of TPC and antioxidant activity via
FRAP analysis. The presence of heavy metals content is determined by ICP-OES.
Finally, the ubi gadong extract is used as the main ingredient in a homemade facial
soap bar.
17 Determination of Antioxidant … 195
17.2 Methods and Procedures
17.2.1 Sample Preparation of Powdered Tubers
The preparation was conducted as a method described by Kumoro et al. (2012)

with some modifications. Tubers were washed thoroughly using tap water to remove
surface soil. The clean tubers were hand-peeled and trimmed to remove the skin
and defective parts and cut into smaller pieces. The samples were leached in an
agitated basin using flowing tap water and dried on open air for about 24 h. The dried
samples were ground into a coarse powder using the commercial grinder and stored
in an airtight container at room temperature for further analysis. Coarse powder of
tubers was sieved to obtain a regular proportion of powders using 500 µm mesh in
size.
17.2.2 Soxhlet Extraction
The coarse powder is subjected to continuous hot extraction in Soxhlet appara-

tus using methanol solvent as suggested by Om (2016) with some modification in
terms of solvent type. About 10 g of the samples were placed in the thimble for six
hours until extraction was completed. After completion of extraction, the solvent
was removed by evaporation until the solid mass was obtained. The dried extracts
were weighed and stored in a refrigerator for further analysis.
17.2.3 Matrix Solid-Phase Dispersion (MSPD)
Extraction of phytochemicals was performed using matrix solid-phase dispersion

extraction technique, according to Tapera and Machacha (2017) with some modifi-
cations. Fresh tubers were sliced into tiny pieces using a blade. 2.0 g of the sliced
tubers were mixed with 4.0 g of clean sea sand in a porcelain mortar and then ground
using a pestle until homogeneity obtained. The ground mixture from the mortar was
transferred using a spatula into a 60 mL syringe (up to half-full). The glass wool was
placed at the bottom as an MSPD sorbent support. Another glass wool was placed at
the top of the mixture. The mixture was gently pressed using a plunger to compact
and eliminate voids. The plunger was pulled out, then 10 mL of elution solvent will
be slowly added to the mixture avoiding overflowing. Three elution solvents namely
methanol, ethanol, and ethyl acetate were used on fresh mixture separately. Each
time a pipette bulb was used to gently apply pressure to the top wool, and the syringe
will be left to drip into a small receiving test tube. The sorbent-sample mixture was
washed with 5 mL of the solvent each time.
17.2.4 Total Phenolic Content Analysis (TPC)
TPC analysis was carried out by using spectrophotometry method of Tapera and
Machacha (2017) using gallic acid used as a standard. 5 mL of a 1:10 dilution of
Folin–Ciocalteu’s reagent in water was prepared. After that, 1 mL of sample extract
and 4 mL of sodium carbonate solution (7.5% w/v) were mixed with the reagent
prepared earlier. The solution was allowed to stand at room temperature for 60 min.
The TPC was expressed as gallic acid equivalents (GAE) in mg/g fresh material at
735 nm absorbance against water. The concentration of phenolics in samples was
derived from a standard curve of the gallic acid.
17.2.5 Ferric Reducing Ability of Plasma Analysis (FRAP)
The determination of antioxidant ability was carried out using FRAP analysis as
suggested by Tamaroh et al. (2018). The power depends on the reduction of ferric
tripyridyltriazine (Fe (III)-TPTZ) complex to the ferrous tripyridyltriazine (Fe (II)-
TPTZ). The FRAP reagent was prepared using 10 mM TPTZ in 40 mM HCl and
20 mM FeCl3 ·6H2 O (ratio 10:1:1). Then 300 mM acetate buffer (pH 3.6) was slowly
added. Next, 100 mL of sample and 300 mL aquadest were mixed with 3 mL of
FRAP reagent and let to stand for 4 min. Lastly, the absorbance was measured at
570 nm absorbance. A FRAP value was calculated using a Fe2+ calibration curve
and expressed as mg of ferro equivalent per gram of extract.
17.2.6 Elemental Analysis by ICP-OES
All apparatus such as vessels and falcon tubes were soaked in analytical grade nitric
acid, HNO3 solution before use. They were dried in the oven and properly stored to
avoid contamination. Approximately 0.5 g of ubi gadong fine powders (65 µm of
mesh size) were weighed using analytical balance and transferred into microwave
Teflon. 8 mL of nitric acid (65%) and 2 mL of perchloric acid (30%) solution were
added. The samples digested based on the condition setup and after digestion com-
pleted, the extract is cooled at room temperature followed by filtering into a falcon
tube. The solution was then diluted to 10 mL with deionized water and analyzed by
using ICP-OES instrument. The blank was prepared the same way as the sample.
Table 17.1 The percentage yield of phytochemical compound in Soxhlet and MSPD extraction
techniques
Extraction method Percentage yield (%) Solvent type T (°C) ET (min)
MSPD 10.2 Methanol-ethanol RT 3
Soxhlet 14.24 ethanol >64 °C 6
Soxhlet 18.16 methanol >78 °C 6
T—Temperature
ET—Extraction time
RT—Room temperature
17.3.1 Extraction Yield
Table 17.1 summarized the percentage yield extract in Soxhlet and MSPD extrac-
tion methods. The experiment is conducted to identify the methods that will be able
to extract higher phenolic compounds in the samples yield. The result shows that
extraction yield from Soxhlet extraction technique is higher than that MSPD extrac-
tion technique. The extraction yield is 18.16% in methanol solvent and 14.24% in
ethanol solvent using Soxhlet. Only 10.2% of extraction yield was able to be obtained
using the MSPD technique for both solvents. According to Sasiwatpaisit et al. (2014),
the yield of ethanolic extract from dried ubi gadong tubers’ samples was about 6.91%
by weight using Soxhlet. Thus, the phenolic compound is possible to extract from
the sample with a promising amount of sample yield. Dhar et al. (2017) state that the
temperature condition and the extraction time affect the phytochemical compound
obtained. Since the yield extract via Soxhlet extraction is higher compared to MSPD,
hence the Soxhlet extraction method was used for the subsequent analysis.
17.3.2 Total Phenolic Content (TPC)
Figure 17.1 and Table 17.2 show the calibration curve of gallic acid standard and
TPC analysis in ubi gadong extracts in two different extraction solvent via Soxhlet
extraction method. The linear regression equation is y = 0.0061x + 0.0528 and the
coefficient (R2 ) value is 0.9991. TPC obtained is higher in methanol extract compared
to ethanol extract, which is 276.56 mg/g of gallic acid and only 56.39 mg/g of gallic
acid equivalent, respectively. According to Chung et al. (2008), the use of different
extraction solvent may also lead to the difference in TPC amount in the samples. The
methanol solvent has higher polarity than ethanol solvent, which easily polarize the
polar compound in the sample. Besides, the phenolic content in methanolic extract
shows better bioactivity properties that are potential antioxidant as expected (Johari
and Khong 2019).
Fig. 17.1 The gallic acid 2

standard solution calibration
Concentration, ppm
curve 1.5
1
y = 0.0061x + 0.0528
R² = 0.9991
0.5
0
0 100 200 300 400
Absorbance, A
Table 17.2 Total phenolic content in Ubi Gadong extracts using Folin–Ciocalteu’s reagent in water
Sample extract Absorbance (A) Total phenol contents (mg/gm) gallic acid equivalent
Methanol 0.2215 276.56
Ethanol 0.0872 56.39
17.3.3 Antioxidant Activity by FRAP Assay
The antioxidant potential in ubi gadong tubers extract was analyzed via FRAP assay
(Cheynier 2012). Figure 17.2 shows the standard calibration curve of Fe (II) sulfate
to reduce Fe2+ to Fe3+ and expressed as an equivalence of ferrous sulfate (mM)
concentration. Table 17.3 indicates the FRAP analysis of the bioactivities of the
1.2
Concentration, ppm
1
0.8
0.6
0.4
y = 1.1395x - 0.0859
0.2 R² = 0.9974
0
0 0.2 0.4 0.6 0.8 1 1.2
Absorbance, A
Fig. 17.2 The ferrous sulfate (FeSO4 ·7H2 O) standard solution calibration curve
Table 17.3 Antioxidant

Sample extract FRAP value of (mM Fe (II)/10 g)
activities of ubi gadong tubers
extract via FRAP assay methanol 0.3328
analysis Ethanol 0.0152
Table 17.4 Heavy metal

Heavy metal Concentration (ppm)
concentration in Ubi Gadong
powders analysis using As 0
ICP-OES Pb 0
Cd 0
Ni 0
Hg 0.080
Cu 0
sample extract. The methanol extract sample showed higher FRAP antioxidant value
compared to ethanol extract sample.
FRAP value of mM Fe (II) in 10 g of the sample is 0.3328 and 0.0152 in methanol
and ethanol solvent, respectively. According to Zhou and Yu (2004), the antioxidant
value in methanol extract is much higher compared to ethanol extract in wheat bran
samples. This shows that the methanolic extraction solvent has higher affinity to
extract the phenolic compound in the samples. Sultana et al. (2009) also stated that
the 100% methanolic extract shows the highest reducing power then followed by
80% ethanolic extracts. More polar solvent is feasible to extract higher antioxidant
assay compared to non-polar ones.
17.3.4 Elemental Analysis
The concentration of arsenic (As), lead (Pb), Cadmium (Cd), Nickel (Ni), Mercury
(Hg), and Copper (Cu) in ubi gadong powders was determined using (ICP-OES).
Table 17.4 summarizes the concentration in six types of metals that is suspected to
be present in the sample extract. Only Mercury (Hg) was detected in the sample with
the concentration 0.080 ppm, but not the five other metals.
Based on Malaysian Cosmetic Guidelines, draft guidance of a maximum allow-
able limit of heavy metals in cosmetic products is 1 ppm (Hg), 20 ppm (Pb), 5 ppm
(As), and 5 ppm (Cd) (Dhar et al. 2017). According to Hashim et al. (2009), a
high possibility of the presence of the metal in the natural samples’ extracts is sus-
pected due to naturally occurring and food intake of the plant. Hence, the number of
metals usually present in trace quantities or sometimes not present at all. From the
data obtained, the ubi gadong powders are safe to be formulated as one of the safe
ingredients for a cosmetic product.
17.4 Conclusion
Ubi gadong tubers were successfully extracted using Soxhlet and MSPD method. The
extract of ubi gadong powders contained a substantial amount of phenolic compound.
Based on the FRAP assay analysis, the extracts show antioxidant activity. The ubi
gadong powders have considerably low metal contents and are suggested safe for
food consumption and cosmetic applications. The extract was added in the facial
soap bar; smooth and soft texture with neutral in pH is obtained.
References
Ashri A, Yusof MSM, Jamil MS, Abdullah A, Yusoff SFM, Nasir MNM, Lazim AM (2014) Physic-
ochemical characterization of starch extracted from Malaysian wild yam (Dioscorea hispida
Dennst.). Emir J Food Agric 26(8):652–658. https://doi.org/10.9755/ejfa.v26i8.17098
Cheynier V (2012) Phenolic compounds: from plants to foods 000(1962). https://doi.org/10.1007/
s11101-012-9242-8
Chung Y, Chiang B, Wei J, Wang C, Chen P, Hsu C (2008) Original article effects of blanching,
drying and extraction processes on the antioxidant activity of yam (Dioscorea alata) 859–864.
https://doi.org/10.1111/j.1365-2621.2007.01528.x
Dhar G, Akther S, Sultana A, May U, Islam MM, Dhali M, Sikdar D (2017) Effect of extraction
solvents on phenolic contents and antioxidant capacities of Artocarpus chaplasha and Carissa
carandas fruits from Bangladesh 5(03):39–44. https://doi.org/10.7324/JABB.2017.50307
Hartanto L, Estyaniyana A (2002) The potency of Gadong (Dioscorea hispida Dennst) tuber as a
functional food: toxicity, phytochemical content, and starch characters, 00037 (2018). https://doi.
org/10.1063/1.5050133
Hashim P, Shahab N, Masilamani T, Baharom R, Ibrahim, R (2009) A cosmetic analysis in
compliance with the legislative requirements, halal and quality control 11(1)
Hudzari RM, Ssomad MAHA, Rizuwan YM, Asimi MNN, Abdullah BC (2011) Development of
automatic alkaloid removal system for Dioscorea hispida 1(1):16–20. https://doi.org/10.5923/j.
fs.20110101.03
Johari MA, Khong HY (2019) Total phenolic content and antioxidant and antibacterial activities of
Pereskia bleo
Kumoro AC, Retnowati DS, Budiyati CS (2012) Water solubility, swelling and gelatinization prop-
erties of raw and ginger oil modified Gadung (Dioscorea hispida Dennst) flour water solubility,
swelling and gelatinization properties of raw and ginger oil modified Gadung (Dioscorea hispida
Dennst)
Lim TK (2016) Edible medicinal and non-medicinal plants: volume 10, modified stems, roots, and
bulbs. Springer Netherlands. https://books.google.com.my/books
Om AD (2016) Phytochemical screening of Ubi Gadong (Dioscorea hispida) by using GC-MS
phytochemical screening of Ubi Gadong (Dioscorea hispida) by using GC-MS
Sasiwatpaisit N, Thitikornpong W, Palanuvej C, Ruangrungsi N (2014) Dioscorine content in
Dioscorea hispida dried tubers in Thailand by TLC-densitometry and TLC image analysis
6(4):803–806
Sonthanasamy RSA, Ahmad WYW, Fazry S, Hassan NI, Lazim AM (2016) Transformation of
crystalline starch nanoparticles into highly luminescent carbon nanodots: toxicity studies and their
applications. Carbohydr Polym 137:488–496. https://doi.org/10.1016/j.carbpol.2015.11.021
Sultana B, Anwar F, Ashraf M (2009) Effect of extraction solvent/technique on the antioxidant activ-
ity of selected medicinal plant extracts 2167–2180. https://doi.org/10.3390/molecules14062167
Tamaroh S, Raharjo S, Murdiati A, Anggrahini S (2018) Total phenolic content and antioxidant
activity of anthocyanin extract from purple yam (Dioscorea Alata) flour using different solvents.
https://doi.org/10.3923/pjn.2018.260.267
Tapera M, Machacha S (2017) Matrix solid phase dispersion extraction and screening of phy-
tochemicals from Dioscorea steriscus tubers of Mashonaland Central Province. Zimbabwe
8(1):117–122
Theerasin S, Baker AT (2009) Analysis and identification of phenolic compounds in Dioscorea

hispida Dennst. As J Food Ag Ind 2:547–560
Zhou K, Yu L (2004) Effects of extraction solvent on wheat bran antioxidant activity estimation
37:717–721. https://doi.org/10.1016/j.lwt.2004.02.00
Chapter 18
Coconut Oil Plasticizer as a Replacement
of Petroleum Oil in Natural Rubber
Compound: Physical and Mechanical
Properties
Farhana Othman and Nismahasyirah Alang Ismail
Abstract Plasticizer that is derived from petroleum oil has been used commercially
in rubber compounding especially in tyre industries. Despite its harmful effect to the
environment, the urge to replace this nonrenewable source is needed. Coconut oil has
a great potential as a natural plasticizer source. The aim of this study was to inves-
tigate the effectiveness on the physical and mechanical properties of natural rubber
with different amounts of coconut oil (2, 4 and 6 phr). The rubber compounding was
performed on a two-roll mill machine. The composition of fatty acid in the oil was
examined by using gas chromatography flame ionization detector (GC-FID). The
predominant saturated fatty acid was found to be lauric acid. Meanwhile, the natural
rubber compound showed a significant reduction in cure time to 4.15 min and highest
torque development at 8.67 dN m. In addition, the mechanical properties were sig-
nificantly improved at 4 phr of coconut oil loading, which gave good tensile strength
at 18.26 MPa and elongation at break for 1859.05%. The crosslink density was at
3.15 × 10−4 gm/mol/cm3 . Therefore, coconut oil exhibits as one of the sustainable
source for plasticizing oil and it is known to be environmentally friendly.
Keywords Coconut oil · Plasticizer · Natural rubber · Compounding
18.1 Introduction
Over the past decade, plasticizer is added with materials such as resin or elastomer
to make them more stretchy, softer, and easy to process (Sears and Darby 1982). The
plasticizer selection is largely dependent on elastomer that will be used as specific
target of the product. This suitability is required in order to achieve greater compat-
ibility between the plasticizer used with the elastomer. According to Bergaman and
Trimbach (2014), addition of the non-polar plasticizer in the non-polar elastomers
F. Othman (B) · N. A. Ismail

Universiti Teknologi MARA, 02600 Arau, Perlis, Malaysia
e-mail: farhana2876@uitm.edu.my
N. A. Ismail
e-mail: nismahasyirah@gmail.com

204 F. Othman and N. A. Ismail
such as natural rubber (NR) will reduce the mixing time and soften the roll compound
(Bergaman and Trimbach 2014). The suitable plasticizer added to elastomer will be
resulting a non-oily surface of the elastomer and the compound can be mixed very
well.
In Malaysia, the commercial solid grade NR products known as Standard Malaysia
Rubber (SMR) have several commons grade such as SMR GP, SMR 5, SMR 10, and
SMR 20. The common grades used in automotive industries: molding and extruded
rubber products are SMR 10 and SMR 20 (Kumpulan Ladang-ladang Perbadanan
Kedah Sdn Bhd 2018). The fundamental property of NR is elasticity. According
Norwood et al. (2014), the compounding techniques for NR can be accomplished by
two methods which are (1) mixing compounding machine and (2) the two-roll mill
machine (Norwood 2014). The two-roll mill machine was opted for easy application.
The specific rubber formulations are natural rubber, accelerator, and crosslinking
reagents. The reinforced filler and plasticizing agent were added into compounding
to improve the elasticity of the NR. All the ingredients were measured in parts per
hundred rubber (phr) by weight. Therefore, the suitable plasticizing oil and reinforced
filler are crucial in determining a good compatibility toward the rubber compounding.
Typically, plasticizers used in the rubber industry are mineral oil that originated
from petroleum-based (Jamarani et al. 2018). Mineral oils are categorized based on
the content to the aromatic paraffinic and naphthenic hydrocarbon. All mineral oils
are nonpolar and relatively cheap, therefore, common plasticizer such as polyisoprene
(IR), polybutadiene (BR), styrene butadiene (SBR), and ethylene propylene (EPR or
EPDM) are widely been used in this industry. In small quantities of mineral oils (range
5–40 phr) were able to soften the rubber, reduce the hardness, and improve the flow
(Petrovic et al. 2013). However, one of the major drawbacks with the petroleum-based
oils is that it comes from nonrenewable sources. Hence, continuous use of the mineral
oils in the polymer compound will give a bad effect on the environment when it is
disposed to the landfill and dump (Zanchet et al. 2016). Furthermore, the mechanical
properties of NR have shown only minimal effectiveness and improvement by using
commercial mineral oil.
Consequently, coconut oil has been explored as a great potential for good alternate
plasticizer in a polymer manufacturing. Coconut oil is a plant-based oil that comes
from a dried coconut kernel that has about 60–65% of oil content with a coconut
aroma (Gutierrez et al. 2014). This oil content about 88.5% of the medium chains
saturated fatty acid such as lauric acid to myristic acid and some unsaturated fatty
acid (11.5%) such as oleic acid and the linoleic acid (Gopala Krishna et al. 2010).
The high fatty acid content can be advantageous to the rubber even when used in a
small amount which can act as an activator (Wilson 1995).
In this study, different ratios amount of coconut oil as a sustainable plasticizer
compounded in the natural rubber were developed. The fatty acid content in coconut
oil was determined by using chromatographic technique. The cure characteristics of
compounded NR, including scorch time, cure time, and torque development were
determined. The mechanical properties of NR compound, such as tensile strength,
elongation at break, and 100% modulus were evaluated. The physical properties of
NR compound were assessed by hardness testing and crosslinking density.
18 Coconut Oil Plasticizer as a Replacement of Petroleum Oil … 205
Natural rubber with grade Standard Malaysia Rubber (SMR 10) was supplied by
Rubber Research Institute Malaysia (RRIM), and it was used as the rubber matrix.
Other compounding ingredients, such as sulfur, zinc oxide, stearic acid, and N-
cylcohexylbenzothiazole-2-sulpheamide (CBS), were supplied by Bayer Co. (M)
Sdn. Bhd., Petaling Jaya, Selangor, Malaysia. Carbon black (HAF N-330) was used
as a reinforcing filler in rubber compounding.
18.2.1 Determination of Fatty Acid Composition in Coconut

Oil
A coconut oil extract was prepared using wet process techniques. 500 ml of coconut
milk were boiled for 4 h until the oil was observed to be separated from the aqueous
phase. Fatty acid composition was examined using gas chromatographic technique
(Bertrand Matthaus 2010). Two grams of oil was added with 0.5 M methanolic
solution and refluxed for 4 min at 60 °C. Then, 7.5 ml of esterification reagent was
added and further refluxed for another 3 min. After cooling to room temperature, the
sample was added with a mixture of 25 ml of saturated NaCl and 12.5 ml ethyl acetate
in the separatory flask. The distinct organic layer of methyl ester was then separated
and analyzed with GC (Agilent Technologies) equipped with a flame ionization
detector. Varian’s capillary column (Varian 589, CP-Sil 88: 100 m long, 0.255 mm ID,
0.2 m film thickness) was used. The temperature conditions operate as follows: oven
temperature program of 150 °C, heated to 200 °C with a rate 5 °C/min, and 20 min
isotherm. Injector and detector temperatures were 300 °C and 325 °C, respectively.
Helium gas was used as a carrier gas with a flow rate of 0.8 ml/min.
18.2.2 Preparation of NR Compound
NR compound was mixed in a two-roll mill (Shanghai Sinan model XK-160 A)

according to the ASTMD 3182-07. Four formulations were designed with some
modification according to Table 18.1. In order to compound NR, the material was
added step by step. Before all the ingredients were fully dispersed, the curing agents
(sulfur) were added and then mixing was continued.
Table 18.1 Rubber formulation

Ingredients Parts per hundred rubber (phr)
Sample 1 Sample 2 Sample 3 Sample 4
Natural rubber 100 100 100 100
(SMR 10)
Zinc Oxide 5 5 5 5
CBS 0.6 0.6 0.6 0.6
Stearic Acid 3 3 3 3
Carbon black 30 30 30 30
(HAF N330)
Sulfur 2.5 2.5 2.5 2.5
Coconut oil 0 2 4 6
18.2.3 Analysis of Curing Characteristics
In order to establish curing characteristics of NR compound, rheometric measure-

ment was carried out using a Hung Ta Rheometer (HT-M 2000) that follow with
ASTM D244. Six grams of the sample was placed between the cone and plate of
the rheometer and the temperature was set at 150 °C for 30 min. Using the informa-
tion obtained from the torque versus time, and the scorch time (t2), cure time (t90),
maximum torque, and the minimum torque were determined.
18.2.4 Mechanical Properties
The dumbbell shape test specimen with dimension 30 × 1 × 7 mm was employed

for this testing. For this purpose, an Instron machine (Model 5567) was employed
and performed according to ASTM D638. The speed of the tensile testing was
500 mm/min at room temperature with the 50 KN load cell. The reading of the
tensile strength, elongation at break, and tensile modulus M100 (stress at 100%
elongation) and M300 (stress at 300% elongation) were recorded.
18.2.5 Hardness Test
Hardness is measured from the depth of indention of a spherical indenter, under a

specified force, into a rubber piece. Hardness test was conducted using durometer
hardness test (shore A) at room temperature. The value was taken after three seconds
when the load was applied on the sample surface. The average value was calculated
by five different locations on each surface area of the samples.
18.2.6 Crosslink Density Measurements
The test specimen with dimensions of 30 mm × 5 mm × 2 mm was soaked in a

beaker containing 30 ml toluene at room temperature and was left for 24 h. Before
being soaked into the toluene, all samples were weighed using electronic balance to
record the initial weight. The beaker was fully covered with aluminum foil to avoid
oxidation. The crosslink density was determined by using Flory–Rehner equation.
The swelling data was applied in calculating the molecular weight between two
crosslinks (MC). The formulae used were as follows:
−ρVsVr1/3
Mc = (18.1)
1n(1 − Vr) + Vr + xVr
where ρ is the density of the natural rubber, Vs is the molar volume of toluene, is the
interaction parameter of the natural rubber, and Vr is the volume fraction of swollen
natural rubber.
Meanwhile, Vr was calculated by using formula:
1
Vr = (18.2)
1 + Qm
Qm is the swollen of natural rubber in toluene. The degree of crosslinking is then

calculated using the formula:
1
V= (18.3)
2Mc
The following constants were used for the calculation procedure:
ρ (SMR10) = 0.92 g/cm3 ; Vs (toluene) = 106.35 cm3 /mol; (SMR10) = 0.390.
18.3.1 Coconut Oil Methyl Ester
Based on the comparison of the retention times measured by analysis of standard

and the retention times measured by the sample, the fatty acids of the measured
sample were identified. The chromatogram of coconut oil (Fig. 18.1), the fatty acid
compositions found were C14:0 methyl myristate, C12:0 methyl laurate, and C16:0
methyl palmitate. Generally, coconut oil contains high saturated fatty acid. In this
case, higher composition of fatty acid in coconut oil was suitable to use in NR for
enhanced colloidal stability and to avoid coagulation (Patil and Benjakul 2018).
Therefore, coconut oil has great potential for rubber compounding.
Fig. 18.1 Chromatogram of coconut oil
18.3.2 The General Characteristics of NR Compound
After vulcanized NR, all the compounds were homogenous and appeared to be very
smooth and has non-oily surface with no separation symptoms as shown in Fig. 18.2.
All the NR compounds were flexible, without pore and cracks. The higher the amount
of coconut oil added into the NR had softened the rubber sheet as compared to the less
amount of coconut oil and control sample. This is due to the large amount of coconut
oil added that were lessening the interconnected force in the polymer medium.
Fig. 18.2 Rubber compound

of vulcanized natural rubber
Table 18.2 Cure characteristics of vulcanized NR compound

Coconut oil Scorch time Cure time Minimum Maximum Torque
(phr) (min) (min) torque, ML torque, MH development
(dN-m) (dN-m) (TMH -TML )
0 1.67 5.65 2.09 6.12 4.03
2 1.74 4.32 1.77 6.99 5.22
4 2.12 4.23 1.65 7.78 6.13
6 2.35 4.15 2.34 11.01 8.67
18.3.3 Cure Characteristics
The scorch time defined as a measured time at the stage of vulcanization begins,
while the cure time measured the time vulcanization started to reach the completion
(Afiratul et al. 2015). It is very important to determine the cure time in order to
identify the optimum physical properties for the vulcanized rubber. From Table 18.2,
the scorch time was increased gradually in opposed to the cure time which was
decreased steadily as increasing amount of coconut oil loading. This indicated that
the coconut oil has an activating effect. Besides, the short time taken for cure time is
due to less heat that had generated to form premature crosslinking during processing
(Chigondo et al. 2013).
Torque development observed the dispersion improvement in natural rubber,
which are the maximum torque value and minimum torque value. There was a grad-
ual rise in the value of torque development from 0 to 6 phr of coconut oil. Mainly,
torque development was affected by the addition of carbon black. Since this study
used constant amount of carbon black, meaning that coconut oil (natural plasticizer)
has played a significant role in the torque development. A study from Raju (2007)
shows that the higher value of torque development shows better filler matrix disper-
sion and leads to better dispersion (Raju 2007). In general, the better the dispersion,
the better the performance of properties of NR compound.
Firstly, Fig. 18.3 illustrates that the tensile strength had significantly increased up
to 4 phr oil loading, but it was slight decreased after addition of 6 phr of coconut
oil. Plasticizer contains fatty acid, which has the ability to stretch rubber matrix
during chemical dispersion and compatibility between polymer matrix and filler.
The addition of coconut oil acts as plasticizer and had remarkably improved tensile
strength. This is because coconut oil is high in saturated fatty acid that decreases the
bound rubber, therefore leads to strong interaction with filler surface (Nasruddin and
Susanto 2018). The declined tensile strength at 6 phr caused by excessive plasticizing
Fig. 18.3 Tensile strength of 25
Tensile Strentgh
NR compound 20
(MPa)
15
10
5
0
0 2 4 6
Coconut oil (phr)
Fig. 18.4 100% Modulus of 4
100 % Modulus (MPa)

NR compound
3
0
0 2 4 6
Coconut oil (phr)
oil contains more carbon chain that disturbs crosslink density of NR (Ginting et al.
2017).
Secondly, Fig. 18.4 shows 100% modulus of NR formulation that are in the range
of 1.799–3.233 MPa. The plasticizing oil mainly affected the rubber matrix disper-
sion. Meanwhile, elongation at break will show to what extent the product may be
able to stretch to the right in place. Thirdly, Fig. 18.5 illustrates the greatest elonga-
tion at break which was 4 phr coconut oil at 1859.05%. The result was exceptionally
great as several studies reported the value of the elongation at break of NR compound
was in the range of 500–800%. This has proven that by adding vegetable oil into vul-
canize rubbers, it tends to resist stretching mechanism of the rubber and hence make
it become stiffer (Chigondo et al. 2013). Nevertheless, at 6 phr of coconut oil, the
trend has slightly decreased to the value of 1839.42%. This is because of the limited
compatibility plasticizer with the rubber matrix, which it promoted less stiffness to
the rubber compound when stress was applied (Aguele and Madufor 2012).
Fig. 18.5 Elongation at 2500

ElongaƟon at break
percentage (%)
break percentage of NR 2000

compound 1500
1000
500
0
0 2 4 6
Coconut oil (phr)
Fig. 18.6 Effect of 34

plasticizer on hardness
33.5
33
32.5
(Shore A)
Hardness
32
31.5
31
30.5
30
0 2 4 6
Coconut oil (phr)
18.3.5 Hardness
The hardness value was influenced by the filler interaction into the matrix. As shown
in Fig. 18.6, the hardness of the natural rubber was gradually decreased as the amount
of coconut oil increased. Based on hardness theory, carbon black as a filler contribute
to the hardness value. But, the addition of coconut oil gives less strength to the rubber
and contributes to less cross-linked network structure within its molecular structure.
In addition, the hardness value shows minimal differences between the samples. This
is because the hardness was greatly influenced by reinforced filler concentration
compared to plasticizer.
18.3.6 Crosslink Density
Figure 18.7 shows the effect of plasticizer toward crosslink density. Generally,
crosslink density was gradually increased up to 4 phr coconut oil, but it was slightly
Fig. 18.7 Effect of 3.332

plasticizer on crosslink
Crosslink density (×10-4)
density 3.33
(gm/mol/cm3)
3.328
3.326
3.324
3.322
3.32
0 2 4 6
Coconut oil (phr)
decreased on the maximum loading of plasticizer. The increasing trends were due
to the additions of coconut oil, which has given a good interaction with vulcan-
ized natural rubber that lead elastically chain numbers. The degrees of crosslink
were comparable to the hardness, modulus, and tensile strength of the natural rubber
(Afiratul et al. 2015). This effect can be related to tensile strength which has been
discussed in the previous part.
18.4 Conclusions
In summary, the natural rubber matrix, fillers and different amounts of coconut oil
as a natural plasticizing oil are successfully compounded and resulted in visually
attractive, very smooth, flexible, and non-oily surface. The extracted coconut oil
from coconut milk was confirmed by GC-FID chromatogram as it contains high
saturated fatty acid. Coconut oil showed improvement on the physical and mechanical
properties of natural rubber compound compared to control sample. After all, 4
phr coconut oil loading was considered as an optimum amount plasticizing oil in
natural rubber compound. This is because the optimum crosslink density has a good
interaction with vulcanized natural rubber. For the optimum conditions, the tensile
strength was at 18.26 MPa, 1859.05% for elongation at break, 2.736 MPa for 100%
modulus, crosslinking value was at 3.32 gm/mol/cm3, and 31.5 for the hardness
value. A promising result for commercial used provided that in-depth analysis of the
natural compound was taken. Further study of these NR compound compared with
commercial mineral oil used by rubber industries should be taken place. A better
understanding of natural plasticizing oil is a promising direction of research, which
perfectly fit into the policy of sustainable development.
References
Afiratul AA, Noriman NZ, Husin K, Sam ST, Ismail H, Mustafa Al Bakri AM, Omar MF, Norhafizah
Z (2015) The addition of imperata cylindric as natural filler in epoxidized natural rubber filled
recycled nitrile glove: cure characteristics and physical properties. Appl Mech Mater 815:39–43
Aguele FO, Madufor CI (2012) Effects of carbonized coir on physical properties of natural rubber
composites. Am J Polymer Science. 2(3):28–34
Bergaman C, Trimbach J (2014) Influence of plasticizer on the properties of natural rubber-based
compounds. Prufen Und Mess Test Meas 40
Bertrand Matthaus MM (2010) Lipid evaluation of cultivated and wild carob seed oil growing in
Turkey. Sci Hortic 130:182
Chigondo F, Shoko P, Nyamunda BC, Guyo U, Moyo M (2013) Maize stalk as reinforcement in
natural rubber composite. Int J Sci Technol Res 2(6):263–271
Ginting EM, Bukit N, Muliani, Frida E (2017) Mechanical properties and morphology natural
rubber blend with bentonite and carbon black. In: innovation in polymer science and technology.
IOP Publishing, Bristol, pp 1–7
Gopala Krishna AG, Raj G, Bhatnagar AS, Prasant Kumar PK, Chandrashekar P (2010) Coconut
oil in chemistry production and its applications. Indian Coconut J 16–18
Gutierrez MC, Nunez-Santiago MDC, Romero-Bastida CA, Martinez-Bustos F (2014) Effect of
coconut oil concentration as plasticizer as a surfactant in the preparation of extruded corn starch
films. Starch 1079–1088
Jamarani R, Erythropel CH, Nicell JA, Leask RL, Maric M (2018) How green is your plasticizer?
Polymer 10:834
Kumpulan Ladang-ladang Perbadanan Kedah Sdn Bhd (2018). From standard Malaysia Rubber.
http://www.klpk.com.my/smr-10-and-smr20/. Accessed 6 Oct 2018
Nasruddin, Susanto T (2018) The effect of natural based oil as plasticizer towards physics-
mechanical properties of NR-SBR blending for solid tyres. In: The 6th international conference
of the Indonesia Chemical Society. IOP Publishing, Bristol, pp 20–27
Norwood, VM (2014). Introduction of Natural Oils into Rubber Compounds. In: Digital Com-
mons@ East Tennessee State University, pp 10–43
Patil U, Benjakul S (2018) Coconut milk and coconut oil: their manufacture associated with protein
functionality. J Food Sci 83(1):1–9
Petrovic ZS, Ionescu M, Milic J, Halladay JR (2013) Soybean oil plasticizer as replacement of
petroleum oil in rubber. Rubber Chem Technol 86(2):233–246
Raju NS (2007) A study on the use of coconut oil as plasticizer in natural rubber compounds. J
Rubber Res 10(1):1–7
Sears JK, Darby JK (1982) The Technology of Plasticizers. Wiley, New York
Wilson AS (1995) Plasticizers principles and practice, 1st edn. Institute of Materials, London,
England
Zanchet A, Garcia PS, Nunes RCR, Crespo JS, Scuracchio CH (2016) Sustainable natural rubber
compounds: naphthenic oil exchange for another alternativefrom renewable source. Int Ref J Eng
Sci 5(12):2319
Chapter 19
Histopathology Alteration of Red Hybrid
Tilapia (Oreochromis Spp.) Caused
by Streptococcus Agalactiae Infection
Ain Auzureen Mat Zin, Ruhil Hayati Hamdan, Mohd Hafiz Jamaludin,
Jasni Sabri and Li Peng Tan
Abstract Streptococcus agalactiae is one of the streptococcal species most fre-

quently associated with disease in aquaculture. The aim of this study was to assess the
histopathology alteration and pathogenicity of S. agalactiae experimentally infected
in red hybrid tilapia, Oreochromis spp. Streptococcus agalactiae was isolated from
kidney of healthy Oreochromis spp. obtained from wet market. Then, 120 of healthy
juveniles of red hybrid tilapia (50–70 g) were injected intraperitoneally with 0.2 ml of
S. agalactiae suspension containing 104 , 105 , 106 , 107 and 108 cfu/ml. Fish with clin-
ical signs of streptococcosis were fixed in 10% buffered formalin and proceeded to
histopathological examination. As a result, LD50 is 105.8 LD50 /ml which is equivalent
with bacterial concentration 6.1 × 106 . The important histopathology findings were
hydropic degeneration of hepatocyte, hypertrophy in liver cells, hemosiderin deposi-
tion and haemorrhages on spleen, dilated of Bowman spaces in glomeruli and nephro-
sis in tubule, and hyperplasia and fusion of secondary lamellae; all these finding were
testament for Streptococcosis. In conclusion, this study showed that S. agalactiae
isolate was able to produce clinical disease in Red hybrid tilapia, Oreochromis spp.
experimentally.
Keywords Histopathology · Pathogenicity · Streptococcus agalactiae ·

Oreochromis spp.
A. A. Mat Zin (B) · R. H. Hamdan · J. Sabri · L. P. Tan

Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, Pengkalan Chepa, Kelantan,
Malaysia
e-mail: ainauzureen@gmail.com
R. H. Hamdan
e-mail: ruhil@umk.edu.my
J. Sabri
e-mail: jasni@umk.edu
L. P. Tan
e-mail: li.peng@umk.edu.my
M. H. Jamaludin
Faculty of Agro Based Industry, Universiti Malaysia Kelantan, Jeli, Kelantan, Malaysia
e-mail: hafiz@umk.edu.my

216 A. A. Mat Zin et al.
19.1 Introduction
Tilapia is an important freshwater fish on global aquaculture. The progressive produc-

tion has led to inapt farm management system, viz, high stocking density, fluctuating
temperature, poor aeration and water exchange that led to stress and increase in sus-
ceptibility to microbial infection. Streptococcus agalactiae can cause outbreak that
will lead to serious mortalities and morbidity (Iregui et al. 2014). In South China, S.
agalactiae was known as pathogenic bacteria agent in tilapia industry (Wang et al.
2013). This bacterium also affected variety of fish species including Nile tilapia,
Oreochromis niloticus (Inocente et al. 2009); silver pomfret, (Pampus argenteus
Euphrase) (Azad et al. 2012); and Ya-fish, (Schizothorax prenanti) (Geng et al.
2012). Infected fish developed clinical signs of exophthalmia, erratic swimming and
ascites (Anshary et al. 2014). Histopathology was used to understand the changes
of sequential pathology of S. agalactiae infection in Oreochromis spp. Hence, the
objectives of this study were to determine the pathogenicity of S. agalactiae in red
hybrid tilapia, Oreochromis spp. and to describe the alteration of histopathology
associated with S. agalactiae.
19.2.1 Bacterial Isolation and Identification
The organ samples, eyes, gills, heart and intestine, were aseptically collected from
each tilapia fish for bacteria isolation using Columbia blood agar (Oxoid, UK). The
organs of tilapia were aseptically dissected and streaked on BA. Then, the cultures
were incubated at 37 °C for 24 h. Suspected S. agalactiae colonies were selected and
further morphology and biochemical test were done such as Gram staining, catalase,
oxidase and indole. S. agalactiae colony confirmation was performed using poly-
merase chain reaction. The bacterial samples were preserved at –20 °C in tryptic soy
broth, TSB (Oxoid, UK) containing 20% glycerol (v/v).
19.2.2 Bacterial Inoculum Preparation
Streptococcus agalactiae was inoculated on trypticase soy agar, TSA (Oxoid, UK) for
fresh colony bacteria. The plate was incubated at 30 °C for 24 h. Inoculated bacteria
suspensions were compared with 0.5 Standard McFarland with approximate bacteria
1.5 × 108 . The bacterial stock was diluted in a 0.85% physiological saline by serial
10-fold serial dilutions (1:10). Spread plate counts technique was used and colony
forming unit was calculated.
19 Histopathology Alteration of Red Hybrid Tilapia … 217
19.2.3 Experimental Fish
Two hundred and twenty of red hybrid tilapia weighing 50–70 g were acclimatized in
500 L tank for two weeks. Fish were fed with 50% crude protein pellets (PrimexTM,
Malaysia) and given twice a day. To determine whether the fish were free from
any bacterial infection, they were randomly sampled, and samples from the liver,
kidney and brain were streaked on TSA (Oxoid, UK). The plates were incubated at
30 °C for 24 h. Feeding was terminated 24 h before doing the experiment. All fish
experiments were conducted in 45 L aquaria at 27 °C. Ten groups of fish and one
control group per isolates were placed in each aquarium 24 h prior to the experiments
for acclimatization.
19.2.4 Pathogenicity Test, (LD50 )
Ten labelled tubes were prepared for 10-fold dilutions for difference suspension
concentration101 –1010 . Each dilution was duplicated and consisted of 10 fish. The
fish were anesthetized with tricaine methanesulfonate (MS-222, Oxoid, UK) at
50 mg/L and intraperitoneally (IP) injection with 0.2 ml per fish. All inoculated
fish were observed daily for any clinical signs, abnormal behaviour or mortalities for
five days after infection. The results of dilution were filled in Reed Muench working
sheet and calculated. Fish were monitored twice a day which was at 0800 a.m. and
1600 p.m. and dead fish was removed, dissected inoculated on TSA and the organ
specimens fixed in buffered formalin.
19.2.5 Histopathological Assessment
Tissue samples (kidney, liver, spleen, heart, eye and brain) were taken from dead
infected fish and fixed in 10% buffered formalin. Samples were processed through a
graded series alcohol and xylene in an automatic tissue processor (Leica 5500, Ger-
many). Tissue were then embedded in paraffin wax and sectioned at 4–5 μm thick-
ness. The sections were stained using haematoxylin and eosin (H&E) and mounted
by DPX. The slides were examined under light microscope.
19.3.1 Determination of Bacteria Concentration (CFU/Ml)
The bacterial concentration was determined by colony forming unit calculation with
6.1 × 106 cfu/ml
19.3.2 Lethal Dose (LD50 ) Challenge
The LD50 of S. agalactiae of Oreochromis spp. was calculated to be 105.8 LD50 /ml
by using Reed–Muench method.
19.3.3 Clinical Signs and Histopathological Finding
There were no significant observations in negative control group. The clinical signs
of infected S. agalactiae were staying motionless on the bottom aquarium, lethargy,
exophthalmia and pale skin on fish body. Gross lesion such as hepatomegaly,
splenomegaly and haemorrhages at operculum, fins and body was observed in 5
post day of infection (dpi) (Fig. 19.1, 19.2, 19.3 and 19.4). Histopathology was
performed only at day 5 of inoculation of S. agalactiae. The clinical signs and
post-mortem findings are showed in Table 19.1.
This study showed that the red hybrid tilapia is susceptible to S. agalactiae.
A total of 8 fish died and 2 fish were alive until day 5 post infection at the end
of experiment. Clinical sign such as erratic swimming, circling around at water
surface and dead infected fish was noticed at day 2 post infection. The death was
Fig. 19.1 Red hybrid tilapia experimentally infected with S. agalactiae at day 5 post infection
showing haemorrhages at body, operculum and eyes (red arrow)
Fig. 19.2 Red hybrid tilapia experimentally infected with S. agalactiae at day 5 post infection
showing pale skin colour and exophthalmia
Fig. 19.3 Red hybrid tilapia experimentally infected with S. agalactiae at day 5 dpi showing
hepatomegaly (red arrow) and exophthalmia (yellow arrow)
Fig. 19.4 Red hybrid tilapia experimentally infected with S. agalactiae at 5 dpi showing an enlarged
spleen (arrow)
Table 19.1 Observation table after inoculation of Streptococcus agalactiae into red hybrid tilapia
Day post inoculation No. of dead fish per Clinical signs Gross lesion
(dpi) day
1 0 No clinical signs No gross lesion
2 1 Erratic swimming, Detachable scale,
circling around at skin discolouration
water surface
3 2 Motionless Detachable scale,
haemorrhages at
operculum
4 4 Lethargy, loss of Exophthalmia,
balance haemorrhages at tail,
operculum and eyes
5 1 Stay at bottom of Bilateral
tank, loss of balance exophthalmia,
haemorrhages
accompanied with scale detachment and skin discolouration. Other clinical sign from
day 3 to day 5 post infection includes motionless (3 dpi), lethargy (4 dpi), loss of
balance (4 dpi and 5 dpi) and stay at the bottom of the tank (5 dpi). Gross lesions
such as detachment of the scales, haemorrhages at the operculum (3 dpi), bilateral
exophthalmia and haemorrhage at multiple parts such as operculum, eyes, body,
pectoral fin, dorsal fin and caudal fin were seen. Control fish showed no clinical
signs or gross changes. This study showed that fish developed gross changes at the
external part of the body and revealed the clinical signs if infected with S. agalactiae.
The control group showed undetectable gross and histopathological alterations, while
infected fish with S. agalactiae isolate showed variable histopathological changes in
gills, liver, kidney and spleen at day 5 post inoculations (dpi). The bacterial isolate
was able to produce clinical disease in red hybrid tilapia with S. agalactiae bacteria.
The sources transmissions of S. agalactiae in fish were associated between fish
species and fish (Evans et al. 2002). If S. agalactiae were from cattle, it was not a
major source of infection (Garcia et al. 2008).
This study was done by using red hybrid tilapia weighing between 50 and 70 g to
stimulate the widespread of S. agalactiae infection. Streptococcus agalactiae infec-
tions were not detected by clinical disease in tilapia/juveniles that has less than 20 g
body weight (Hernández et al. 2009; Jiménez et al. 2011). Streptococcus agalactiae
were isolated at 30 °C and in hot weather regions at 28–33 °C. The transmissions of
S. agalactiae were influenced by hot/dry seasons and hatchery of various farms in
Malaysia (Amal et al. 2013). It were agreed that the high temperature was one of the
stressing factors contributed to Streptococci infection (Inocente et al. 2009). It was
supported that the seasonality and sample sizes were most important conditions in
sampling roles (Bernet et al. 1999). The value of median lethal dose in red hybrid
tilapia infected with S. agalactiae was 105.8 and bacterial concentration was 6.1 ×
106 cfu/ml. Previous study by Amal et al. (2008) stated that the susceptible of LD50 of
S. agalactiae concentration was 3 × 106 cfu/ml definitely causing death. The lethal
median of S. agalactiae for Nile tilapia was 6.8 × 106 and 5.3 × 106 cfu/fish are
quite low but it is high virulence (Wang et al. 2013). Hence, it was proven clinical
isolates of S. agalactiae in this study were more virulent compared with previous
study. However, nor S. agalactiae was cultured from infected fish samples neither
control group. Most probably re-isolations were cultured from kidney and it should
be from same organs isolated earlier such as intestines, eyes, heart and gills. Suppos-
edly the bacteria re-isolation correlates with positive results of S. agalactiae. There
was no significant reason to explain these results. The similar findings showed that
the bacterial re-isolation were decreased over the time and considered that cellular
effective immune response would be established later (Inocente et al. 2009).
Pathological changes had been studied in variety of fish species during disease
infection to determine the level of parameter of healthy and infected fish. Sev-
eral fish showed congested olr pale gills, pale skin colour with detached scales,
splenomegaly and hepatomegaly (Pretto-Giodano et al. 2010; Amal and Zamri-Saad
2011; Mohamed Fawzy et al. 2014). However, there were eyes lesion of exoph-
thalmia observed in red hybrid tilapia but no changes in structure physiology. In this
study, the reactivate of pathogenicity of S. agalactiae inoculation were not in highest
concentration of bacteria. The alternate results in eyes samples outcome caused by S.
agalactiae strains of characterization or environmental factors, and it needs further
determination in future. Few factors that influenced the differences in fish mortality
including bacterial concentration were different types of S. agalactiae strain, age
and weight of fish, period observation of experiment and pathogenicity level (Pretto-
Giordano et al. 2010). The gastrointestinal tract would be considered as a possible
main route of S. agalactiae infection in tilapia (Adikesavalu et al. 2017).
Among all organs, only liver, spleen, kidney and gills, were having alteration of
structure examined by histopathology procedure. The most affected target organs
with S. agalactiae were heart, liver, eye, spleen and brain (Ortega et al. 2016).
The histopathological description of fish samples were correspondent with post-
mortem examination, the haemorrhages of kidney, pale gills and enlargement of liver
and spleen. The histopathology findings were the hydropic degeneration of hepato-
cyte, hypertrophy in liver cells, hemosiderin deposition and haemorrhages on spleen,
dilated of Bowman spaces in glomeruli and nephrosis in tubule and hyperplasia and
fusion of secondary lamellae; all these finding were testament for Streptococosis.
The finding in spleen showed that the fish developed haemorrhages of blood vessel
cumulated at red pulp area, and was possibly consisting of sinusoidal phagocytic
tissue which has large number of red blood cell (Fig. 19.5). Hemosiderin depositions
that appeared were caused by degenerative process of haemoglobin molecules during
the destruction of red blood cell. The focal macrophages infiltration were in spleen
tissue and the erythrocytes and hemosiderin in splenic red pulp (Jantrakajorn et al.
2014). The Streptococcus infection and melanomacrophages association might be
used as biomarker for water quality (Inocente et al. 2009). Contaminated water could
affect Oreochromis spp. during the hatchery or acclimatization periods (Fig. 19.6).
Histopathological changes of kidney were tubular cytoplasmic degenerative and
dilated of Bowman spaces in glomeruli was observed after 5 day of post challenge
Fig. 19.5 Hemosiderin

deposition (red arrow) in
spleen of a red hybrid tilapia
infected with S. agalactiae at
5 dpi (400×, H&E)
Fig. 19.6 Hydropic

degeneration of hepatocyte
in the liver (black
arrow) showed hepatocytes
adjacent to the central vein
(CV) appeared to be
enlarged (hypertrophy) (red
arrow) of a red hybrid tilapia
infected with S. agalactiae at
5 dpi (400×, H&E)
(Fig. 19.7). Severe degenerative occurrence in nucleus and cytoplasmic (nephro-

sis) in tubule cells proximal tubules were damaged due to deposition of hyaline
droplet in distal kidney (Fig. 19.8). Kidney in Nile tilapia infected with S. agalac-
Fig. 19.7 Dilated of

Bowman’s space (red arrow)
formed in glomeruli of
kidney of a red hybrid tilapia
infected with Streptococcus
agalactiae at 5 dpi (1000×,
H&E)
Fig. 19.8 Nephrosis in

tubule (arrow) of kidney of a
red hybrid tilapia infected
with Streptococcus
agalactiae at day 5 post
infection (1000×, H&E)
tiae also yielded glomerulopathy with dilated Bowman’s capsule and reduces the
tubular lumen with vacuolation (Adikesavalu et al. 2017). The lesion in kidney and
spleen infected by S. agalactiae may intercept the immune systems and host sus-
ceptibility increased towards infection with other microorganism (Laith and Najiah
2013). The results of liver specimens showed that the haemorrhages and enlarged
paled liver revealed the hydropic degeneration changes of hepatocyte accompanied
with enlarged nucleus at central vein, hypertrophy. The histopathological changes in
liver notified the degeneration of hepatocytes and congestion due to its disability to
detoxify the foreign object and caused the dysfunctional of liver or death (Laith and
Najiah 2013). The lesion that was observed in the liver as proliferation and hypertro-
phy with S. agalactiae in this study was consistent with Ortega et al. 2016). Degen-
eration of nuclei with inflammatory cells was similar in Acipenser baerii infected
with S. agalactiae (Deng et al. 2017). The finding results showed that, a major organ
like liver showed multiple pathological alterations including hemosiderin deposition,
vacuolation, and haemorrhagic (Adikesavalu et al. 2017).
The results showed that the species of Oreochromis spp. infected with S. agalac-
tiae demonstrated the alteration of structure and cause hyperplasia of epithelial cells
at primary filament and fusion of secondary lamellae (Fig. 19.9). Deterioration in
lamellae epithelium could be a possible route of Streptococci to penetrate into fish
host due capillaries to the nerve tissues (Azad et al. 2012). Hyperplasia, fusion and
shortening of secondary gill lamellae are in stage one of severity of gill alterations
(Flores-Lopes and Thomaz 2011).
19.4 Conclusions
Thus, the results obtained in the present work are indicative that S. agalactiae isolated
from healthy fish inflicted disease in red hybrid tilapia (Oreochromis spp.). In this
study, the detection of the pathogenicity in S. agalactiae was divulged and it might
Fig. 19.9 Hyperplasia at

primary of epithelial cells
(red arrow) and fusion at
secondary lamellae (black
arrow) of the gills of red
hybrid tilapia infected with
S. agalactiae at day 5 post
infection (100×, H&E)
bear severely the aquaculture industry in Kelantan as well as the consumers with
adverse effect.
Acknowledgements The authors wish to thank Ministry of Malaysian Education for granted Niche
Research Grant Scheme Project 5 (R/NRGS/A07.00/00413A/006/000150).
References
Adikesavalu H, Banerjee S, Patra A, Abraham TJ (2017) Meningoencephalitis in farmed mono-

sex Nile tilapia (Oreochromis niloticus L.) caused by Streptococcus agalactiae. Arch Pol Fish
25(3):187–200
Amal MNA, Nur-Nazifah M, Siti-Zahrah A, Sabri MY, Zamri-Saad M (2008) Determination of LD50
for Streptococcus agalactiae infections in red tilapia and GIFT. In: 8th International symposium
on tilapia in aquaculture, pp 1245–1251
Amal MNA, Zamri-Saad M, Siti-Zahrah A, Zulkafli AR (2013) Transmission of Streptococcus
agalactiae from a hatchery into a newly established red hybrid tilapia, Oreochromis niloticus (L.)
x Oreochromis mossambicus (Peters), farm. J Fish Dis 1–5
Amal MNA, Zamri-Saad M (2011) Streptococcosis in tilapia (Oreochromis niloticus): A Review.
Pertanika J Trop Agric Sci 34(2):195–206
Anshary H, Kurniawan RA, Sriwulan S, Ramli R, Baxa DV (2014) Isolation and molecular identifi-
cation of the etiological agents of Streptococcosis in Nile tilapia (Oreochromis niloticus) cultured
in net cages in Lake Sentani, Papua, Indonesia. SpringerPlus, 3:627
Azad IS, Al-Marzouk A, James CM, Almatar S, Al-Gharabally H, Qasem JA (2012) Outbreak
of natural Streptococcosis in hatchery produced silver pomfret (Pampus argenteus Euphrasen)
larvae in Kuwait. Aquaculture 330–333:15–20
Bernet D, Schmidt H, Meier W, Wahli T (1999) Histopathology in fish: proposal for a protocol to
assess aquatic pollution. J Fish Dis 22:25–34
Deng ML, Yu ZH, Geng Y, Wang KY, Chen DF, Huang XL et al (2017) Outbreaks of Streptococcosis
associated with Streptococcus iniae in Siberian sturgeon (Acipenser baerii) in China. Aquac Res
48(3):909–919
Evans JJ, Klesius PH, Gilbert PM, Shoemaker CA, Al Sarawi MA, Landsberg J et al (2002) Char-
acterization of β-haemolytic group B Streptococcus agalactiae in cultured seabream, Sparus
auratus L., and wild mullet, Liza klunzingeri (Day), in Kuwait. J Fish Dis 25:505–513
Flores-Lopes F, Thomaz AT (2011) Histopathologic alterations observed in fish gills as a tool in

environmental monitoring. Braz J Biol 71(1):179–188
Garcia JC, Klesius PH, Evans JJ, Shoemaker CA (2008) Non-infectivity of cattle Streptococcus
agalactiae in Nile tilapia, Oreochromis niloticus and channel catfish. Ictalurus Punctatus Aquac
281(1–4):151–154
Geng Y, Wang KY, Huang XL, Chen DF, Li CW, Ren SY et al (2012) Streptococcus agalactiae, an
Emerging Pathogen for Cultured Ya-Fish, Schizothorax prenanti. China Transbound Emerg Dis
59(4):369–375
Hernández E, Figueroa J, Iregui C (2009) Streptococcosis on a red tilapia, Oreochromis sp., farm:
a case study. J Fish Dis 32(3):247–252
Inocente FC, Müller EE, Pretto-Giordano LG, Bracarense APF (2009) Histological findings of
experimental Streptococcus agalactiae infection in Nile tilapias (Oreochromis niloticus). Braz J
VetY Pathol 2(1):12–15
Iregui C, Barato P, Rey A, Vasquez G (2014) Epidemiology of Streptococcus agalactiae and Strep-
tococcosis in tilapia fish. Epidemiology: theory, research & practice, 1st Edition iConcept Press
Ltd
Jiménez A, Tibatá V, Junca H, Ariza F, Verjan N, Iregui C (2011) Evaluating a nested-PCR
assay for detecting Streptococcus agalactiae in red tilapia (Oreochromis sp.) tissue. Aquaculture
321(3):203–206
Jantrakajorn S, Maisak H, Wongtavatchai J (2014) Comprehensive investigation of Streptococcosis
outbreaks in cultured Nile tilapia, Oreochromis niloticus, and red tilapia, Oreochromis sp., of
Thailand. J World Aquac Soc 45(4):392–402
Laith AR, Najiah M (2013) Aeromonas hydrophila: Antimicrobial susceptibility and histopathology
of isolates from diseased catfish, Clarias gariepinus (Burchell). J Aquac Res Dev 5:2
Mohamed Fawzy N, Osman KM, Mai El-D, El-S I, Mohamed NMA, Abd-Elrahman SS (2014)
Streptococcosis in tilapia: clinico-pathological picture of experimentally infected tilapia. Life Sci
J 11(9):1005–1012
Ortega YA, Barreiro FS, Bueno HM, Huancaré KP, Ostos HA, Manchego AS et al (2016) First
report of Streptococcus agalactiae isolated from Oreochromis niloticus in Piura, Peru: molecular
identification and histopathological lesions. Aquac Rep 4:74–79
Pretto-Giordano LG, Müller EE, de Freitas JC, da Silva VG (2010) Evaluation on the Pathogenesis
of Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus). Braz Arch Biol Technol
53(1):87–92
Wang K-y, Chen D-f, Huang L-y, Lian H, Wang J, Xiao D et al (2013) Isolation and characterization
of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus in China. Afr J Microbiol
Res 7(4):317–323
Chapter 20
Ethnobotanical Study on Flowering
Plants Along with Phytochemicals
and Antioxidants Analysis on Selected
Plumeria Species
Nur Illani Abdul Razak, Siti Sumaiyah Syahida Hassan

Abstract Even though ethnobotanical flowering plants were traditionally used for
treatment and to maintain health, scientific study is still lacking in literature. There-
fore, the aim of this study is to link the traditional application of the most commonly
used ethnobotanical flowering plants with scientific evidences. Eleven types of differ-
ent flowers had been identified among local medicinal practitioners for this purpose.
Based on the semi-structured interview, the Plumeria rubra and Plumeria obtusa
were 100% used by respondents. The phytochemicals analysis was conducted toward
P. obtusa and P. rubra by using Preliminary Qualitative Phytochemicals Screening.
The presence of secondary metabolites such as flavonoids, saponins, tannins, and
phenolic compounds were detected on the qualitative screening toward both species.
These compounds have a role in antimicrobial and antioxidants activities. For antiox-
idant test, DPPH scavenging activity is used on five different concentrations of both
species ranging from 0.01 to 100 mg/ml. It was found that at the higher concentration
of extract, the DPPH scavenging activity is increased. In short, both Plumeria species
are rich with secondary metabolites and has a potential to be used for antioxidant
treatment.
Keywords Ethnobotany · Phytochemicals · DPPH scavenging activity · P.

obtusa · P. rubra
N. I. A. Razak (B) · S. S. S. Hassan

Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA,
Perlis Branch, 02600 Arau, Perlis, Malaysia
e-mail: illanirazak@uitm.edu.my
S. S. S. Hassan
e-mail: sumaiyah5068@gmail.com
N. A. H. A. Nasir
Faculty of Applied Sciences, Universiti Teknologi MARA,
Perlis Branch, 02600 Arau, Perlis, Malaysia
e-mail: atikah1388@uitm.edu.my

228 N. I. A. Razak et al.
20.1 Introduction
Ethnobotany is the study of how culture and region make use of indigenous plants
and studies how they used plants for food, shelter, medicine, clothing, hunting, and
religious ceremonies (Martin 2004). Aromatherapy, on the other hand, involves the
use of high-quality essential oils and aromatics derived from plants to cure the dis-
eases by entering the body through the airway and applied to the skin (Ali et al.
2015). The methods and preparations are available which providing a wide range of
application options such as inhalation, massages, aromatherapy bath, sauna, and oth-
ers (Michalak 2018). The medicinal, aromatic plants and local knowledge remains
poorly documented in the scientific literature and greatly threatened by urbaniza-
tion (Ismail et al. 2018). The necessity of the collection and documentation of plant
species with therapeutic and aromatic properties as well as the traditional knowledge
is associated to their identification, conservation, and uses (Barata et al. 2014). Young
generations have little awareness of the significance of the value and consumption
of medicinal and aromatic plants (Barata et al. 2014). The usage of synthetic drugs
over long time has started exhibiting serious side effects toward the users (Ram-
proshad et al. 2012). Thus, it is important to pay attention to the herbs, medicinal,
and aromatic plants (Barata et al. 2014). This will ensure that the side effect from
the usage of synthetic drugs will be decreased. The objectives of the study are to
screen the plants that are commonly used by local traditional practitioners in Arau,
Perlis in aromatherapy applications and determine the phytochemicals compounds
and potential antioxidants activity of the selected plants.
Nowadays, the medicinal and aromatic plants have the potential in the indus-
trial products and applications such as aromatherapy applications, pharmaceuticals,
cosmetics, cosmetics, soaps, pharmaceuticals, perfumery, confectionery, and others
(Joy et al. 2016). The traditional medicine as a set of knowledge, skills, and practices
based on theories, beliefs, and experiences that come from different culture whether
explained, these are used to maintain health and for the purpose of prevention, diag-
nosis, recovery, or treatment of physical and mental illness. Traditional medicines
and aromatic plants, including herbal medicines have been used and continue to be
used in most of the countries around the world. This study was focusing the screen-
ing the aromatic plants used for aromatherapy applications based on the traditional
practices by the traditional practitioner in Arau, Perlis. The two most frequently used
flowers were selected for phytochemicals and antioxidants analysis.
20 Ethnobotanical Study on Flowering Plants Along with Phytochemicals … 229
20.2.1 Study Area
This study was conducted at Arau, Perlis. The latitude is 6º26´0´ńorth, while lon-
gitude 100º16´0´éast. Perlis is situated in Peninsular Malaysia, 14 km southeast of
the official state capital of Kangar.
20.3 Ethnobotanical Data
A total of 15 local medicinal practitioners were chosen as respondents for this study.
Verbal information was obtained through semi-structured interviews guided by a
predetermined set of questions during each visit. Informal discussion was also applied
to the respondents for them to clarify information conveniently. Plants specimens
were also collected during each field trip as genuine data in documenting plants used
in aromatherapy application practice among the medicinal practitioners. The plants
were pressed, dried, labeled, and preserved in herbarium for future use. The plant
species were then identified with the help of available books and literature such as the
Tropical Horticulture and Gardening and 1001 Garden Plants in Singapore books
(Chen et al. 2015).
20.4 Sample Extraction Process
Collection and Preparation of Flowers’ Samples. P. obtusa and P. rubra flowers

were gathered and rinsed with distilled water before being dried at 60 °C for three
days. The samples were then grinded into powder and stored for further use (Ruban
& Gajalakshmi 2012).
Flower Extraction of P. obtusa and P. rubra. 36 g of powdered flower were used
for the extraction using Soxhlet extractor for 6–8 h with 200 mL of 80% methanol.
Then, the extracted were concentrated at 50 °C by using rotary evaporator. The extract
was placed in a tight bottle and keep in the chiller for further use (Jamkhande et al.
2015).
20.5 Phytochemicals Screening Assay
Test for Flavonoids. 1 mL of extract was mixed with a few drops of 20% NaOH
solution. The yellow color that appeared in the tube turned colorless when a few
drops of HCl were added. This indicated the presence of flavonoids (Chudasama
et al. 2018).
Test for Phenolic. The extracts were diluted with a few drops of FeCl3 solution.
Formation of blue black color solution indicates the presence of phenolic compound
(Chudasama et al. 2018).
Test for Tannins. 2 mL of extract was added with 10% alcoholic FeCl3 solu-
tion. The presence of blue or greenish color solution shows the existence of tannins
(Chudasama et al. 2018).
Test for Saponins. 20 mL of distilled water was diluted with extract in the tube for
15 min. The mixture was shaken, and the formations of foam showed the existence
of saponins (Chudasama et al. 2018).
20.5.1 DPPH Free Radical Scavenging Assay
The antioxidant activity of the extracts was measured by using 2,2-Diphenyl-1-

picrylhydrazyl (DPPH) scavenging assay (Al-Abd et al. 2015). 0.1 mM concentration
of DPPH was prepared by diluting with methanol, while the concentration of flower
extracts was diluted to get the concentration of 0.01, 0.1, 1, 10, and 100 mg/mL. The
mixture was incubated for 30 min in a dark room and the absorbance was measured
at 517 nm (Wong et al. 2011). The antioxidant activity was conducted in triplicates
and the mean values with ± SD were calculated. The percentage of inhibition was
determined by comparing the results of the antioxidant assay with the control and
expressed as percent inhibition as follows:
Absorbance (DPPH) − Absorbance (DPPH + samples)

% inhibition = × 100
Absorbance
The data collected was analyzed using SPSS software version 20.0. All values were
shown as means ± SD. One-way analysis of variance (ANOVA) with Tuckey’s HSD
and Post Hoc test was used for the comparison among multiple groups, where p <
0.05 was considered as significant (Gull et al. 2012).
20.6.1 Ethnobotanical Result
The demographic data was obtained from the respondents in Arau, Perlis in aro-
matherapy applications. Based on the Table 20.1, the age of the traditional practi-
tioners that involved in traditional knowledge and aromatherapy applications in Arau,
Perlis shows the highest percentage of age on the range of 51–60 years was 53.3%.
The moderate percentage of the age of the range 71–80 years was 20.0% and the
lowest percentage was 13.3% are involved the range of 40–50 years and 61–70 years.
The understanding and practice of traditional medicine have been affected by the age
group in which the age of 50 years and older understands the traditional medicine and
implementations (Ismail et al. 2018). The age range below 40 years shows that the
traditional transfer of knowledge to the young generation is considered poor, which
can cause the practice to erode. The research disclosed that the transfer of medic-
inal plant knowledge to the young generation is influenced by modernization and
may be associated with a decrease in the young generation’s interest in indigenous
knowledge (Jima and Megersa 2018). Knowledge is hard to pass from the elderly to
the younger generation and is focused among the family’s senior members (Mowobi
et al. 2013).
The highest percentage regarding the involvement of the practitioners in the tra-
ditional medicinal practiced is 5–10 years (46.7%). The moderate percentage is 11–
20 years (33.3%) and the lowest is (13.3%) on 21 years and above. The highest per-
centage is 5–10 years due to the ability of the practitioners to receive the knowledge
and practice it to the users in order to create job opportunities and income. Besides,
the lowest percentage on 21 years and above is possibly due to the disabilities of
the practitioners to practice the knowledge. Previous study indicated that knowledge
of medicinal plant uses, and their features are generally acquired, accumulated, and
Table 20.1 The demographic information of respondents in Arau, Perlis

Demographic information Percentages (%)
Age (years) 40–50 13.3
51–60 53.3
61–70 13.3
71–80 20.0
Involvement in traditional medicinal practitioners 5–10 years 46.7
11–20 years 40.4
21 years and above 13.3
Occupation Small-scale business 20.0
Housewives 66.7
Others 13.3
transmitted from generation to generation after a long experience (Zougagh et al.

2019). The occupation of the traditional practitioners shows the highest percentage
on housewives (66.7%) followed by small-scale business (20%), and others (13.3%).
This result ensures that the practitioners are able to generate their income and create
job opportunities through the aromatherapy applications practices. Previous research
indicated that a certain percentage of individuals make a living from the usage of
medicinal and aromatic plants, hence the need to encourage it in order to guarantee
that individuals know the advantages and significance of crops (Cheikhyoussef et al.
2011).
20.6.2 Identification of Aromatic Plants
Majority of the plants used by the traditional practitioners are fragrance plants that
are excellently used in aromatherapy applications. Based on Table 20.2, P. obtusa and
P. rubra flowers were selected for extraction based on the highest numbers of flowers
used for further phytochemicals screening and antioxidant analysis by using Soxhlet
extraction and DPPH free radicals scavenging activity method based on the highest
number of usages by the practitioners. The percentages yield extract obtained a total
of 55.56% for P. obtusa and 44.44% of P. rubra. P. obtusa shows high percentage
of yield extract than P. rubra. The yield extract proportion was above 40%. Previous
research with the largest yield extract percentages is created through the methanol
solution (Hassim et al. 2015). The solvent polarity and its chemical structure will
affect the extraction output (Goli et al. 2005).
Table 20.2 The aromatic plants used by the traditional practitioners

No. Scientific name Local name Family No. of flowers used
1. Cananga odorata Kenanga Nyctaginaceae 12
2. Gardenia carinata Gardenia hutan Rubiaceae 6
3. Jasminum sambac Melur Oleaceae 12
4. Magnolia champaca Cempaka kuning Magnoliaceae 5
5. Magnolia alba Cempaka putih Magnoliaceae 8
6. Mimusops elengi Bunga Tanjung Sapotaceae 5
7. Murraya paniculata Kemuning Rutaceae 7
8. P. obtusa Kemboja Putih Apocynaceae 15
9. P. rubra Kemboja merah Apocynaceae 15
10. Rosa cultivars Mawar Rosaceae 15
11. Vallaris glabra Kesidang Apocynaceae 7
Table 20.3 The

Phytochemicals compounds Types of plants
phytochemicals compounds
of P. obtusa and P. rubra P. obtusa P. rubra
Flavonoid + +
Saponins + +
Tannins + +
Phenolic + +
20.6.3 Screening of Phytochemicals Components on

P. obtusa and P. rubra Flowers Extract
Based on Table 20.3, the result revealed the presence of saponins, tannins, flavonoid,
and phenolic compound for the both species. The primary source of natural antiox-
idant is plants in the form of phenolic compounds such as flavonoids, phenolic
acids (Ali et al. 2015). Phenolic compounds are commonly discovered in medicinal
plants, and strong antioxidants are reported in many edible plants and flavonoids
and were continuously protective by scavenging reactive oxygen (Halliwel 2007).
Flavonoids are well known as antioxidant and free radical scavengers (Sasaki et al.
2002). The presence of saponin in both Plumeria species was the reason why the
plants were used to treat hypertension (Fahey 2005). Screening of phytochemicals is
very essential in the identification of fresh sources of therapeutic compounds such as
phenolic, alkaloids, flavonoids, saponin, and tannins (Akindele and Adeyemi 2007).
Thus, detection of the bioactive principles and subsequently may lead to the drug
discovery and improvement are useful through the preliminary screening test.
20.6.4 Antioxidant Activity of Flower Extract
DPPH radical scavenging activity of methanolic extract of P. obtusa and P. rubra was
used to screen the potential antioxidant. Table 20.4 shows the percentage of DPPH
inhibition for the potential antioxidant test.
Based on Table 20.4, there is significant difference between the concentrations
of flowers extract. The highest percentage of DPPH inhibition was exhibited at
Table 20.4 The percentages of DPPH inhibition for the potential antioxidant activity
Samples Concentration (mg/mL)
0.01 0.1 1 10 100 p-value
P. obtusa 19.09 ± 0.10 28.55 ± 0.05 49.25 ± 0.05 61.88 ± 0.07 76.19 ± 0.15 0.00
P. rubra 6.33 ± 0.03 31.77 ± 0.02 57.12 ± 0.02 68.24 ± 0.04 70.58 ± 0.08 0.00
Ascorbic 12.22 ± 0.26 31.72 ± 0.03 42.47 ± 0.19 57.14 ± 0.05 65.06 ± 0.05 0.00
acid
100 mg/mL with 76.19% ± 0.15 for P. obtusa and 70.58% ± 0.08 for P. rubra.
Meanwhile, the lowest DPPH inhibition was detected at 0.01 mg/mL for both species.
19.09 ± 0.10% was recorded for P. obtusa and 6.33 ± 0.03% was recorded for P.
rubra. The percentage of inhibition is increased when the concentration of extract
is increased. The scavenging ability might contribute by the presence of secondary
metabolites such as flavonoids, saponins, and tannins. These compounds can protect
the biological systems as they can pass on the free radical and electron (Abdullah
et al. 2012).
20.7 Conclusions
In the conclusion, there are eleven types of aromatic plants used by the traditional
medicinal practitioners in Arau, Perlis. P. obtusa and P. rubra have been selected
based on the highest usage of the plants by the respondents for phytochemicals and
antioxidants analysis of the flowers. In addition, the antioxidants activity of flowers
extract demonstrated a significant potential antioxidant activity with the percentage
of inhibition at the concentration 100 mg/mL, respectively.
References
Abdullah N, Zulkifli KS, Abdullah A, Aziman N, Kamarudin WS (2012). Assessment on the

antioxidant and antibacterial activities of selected fruit peels. Int J Chem Tech Res 4(4):1534–1542
Akindele AJ, Adeyemi OO (2007) Antiinflammatory activity of the aqueous leaf extract of
Byrsocarpus coccineus. Fitoterapia 78(1):25–28
Al-Abd NM, Mohamed Nor Z, Mansor M, Azhar F, Hasan MS, Kassim M (2015) Antioxidant,
antibacterial activity and phytochemical characterization of Melaleuca cajuputi extract. BMC
Complement Altern Med 15(1):385
Ali B, Al-Wabel NA, Shams S, Ahamad A, Khan SA, Anwar F (2015) Essential oils used in
aromatherapy: a systemic review. Asian Pacific J Trop Biomed 5(8):601–611
Barata AM, Rocha F, Lopes V, Figueiredo AC, Bettencourt E (2014) Medicinal and aromatic
plants-Portugal
Cheikhyoussef A, Shapi M, Matengu K, Ashekele, HM (2011) Ethnobotanical study of indigenous
knowledge on medicinal plant use by traditional healers in Oshikoto region, Namibia. J Ethnobiol
Ethnomed 7(1):10
Chen L, Ang WF, Ng A, Teo J, Tang J (2015) 1001 garden plants in Singapore. National Parks
Chudasama RG, Dhanani NJ, Amrutiya RM, Chandni R, Jayanthi G, Karthikeyan K (2018) Screen-
ing of selected plants from semi-arid region for its phytochemical constituents and antimicrobial
activity. J Pharmacognosy and Phytochem 7(2):16–22
Fahey JW (2005) Moringa oleifera: a review of the medical evidence for its nutritional, therapeutic,
and prophylactic properties. Part 1. Trees for life J 1(5):1–15
Goli AH, Barzegar M, Sahari MA (2005) Antioxidant activity and total phenolic compounds of
pistachio (Pistachia vera) hull extracts. Food Chem 92(3):521–525
Gull I, Saeed M, Shaukat H, Aslam SM, Samra ZQ, Athar AM (2012) Inhibitory effect of Allium
sativum and Zingiber officinale extracts on clinically important drug resistant pathogenic bacteria.
Ann Clin Microbiol Antimicrob 11(1):8
Halliwell B (2007) Biochemistry of oxidative stress. Biochem Soc Trans 35(5):1147–1150

Hassim N, Markom M, Anuar N, Dewi KH, Baharum SN, Mohd Noor N (2015) Antioxidant and
antibacterial assays on Polygonum minus extracts: different extraction methods. Int J Chem Eng
Hirano R, Sasamoto W, Matsumoto A, Itakura H, Igarashi O, Kondo K (2001) Antioxidant ability of
various flavonoids against DPPH radicals and LDL oxidation. J Nutr Sci Vitaminol 47(5):357–362
Ismail NA, Sabran SF, Mohamed M, Abu Bakar MF (2018) Ethnomedicinal knowledge of plants
used for healthcare by the Javanese-Malay community in Parit Jelutong, Batu Pahat, Johor,
Malaysia. In: AIP conference proceedings
Jima TT, Megersa M (2018) Ethnobotanical study of medicinal plants used to treat human diseases
in Berbere district, Bale zone of Oromia regional state, south east Ethiopia. Evidence-Based
Complementary and Alternative Medicine
Joy PP, Mathew S, Jose G, Joseph J (2016) Aromatic plants. Aromatic and Medicinal Plants Research
Station
Martin GJ (2004) Ethnobotany: a methods manual
Michalak M (2018) Aromatherapy and methods of applying essential oils. Arch Physiother Glob
Res 22(2):25–31
Mowobi GG, Abubakar S, Osuji C, Etim VN, Ogechi N, Egya JJ (2013) Ethnobotanical survey of
medicinal plants used for the treatment of skin disease in Keffi, Nigeria. Am J Phytomed Clin
Ther 4:73–90
Ramproshad S, Afroz T, Mondal B, Khan R, Ahmed S (2012) Screening of phytochemical and
pharmacological activities of leaves of medicinal plant Plumeria rubra. Int J Res Pharm Chem
2(4):1001–1007
Sasaki K, Abe H, Yoshizaki F (2002) In vitro antifungal activity of naphthoquinone derivatives.
Biol Pharm Bull 25(5):669–670
Wong SK, Lim YY, Abdullah NR, Nordin FJ (2011) Antiproliferative and phytochemical analyses
of leaf extracts of ten Apocynaceae species. Pharmacognosy Res 3(2):100
Zougagh S, Belghiti A, Rochd T, Zerdani I, Mouslim J (2019) Medicinal and aromatic plants used
in traditional treatment of the Oral pathology: the Ethnobotanical survey in the economic capital
Casablanca, Morocco (North Africa). Nat Prod Bioprospecting 9(1):35–48
Chapter 21
i-Kids Science Courseware Toward
Sustainability Education
for Hearing-Impaired Students
Darleena Eri Zeti, Adilin Mohd Abd Majid Hayati,

Nurulhikmah Syed Yasin Sharifah, Salbiah Hamzah Siti and Raju Rajeswari
Abstract The learning practice and syllabus used by hearing-impaired (HI) students
today are the same as the conventional ones used by other normal students. Through
user specification interview, it is found that the learning materials are not tailor-
made for HI students and are often claimed to be difficult and unattractive to them.
They use different ways of communication that may cause delay in understanding
the learning contents. Current learning materials are still lacking for HI students,
especially the digital resources that they can use repetitively. The main purpose for
i-Kids Science courseware using User Centered Model (UCD) is to help in providing
assistive learning material in sustaining learning ability for HI students. Interestingly,
it is provided with Malay sign language videos that assist them to study; which is
a unique feature added to sustain their learning process. The topic selected is Acid
and Alkali which is the hardest topic for the students to understand and practice.
The UCD model is used to develop the courseware that consists of four phases:
understand user requirements, establish requirements, courseware specification, and
design. The evaluation parameters for the courseware are interface design, navigation,
multimedia elements, usability, contents, and activities. The results showed on the
interface design at the highest mean received is 4.51 with SD = 0.50, respectively.
Finally, this approach is expected to improve the learning process among HI students
D. E. Zeti (B) · N. S. Y. Sharifah · S. H. Siti · R. Rajeswari

Faculty of Computer and Mathematical Science, Universiti Teknologi MARA (UiTM),
Terengganu Branch, Kuala Terengganu Campus, Kuala Terengganu, Terengganu, Malaysia
e-mail: zetid415@uitm.edu.my
N. S. Y. Sharifah
e-mail: nurulhikmah@uitm.edu.my
S. H. Siti
e-mail: salbiah7922@uitm.edu.my
R. Rajeswari
e-mail: rajes332@uitm.edu.my
A. M. A. M. Hayati
Faculty of Hotel and Tourism Management, Universiti Teknologi MARA (UiTM), Terengganu
Branch, Dungun Campus, Kuala Terengganu, Malaysia
e-mail: hayati2959@uitm.edu.my

238 D. E. Zeti et al.
in ASEAN and other developing countries to sustain the lifelong learning among
students with disability.
Keywords Courseware · Hearing-impaired · Sustainable education
21.1 Introduction
In the field of education, the use of multimedia especially computers have permeated
in every classroom. The use of courseware through the combinations of multimedia
elements contained in it can help students learn more effectively as they focus on
important content on the topics presented. In addition to saving time, effort and cost
of spending, students can also experience an engaging learning experience through a
combination of textual elements, graphic, audio, video, and animation. In addition to
facilitating the delivery of teaching and learning processes, educational technology
can also prevent the tiredness of the teachers as well as to sustain the student’s interest
while entertaining students.
Courseware is educational material for teachers or trainers or as a tutorial for
students, usually packaged for use with computers. Courseware is also known as
educational software intended to facilitate teaching and learning sessions.
In primary school, the curriculum for basic learning such as Malay, English, and
Islamic Education subjects for Special Needs Student or “Murid Berkeperluan Khas”
(MBK) are tailored to the students’ abilities, and they have their own module for the
subject. However, the “Kurikulum Berasaskan Sekolah Rendah” (KSSR) for Science
subject for MBK is similar to the mainstream KSSR subject for a normal student. So,
the courseware development for special needs students is required to help students
in the process of learning. It is to make sure that they can enjoy learning and that
they have no excuse for why they cannot achieve success like normal students just
because of their hearing impairment.
21.1.1 Problem Identification
Based on an interview conducted at Sekolah Kebangsaan Pendidikan Khas Kuala

Terengganu (SKPKKT), there are problems identified as following:
Firstly, HI student is easy to mislay their focus due to the difficulty to understand
new words and remember what they have learned at class. Besides that, this is because
their short-term memory is quite weak and need to keep revising. They cannot answer
properly and share the previous information when being asked by the teacher during
revision. They fail to read and understand by themselves which at the end resulted
in the laziness and in giving up. This is supported by Awang et al. (2010) that HI
students have a deprived memory problem. The memory weakness factor is because
an object seen by a hearing-impaired student is difficult to be associated with another
21 i-Kids Science Courseware Toward Sustainability Education … 239
object in their memory. This causes the memory of something learned will not last
long.
The second problem is the shortage of support materials provided for the HI stu-
dents at school. Since they have this problem, they mostly use sign language to com-
municate with each other compared to the normal children. Teaching techniques are
also dissimilar compared to regular daily schools. Hence some support materials pro-
vided are essential to help them learn proficiently. Furthermore, today’s support mate-
rials need improvement and are no longer suitable to be used by hearing-impaired
students as it is more suitable for normal students (Ow et al. 2007).
The third problem is the languages used in the book that are provided to the stu-
dent are quite complex and not user-friendly to HI students. It is needed to simplify
and figure out what is the best way to teach them effortlessly. Students with verbal
communication problems will have difficulty in expressing what they want to com-
municate through speech and have difficulty in understanding the conversation of
others (Yusoff and Mohamed 2014). This may cause learning process getting bored
and less fun that instantaneously affects their motivation to keep learning.
21.1.2 Aim and Solution
The teachers also find it difficult to teach HI students because they face the same
problem which is, they lack digital resources and teaching aids to teach them inter-
actively. According to “Science Senior Teacher” Puan Raja Azianwati Raja Ismail,
they only use a textbook that is provided by KPM which is similar to that of the nor-
mal children. Hence to have extra info or materials for teaching they need to search
some information from the Internet or by their own creativity which may take time,
extra effort and money. Thus, the interactive courseware is necessary to help the chil-
dren increase their understanding in learning that may reduce some burden among
the teachers. The courseware is aimed to (1) identify features and requirements in
designing science modules for hearing-impaired students; (2) design and develop
User-Centered Design Courseware for hearing–impaired students using Cognitive
Learning Theory and (3) evaluate usability and the functionality of the developed
courseware.
21.2.1 Multimedia Courseware
Multimedia is the combination of text, image, sound, animation, and video which
is delivered to the end user by computer or other electronic or digitally manipu-
lated means (Vaughan 2006). In addition, multimedia can simply be explained as an
electronic means of presenting information to an audience.
While courseware is a term that combines the words “course” with “software”
and courseware learning. It is known as the process of learning through a courseware
(Pavnesh 2012). According to Parrott and Kok (1997), courseware can be defined
as instructional material delivered in electronic format. Courseware also has been
known as computer-based learning (CBL).
Computer-based learning refers to the use of the computer as a tool for facil-
itating and improving instruction. CBL programs use tutorials, drill and practice,
simulation, and problem-solving approaches to present topics and to test the stu-
dent’s understanding. CBL uses a combination of the multimedia element which is
the combination of text, graphics, sound, and video in the learning process. It is
especially useful in a distance learning situation (Han et al. 2013).
21.2.2 Hearing Disability
World Health Organization defines disability as any restriction or lack of ability to

perform an activity in the manner or within the range considered normal for human
design. Therefore, hearing disability is the inability to hear the everyday sound, in
either quiet or noisy backgrounds, in a manner which is normal for humans.
According to Thierry (2016) the term impairment means something is not working
correctly or as well as it should. Hearing loss, or hearing impairment, happens when
there is a problem with one or more parts of the ear or ears, the nerves coming from
the ears, or the part of the brain that controls hearing.
21.2.3 Courseware as Supported Technology for Sustainable

Education
Educational technologies have flourished in all application areas and create enormous
influences. Multimedia technology has a speedy cutting-edge in current Malaysian
education perspective in delivering course material to students via interactive course-
ware (Kamaruddin 2015). These include technological approaches for hearing-
impaired students (Hashim et al. 2013). Hearing-impaired students do not have the
ability to distinguish sounds. Their communication was impacted from mild to severe
hearing impairment as diagnosed (Egaga and Aderibigbe 2015). However, with tech-
nology, they have a chance to interconnect with friends and others in an instructional
environment. The modernization helped them in various parts of their life including
enhancement in their learning process that may build positive attitude and increase
self-esteem (Shepherd and Alpert 2015).
This is in agreement as Baglama et al. (2018) stated that training technology
positively helps impaired students to build more learning desire, spark their curiosity,
and create realistic experience. According to Goldman and Pellegrino (1987) as cited
in Baglama et al. (2018), technologies applied such as computer training programs has
improved academic skills, language, mathematics, literacy, and competence among
disabled children as well as enhance their attention period and sustain their learning
process among them.
Mazlina et al. (2012) have created a multimedia courseware for hearing-impaired
students, where they have developed a prototype by using multimedia features such
as graphics, text, animation, and audio. This study has proposed a courseware for
hearing-impaired pre-school children to understand and memorize alphabets, num-
bers, and words by using multimedia elements such as picture, text, video, sound,
and animation. In addition, Ahmad et al. (2010) demonstrate the use of game-based
courseware known as Playtime Learning that contains play games and fun activities.
The courseware helps students with learning disability to explore their capabilities
at their own speed and build basic skills as well as to having fun in learning it. The
acceptance test revealed that teachers and students were well adapted to the learning
tool. They positively show interest to use the courseware in future.
In summary, the use of technology has been recognized to demonstrate the abil-
ity of learners in thinking, writing, and speaking courageously (Beal-Alvarez and
Cannon 2014). This was really helpful to nurture and preserve more interest among
them, being actively taking part in classroom and have a greater rate of concentration
than other peers in traditional on-site classes and online (Shepherd and Alpert 2015).
Hence, undeniably the current technology on mobile devices and laptop has been
prominently recognized not only to easy access but also to outpour social, emotional,
and behavioral performance for students beside than education solely (Fitzpatrick
and Neild 2017). This concomitantly gives them more entertaining learning and more
courage to practice determinedly in their daily life. Thus, Asian and other develop-
ing countries can absolutely sustain the education performance among them and give
some outstanding achievement in future.
21.3 Development Methodology
21.3.1 UCD Model Phases
UCD is one of the essential concepts in usability engineering and areas that set
designing interactive application as their goals. UCD is a design that is based on the
Table 21.1 Content requirement in i-Kids science courseware

No. Requirement Description
1 Interactive science courseware The hearing-impaired student and their
teachers can learn “Asid dan Alkali” with
more enjoyable
2 Kenali Sifat Kimia Bahan dan Contoh HI student can learn, distinguish, and
categorize each type of chemicals based on
acid and alkali
3 Experiment perubahan Kertas Litmus HI student can learn and see the changes of
color of filter paper
4 Uji pengetahuan HI student can do the quizzes to test their
knowledge and understanding
5 Permainan Hi student can play after learning and test
their understanding
actual requirement of users and comprises of task analysis, prototype development

with users, and interactive design. UCD method has four phases which are analysis to
understand user requirement, establish the requirement, design phase, and evaluation
phase. Table 21.1 shows the UCD model phases.
Understand User Requirement. In this phase it helps with the understanding that
the current scenario of learning session flow for HI students at SKPKKT in order
to gather the information, an interview session and literature review was conducted
with a Special Education School Teacher to obtain some information that may help
to further study. The interview is to identify the current process of teaching process
of Science Year 5 subject.
Establish a Requirement. In this phase, the requirement is gathered from lit-
erature review and the interview session with the SKPKKT teacher who has many
experiences in teaching HI student. The i-Kids Science courseware will be focused
on primary school students with hearing impairment and their teacher. From the
interview session, the appropriate content and design are obtained. Table 21.1 shows
the content required in i-Kids Science courseware for HI students.
Create Design and Development. Next phase is to create design solution and
development phase. Based on product goals and requirements, the developer starts
an iterative process of product design and development. The developer uses the
multimedia element to translate the content material to complete information which
came from the result of specifying the content of use and specific requirements. In
this phase, the i-Kids Science courseware will start to develop based on the designs
using site map for overview of contents and storyboard for content design.
Evaluate. The last phase is to evaluate Product phase. Evaluation is the process
of examining the process to determine whether the program is working or not. In
this phase, the Product designers do usability testing to get users’ feedback on the
product. Product evaluation is a crucial step in product development which gives
critical feedback of the product. The i-Kids Science courseware was evaluated by
distributing the questionnaire to 35 respondents and 3 experts.
21.3.2 Cognitive Learning Theory
Normally the information that went to be enrolled in long-term memory should be

through temporary storage in sensory memory and working memory. But because of
the capacity and the ability of work memory is very limited, not all the information
through it will fit into long-term memory.
Students need to repeat the lesson several times to understand the concept of
learning. Moreover, the repetition process performed through instructional software
more helps students to remember something rather than a repetition process through
printed material (Gagne 1985). The cognitive learning criteria are based on learning
experience elements of friendliness and learning material elements of simplicity and
interaction.
21.3.3 Interactive Scenes
i-Kids Science Courseware has been developed to attract and help HI students of
year 5 in learning Acid and Alkali topic. Some of the interactive pages are shown
in Figs. 21.1, 21.2, and 21.3. Figure 21.1 shows the menu page of the courseware
and consists of menu of “JOM BELAJAR,” “JOM MAIN,” and “JOM UJI”. Every
button will change the color of the words when the user touches the button. All the
buttons also have sound when the user clicks on it. Figure 21.2 shows the interface
of “JOM BELAJAR”. This page contains image and text related to the subtopic.
Figure 21.3 shows the explanation in sign language in Malay language with Malay
subtitles. With features in Fig. 21.3 provides repetitive features for HI students to
help them with revision.
Fig. 21.1 Menu page

Fig. 21.2 Subtopics page
Fig. 21.3 Malay sign language
21.4 Results
i-Kids Science was evaluated by two methods which were (1) by user acceptance
test and (2) two experts for courseware evaluations.
21.4.1 User Testing
In order to conduct the user evaluation, a questionnaire was self-distributed with

35 respondents which contained six constructs. The description of the constructs
which are the interface, navigation, multimedia, usability, and activities is shown in
Table 21.2. As for Fig. 21.4 shows the overall mean descriptive analysis results of
Table 21.2 Constructs description for evaluation

Constructs Description
A: Interface Interface design including font size, colors, icons are consistent,
clear, suitable, and interesting
B: Navigation Provide adequate navigation functions that are easy to operate,
proper labels and effectively
C: Multimedia Elements The text, images, sound, animation, and video are properly applied
D: Usability User-friendly, ease of use, provide user interaction to use
E: Content The topic covers according to syllabus, relevant, make the content
interesting and easy to understand
F: Activities Provide activities related to the topics, proper response and
appropriate test on the content
4.62
4.6
4.58
4.56
4.54
4.52
4.5
4.48
4.46
Fig. 21.4 Graph of mean of all construct
the courseware. The figure displays the mean of each construct. Mostly, the mean
that is responded by the respondents is 4 which is “Agree” and it is consistent for all
from item in construct A until F. The overall average of construct A is 4.51, construct
B is 4.54, construct C is 4.54, construct D is 4.51, construct E is 4.60, and construct
F is 4.54.
21.4.2 Expert Evaluation
This courseware was being evaluated by two experts in their respective fields. Basi-
cally, the expert is being asked in terms of interface, usability, multimedia, naviga-
tion, efficiency, and activities that are in the courseware. They were asked to test the
courseware and write down the comment and suggestion towards the courseware.
Table 21.3 Experts’ feedbacks for improvisation

Expert Section Comment Suggestion
1 Interface Add menu bar –
Usability – –
Activities Lack of instruction for user Need to improve detail
information
User experience Use a systematic navigation –
Efficiency – –
Multimedia Lack of animation and video –
2 Interface Interesting Need to improve certain part
Usability Ok Need to improve certain part
Activities Ok –
User experience Ok –
Efficiency Ok –
Multimedia Very good. Interesting Add more animation at game
Based on the question that has been distributed, both experts have their own
opinions and suggestion regarding the courseware. The comment and the suggestion
that the part of the courseware needs to be improved are as shown in Table 21.3.
Table 21.3 shows the first expert review comment and suggestion. All the comment
and suggestion were taken for improvement and enhancement for the final product.
21.5 Conclusion
i-Kids Science Courseware has been developed in purpose to help students and teach-
ers in the learning process and teaching about Acid and Alkali topic. For students,
this courseware will help them to study by their selves. Meanwhile, for teachers, it
can help them to attract their student’s attention during learning session and also as
additional tools for learning. This courseware contains all elements of multimedia
which is text, animation, sound, video, and image. With this courseware, the lesson
becomes more attractive, interesting, and more fun. This courseware contains video,
animation, and image which can make sure users enjoy while using it.
As a conclusion, i-Kids Science courseware had been successfully developed to
help the standard 5 students with hearing problems to enhance their knowledge about
one of the science topics. The courseware has included five multimedia elements
which are text, animation, images, sound, and videos to attract the students to learn
acid and alkali topic. In also contains video with the sign language that can help
the student to revise the topic as many times they want. Overall, i-Kids Science
courseware has brought joyfulness and is useful to the users especially standard 5
students with hearing-impaired problems.
Moreover, all these three objectives of this project had been successfully achieved.
This courseware can give benefits to the students, teachers, and others. Furthermore,
the development of this courseware also can help the user to learn more about this
topic. There are several aspects of this courseware that could be improved and mod-
ified for future enhancement. The improvements are achievable in a matter of time.
Overall, this courseware can be of such significant benefit to the users.
References
Ahmad WFW, Akhir EAP, Azmee S (2010) Game-based learning courseware for children with
learning disabilities. In: 2010 international symposium on information technology, vo. 1. IEEE,
pp 1–4
Awang MH, Zakaria HB, Shafie BHM, Talib NHF, Kassim N (2010) Persepsi pelajar bermasalah
pendengaran terhadap pembelajaran fardhu ain: Cabaran terhadap guru. In: Proceedings of the
4th international conference on teacher education: join conference UPI & UPSI, pp 240–250
Baglama B, Haksiz M, Uzunboylu H (2018) Technologies used in education of hearing-impaired
individuals. Int J Emerg Technol Learn (iJET) 13(09):53–63
Beal-Alvarez J, Cannon JE (2014) Technology intervention research with deaf and hard of hearing
learners: levels of evidence. Am Ann Deaf 158(5):486–505. https://doi.org/10.1353/aad.2014.
0002
Egaga PI, Aderibigbe SA (2015) Efficacy of information and communication technology in
enhancing learning outcomes of students with hearing impairment in Ibadan. J Educ Pract
6(30):202–205
Fitzpatrick M, Neild R (2017) Assistive technology in the classroom. benefits deaf and hard of
hearing students. Gallaudet University Laurent Clerc National Deaf Education Center
Gagne ED (1985) The cognitive psychology of school learning. Little, Brown and Company, Boston,
MA
Han OB, Halim NDBA, Shariffuddin RSB, Abdullah ZB (2013) Computer based courseware in
learning mathematics: potentials and constrains. Procedia Soc Behav Sci 103:238–244
Hashim H, Tasir Z, Mohamad SK (2013) E-Learning environment for hearing impaired students.
Turk Online J Educ Technol TOJET 12(4):67–70
Kamaruddin N (2015) Understanding patterns of interactive courseware use within malaysian
primary smart schools. Malays Online J Educ Technol 3(1):49–56
Mazlina AM, Ananthi KM, Herawan T (2012) A design of educational multimedia software for dis-
ability: a case study for deaf people. In: The international conference on modelling and simulation,
pp 28–30
Ow SH, Mokhtar S, Zainuddin R (2007) A Review on the teaching and learning resources for the
deaf community in Malaysia. CMU J 165
Parrott L, Kok R (1997) courseware: An overview. Can Agric Eng 39(2):131
Pavnesh (2012) Multimedia: component and applications. Retrieved from https://www.
indiastudychannel.com/resources/151966-Multimedia-Components-Applications.aspx
Shepherd CM, Alpert M (2015) Using technology to provide differentiated instruction for deaf
learners. J Instruct Pedagogies 16
Thierry M (2016) What’s Hearing Loss? Retrieved from https://kidshealth.org/en/kids/hearing-
impairment.html
Vaughan T (2006) Multimedia: making it work. Tata McGraw-Hill Education
Yusoff A, Mohamed C (2014) Masalah Pembelajaran: Tanda dan Simptom Kecacatan Komunikasi
Lisan Murid Pendidikan Khas. Jurnal Bahasa 14(2):301–324
Chapter 22
Phytochemical Screening and Potential
DPPH Radical Scavenging Activity
of Banana Peel Extract
Nor Atikah Husna Ahmad Nasir, Nurul Atikah Liana Roslly,
Nurul Miza Rosli and Zainab Razali
Abstract Every year, about one-third of banana and its peels are discarded as waste
without maximizing their potential. Previous reports showed that the by-product
of banana peels is rich with phenolics compound and influenced by various fac-
tors including varieties, maturity, and cultivation. However, most present researches
are only limited to these factors. In this study, the unknown varieties of banana
peels were collected around Arau, Perlis and the potential of antioxidant proper-
ties of banana peels was evaluated. Soxhlet extraction method was used for the
extraction, and five different concentrations of the crude extract were prepared
and analyzed using DPPH (1,1-Diphenyl-2-picrylhydroxyl) assay method. Results
that showed the highest scavenging activity was recorded at 1000 mg/mL which
was up to 94.13 ± 0.11%. Meanwhile, the lowest scavenging activity was recorded
at 0.1 mg/mL. In phytochemicals identification, flavonoids, alkaloids, tannins, and
glycosides were found. Through GC/MS analysis, antioxidant compounds such
as 2-pentenoic acid, 3-ethyl-methyl ester, 2-tetradecene, pentafluoropropionic acid,
4-hexadecyl ester, and 1-hexadecene were detected. The presence of these com-
pounds plays an important role in neutralizing free radicals and reducing their power
to cause damage.
Keywords Banana peels · Phytochemicals · Antioxidants · DPPH scavenging

activity
N. A. H. A. Nasir (B) · N. A. L. Roslly · N. M. Rosli · Z. Razali

Department of Biology, Faculty of Applied Sciences, Universiti Teknologi MARA, 02600 Arau,
Perlis, Malaysia
N. A. L. Roslly
e-mail: atikahliyana96@gmail.com
N. M. Rosli
e-mail: nurulmiza1904@gmail.com
Z. Razali
e-mail: zainab215@perlis.uitm.edu.my

250 N. A. H. A. Nasir et al.
22.1 Introduction
Free radicals are highly reactive chemicals that contain oxygen. These free radi-
cals are produced continuously in daily life either naturally or via exposure from
environmental stress, as well as other factors that can contribute to many oxidative
damage such as aging, uneven skin tones, and texture (Montelongo et al. 2010). This
is because free radicals tend to damage some of the essential cellular molecules in a
body (Baskar et al. 2011a, b). However, human bodies have their own defense systems
for radical detoxification. One of it is through antioxidant which is well-known as an
agent that can slow down or prevent the oxidative damage process towards human
bodies. Most of the time, these oxidative damages can be treated by using synthetic
antioxidants such as butylated hydroxytoluene (BHT), tertiary butylhydroxyanisole
(TBHQ), butylated hydroxyanisole (BHA), and propyl gallate (PG). Unfortunately,
most of these synthetic antioxidant supplements can have severe effect if taken for
a long time (Azmi 2010). This is because these supplements contain chemicals that
can cause side effects to human health and eventually contribute to severe diseases
such as cancer and Alzheimer’s disease (Muhammad 2006).
Thus, it is vital to seek an alternative to replace the current available synthetic
antioxidants in the markets. Fruits and vegetables such as garlic, ginger, mango, and
banana have been traditionally used for the purpose. However, not many are aware
that the crops waste from these fruits and vegetables also contain high and natural
antioxidants.
Banana flesh and its peel have the potential to possess antioxidant and antifungal
activities because of their rich phytochemical compounds. Banana peels are naturally
used as a home remedy for several skin problems including skin irritation and allergic.
It also can reduce skin problem conditions including reducing bruises, getting rid of
warts, aging, treating poison ivy, treating rashes irritation from mosquito bites, and
managing wrinkles (Montelongo et al. 2010). Recent trends focus on the isolation,
characterization, and application of natural antioxidants is gaining attention. Thus, it
would be worthwhile to investigate the natural antioxidant compounds offered by the
banana peel (Baskar et al. 2011a, b). Instead of providing scientific data on banana
peels, this research focuses on sustaining waste management issues caused by food
crops (Sundram et al. 2011).
22.2 Methods
22.2.1 Preparation of Banana Sample
1 kg of banana peel was collected from various stalls along the roadside in Arau.
The banana peels were sliced into small pieces and washed with distilled water to
remove any adherent particles. Next, the peels were dried for 48 h, at 50 °C in the
oven. Then, the dried banana peels were ground into fine powders by using electronic
22 Phytochemical Screening and Potential DPPH Radical … 251
blender and stored in airtight container to prevent them from contamination (Kumar
and Reddy 2017).
22.2.2 Banana Peel Extraction
25 g of banana peel sample was immersed in thimble with 95% of ethanol by con-
tinuous hot percolation using the Soxhlet apparatus for 6 h refluxing up to six times.
The extract was filtered and concentrated using a rotary evaporator at 50 °C and
stored in the refrigerator at 4 °C (Kumar and Reddy 2017). Percentage of yield was
calculated as below:
Mass dry concentration crude extraction
× 100% (22.1)
Mass powder plant sample
22.2.3 Antioxidant Assay
DPPH Scavenging Test. The antioxidant capacity of the banana peels was deter-
mined by using free radical scavenging effect on the 1,1-diphenyl-2-picrylhydrazyl
(DPPH) radical. Five different concentrations (1000, 100, 10, 1, and 0.1 mg/mL were
dissolved in 95% ethanol) of banana peel extract and standard ascorbic acid were
prepared and taken in different test tubes. 4.0 mL of 0.2 mmol/L freshly prepared
1, 1-diphenyl-2-picrylhydrazyl (DPPH) methanolic solution was added into 40 µL
of banana peel extract with different concentration (Baskar et al. 2011a, b). Finally,
the mixture was shaken gently and was incubated in dark at room temperature for
30 min before the absorbance was read at 517 nm by using UV-visible spectropho-
tometer (Bashir et al. 2015). The DPPH radical scavenging was calculated by using
the following equation:
Abs DPPH − Abs(DPPH + Sample)

%= × 100% (22.2)
Abs DPPH
22.2.4 Preliminary Qualitative Phytochemical Analysis
Banana peel extraction was subjected for flavonoids, terpenoids, alkanoids, tannins,
and glycosides.
Flavonoids. 5 mL of diluted ammonia solutions was added to aqueous filtrate
of the banana peel extract followed by the addition of concentrated hydrochloric
acid (HCl) and was mixed vigorously. The formation of yellow coloration after one
minute indicates the presence of flavonoids (Velumani 2016).
Alkaloids. 3 mL of the extract was added into 1 mL of 1% HCl before adding a
few drops of Meyer’s reagent. The appearance of a creamy white precipitate indicates
the presence of alkaloids (Velumani 2016).
Tannins. Two drops of 5% FeCl3 were added into 1 mL of the banana extract.
The appearance of a dirty green precipitate indicates the presence of tannins (Bashir
et al. 2015).
Glycosides. 1 mL of the extracts was mixed with 1 mL of water in a test tube fol-
lowed by the addition of 1 mL of NaOH. A yellow precipitate indicates the presence
of glycosides in two minutes (Bashir et al. 2015).
22.2.5 Identification of Phenolic Compounds by GC/MS
The phenolic compounds of banana peel extract were analyzed by using Agilent’s gas
chromatography model 6890 (Agilent Technology). Helium was used as carrier gas
at 1.0 mL/min via injection in split less mode. First, the starting temperature was set at
110 °C and was held for three minutes, then increased to 200 °C at a rate of 5 °C/min,
then increased to 250 °C at a rate of 10 °C/min and lastly maintained at 250 °C for
10 min. The component identification was based on the comparison of their mass
spectra with those in Wiley Registry of Mass Spectral Data and National Institute of
Standard and Technology 05MS (NIST) mass spectral library data (Mustapha et al.
2015).
The data of DPPH Scavenging Activity was analyzed by using Analysis of Variance
(ANOVA) test. TUKEY test was used to determine the differences between means
at the 0.05 probability level (P ≤ 0.05). SPSS software was used to conduct all the
statistical analysis (Jalani et al. 2014).
22.3.1 Extraction of Banana Peels
Through the extraction of banana peels, 20.26% of crude extract was recorded. How-
ever, the percentage of yield extracted was quite low than the expected yield. This
might be attributed to the presence of impurities in the samples that might affect the
chemical reaction in banana peel extract during the continuous hot percolation using
Soxhlet apparatus (Azhar et al. 2012).
22.3.2 Antioxidant Properties
DPPH Scavenging Test. Radical scavenging activity of ethanol extract of banana

peels was determined by using DPPH Scavenging test. The banana peel extract was
diluted to get different concentration varying from 0.1, 1, 10, 100 to 1000 mg/mL.
Figure 22.1 shows the percentage of inhibition versus concentration between sam-
ple banana peel extract and ascorbic acid. Meanwhile, Table 22.1 shows statistical
analysis of the antioxidant on the banana peel extracts.
Based on Fig. 22.1, the highest percentage of inhibition of the antioxidant activity
of banana peel extract was exhibited by the concentration of 1000 mg/mL with 94.13
± 0.11%, followed by 100 mg/mL (79.89 ± 1.45%), 10 mg/mL (62.83 ± 0.55%),
1 mg/mL (60.06 ± 0.41%), and 0.1 mg/mL (41.38 ± 0.71%). In short, the percentage
of inhibition of banana peel extract increased when the concentration increased. The
same pattern was observed when comparing the DPPH scavenging activities with
ascorbic acid.
The scavenging ability exhibited by banana peel extract might be due to the
presence of flavonoids, alkaloids, tannins, and other related compounds. These com-
pounds can protect the biological system as they can pass on the free radical and
electron (Ahmed and Zeinab 2016).
Free radicals were reduced by antioxidant compound present in the samples and
cause color changes of DPPH solution from violet to yellow as molar absorptivity
of DPPH radical decreases when the free radical easily accepts electron or hydrogen
120 Percentage of Inhibition (%) vs Concentration (mg/ml)
95.8 96.28
Percentage of Inhibition (%)
100
94.13
79.89
80 70.62
64.51
59.61 62.83
60 60.06
41.38
40
20
0
0 0.1 1 10 100 1000
Concentration (mg/ml)
% Standard (Ascorbic Acid) % Sample (Banana Peels)
Fig. 22.1 Percentage of inhibition versus concentration between samples and ascorbic acid
Table 22.1 Statistical analysis of antioxidant test of banana peel extract

Confidence Limits
95% confidence limits for conc 95% confidence limits for log(conc)a
Probability Estimate Lower Upper Estimate Lower Upper
bound bound bound bound
Probit 0.010 0.615 −0.211
0.020 0.519 −0.285
0.030 0.465 −0.332
0.040 0.429 −0.367
0.050 0.402 −0.396
0.060 0.380 −0.421
0.070 0.361 −0.442
0.080 0.346 −0.461
0.090 0.332 −0.479
0.100 0.320 −0.495
0.150 0.274 −0.562
0.200 0.243 −0.614
0.250 0.219 −0.660
0.300 0.199 −0.701
0.350 0.183 −0.738
0.400 0.168 −0.774
0.450 0.155 −0.809
0.500 0.144 −0.843
0.550 0.133 −0.877
0.600 0.122 −0.912
0.650 0.113 −0.948
0.700 0.103 −0.986
0.750 0.094 −1.026
0.800 0.085 −1.072
0.850 0.075 −1.125
0.900 0.064 −1.191
0.910 0.062 −1.207
0.920 0.060 −1.225
0.930 0.057 −1.244
0.940 0.054 −1.265
0.950 0.051 −1.290
0.960 0.048 −1.319
0.970 0.044 −1.354
0.980 0.040 −1.401
0.990 0.033 −1.475
a Logarithm base = 10
radicle to become stable molecule thus neutralizing its free radical character (Shekar
and Goyal 2014).
22.3.3 Preliminary Qualitative Phytochemical Analysis

of Banana Peel Extract
Phytochemicals are secondary metabolites that are known for their therapeutic activ-
ity and are synthesized from the primary metabolites of the plant. Table 22.2 shows
the preliminary qualitative phytochemical content in banana peel extract that indi-
cates the presence of phytochemical compounds which are alkaloids, tannins, and
glycosides. These compounds are important as they possess several biological effects
on bacterial, fungi, and antioxidant properties (Yadav and Agarwala 2011).
Based on Table 22.2, the presence of flavonoid was detected when the mix-
ture color turned to yellow. Flavonoids are a hydroxylated phenolic substance and
are known to exhibit various inhibitory effects against multiple viruses. Further-
more, flavonoids also contain antioxidant and antibacterial properties, in addition to
lowering the risk of aging (Kuan 2015).
Moreover, banana peels contain alkaloid components. These components are
responsible for the antifungal and antioxidant properties of the plant and possess
antispasmodic and bactericidal effects (Velumani 2016).
The result of the banana peel extraction also shows the presence of tannins. Tannins
are a general descriptive name for the group of polymeric phenolic substances. The
consumption of tannin can help to prevent various illness such as a wide range of
anti-infective actions and host-mediated tumor activity. Besides that, tannins also
showed antimicrobial and antioxidant activities by coagulating the protoplasm of the
microorganisms (Radha et al. 2011).
The fourth component found in the banana peel extract was glycosides. This
component plays an important role in antimicrobial activity. The presence of these
phytochemicals supports the medicinal use of banana peel extract (Compean and
Ynalvez 2014).
Table 22.2 The preliminary

Phytochemicals Observation Indicator
qualitative phytochemical
content in banana peel extract Flavonoids The formation of yellow +
coloration
Alkaloids Formation of creamy white +
precipitate
Tannins Presence of dirty green +
precipitate
Glycosides Formation of yellow precipitate +
+ = Positive result/color changes
Table 22.3 Bioactive compounds of banana peel extract by GC/MS analysis

Bioactive compounds Retention time Peak area Benefits
(%)
2-pentenoic acid, 3-ethyl-methyl 10.276 0.08 Antioxidants,
ester, Antifungal
4-amino-1-methyl-3-nitropyrazole
Thiophene-2-carboxamide, 13.763 3.81 Antioxidants,
3-ethoxy-N-(4-chlorophenyl)- Anti-inflammatory
Pentadecane, 14.666 1.31 Antioxidants,
1-methoxy-13-methyl-3-Hexadecane, Antibacterial
(Z)-
4-Heptafluorobutyryloxyhexadecane.
1-Hexadecene, 2-Tetradecene, 14.769 14.46 Antibacterial,
Pentafluoropropionic acid, Antioxidants
4-hexadecyl ester
Note The compounds present in the banana peel extract which were detected by the GC/MS
22.3.4 Bioactive Compounds by GC/MS of Banana Peel

Extract
Apart from qualitative screening on phytochemical compounds, the identification of

bioactive components was also performed by using GC/MS Agilent 6890 equipped
with capillary column (30 m × 250 um × 0.25 um). Table 22.2 shows the result of
phytochemical screening of banana peel extract.
Table 22.3 shows several compounds that were found in the banana peels. The
bioactive compounds were detected by using GC-MS analysis. The 2- pentenoic acid
(RT 10.276) and pentafluoropropionic acid, 4-hexadecyl ester (RT 14.769) detected
in the banana peels are a type of oleic acid which is one of the fatty acid compounds
consisting of biological and medicinal activity (Mordi et al. 2016). The role of fatty
acid in human health is significant in preventing or reducing chronic diseases such
as cancer, cardiovascular disease, osteoporosis, and some immune disorders (Vilela
et al. 2014). In addition, the existence of these two compounds in the sample built
up the flavonoids which were present in qualitative assay. As flavonoids have the
ability as antioxidants, antifungal, and antibacterial, they can inhibit the activities
of bacterial protein reductase (FabI) by inhibiting the synthesis fatty acid of bacte-
ria (Skalicka-Woźniak et al. 2010). This proves that banana peels are able to act as
antioxidants, antifungal, and antibacterial agents. Next, the second peaks that stood
for thiophene-2-carboxamide, 3-ethoxy-N-(4-chlorophenyl) (RT 13.763) can act as
anti-inflammatory agent and have antioxidant properties (Altaee et al. 2016). This is
because the existence of these compounds in the sample built up the tannins which
were present in qualitative assay and can be used as a natural aromatic agent in cos-
metic product (Shirai et al. 2017). Thus, banana peels are effective as free radical
scavenger as their rich natural antioxidants can prevent peroxidation and protect from
oxidative stress (Ojekale et al. 2013). On the other hand, pentadecane, 1-methoxy-
13-methyl-3-hexadecane (Z)-4-heptafluorobutyryloxyhexadecane (RT 14.666) and
1-hexadecene, 2-tetradecene (RT 14.769) were detected as the third and fourth abun-
dance peaks in banana peels. In addition, the existence of these four compounds in the
sample built up the glycoside which was present in qualitative assay and was known
for their role as antimicrobial and antioxidant. Therefore, this saturated fatty acid
was primarily used to produce hormone-like substances that regulate a wide range
of functions, including blood clotting, the immune response, and the inflammation
response to injury infection and also can act as antioxidant agents that help to reduce
oxidative stress (Shekar and Goyal 2014).
22.4 Conclusion
In conclusion, the percentage of the banana peel extract through the Soxhlet extraction
(20.26%) was lower than expectation as it might be due to the presence of impurities
in the ample that caused incomplete reaction of the chemical process. Meanwhile, the
extract from the scavenging DPPH of the banana peel exhibited a high percentage of
inhibition in which the highest was 1000 mg/mL with 94.13 ± 0.11% while the lowest
percentage inhibition was 41.38 ± 0.71% exhibited by 0.1 mg/mL. The qualitative
phytochemical screening exhibited by banana peel extract was flavonoids, alkaloids,
tannins, and glycosides. The phenolic compound from GC/MS shows that banana
peel extract consists of high number of antioxidant compounds such as 2-pentenoic
acid, pentafluoropropionic acid, 4-hexadecyl ester, 2-tetradecene, and 1-hexadecene.
The existence of all these compounds proves that banana peel extract has potential
to act as natural antioxidants.
References
Ahmed MA, Zeinab A (2016) Identification of phenolic compounds from banana peel (Musa
paradaisica L.) as antioxidant and antimicrobial agents. J Chem Pharm Res 8(4):46–55
Altaee N, Kadhim MJ, Hammeed IH (2016) Characterization of metabolites produced by E. Coli
and analysis of its chemical compounds using GC-MS. Int J Curr Pharm Rev Res 7(6):393–399
Azhar ME, Fatemeh SR, Saifullah R, Abbas FMA (2012) Total phenolics, flavonoids and antioxidant
activity of banana pulp and peel flours: influence of variety and stage of ripeness. Int Food Res J
19(3):1041–1046
Azmi NA (2010) Extraction of antioxidant activity, phenolic content and minerals in banana peel.
J Chem Nat Resour 1–61
Bashir AA, Mohd KS, Razak MA (2015) Phytochemical screening, antioxidant activity of pure
syringin in comparison to various solvents extracts of musaparadisiaca(banana) (fruit and flower)
and total phenolic contents. Int J Pharm Pharm Sci 7(5)
Baskar R, Shrisakhti S, Nithya R, Poongodi P (2011a) Antioxidant potential of peel extracts of
banana varieties (Musa sapientum). Food Nutr Sci 02:1128–1133
Baskar R, Shrisakthi S, Sathyapriya S, Shyampriya R, Nithya R, Poongodi P (2011b) Antioxidant

potential of peel extracts of banana varieties (Musa sapientum). Food Nutr Sci 2:1128–1133
Compean KL, Ynalvez RA (2014) Antimicrobial properties activity of plant secondary metabolites:
a review. Res J Med Plants 8(5):204–213
Jalani MFF, Mohamad S, Shahidan WNS (2014) Antibacterial effects of banana pulp extracts
based on different extraction methods against selected microorganisms. Asian J Biomed Pharm
Sci 4(36):14–19
Kuan TY (2015) Phytochemicals screening and antibacterial activity of AndrographisPaniculata. J
Biol Sci 1–103
Kumar DJ, Reddy NB (2017) Development, formulation and investigation of preliminary toxicity
studies on Brine shrimp and to detect anti microbial activity by ethanolic leaf extract of Lantana
camara. Int J Pharm Life Sci 8(1):5651–5656
Montelongo GRM, Gloria LG, Gonzalez M (2010) Antioxidant activity in banana peel extracts:
testing extraction conditions and related bioactive compounds. Food Chem 119:1030–1039
Mordi RC, Fadiaro AE, Owoeye TF, Olanrewaju IO, UzaomokaGC, Olorunshola SJ (2016) Iden-
tification by GC-MS of the components of oils of banana peels extract, phytochemical and
antimicrobial analyses. Res J Phytochem 1–6
Muhammad A (2006) Comparative activities of some antifungal agents against dermatophyte iso-
lates from school with Tinea Capitis, pp 1–112. Department of Pharmaceutics & Pharmaceutical
Microbiology
Mustapha AN, Martin A, Mato RB, Cocero MJ (2015) Extraction of phytocompounds from medi-
cal plant Clinacanthus nutans Lindauby microwave-assisted extraction and supercritical carbon
dioxide extraction. Ind Crop Prod 74:83–94
Ojekale BA, Lawal AO, Segun AA, Samuel OF, Ismaila IA, Opoku AR (2013) Volatile constituents,
antioxidant and insecticidal activities of essential oil from the leaves of Thaumatococcus Danielli
(Benn.) Benth. From Nigeria. Iosr J Pharm 3(3):1–5
Radha R, Sermakkani M, Thangapandian V (2011) Evaluation of phytochemical and antimicro-
bial activity of Andrographispaniculata Nees (Acanthaceae) aerial parts. Int J Pharm Life Sci
2(2):562–567
Shekar TC, Goyal A (2014) Antioxidant activity by DPPH radical scavenging method of Ageratum
conyzoides Linn. Leaves. Am J Ethnomedicine 1(4):244–249
Shirai H, Iwama T, Tsuiki HI (2017) Cosmetic methods using metal phythalocyanane derivative,
pp 1–16. United State Patent Application Publication
Skalicka-Woźniak K, Los R, Glowniak K, Malm AL (2010) Antimicrobial activity of fatty acids
from fruits of Peucedanum cervaria and P. alsaticum. Biochem Biodivers 7:2748–2754
Sundram S, Anjum S, Dwivedi P, Rai GK (2011) Antioxidant activity and protective effect of
banana peel against oxidative hemolysis of human erythrocyte at different stages of ripening. J
Cent Biotechnol (7):192–206
Velumani S (2016) Phytochemical screening and antioxidant activity of banana peels 2(1).
Department of Biotechnology Chennai
Vilela C, Santos SAO, Vilaverde JJ, Oliveira L, Nunes A, Cardeiro N, Freire CSR, Silvestre
AJDS (2014) Lipophilic phytochemicals from banana fruits of several Musa species. Food Chem
162:247–252
Yadav RNS, Agarwala M (2011) Phytochemical analysis of some medicinal plants. J Phytol
3(12):10–14
Chapter 23
Newly Revised Optimal
and Synchronized Timetables for Greater
Kuala Lumpur Using Mixed Integer
Programming
Noraini Noordin and Saiyidatul Adidah Idris
Abstract Sustainable transportation supports the mobility needs of a society. Peo-

ple are encouraged to use public transport networks such as Greater Kuala Lumpur
transportation system (GKL) with 11 rail lines and 192 stations. Passengers using
GKL often miss the next connecting train to their destination. They must also rush
to catch this train. This problem may be caused by the utilization of unsynchronized
train schedules. Aimed with the objective to produce an optimal revised timetable
synchronization for GKL, the study applied Mixed Integer Programming and Heuris-
tic Approach in Code Blocks platform to successfully estimate the departure times
during Rush-Hour and Non-Rush-Hour periods. As a result, arrival times for newly
revised timetables involving 4 connecting transit stations for routes 1 with 15 stations
and route 2 with 9 stations were found. By assuming Rush-Hour period equivalent to
workday starting time and workday ending time, optimal synchronizations for Rush-
Hour and Non-Rush-Hour periods were 108 cycles and 66 cycles, respectively. A
comparative analysis was made between waiting times of the original timetable and
the newly revised timetable. The newly revised timetables for Rush-Hour and Non-
Rush-Hour periods showed efficiency rates of 86.11% and 31.03%, respectively.
Therefore, the study has successfully revised four timetables for routes 1 and 2. Sus-
tainable transportation for GKL will be complete when future research works are
expanded to include the other 10 lines and all other train stations in GKL. The study
also recommends adding new variables such as headways, dwell times, and runtimes.
Keywords Mixed integer programming · Sustainable transportation · Timetable

synchronization
N. Noordin (B) · S. A. Idris

Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, Arau, Perlis,
Malaysia
e-mail: noraininoordin@uitm.edu.my
S. A. Idris
e-mail: saiyidatuladidah@gmail.com

260 N. Noordin and S. A. Idris
23.1 Introduction
Sustainable transportation supports the mobility needs of a society. It caters the

livelihood and progress of a city. Customers can easily travel and have access to
markets, employment, education, and basic services (Boschmann and Kwan 2008).
Therefore, public transportation systems, like buses, taxis, and trains must follow
a regular timetable, are safe but fast to travel in, provide high service quality, use
resources efficiently, and satisfy customer needs (Bachok et al. 2014).
Long waiting time and unpunctual arrival and departure times are two common
issues faced by public transportation services in Malaysia such as the Keretapi Tanah
Melayu (KTM) Komuter (Bachok et al. 2014; Zakaria et al. 2010) and bus services
to get in and out of Kuala Lumpur (Zakaria et al. 2010). The focus of this study
is the public transport network named Greater Kuala Lumpur transportation system
(GKL). GKL provides an alternative solution to traffic congestion problem in urban
areas. GKL operates 11 rail lines and 192 stations. However, GKL is also affected
by these issues.
GKL passengers must rush so as not to miss a connecting train to their destination.
However, they usually miss their transit trains by a few seconds after they arrive at
the platform. Timetable synchronization is the adjustment that is made to minimize
the transfer waiting time in a transit system. The current study aimed to produce
an optimal revised timetable synchronization for GKL. The following sections will
describe how Mixed Integer Programming (MIP) and Heuristic Approach (HA) have
been used in Code Blocks platform to successfully produce new and revised timeta-
bles involving 4 connecting transit stations for routes 1 with 15 stations and route 2
with 9 stations at GKL.
23.2 Timetable Synchronization Problem
The timetable synchronization problem can involve run times, dwell times, dispatch
times, and headways for all public transport. Many solution methods have been
proposed as solutions to these problems. These solutions include Integer Program-
ming (Liu and Ceder 2017; Shen et al. 2018), Mixed Integer Programming (MIP)
(Eranki 2004; Fonseca et al. 2018; Niu et al. 2015; Petering et al. 2015; Sorussa
2014), Multi-Objective Evolutionary Algorithms (Kwan and Chang 2008), Genetic
Algorithm (Wu et al. 2015), and Simulated Annealing Algorithm (Poorjafari et al.
2014).
MIP technique alone has been found to be impractical at solving larger problems.
On the other hand, Heuristic Approach (HA) can obtain an optimal solution within a
reasonable amount of computational time (Eranki 2004; Sorussa 2014). In this study,
Heuristic Approach (HA) is used in MIP to find a good feasible solution quickly.
HAs include Rounding Heuristic, Driving Heuristic, Relax-and-Fix Heuristic, Local
23 Newly Revised Optimal and Synchronized Timetables … 261
Branching Heuristic (LBH), Relaxation Induced Neighborhood Search Heuristic

RINS, and Exchange Heuristic.
What is most important in any practical case is the possibility of coming up with a
reasonable solution with minimal computation. LBH defines solution neighborhoods
in high-level strategic branching while low-level tactical branching is used to explore
these neighborhoods. As a result, the branching strategy produces improved solutions
at early stages of the computation (Fischetti and Lodi 2003; Fischetti et al. 2004).
Based on similarity of the setup, this HA approach has been adopted in this study.
23.3 Methodology
Figure 23.1 displays the framework of a public Transportation Operational Planning

Process (TOPP) used by Eranki (2004). TOPP has four components: (i) determination
Fig. 23.1 Framework of public TOPP

of interchanges and terminals as well as network route design; (ii) timetable setting;
(iii) vehicle scheduling; and (iv) crew scheduling. Every component has a set of input
variables and output variables.
The current study concerned the development of an optimal synchronized
timetable for GKL. Thus, it has focused only on the timetable setting instead of
the other three components (highlighted in yellow). As can be seen in Fig. 23.1,
there are three input variables (demand by time of day, day-of-the-week, service
standards, and comparison measures) and two output variables (fixed routes and
stops; and public timetables) for timetable setting. However, this study has chosen
to use only one input variable, namely, waiting time at the interchange stations in
order to produce an optimal revised and synchronized timetable for GKL.
23.3.1 Objective Function
Timetable synchronization optimization is used to maximize the synchronization

arrival at the transit station. The objective function is given by

M−1
M
fi

fi

f = max Yi jkpq (23.1)
i=1 j=i+1 k∈ p=1 q=1
subject to the number of trains in the number of transit pair, the total number of pth
to qth train to be scheduled in routes i to j and the arrival time of pth train on route i
and qth train on route j at the transit station.
X i1 ≤ Hmaxi ; 1 ≤ i ≤ M (23.2)
X i f i ≤ T ; 1 ≤ i ≤ M, (23.3)
where X ip is the departure time of pth train from its transit on route i, H denotes the
headway for route i, f i is the number of trains on route i to be scheduled, M is the
total number of trains on routes i and j, and T denotes the arrival time of trains at the
transit station.
Hmini ≤ X i( p+1) − X i p ≤ Hmaxi ; 1 ≤ i ≤ M; 1 ≤ p ≤ f i − 1, (23.4)
where Hmini and Hmaxi , respectively, denote the minimum and maximum headway
at each station and f is the frequency of trains departing at each route.
Yi jkpq = 1 if W Tmink ≤ |(X i p + tik ) − (X jq + t jk )| ≤ W Tmaxk , k ∈ Bi, j , (23.5)
Yi jkpq = 0; (23.6)
where Yi jkpq is the pth train on route i and qth train on route j arrive simultaneously
at the transit station if
|(X i p + tik ) − (X jq + t jk )| ≤ W Tmink or |(Xi p + tik ) − (X jq + t jk )| ≥ W Tmaxk .

(23.7)
Constraints (23.2) and (23.3) will ensure that the departure times of the first and
last train at the transit station do not exceed the maximum headway of each route.
Constraint (23.4) will ensure that headways are in the given range. Constraint (23.5)
is introduced as a binary variable. In particular, Yi jkpq = 1 guarantees that the arrival
of the trains at the transit station is within the waiting limits. Lastly, Constraint (23.6)
warrants that Yi jkpq = 0 a condition that is in contrast with Constraint (23.5).
23.3.2 Implementation Steps for MIP
There are four steps in the implementation of MIP algorithm.

Step 1:
(a) Start the initialization of the variables.
(b) Formulate the Linear Programming problem.
(c) Solve using Simplex method. Ignore the integer variables. This method is
used to fix the basic variable that is assigned to zero.
(d) Simplex method starts with a basic feasible solution and moves to a better
basic feasible solution.
Step 2:
(a) Examine the optimal solution.
(b) If basic variables have integer values, then stop.
The actual optimal solution is the optimal basic feasible solution to IP. Otherwise,
go to Step 3.
Step 3:
(a) Generate the cutting plane.
(b) Choose constraint k * to correspond to a basic variable Yi jkpq and generate the
cutting plane.
Step 4:
(a) Find a new solution.
(b) Obtain new optimal solution by adding the cutting plane in Step 3 to the
optimal solution in Step 1.
(c) Then, go to Step 2.
(d) The steps are repeated until the integer value is obtained in all basic variables.
23.3.3 Implementation Steps for HA
As stated earlier on, HA is used to make sure feasible and good solution exist for
an MIP problem. The algorithm is based on the selection of the nodes. Nodes are
identified as “new”, “possible”, or “not possible”. This algorithm abides by the
procedures as given in Fig. 23.2.
Fig. 23.2 Implementation steps for HA

Give the Inputs. Five assumptions are made for input data on route i:
(a) Hmaxi ≥ Hmini
(b) T ≥ ( f i − 1) · Hmini
(c) The maximum value of ( f i · Hmaxi ) at each route is the maximum possible range
on the time planning horizon.
(d) The minimum waiting time at transit station should be greater than zero.
(e) The maximum waiting time at the transit station must not be beyond the
maximum headway of each route.
Node Selection Procedure. In the algorithm, a node is selected among the “new”
and “possible” nodes using the following implementation steps.
Step 1:
Find the maximum number of arrival time for each “new” and “possible” nodes. Go
to Step 2 if no arrival time is defined. Set the node as “SELECTED NODE” if only
one node is defined.
Step 2:
Go to Step 3 if the identified node has the maximum number of routes. Set the node
as “SELECTED NODE” and exit if only one node is identified.
Step 3:
Calculate the maximum travel time from the origin station to the nodes. Label
“SELECTED NODE” if the node has a minimum value. Stop if a tie exists.
Procedures to assign departure times. Three procedures, Procedure 1, Proce-
dure 2, and Procedure 3 are used to assign departure times to the nodes.
Procedure 1. If the “new” node is identified, the departure time is assigned for
routes passing the “Selected Node” that takes the maximum time to arrive when two
routes pass the node. Value 0 is set as the initial value to find the departure time. For
the other route, the departure time is assigned as the arrival time of two routes at the
selected node.
The departure time is assigned after the minimum waiting time is determined. If
the minimum waiting time is not defined, the time is increased by one. Then, the same
processes are applied to find the next possible waiting time within the range. The
departure time will be constant after a certain time d. Time d from the last departure
is constrained by the following condition for all routes that pass through the node:

d = min max Hmini , min Hmaxi ∀i. (23.8)
i=1,2,...M i=1,2,...M
Procedure 2. This procedure assigns “possible” as the departure time during the
selected node. Starting time is already set for some routes in Procedure 1. Therefore,
the other unassigned departure time is set to have unsynchronized arrival with the set
of arrivals at the node. The node is marked as “not possible” if no more assignment
was possible.
Procedure 3. Procedure 3 is applied to check for the unassigned departures that
are not created in Procedure 1 and Procedure 2.
The study aimed at successfully constructing new and revised optimal timetables
for GKL. It used C language in the open-source platform, Code Blocks to find the
maximum synchronized train based on waiting times at the transit station during
Rush-Hour and Non-Rush-Hour periods. The GKL network has two routes and four
nodes.
23.4.1 Optimize Timetable Synchronization by Considering

Waiting Time at the Transit Station During
Rush-Hour
Train headways range between 30 and 60 min. The time horizon was [0, 300] minutes.
6 trains operated at route 1 while 7 trains were at route 2. The results were obtained
using HA Algorithm. Table 23.1 displays the departure times in minutes for 7 trains.
The number of synchronized arrivals is 30, 30, 24, and 24, respectively, for nodes
1–4, as displayed in Table 23.2. These values are presented in Fig. 23.3. Table 23.2
indicates that different total synchronized arrivals are obtained when the range of
waiting time is changed.
Table 23.2 concludes that the number of synchronized arrivals increase when the
range of waiting time increase. As can be seen, the highest number of synchronized
arrivals is 108 which is in the range of 15–80 min.
Table 23.1 Departure time

Number of trains Route 1 Route 2
during Rush-Hour in minutes
Train 1 0 67
Train 2 30 97
Train 3 60 127
Train 4 90 157
Train 5 120 187
Train 6 150 217
Train 7 – 247
Table 23.2 Synchronized arrivals for different waiting times during Rush-Hour
Range of waiting time at Number of synchronized arrivals at Total number of
nodes nodes synchronized arrivals
Node 1 Node 2 Node 3 Node 4
[10, 65] 22 22 16 16 76
[10, 80] 30 30 20 20 100
[15, 65] 22 22 16 16 76
[15, 80] 30 30 24 24 108
[20, 65] 16 16 10 10 52
[20, 80] 24 24 18 18 84
[27, 50] 11 11 5 5 32
[30, 65] 20 20 14 14 68
[30, 80] 20 20 14 14 68
[40, 80] 18 18 9 9 51
[45, 50] 10 10 4 4 28
120
100
Total number of
synchronization
80
60
40
20
0
1 2 3 4 5 6 7 8 9 10 11
min max total number of synchronization
Fig. 23.3 Total number of synchronizations for different waiting times during Rush-Hour
23.4.2 Optimize Timetable Synchronization by Considering

Waiting Time at the Transit Station During
Non-Rush-Hour
The minimum and maximum headways for each route were 25 and 105 min, respec-
tively. The number of trains operating during the Non-Rush-Hour was 5 for route 1
and 7 for route 2. The time horizon for Non-Rush-Hour was [0, 400] minutes between
12 p.m. and 5 p.m. Table 23.3 presents the departure time during the Non-Rush-Hour.
Table 23.4 displays the number of synchronized arrivals for a different range of
waiting time. As can be seen, the total maximum number of synchronized arrivals is
66 which is in the larger range of the waiting time.
Table 23.3 Departure time

Number of trains Route 1 Route 2
during the Non-Rush-Hour in
minutes Train 1 0 107
Train 2 45 152
Train 3 90 197
Train 4 135 242
Train 5 180 287
Train 6 – 332
Train 7 – 377
Table 23.4 Synchronized arrivals for different waiting times during Non-Rush-Hour
Range of waiting times at Number of synchronization arrival at Total number of
Nodes Nodes synchronized arrivals
Node 1 Node 2 Node 3 Node 4
[10, 65] 16 16 11 11 54
[10, 80] 19 19 9 9 56
[15, 65] 15 15 10 10 50
[15, 80] 19 19 13 13 64
[20, 65] 15 15 10 10 50
[20, 80] 19 19 14 14 66
[27, 50] 7 7 2 2 18
[30, 65] 10 10 4 4 28
[30, 80] 14 14 9 9 46
[40, 80] 10 10 5 5 30
[45, 50] 10 10 5 5 30
Figure 23.4 presents the synchronized arrivals for Non-Rush-Hour. Like the find-
ings for Rush-Hour, the number of synchronized arrivals was related to the range of
the waiting times. The higher the range of waiting time, the higher the number of
synchronizations. Thus, the maximum number of synchronized arrivals was 66 and
was in the range of 20–80 min (highlighted in yellow in Table 23.4).
23.4.3 Comparing Efficiency of Newly Revised Timetable

to Original Timetable
After the completion of MIP and HA, a new timetable was designed to display the
optimal synchronized arrival. Table 23.5 displays the comparison range of the waiting
times for the original and revised timetable and the efficiency of the revised timetable
over the original timetable.
180
160
Total synchronization arrivals
140
120
100
80
60
40
20
0
1 2 3 4 5 6 7 8 9 10 11
min max total number of synchronization
Fig. 23.4 Total number of synchronizations for different waiting times during Non-Rush-Hour
Table 23.5 Comparison of waiting time for original and revised timetable
Range of waiting time for the Range of waiting time for the The efficiency of the revised
original timetable revised timetable timetable
Rush-Hour Non-Rush-Hour Rush-Hour Non-Rush-Hour Rush-Hour Non-Rush-Hour
[22, 58] [24, 53] [15, 20] [15, 35] 86.11% 31.03%
The range of waiting times for the revised timetable is much better than the original
timetable. Thus, it will be much better and more conducive for the passengers to
consider the waiting time. They are also advised to refuse the larger waiting times.
By comparing the results of both Rush-Hour and Non-Rush-Hour, it can be con-
cluded that there is a strong relationship between waiting time and transit optimiza-
tion. The efficiency of the revised timetable over the original timetable is 86.11% in
the Rush-Hour and 31.03% in the Non-Rush-Hour (see column 5 and 6 in Table 23.5).
This finding indicates that the study has successfully achieved four newly revised
optimal timetables for routes 1 and 2 for both Rush-Hour and Non-Rush-Hour
periods.
23.5 Conclusion
This study has successfully resolved the timetable synchronization problem for
GKL during Rush-Hour and Non-Rush-Hour. Maximum number of synchronizations
during Rush-Hour and Non-Rush-Hour are 108 and 66, respectively.
A comparative analysis was performed between the waiting time of the original
timetable and the new timetable. The analysis showed that the efficiency of the new
timetable over the original timetable is 86.11% for Rush-Hour and 31.03% for Non-
Rush-Hour. Therefore, the range of the waiting time for the new timetable is better
at attaining the optimal timetable synchronization.
In conclusion, the study has successfully revised four timetables for routes 1
and 2. Future research works in this area may consider expanding these optimal
synchronized timetables by including the other 10 lines and all other train stations
in GKL. The study also recommends adding new variables such as headways, dwell
times, and runtimes.
References
Bachok S, Osman MM, Ponrahono Z (2014) Passenger’s aspiration towards sustainable public
transportation system: Kerian District, Perak, Malaysia. Procedia Soc Behav Sci 153:553–565
Boschmann EE, Kwan M-P (2008) Toward socially sustainable urban transportation: progress and
potentials. Int J Sustain Transp 2(3):138–157
Eranki A (2004) A model to create bus timetables to attain maximum synchronization considering
waiting times at transfer stops
Fischetti M, Lodi A (2003) Local branching. Math Program 98(1–3):23–47
Fischetti M, Polo C, Scantamburlo M (2004) A local branching heuristic for mixed-integer programs
with 2-level variables, with an application to a telecommunication network design problem. Netw
Int J 44(2):61–72
Fonseca JP et al (2018) A matheuristic for transfer synchronization through integrated timetabling
and vehicle scheduling. Transp Res Part B Methodol 109:128–149
Kwan CM, Chang CS (2008) Timetable synchronization of mass rapid transit system using
multiobjective evolutionary approach. IEEE Trans Syst Man Cybern Part C (Appl Rev)
38(5):636–648
Liu T, Ceder AA (2017) Integrated public transport timetable synchronization and vehicle schedul-
ing with demand assignment: a bi-objective bi-level model using deficit function approach. Transp
Res Procedia 23:341–361
Niu H, Zhou X, Gao R (2015) Train scheduling for minimizing passenger waiting time with time-
dependent demand and skip-stop patterns: nonlinear integer programming models with linear
constraints. Transp Res Part B Methodol 76:117–135
Petering ME, Heydar M, Bergmann DR (2015) Mixed-integer programming for railway capacity
analysis and cyclic, combined train timetabling and platforming. Transp Sci 50(3):892–909
Poorjafari V, Yue WL, Holyoak N (2014) Application of simulated annealing in transit schedule
synchronization. Int J Model Optim 4(6):476
Shen Y, Ren G, Liu Y (2018) Timetable design for minimizing passenger travel time and congestion
for a single metro line. Promet-Traffic Transp 30(1):21–33
Sorussa J (2014) Optimizing the synchronization of multiple bus routes at multiple transfer points
assuming stochastic bus journey times
Wu J et al (2015) Equity-based timetable synchronization optimization in urban subway network.
Transp Res Part C Emerg Technol 51:1–18
Zakaria Z et al (2010) Service quality of Malaysian public transports. Cross Cult Commun 6(2):84–
90
Chapter 24
Kinetic Modeling and Half-Life Study
on Bioaugmentation of Oil Sludge
Contaminated Soil by Single
and Consortia LIBeM at Different
Concentration Levels
Nur Zaida Zahari and Piakong Mohd Tuah
Abstract The focus of this study is to evaluate the potential of five locally isolated
beneficial microorganism (LIBeM) strains, namely, C. tropicalis—RETL-Cr1, C.
violaceum—MAB-Cr1, P. aeruginosa—BAS-Cr1, S. paucimobilis—ReTOS-Cr1, S.
maltophilia—RAS-Cr1 to treat oil sludge-contaminated soil. The bioaugmentation
study was investigated in a lab-scale up experiment over various concentration of
oil sludge at 5, 10, 15, and 20% v/v levels. Their efficiency to degrade oil sludge-
contaminated soil was carried out within 84 days treatment. A natural attenuation
plot was set up as a control to compare the ability of indigenous microbes in a
soil with augmented LIBeM added. The results showed that augmented soil with
single and consortia LIBeM had a relative significant influence on biodegradation of
total petroleum hydrocarbon (TPH) in soil. Analysis of biodegradation rate showed
that all treatments obeyed the first-order kinetics model indicated by the high R2
(= 0.99) value that fitted well to the first-order kinetics model. The results showed
that soil treated with Consortia 4 (C. tropicalis + C. violaceum + P. aeruginosa)
at 10% v/v of oil sludge recorded higher biodegradation rate, k (0.0375 day−1 )
and lower biodegradation half-life, t ½ (18.5 days), respectively. On the contrary,
natural attenuation showed the lowest biodegradation rate, k (0.0044 day−1 ) and
recorded 157.5 days of biodegradation half-life times. This result was 8.5-fold higher
as compared to natural attenuation. This study can be very useful as application tools
for oil remediation based in soil subjected to prediction of times present in the
environment.
Keywords Bioaugmentation · Single · Consortia · Isolated beneficial

microorganism (LIBeM) · First-order kinetic · Half-life
N. Z. Zahari (B) · P. M. Tuah

Faculty of Science & Natural Resources, Universiti Malaysia Sabah, UMS Road, 88400 Kota
Kinabalu, Sabah, Malaysia
e-mail: zaidazahari@ums.edu.my
P. M. Tuah
e-mail: pmdtuah@ums.edu.my

272 N. Z. Zahari and P. M. Tuah
24.1 Introduction
Biaoaugmentation is one of the selective techniques used in bioremediation to

enhance the microbial population by adding selected microbial cultures in contami-
nated site (Ruberto et al. 2003). This method is known to improve the biodegradative
capacities of contaminated sites by speeding up the rate of degradation of a con-
taminant. The addition of these selected and standardized microorganisms into con-
taminated site can be targeted to address specific contaminants in the polluted area.
Biodegradation rate is expressed as a half-life times, which indicates as the time taken
for 50% of substances degraded in the contaminated site. It can be evaluated using
first-order kinetics model by following the concept of exponential decay, where the
rate constant is independent of the concentration and time (Reardon et al. 2002). The
first-order kinetics is commonly used to describe biodegradation of the constituents
in the targeted site because mathematically the expression can be incorporated eas-
ily into the models (Greene et al. 2000). This model can be calculated based on
equations that used to describe the reduction of substances from the environment
subjected to various mechanisms in biodegradation process. The understanding of
the basic mechanism is vital for quality modeling and quality control of the process.
Previous study has implemented the first-order kinetics model because of the ease
of presenting and analyzing the data, the simplicity of plotting the logarithm of the
chemical remaining versus time as a straight line, and the ease of predicting future
concentrations (Reardon et al. 2002). Hinga (2003), further reported that the selection
of the appropriate kinetics and rate constants is essential for accurate predictions of
various hydrocarbon concentrations with time in the affected target medium. It was
notified that kinetics of biodegradation processes is solely dependent on the speed
and development of the efficient removal of oil in any contaminated water bodies or
soil environment (Venosa and Holder 2007). For the evaluation of the biodegradation
activity, the following factors are taken into account such as type of oil, surfactant
formulation, effect of surfactants on microbial attachments toward oil droplets, dilu-
tion effects of oil, differences in uptakes of the various hydrocarbon constituents, and
dispersant efficiency in biodegradation processes (Kachieng’a and Momba 2017).
Literature search showed that different species have different susceptibility to
microbial degradation and it takes different time spans to degrade different hydro-
carbons. The advantages of employing mixed cultures as opposed to single cultures
in bioremediation have also been widely demonstrated. It could be attributed to the
effects of synergistic interactions among microorganisms used for bioaugmentation.
The mechanisms in which petroleum degraders benefit from synergistic interactions
may be complex. It is possible that one species removes the toxic metabolites (that
otherwise may hinder microbial activities) of the species preceding it. It is also
possible that the second species are able to degrade compounds that the first are
able to only partially (Alexander 1999). Further research should be directed toward
understanding the roles of individual members in influencing the effectiveness of
a microbial association. Therefore, the main aim of this study is to determine the
24 Kinetic Modeling and Half-Life Study on Bioaugmentation … 273
Model RESUN LP100

Low Noise Air Pump
Continuous
Aeration via 3
tubing’s (ASP)
Soil
Sand
Gravel sized
(1-1-5cm)
Fig. 24.1 ASP-bioreactor system used in bioaugmentation of oil sludge-contaminated soil by single
and consortia LIBeM
potential of augmented single and consortia LIBeM in biodegradation of oil sludge-

contaminated soil. The degradation kinetics of oil sludge in soil with respect to the
different augmented LIBeM and concentration levels at 5, 10, 15, and 20% v/v oil
sludge were determined and modeled using first-order kinetic model.
24.2.1 Experimental Setup
The ability and potential of single and consortia LIBeM as green technology to treat
oil sludge-contaminated soil were conducted by carrying out the biodegradation
experiment at various treatments in Fig. 24.1. The experiments (duplicates) for each
ASP-bioreactor were carried out for 84 days at open and air ventilated with the
following treatment combination as in Table 24.1.
24.2.2 Inoculum Preparation of Single and Consortia LIBeM
1 loop of LIBeM fresh culture was inoculated to 200 mL Ramsay broth in 250 mL
Erlenmeyer flasks that had been sterile at 1210 °C for 15 min. 2 mM of Mg with 5, 10,
15, and 20% (v/v) concentration of oil sludge were added to flasks. The flasks were
incubated in an orbital shaker agitated at 200 rpm at 300 °C for 24 h. After incubation,
microbial growth was assessed by using spectrophotometer (Model CECIL CE 1011)
set at 600 nm. 10% (v/v) of the cultured LIBeM (1 × 107) with OD 0.5 and above
Table 24.1 Treatment combination of LIBeM at 5, 10, 15, and 20% v/v of oil sludge
Treatment Plot Single LIBeM
S1 10 kg of soil were treated with C. tropicalis-RETL-Cr1
S2 10 kg of soil were treated with C. violaceum-MAB-Cr1
S3 10 kg of soil were treated with P. aeruginosa -BAS-Cr1
S4 10 kg of soil were treated with S. paucimobilis-ReTOS-Cr1
S5 10 kg of soil were treated with S. maltophilia-RAS-Cr1
Consortia LIBeM
C1 10 kg of soil were treated with consortia
(ReTOS-Cr1+BAS-Cr1+RAS-Cr1)
C2 10 kg of soil were treated with consortia (RETL-Cr1+
MAB-Cr1+RAS-Cr1)
RAS-Cr1+BAS-Cr1)
MAB-Cr1+BAS-Cr1)
C5 10 kg of soil were treated with consortia
(ReTOS-Cr1+BAS-Cr1+RAS-Cr1+RETL-Cr1+MAB-Cr1)
NA (Control Plot) 10 kg of soil were treated with indigenous microorganisms in activated
soil. No inoculation of LIBeM into the soil
were used as inoculum and harvested to proceed for working volume study. A total
1.0 L of inoculum was sprayed into the soil for bioremediation studies.
24.2.3 Soil Sampling Analyses
Approximately 20 g surface soil (10 cm) were collected weekly into plastic bags
from the bioreactor. The soil were brought to the laboratory and mixed thoroughly
for physical, chemical, and biological analyses. The soil samples were kept in the
laboratory at 40 °C for further analysis and preservation.
24.2.4 Determination of Total Petroleum Hydrocarbons

(TPH)
Total petroleum hydrocarbon was carried out based on gravimetric method (Soxhlet
extraction) (USEPA 3540 °C) (USEPA 1996). 20 g of soil sample were grained and
placed in thimble and were extracted with dichloromethane (DCM). Then the thimble
was placed in Soxhlet extractor. 250 mL of dichloromethane were added into round-
bottomed flask (RBC). After that, the soxhlet extraction was arranged and mixed
with enough dichloromethane until it covers the thimble. The cooling temperature
and mantel heater were set at 17 °C and 4 °C, respectively. The extraction process
will take places for less than 24 h. Then the content was cooled and let the DCM
flow to the round-bottomed flask from the extractor. The total solvent will be cleared
completely with the vacuum evaporator at 40–50 °C. By using the rotary pump, let
DCM leave the sample. The RBC together with the extract was cooled in desiccator
after being dried in oven at 40 °C. The RBC was measured until constant weighed
obtained. The percentage of total petroleum hydrocarbon (TPH) was calculated using
the Eq. 24.1.
Minextractweightin R BC
%T P H = × 10. (24.1)
W eighto f sample
24.2.5 Determination of Kinetic Evaluation
Biodegradation of hydrocarbon by microorganisms is usually explained by first-order

kinetics as described by Agarry et al. (2013), Maletić et al. (2009), Zahed et al. (2011)
and Pala et al. (2006) using Eq. 24.2.
Ct = C0 e−kt , (24.2)
where
C o initial TPH content in soil (g/kg) at time t,
t the biodegradation study (day),
C o initial concentration of hydrocarbons (g/kg)
k rate constant of the change in the hydrocarbon content (day−1 ).
The model was used to estimate the rate of biodegradation and half-life of hydro-
carbons in soil under each treatment and the model was based on the assumption that
the degradation rate of hydrocarbons positively correlated with the concentration in
the soil. Plotting the logarithm of hydrocarbon concentration versus time presents
appropriate information about the biodegradation rate.
24.2.6 Biodegradation Half-Life Times
The biological half-life can be defined as the time taken for a substance to lose half
of its amount (Agarry et al. 2013). This is very important in environmental modeling
as it can describe the conversion of pollutants (Sinkkonen and Paasivirta 2000) in the
contaminated area. Biodegradation half-life times (t 1/2 ) are calculated by Eq. 24.3.
ln(2)
t1/2 = , (24.3)
k
where
k rate constant.
t 1/2 half-life times
ln (2) 0.693
Rate constant (k) is calculated according to Eq. 24.2 and presented in kinetic
expression list graph plotted as shown in Figs. 24.2 and 24.3.
24.3 Results & Discussions
Analysis rates of biodegradation of oil sludge showed that most treatments obeyed
first-order kinetics which indicated by the high R2 (= 0.99) that fitted well to the
first-order kinetics model. The R values represent the correlation coefficient of the
data. The rate constant (k), obtained from the fitting model (Table 24.2) is reflective
of the effects of various treatments (LIBeM) on TPH degradation in contaminated
soil (Sarkar et al. 2005).
Based on the results obtained (Figs. 24.2 and 24.3), the R values recorded for all the
treatment were in the range of 0.8571—0.9973 for the first-order kinetics. The highest
R value can be observed in treatment Single 3 with 0.9973 at 20% (v/v) oil sludge.
According to Everitt (2002), the nearer the R value to 1, the stronger the correlation
of the data. A relatively high value of R indicated that the models successfully
described the kinetics of the degradation of oil sludge by LIBeM. The determination
of regression (R2 ) also revealed that the model fits well with all treatment studied.
The highest biodegradation rate constant (k) and half-life times (t 1/2 ) were observed
in soil augmented with Consortia 4 at 10% v/v with rate constant of 0.0375 day−1
and 18.5 days, respectively.
On the contrary, natural attenuation showed the lowest biodegradation rate in
ranges from 0.0044, 0.0073, 0.0047, 0.0051 day−1 with 157.5, 94.9, 147.4, 135.9 days
as the concentration of oil sludge (v/v) increase in the treatment plot. The half-
life times of oil sludge biodegradation was calculated using Equation in Sects. 2.5
(Reardon et al. 2002) and 2.6 (Greene et al. 2000). The biodegradation rate constant
(k) and half-life times (t 1/2 ) for the different concentration levels of oil sludge treated
by single and consortia LIBeM are presented in Table 24.2.
The results showed that there are significant relationships between the rate of
biodegradation and the concentration of oil sludge in contaminated soil augmented
with LIBeM. It is noticeable that biodegradation rate constant (k) increased (1.9-fold)
as the concentration of oil sludge increase from 5% to 15% v/v, respectively. This
observation indicates that the addition of augmented single and consortia LIBeM
enhanced the combined effect of oil degrading microbial in the treatment systems.
Among single and consortia LIBeM treatment, it can be concluded that the augmented
LIBeM Consortia 4 has a great potential for bioremediation oil sludge-contaminated
5% 5%
6 6
5.5 10% 5.5 10%
5 15% 5 15%
R² = 0.9106
4.5 20%
ln (TPH)
ln (TPH)
4.5 20%
4 4 R² = 0.9918
3.5 3.5 R² = 0.9083
3 R² = 0.9793 3
R² = 0.9571 R² = 0.9898 R² = 0.9906
2.5 R² = 0.9617 2.5
2 2
0 7 14 21 28 35 42 49 56 63 70 77 84 0 7 14 21 28 35 42 49 56 63 70 77 84
Time (Days) Time (Days)
(a) S1: C. tropicalis-RETL-Cr1 (b) S2: C. vioaleceum-MAB-Cr1

5%
6 5% 6 10%
5.5 10% 5.5 15%
5 15% 5 20%
20% R² = 0.9432
4.5 4.5
ln (TPH)
4 R² = 0.9973 ln (TPH) 4
3.5 3.5 R² = 0.974
R² = 0.944 R² = 0.9347
3 3
R² = 0.972 2.5 R² = 0.9475
2.5 R² = 0.9936
2 2
0 7 14 21 28 35 42 49 56 63 70 77 84 0 7 14 21 28 35 42 49 56 63 70 77 84
(c) S3: P. aeruginosa-BAS-Cr1 (d) S4: S. paucimobilis-ReTOS-Cr1

6 5%
5.5 10%
5 15%
4.5 20%
ln (TPH)
R² = 0.977
4
3.5
R² = 0.9815 R² = 0.953
3
R² = 0.9306
2.5
2
0 7 14 21 28 35 42 49 56 63 70 77 84
Time (Days)
Fig. 24.2 Biodegradation kinetic evaluation of oil sludge-contaminated soil by single LIBeM at
5, 10, 15, and 20% (v/v) concentration of oil sludge. a S1: C. tropicalis-RETL-Cr1, b S2: C.
vioaleceum-MAB-Cr1, c S3: P. aeruginosa-BAS-Cr1, d S4: S. paucimobilis-ReTOS-Cr1
soil. This is due to the high biodegradation rate (k) recorded in all concentrations
studied with more than 0.0300 day−1 , respectively.
The biological half-life times is the time taken for a substance to lose half of
its amount. The half-life of biodegradation has been recommended as a principle
standard to decide whether a substance should be categorized as persistent or not as
suggested by Mohajeri et al. (2013). It is reported that the substances with half-life
6 5% 6 5%
5.5 10% 10%
15% 15%
5 5
20% 20%
R² = 0.9753
ln (TPH)
ln (TPH)
4.5 R² = 0.9831
4 4
3.5
3 R² = 0.9812 3 R² = 0.9772
R² = 0.9432 R² = 0.9744 R² = 0.9383
2.5 R² = 0.947
2 2
0 7 14 21 28 35 42 49 56 63 70 77 84 0 7 14 21 28 35 42 49 56 63 70 77 84
(a) C1: ReTOS-Cr1 BAS-Cr+RAS-Cr1 (b) C2: RETL-Cr1+MAB-Cr1+RAS-Cr1
5% 6 5%
6
10% 10%
5.5
15% 5 15%
5
R² = 0.9913 20% 20%
ln (TPH)
ln (TPH)
4.5
4 4
R² = 0.9838
3.5
3 3
2.5 R² = 0.9379 R² = 0.9671
R² = 0.9879 R² = 0.9954
R² = 0.9098 R² = 0.9305
2 2
0 7 14 21 28 35 42 49 56 63 70 77 84 0 7 14 21 28 35 42 49 56 63 70 77 84
(c) C3: RETL-Cr1+RAS-Cr1+BAS-Cr1 (d) C4: RETL-Cr1+MAB-Cr1+BAS-Cr1
6 6 5% 10% 15% 20%

5%
5.5 10%
5 15% 5
20%
ln (TPH)
4.5 R² = 0.9712
ln (TPH)
R² = 0.9823 R² = 0.9349
4 4 R² = 0.9242
3.5 R² = 0.9509
R² = 0.9629
3 3
2.5 R² = 0.9194R² = 0.9805
2 2
0 7 14 21 28 35 42 49 56 63 70 77 84 0 7 14 21 28 35 42 49 56 63 70 77 84
(e) C5: RETL-Cr1+MAB-Cr1+BAS-Cr1+ (f) NA:Natural attenuation
ReTOS-Cr1+RAS-Cr1
Fig. 24.3 Biodegradation kinetic evaluation of oil sludge-contaminated soil by consortia LIBeM
and Natural attenuation at 5, 10, 15, and 20% (v/v) concentration of oil sludge. a C1: ReTOS-Cr1
BAS-Cr+RAS-Cr1, b C2: RETL-Cr1+MAB-Cr1+RAS-Cr1, c C3: RETL-Cr1+RAS-Cr1+BAS-
Cr1, d C4: RETL-Cr1+MAB-Cr1+BAS-Cr1, e C5: RETL-Cr1+MAB-Cr1+BAS-Cr1+ f NA:
Natural attenuation ReTOS-Cr1 + RAS-Cr1
Table 24.2 Kinetic expression and half-life times by single and consortia LIBeM
Concentration Incubation Treatment Kinetic K R2 t 1/2 (days)
of oil sludge periods expression (day−1 )
in soil (v/v)
5% 56 days S1 y=− 0.0178 0.9571 38.9
0.0178× +
3.8181
S2 y=− 0.0185 0.9898 37.5
0.0185× +
3.8870
S3 y=− 0.0277 0.9936 25.0
0.0277× +
3.8634
S4 y=− 0.0253 0.9740 27.4
0.0253× +
4.0209
S5 y=− 0.0196 0.9815 35.4
0.0196× +
3.9249
C1 y=− 0.0181 0.9432 38.3
0.0181× +
3.9064
C2 y=− 0.0211 0.9383 38.3
0.0211× +
3.7761
C3 y=− 0.0275 0.9098 25.2
0.0275× +
3.9975
C4 y=− 0.0309 0.9879 22.4
0.0309× +
3.8719
C5 y=− 0.0275 0.9629 23.2
0.0275x +
3.9644
NA y= 0.0044 0.9509 157.5
−0.0044x
+ 3.8846
10% 56 days S1 y=− 0.0313 0.9617 22.1
0.0313× +
4.5939
S2 y=− 0.0270 0.9083 25.7
0.0270× +
4.3848
S3 y=− 0.0323 0.9445 21.5
0.0323× +
4.4332
(continued)

in soil (v/v)
S4 y=− 0.0289 0.9471 24.0
0.0289× +
4.4430
S5 y=− 0.0304 0.9306 22.8
0.0304× +
4.4804
C1 y=− 0.0278 0.9741 24.9
0.0278× +
4.5427
C2 y=− 0.0338 0.9469 20.5
0.0338× +
4.6718
C3 y=− 0.0238 0.9377 29.1
0.0238x +
4.4444
C4 y= 0.0375 0.9305 18.5
−0.0375×
+ 4.3973
C5 y=− 0.0295 0.9200 23.5
0.0295× +
4.3631
NA y=− 0.0073 0.9242 94.9
0.0073× +
4.5512
15% 70 days S1 y=− 0.0248 0.9793 27.9
0.0248x +
5.0360
S2 y=− 0.0251 0.9906 27.6
0.0251× +
4.9173
S3 y=− 0.0264 0.9720 26.3
0.0264× +
5.0578
S4 y=− 0.0246 0.9347 28.2
0.0246× +
5.1764
S5 y=− 0.0287 0.9530 24.1
0.0287× +
5.1135
C1 y=− 0.0274 0.9812 25.3
0.0274× +
5.0054
(continued)

in soil (v/v)
C2 y=− 0.0313 0.9722 22.1
0.0313× +
5.0124
C3 y=− 0.0333 0.9671 20.8
0.0330× +
5.0109
C4 y=− 0.0348 0.9954 19.9
0.0348× +
5.0133
C5 y=− 0.0313 0.9805 22.1
0.0310× +
4.9387
NA y=− 0.0047 0.9349 147.4
0.0047× +
4.9620
20% 84 days S1 y=− 0.0207 0.9106 33.5
0.0207× +
5.3224
S2 y=− 0.0246 0.9918 28.2
0.0246× +
5.3432
S3 y=− 0.0276 0.9973 25.1
0.0276× +
5.2853
S4 y=− 0.0241 0.9432 28.8
0.0241× +
5.4064
S5 y=− 0.0252 0.9770 27.5
0.0252× +
5.3694
C1 y=− 0.0282 0.9753 24.6
0.0282× +
5.3524
C2 y=− 0.0290 0.9772 23.9
0.0313× +
5.2403
C3 y=− 0.0260 0.9913 26.7
0.0260× +
5.2894
C4 y=− 0.0318 0.9838 21.8
0.0318× +
5.3049
(continued)

in soil (v/v)
C5 y=− 0.0272 0.9823 25.5
0.0272× +
5.2469
NA y=− 0.0051 0.9712 135.9
0.0051× +
5.2628
*S = single LIBeM, *C = consortia LIBeM, *NA = natural attenuation
times of more than 40 days are considered persistent to the environment. The natural
attenuation treatment at 5–20% (v/v) concentration oil sludge represents the longest
half-life times with 157.5 days at 5% concentration of oil sludge study. The result
indicates that the indigenous population can degrade the TPH in the polluted soil but
the efficiency is very low and it would be effective over a long period of time.
When compared to others concentration of oil sludge treated, the shortest half-life
times (18.5 days) was recorded in LIBeM Consortia 4 at 10% concentration which
indicates that the augmented soil with (C. tropicalis-RETL-Cr1 + C. violaceum-
MAB-Cr1 + P. aeruginosa-BAS-Cr1) is a promising technique to enhance the
biodegradation of oil sludge as compared to others treatment. The highly increase
in the rate of biodegradation in the ASP-bioreactor system suggests that ventilation
provided through three silicon tubes improves the efficiency of biodegradation in
contaminated soil.
The variation of the rate constants and half-life times observed in this study maybe
due to the following reasons: firstly, different carbon to nitrogen (C:N) induced in
the contaminated soil, the different uptakes by different formulation of LIBeM at
various hydrocarbon concentrations, the effect of biosurfactant produced by single
and consortia LIBeM and their synergistic/mutual relationship are some of the factors
that affect the biodegradation efficiency of oil sludge in the soil (Venosa and Holder
2007).
However, our finding is in line with Aghalibe et al. (2017) who described that
the biodegradation rate of petroleum hydrocarbons (PHCs) contaminated soil micro-
cosms amended with animal-derived organic wastes had a higher rate constant (k)
as well as a lower half-life times (t 1/2 ) (0.025 day−1 and 27.7 days) than unamended
soil (natural attenuation = 0.005 day−1 and 138.6 days), respectively.
Thus it can be concluded that the results of the kinetic modeling indicate that the
remediation process fitted well to first-order kinetics. The kinetics observed in this
study suggested that the maximum biodegradation rate of oil sludge degraded by
LIBeM is at 10% v/v oil sludge rate constant k 0.0375 day−1 and 18.5 days half-life
times recorded. The biodegradation rate and half-life parameters obtained from the
present work demonstrated that the bioremediation of oil sludge depends on variety
of factors such as concentration of the oil sludge, time, and selected strains used as
well as single and consortia LIBeM.
24.4 Conclusion
This study concluded that the R value recorded for all treatment by single and con-
sortia LIBeM at 5, 10, 15, and 20% v/v concentration levels studied obeyed the
first-order kinetics model with R2 (> 0.90). Due to the possibility of sufficient aer-
ation via aerated static pile (ASP) in the soil, the biodegradation of oil sludge was
improving by augmented LIBeM Consortia 4 as compared to other treatments and
control plot (natural attenuation). This was proved by kinetic model and biodegra-
dation rate constant (k) and half-life times recorded with maximum biodegradation
rate of 0.0375 day−1 and the shortest biodegradation half-life times of 18.5 days.
Thus, bioaugmentation of by LIBeM Consortia 4 (C. tropicalis-RETL-Cr1 + C.
violaceum-MAB-Cr1 + P. aeruginosa-BAS-Cr1) was found to show a great perfor-
mance in degrading oil sludge in soil as compared to other treatments. Therefore,
LIBeM consortia 4 has a prominent potential to discover for oil-based remediation
either in soil or in seawater.
Acknowledgements This study was financially supported by a grant (GUG0035-SGP-1/2016)

from the Centre of Research and Innovation, Universiti Malaysia Sabah. We are indebted to Depart-
ment of Environment (DOE) Malaysia and Labuan Shipyard and Engineering Sdn. Bhd. for granting
us permission to use and treat the oil sludge for this research.
References
Agarry SE, Aremu MO, Aworanti OA (2013) Kinetic modelling and half-life study on enhanced soil
bioremediation of Bonny light crude oil amended with crop and animal derived organic wastes.
Pet Environ Biotechnol 4:2
Aghalibe CU, Igwe JC, Obike AI (2017) Studies on the removal of petroleum hydrocarbon (PHCs)
from a crude oil impacted soil amended with cow dung, poultry manure and NPK fertilizer. Chem
Res J 2(4):22–30
Alexander M (1999) Biodegradation and bioremediation, 2nd edn. Academic Press, San, Diego
Everitt B (2002) The cambridge dictionary of statistics. Cambridge University Press, Cambridge,
UK
Greene EA, Kay JG, Jaber K, Stehmeier G, Voordouw G (2000) Composition of soil micro-
bial communities enriched on a mixture of aromatic hydrocarbons. Apply Environ Microbiol
66(12):5282–5289
Hinga KR (2003) Degradation rates of low molecular weight PAH correlate with sediment TOC in
marine subtidal sediments. March Pollution Bull 46:466–474
Kachieng’a L, Momba MNB (2017) Kinetics of petroleum oil biodegradation by a consortium of
three protozoan isolates (Aspidisca sp., Trachelophyllum sp. and Peranema sp.). Biotechnol Rep
15:125–131
Maletić S, Dalmacija B, Rončević S, Agbaba J, Petrović O (2009) Degradation kinetics of an aged

hydrocarbon-contaminated soil. Water Air Soil Pollut 202:149–159
Mohajeri L, Aziz HA, Isa MH, Zahed MA, Mohajeri S (2013) Effect of remediation strategy on
crude oil biodegradation kinetic and half-life times in shoreline sediment samples. Int J Agric Sci
Eng 3(2):99–104
Pala DM, de Carvalho DD, Pinto JC, Sant’Anna Jr GL (2006). A suitable model to describe
bioremediation of a petroleum-contaminated soil. Int Biodeterior Biodegrad 58:254–260
Reardon KF, Mosteller DC, Rogers JB, DuTeau NM, Kee-Hong K (2002) Biodegradation kinetic
of aromatic hydrocarbon mixtures by pure and mixed bacterial cultures. Environ Health Prospect
110(12):1005–1012
Ruberto L, Vazquez SC, Cormack WPM (2003) Effectiveness of the natural bacterial flora, bios-
timulation and bioaugmentation on the bioremediation of a hydrocarbon contaminated Antarctic
soil. Int Biodeterior Biodegrad 52:115–125
Sarkar D, Ferguson M, Datta R, Birnbaum S (2005) Bioremediation of petroleum hydrocarbons
in contaminated soils: comparison of biosolids addition, carbon supplementation, and monitored
natural attenuation. Environ Pollut 136:187–195
Sinkkonen S, Paasivirta J (2000) Degradation half-life times of PCDDs, PCDFs and PCBs for
environmental fate modeling. Chemosphere 40(9–11):943–949
United States Environmental Protection Agency (USEPA) (1996) Abstracts of remediation case
studies. Office of Solid Waste and Emergency Response, US Environmental Protection Agency.
Publication number EPA-542-R-95-001, Washington, DC
Venosa AD, Holder EL (2007) Biodegradability of dispersed crude oil at two different temperatures.
March Pollution Bull 54:545–553
Zahed MA, Abdul Aziz H, Isa MH, Mohajeri L, Mohajeri S, Kutty SRM (2011) Kinetic modeling
and half-life study on bioremediation of crude oil dispersed by Corexit 9500. J Hazard Mater
185:1027–1031
Chapter 25
A Comparative Study of the Accuracy
of Regularized and Tension Spline
Interpolation Methods to Map
the Surface Water Temperature of Pulau
Tuba, Langkawi, Kedah
Sharir Aizat Kamaruddin, Shaidatul Najwa Zainolabdin,

Khairul Naim Abd.Aziz, Muhammad Akmal Roslani,
Nur Syazwana Akmal Mohd Zohir
and Nurdamia Yasmin Mustaffa Al-Bakri
Abstract Spatial models developed using deterministic interpolation techniques

have been popularly used to predict the distribution of water quality parameters. A
research was carried out to compare the performance of regularized spline and tension
spline methods to estimate the surface water temperature of Pulau Tuba, Langkawi,
Kedah. Twenty sampling points have been randomly set up to measure the level of
surface water temperature using the Yellow Springs Instrument 650 Multiparameter
Display System (YSI650 MDS) from September to November 2016. The data from
half of the randomly selected sampling points have been used to calibrate the model
while the remaining was used for validation. Regularized and tension spline interpo-
lation methods were used in this research. Based on the correlation and error analysis,
S. A. Kamaruddin (B) · S. N. Zainolabdin · K. N. Abd.Aziz · M. A. Roslani · N. S. A. M. Zohir ·

N. Y. M. Al-Bakri
Faculty of Applied Sciences, Universiti Teknologi MARA, Perlis Branch, Arau Campus, 02600
Arau, Perlis, Malaysia
e-mail: shariraizat@uitm.edu.my
S. N. Zainolabdin
e-mail: shaidatulnajwa0212@gmail.com
K. N. Abd.Aziz
e-mail: khairul87@uitm.edu.my
M. A. Roslani
e-mail: akmalroslani@uitm.edu.my
N. S. A. M. Zohir
e-mail: syazwana.akmalmz@gmail.com
N. Y. M. Al-Bakri
e-mail: yasminmus266@gmail.com
Faculty of Applied Sciences, Marine Research and Excellent Center, Universiti Teknologi
MARA, Perlis Branch, Arau Campus, 02600 Arau, Perlis, Malaysia

286 S. A. Kamaruddin et al.
the research found that the tension spline method performed better than the regular-
ized spline method. The spatial model developed using the tension spline method
was then transformed into a map of temperature. The map accuracy assessment was
then carried out and it was found that it produced a high accuracy to estimate the
sea surface temperature at other locations. The developed map can be used by the
government and private sector for the future and sustainable development of Pulau
Tuba, Langkawi, Kedah.
Keywords Temperature · Spline · Interpolation · Pulau Tuba
25.1 Introduction
Time-consuming, expensiveness, and requiring a lot of efforts are examples of several

barriers faced by environmentalists to gather information related to the water quality
status of an area (Kamaruddin et al. 2018). Instead, spatial interpolation techniques
are being explored for a better assessment of the water quality of an area (Kamaruddin
et al. 2019). Spatial interpolation is a form of the mathematical model that treated
points with known values to estimate the unknown values within the study area (Wei
et al. 2012). However, there is a lack of information on the applicability of spatial
interpolation methods to estimate the surface water quality in river, stream, estuary,
and coastal.
Spatial interpolation methods can be classified into deterministic and stochastic
interpolation methods (Varouchakis and Hristopulos 2012). Today, lots of research
have been carried out to investigate the application of stochastic interpolation tech-
nique due to its capability to assess spatial autocorrelation (Kalivas et al. 2013).
The extensive mathematical and statistical model is well equipped in the stochas-
tic methods to predict the point of unknown locations (Mariethoz and Caers 2014).
Consequently, there were not many studies carried out to look into the potential
applicability of spline interpolation methods which is a form of deterministic inter-
polation method. The spline interpolation method estimates the value to produce a
smooth surface that passes exactly through the input points (Xiong and Tang 2019).
The smooth surface is a result of applying the mathematical function that minimized
the overall surface curvature (Favorskaya and Jain 2017).
This research is carried out to investigate the performance of the tension and
regularized spline methods to estimate the surface water temperature of Pulau Tuba
(Tuba Island), Langkawi, Kedah. To achieve the aim of this research, several specific
objectives are outlined, (1) to develop spatial models of sea surface temperature
using tension and regularized spline methods and (2) to compare the accuracy of the
developed spatial models.
25 A Comparative Study of the Accuracy of Regularized … 287
Water quality is described in terms of the chemical, physical, and biological contents
of water. The quality of marine water changes with the variations of seasons and
geographical areas (Costa et al. 2018). Assessment of water quality can be made
by investigating and analyzing water samples of the subject area. Temperature, for
instance, is an example of a water quality parameter—a form of limiting factor in
the aquatic environment (Gholizadeh et al. 2016). Water temperature governs marine
life and ecosystems. It affects the metabolic activities, growth, feeding, reproduction,
distribution, and behaviors of aquatic organisms. It affects the solubility of gases in
the water, when the temperature increases the solubility of gases in water decreases
(Reger et al. 2009).
Geographical Information Systems (GIS) provides a platform for data capture,
data management, data manipulation, analysis, and the presentation of results in
both graphic and statistical forms (Bernhardsen 2002). A Geographical Information
System links locational (spatial) and database (tabular) information and enables a
person to visualize patterns, relationships, and trends (Panigrahi 2014). This pro-
cess gives an entire perspective to data analysis that cannot be seen in a table or
list format. Interpolation is one of the most successful application areas of GIS in
modeling spatial changes in environmental systems (Bui et al. 2017). Interpolation
is the procedure used to predict cell values for locations that are in lack of sample
points (Szypula 2017). Interpolation applies the principle of spatial autocorrelation
or spatial dependence between near and distant objects through the measurement of
the degree of relationship/dependence.
A spline interpolation method is a form of deterministic interpolation technique.
This technique has been widely used for the estimation of the pattern of pollution
and weather analysis. For instance, Londoño-Ciro and Cañón-Barriga (2015) used
the spline method for spatial air quality study while Wei et al. (2012) used it to
interpolate the mean precipitation.
25.3 Methodology
Sampling activities were carried out from September to November 2016 during high
tide at noon to show the maximum reading of water quality. Twenty sampling points
were set up and their locations were recorded using Global Positioning Systems
(GPS). The Yellow Springs Instrument 650 Multiparameter Display System (YSI650
MDS) was calibrated carefully before the sampling activities were commenced. The
probe was lowered to a depth of 1 m to sample the temperature level. Then, the
raw data were downloaded into excel sheets and post-processing of raw data was
carried out later. In this research, 10 sampling points were randomly chosen to be
used in developing the spatial model while the remaining was used to validate the
developed model. Two types of mathematical spline methods, namely, the tension and
regularize spline were used in this research. Correlation analysis was then carried
out to investigate the strength and magnitude of the association between the two
variables (predicted and observed values of the temperature). An error analysis has
also been used to investigate the total residuals produced by the developed spatial
model. The best interpolation method should yield positive and high correlation.
Thus, the developed model should generate less mean square error or residuals. The
best spatial model was then transformed into a map. Common map elements such as
north arrow, title, scale, legend, and frame were inserted for better presentation and
visualization.
According to Tait et al. (2006), splines are interpolators that fit a function to sam-
pled points and can be classified as tension splines and regularized splines. Tension
spline type creates a less smooth surface with value more closed constrained by the
sample data range compared to regularized spline type. Section A shows the general
mathematical formula for the spline model. T (x, y) and R(r) are defined differently,
depending on the selected option: tension-type (refer to Section B) or regularize-type
(refer to Section C). The formula for splines methods was referred to Wu and Hung
(2016). The Eq. (25.1) shows the general equation for the spline model which can be
divided into two parts: T (x, y) and R(r). The Eqs. (25.2) and (25.4) used the coeffi-
cients found by the solution of a system of the linear equations and to be substituted
for T (x, y). On the other hand, Eqs. (25.3) and (25.5) calculated the distance between
points and was substituted for R(r).
A. Splines Equation

N

S(x, y) = T (x, y) + λj R r j , (25.1)
j=1
where
J 1, 2, … N
N Number of points
λj Coefficients found by the solution of a system of the linear equations.
rj Distance from the point (x, y) to the jth point.
B. Tension spline method
T (x, y) = a1 , (25.2)
where
a1 coefficients found by the solution of a system of the linear equations
and
1 rϕ
R(r ) = ln + c + K ◦ (r ϕ) (25.3)
2π ϕ 2 2
ϕ 2 Weight parameter
K ◦ Modified Bessel function
C constant equal to 0.0577215
C. Regularized spline method
T (x, y) = a1 + a2 x + a3 y, (25.4)
where
a1 coefficients found by the solution of a system of the linear equation
and,
r
1 r2 r r
R(r ) = ln + c − 1 + τ K◦
2
+ c + ln , (25.5)
2π 4 2π τ 2π
where
r Distance between the point and the sample
τ 2 Weight parameter
K ◦ Modified Bessel function
For the statistical analysis, the observed values were compared with the predicted
values through the correlation analysis and error analysis. Pearson correlation coeffi-
cient (r) (Eq. 25.6) and Coefficient of determination (R2 ) (Eq. 25.7) were used for the
correlation analysis while the Root Mean Square Error (RMSE) (Eq. 25.8) and Mean
Absolute Error (MAE) (Eq. 25.9) were used for the error analysis. After the spatial
model is transformed into the spatial map, an assessment of accuracy is carried out.
Equation (25.10) shows the formula to calculate the map’s overall accuracy (OA).
n
xi − X y1 − Y
i=1
Pearson correlation coefficient (r ) = 2 , (25.6)
n 2 n
i=1 x i − X i=1 yi − Y
where
X and Y are the sample means of x i and yi
Coefficient of Determination, R 2 = r 2 , (25.7)
where
r Pearson correlation coefficient
21

N
2
Root Mean Square Error (RMSE) = z f i − z 0i /N , (25.8)
i=1
where
z f i is the observed value and z 0i is the predicted value.
1
n
y j − y j ,

Mean Absoulte Error (MAE) = (25.9)

n j=1
where
yj is the observed value and y j is the predicted value
Sum of Correct Occurrences

Overall Accuracy (OA) = × 100% (25.10)
Sum of Occurrences
The spatial model of temperature was successfully developed using tension and reg-
ularized spline methods. The analysis of the Pearson correlation coefficient shows
that the tension spline produced a coefficient of 0.854 while the regularized spline
generates a coefficient of 0.767. Both models exhibited positive and strong correla-
tions between predicted and observed values of temperature level. The research also
found that the coefficient of determination recorded by the tension spline method
is more than the coefficients of determination recorded by the regularized spline
method. 58.88% of the variance was explained by the regularized model compared
to 72.97% of the variance explained by the tension spline model. The linear equation
for the regularized and tension is y = 0.7415x + 8.1633 and y = 1.0946x + 3.4731,
respectively. Figures 25.1 and 25.2 show the plot of regression of the predicted and
observed values of temperature (o C) for both models.
The standard deviation calculated for the regularized spline and tension spline was
0.634 and 0.478, respectively. This research found that tension spline had less amount
of variation or deviation from the mean compared to regularize spline. Furthermore,
the research found that regularized spline type overestimated the level of temperature
at ST002, ST003, ST004, ST005, ST006, ST007, ST008, and ST010 and underesti-
mated the level of temperature at ST001 and ST009. Conversely, for tension spline
type, the model overestimated the level of temperature at ST001, ST002, ST003,
ST004, ST005, ST006, ST007, ST008, and ST010 while the model underestimated
the level of temperature at ST009 only. Table 25.1 shows the list of observed and
predicted values generated using regularized and tension spline types.
Fig. 25.1 Plot showing the Predicted vs Observed Value (0C) :

regression between the
Regularized Spline Model
predicted and the observed
value of temperature (°C) 34
Predicted Value (0C)

based on the Regularized 33.5
Spline model
33
32.5
32 y = 0.7415x + 8.1633
R² = 0.5888
31.5
31
32 32.5 33 33.5 34 34.5
Observed Value (0C)
Fig. 25.2 Plot showing the Predicted vs Observed Value (0C) :

regression between the Tension Spline Model
predicted and observed value
34.5
of temperature (°C) based on
Predicted Value (0C)
34
the Tension Spline model
33.5
33
32.5
32 y = 1.0946x - 3.4731
31.5 R² = 0.7297
31
32 32.5 33 33.5 34 34.5
Observed Value (0C)
Table 25.1 Comparison between observed and predicted reading of temperature (°C)
Station Observed (°C) Predicted (°C)
Regularized Tension
ST001 33.06 32.82 33.10
ST002 32.75 32.99 33.11
ST003 32.87 33.89 33.23
ST004 33.00 33.61 33.14
ST005 31.50 32.15 32.41
ST006 32.89 33.26 33.09
ST007 32.96 33.18 33.22
ST008 33.58 34.15 34.13
ST009 32.78 32.49 32.64
ST010 31.80 32.61 32.56
Mean (µ) 32.719 33.115 33.063
Standard deviation (Std.) 0.613 0.634 0.478
Variance (Var.) 0.376 0.402 0.229
In the error analysis, the Mean Absolute Error (MAE) and Root Mean Square
Error (RMSE) values for regularized spline method were determined at 0.502 and
0.566. In contrast, the MAE and RMSE values for the tension spline were calculated
at 0.372 and 0.460, respectively.
Next, the spatial model using the tension spline type was transformed into a map.
Legend, map title, scales, and north arrow were inserted into the map of temperature
for better communication and visualization. Only three data classifications were
chosen for the map of temperature (<30, 30–32 and >32 °C). Figure 25.3 shows the
completed map of the surface water temperature of Pulau Tuba, Langkawi, Kedah.
Fig. 25.3 Map developed using tension spline model

Table 25.2 Comparison

Station Observed (°C) Predicted (°C)
between observed and
predicted reading of ST001 >32 >32
temperature (°C) ST002 >32 >32
ST003 >32 >32
ST004 >32 >32
ST005 30–32 >32
ST006 >32 >32
ST007 >32 >32
ST008 >32 >32
ST009 >32 >32
ST010 30–32 >32
The accuracy of the developed map was calculated at 80% of accuracy for temper-
ature. The research found that there were two stations that were ST005 and ST010
did not achieve the correct occurrence. The reason for incorrect occurrence for these
stations was due to overestimating and underestimating of predicted temperature by
tension spline method. Table 25.2 shows the comparison between the observed and
predicted reading of temperature (°C).
Next, the research found that both models exhibited a positive and strong correla-
tion between predicted and observed values of temperature level. The research also
found that the coefficient of determination recorded by the tension spline method
was more than the coefficients of determination recorded by the regularized spline
method. This research found that the tension spline method produced less error in
estimating temperature compared to regularized spline method. The RMSE and MAE
were also found to be less than half of the standard deviation of the observed value
which indicates better model performance. This result agreed with the finding by
Garnero and Godone (2014), where the tension spline estimates the unknown value
better than the regularized spline method.
Changes in sea surface temperature can alter marine ecosystems in several ways.
For example, variations in ocean temperature can affect species density and richness
of plants and animals present in ecology (Costello and Chaudhary 2017), alter migra-
tion (Kuczynski et al. 2017) and breeding patterns (Pankhurst and Munday 2011),
threaten complex ocean life, such as corals, and change the frequency and intensity
of harmful algal blooms. Over the long term, the increasing sea surface tempera-
ture could also reduce the circulation patterns that bring nutrients from the deep sea
to surface waters. The changes in reef habitat and nutrient supply can lead to the
declining of fish populations, which in turn could affect people who are depending
on fishing for food or jobs (Weatherdon et al. 2016). Since the oceans continuously
interact with the atmosphere, sea surface temperature can also have profound effects
on the global climate. Based on the increase in sea surface temperature, the amount
of atmospheric water vapor over the oceans is estimated to have increased during the
twentieth century (Santer et al. 2007).
25.5 Conclusion
Spatial models of surface water temperature have been successfully developed using
a spline interpolation technique. The research found that the tension spline method
performed better than the regularized spline method for both water quality parame-
ters. The developed tension spline model of temperature achieved positive correla-
tions, high coefficient of determinations, low MAE and RMSE value. The developed
spatial model has been successfully transformed into maps. The developed map
demonstrated high overall accuracy. The map can be used by the government and
private sector for the future and sustainable development of Pulau Tuba, Langkawi,
Kedah.
Acknowledgements The authors gratefully acknowledge the generous assistance and support
from the academic and nonacademic staff for their contributions in this research especially to
Marine Research and Excellent Center (MAREC), Universiti Teknologi MARA, Perlis Branch,
Arau Campus, 02600 Arau, Perlis, Malaysia.
References
Bernhardsen T (2002) Geographic information systems: an introduction. Wiley, Hoboken, NJ

Bui DT, Do AN, Bui H, Hoang N (2017) Advances and applications in geospatial technology and
earth resources. In: Proceedings of the international conference on geo-spatial technologies and
earth resources 2017. Springer, Basingstoke, England
Costa CR, Costa MF, Dantas DV, Barletta M (2018) Interannual and seasonal variations in estuarine
water quality. Front Mar Sci 5. https://doi.org/10.3389/fmars.2018.00301
Costello MJ, Chaudhary C (2017) Marine biodiversity, biogeography, deep-sea gradients, and
conservation. Curr Biol 27(13):2051. https://doi.org/10.1016/j.cub.2017.06.015
Favorskaya MN, Jain LC (2017) Handbook on advances in remote sensing and geographic informa-
tion systems: paradigms and applications in forest landscape modeling. Springer, Basingstoke,
England
Garnero G, Godone D (2014) Comparisons between different interpolation techniques. ISPRS—
Int Arch Photogramm, Remote Sens Spat Inf Sci XL-5/W3:139–144. https://doi.org/10.5194/
isprsarchives-xl-5-w3-139-2013
Gholizadeh M, Melesse A, Reddi L (2016) A comprehensive review on water quality parame-
ters estimation using remote sensing techniques. Sensors 16(8):1298. https://doi.org/10.3390/
s16081298
Kalivas D, Kollias V, Apostolidis E (2013) Evaluation of three spatial interpolation methods to
estimate forest volume in the municipal forest of the Greek island Skyros. Geo-Spat Inf Sci
16(2):100–112. https://doi.org/10.1080/10095020.2013.766398
Kamaruddin SA, Abd Aziz KN, Roslani MA, Tajam J, Zaınolabdın SN, Mohd Razman NF (2018)
Mapping of salinity level using spline interpolation techniques over the water of Sungai Merbok
Kedah. Malays J Sustain Environ 5(2):114. https://doi.org/10.24191/myse.v5i2.5620
Kamaruddin SA, Zainolabdin SN, Aziz KN, Roslani MA (2019) Comparative study of regu-
larized and tension spline interpolation method to map surface-water salinity of Pulau Tuba,
Langkawi, Kedah. Multidiscip Inform J 2(1):91–97. https://drive.google.com/file/d/1_qkJEiQql_
Fh9KMOWZeeqoHgFrKQOPJC/view
Kuczynski L, Chevalier M, Laffaille P, Legrand M, Grenouillet G (2017) Indirect effect of temper-

ature on fish population abundances through phenological changes. PLoS ONE 12(4):e0175735.
https://doi.org/10.1371/journal.pone.0175735
Londoño-Ciro LA, Cañón-Barriga JE (2015) Imputation of spatial air quality data using gis-spline
and the index of agreement in sparse urban monitoring networks. Revista Facultad de Ingeniería
Universidad de Antioquia (76). https://doi.org/10.17533/udea.redin.n76a09
Mariethoz PG, Caers J (2014) Multiple-point geostatistics: stochastic modeling with training
images. Wiley, Hoboken, NJ
Panigrahi N (2014) Computing in geographic information systems. CRC Press, Boca Raton, FL
Pankhurst NW, Munday PL (2011) Effects of climate change on fish reproduction and early life
history stages. Mar Freshw Res 62(9):1015. https://doi.org/10.1071/mf10269
Reger DL, Goode SR, Ball DW (2009) Chemistry: principles and practice. Cengage Learning,
Boston, MA
Santer BD, Mears C, Wentz FJ, Taylor KE, Gleckler PJ, Wigley TM, Wehner MF (2007) Iden-
tification of human-induced changes in atmospheric moisture content. Proc Natl Acad Sci
104(39):15248–15253. https://doi.org/10.1073/pnas.0702872104
Szypuła B (2017) Geomorphometric comparison of DEMs built by different interpolation methods.
Landf Anal 32:45–58. https://doi.org/10.12657/landfana.032.004
Tait A, Henderson R, Turner R, Zheng X (2006) Thin plate smoothing spline interpolation of daily
rainfall for New Zealand using a climatological rainfall surface. Int J Climatol 26(14):2097–2115.
https://doi.org/10.1002/joc.1350
Varouchakis EA, Hristopulos DT (2012) Comparison of stochastic and deterministic methods for
mapping groundwater level spatial variability in sparsely monitored basins. Environ Monit Assess
185(1):1–19. https://doi.org/10.1007/s10661-012-2527-y
Weatherdon LV, Magnan AK, Rogers AD, Sumaila UR, Cheung WW (2016) Observed and projected
impacts of climate change on marine fisheries, aquaculture, coastal tourism, and human health:
an update. Front Mar Sci 3. https://doi.org/10.3389/fmars.2016.00048
Wei Z, Yun P, Jinliang Q, Xiaoli Y, Yanjiao L, Jing L (2012) Analysis and study on space variation
laws of rainfall of Yuanyang Hani Terrace. Procedia Earth Planet Sci 5:94–101. https://doi.org/
10.1016/j.proeps.2012.01.016
Wu Y, Hung M (2016) Comparison of spatial interpolation techniques using visualization and
quantitative assessment. Appl Spat Stat. https://doi.org/10.5772/65996
Xiong L, Tang G (2019) Loess landform inheritance: modeling and discovery. Springer, Bas-
ingstoke, England
Chapter 26
Antibacterial and Insect-Repellent
Activities of Cananga odorata Essential
Oil
Syarifah Nursyimi Azlina Syed Ismail, Sharifah Sakinah Syed Soffian,
Rosmawati Abdul Aziz and Nordiana Suhada Mohmad Tahiruddin
Abstract Cananga odorata, known as ‘Bunga Kenanga’, is one of the plants where
its essential oil is widely used in cosmetic and food industry. The C. odorata
essential oils and the extracts showed a number of bioactivities, including anti-
inflammatory, antidiabetic, antimicrobial and insect-repellent activities. Therefore,
this study demonstrates the importance of the extraction of C. odorata essential oil as
insect repellency and antibacterial activities for agriculture and medicine purposes.
The essential oil was extracted from approximately 2600 g of C. odorata dried pow-
dered flower samples by using the steam distillation process. After the distillation,
the percentage yield of the floral-scented colourless C. odorata essential oil is calcu-
lated, and the yield obtained is 0.083% (V/W) or about 2.2 mL of essential oil. Then,
the oil was analysed using GC-MS and it was found that linalool (21.78%), acetic
acid (15.77%), β-ocimene (13.53%), piperonal (10.02%) and eugenol (7.42%) have
been recognized as the bioactive compounds that possess antimicrobial activities
towards food-borne microorganisms that are used: Salmonella typhi, Bacillus sub-
tilis, Staphylococcus aureus and Escherichia coli. Linalool is another compound that
has been shown to have insect-repellent activity against house ants (Monomorium
pharaonis). Overall, this study emphasizes the potential of C. odorata to be used
as a natural insect repellent that also possesses antibacterial activity and provides
sufficient baseline information for future works and commercial exploitation.
Keywords Cananga odorata · Antibacterial activity · Insect repellent
S. N. A. Syed Ismail (B) · S. S. Syed Soffian

Universiti Teknologi MARA, 02600 Arau, Perlis, Malaysia
e-mail: syarifah_nursyimi@uitm.edu.my
S. S. Syed Soffian
e-mail: shsakinah1701@gmail.com
R. A. Aziz · N. S. M. Tahiruddin
Universiti Teknologi MARA Cawangan Perak, Kampus Tapah, 35400 Tapah Road, Perak,
Malaysia
e-mail: rosmawatiaa@uitm.edu.my
N. S. M. Tahiruddin
e-mail: dianasuhada@uitm.edu.my

298 S. N. A. Syed Ismail et al.
26.1 Introduction
Cananga odorata, known as ‘Bunga Kenanga’ by the natives, is locally found in

tropical climate countries, such as Malaysia, Indonesia and Philippines. This fragrant
flower is one of the plants that are largely exploited for its essential oil (Burdock and
Carabin 2008). Cananga odorata has a rich and deep smell of rubber and custard
mixed with hints of neroli and jasmine. The main active compounds in C. odorata
essential oil are linalool, benzyl acetate, methyl benzoate and p-cresyl methyl ether
which determine its distinctive scent (Giang and Son 2016). These active compounds
are not toxic. Furthermore, linalool and eugenol showed repellency to some insects
that might be suitable to replace the use of most of insect-repellent formulas in the
market which contain toxic compounds such as N,N-diethyl-m-toluamide (DEET)
and piperonylbutoxide (PBO) (Wathoni et al. 2018). The use of commercial or syn-
thetic insect repellent has various effects on human health, such as disorientation,
dizziness, seizures, and may cause death. Thus, based on this perspective, the sci-
entific studies are more focused on natural insect repellent in plants as a potential
insect repellent (Wathoni et al. 2018).
Recent studies have shown a wide variety of bioactivities exhibited by the essential
oils and the extracts of C. odorata, including antimicrobial, antivector and insect
repellent (Tan et al. 2015). Repellency activities of linalool showed to lure away
some insects that can be found mainly in C. odorata flowers. Using plant essential
oils as biopesticides can be very efficient in controlling pests. They can function
as fumigants using their topical toxicity, or as antifeedants using their repellent
properties. Other study found that botanical oils can be toxic and repellent to adult
insect and can lead to an inhibition of reproduction. Research agreed that because
it is not harmful to non-target organism, including humans, plant-based repellents
could be more environmental-friendly than synthetic products (Yao et al. 2011).
Generally, herbal plants essential oils were found to have hydrophobic liquid and
it’s the choice to treat and reduce food-borne pathogens contamination. They have
many chemical components that may benefit human and environment due to antibac-
terial activity, antioxidant activity and natural preservative properties (Mabona et al.
2013). With the rising prevalence of microorganisms showing resistance to antibiotics
and contain natural antioxidants and natural antimicrobial agent that can prevent from
heart disease, malaria and cancer, there is an urgency to develop new antimicrobial
compounds.
One of the methods for isolation of essential oil from plant materials is steam
distillation. It is due to higher percentage yield produced by this method compared
to hydro distillation (Yadav et al. 2017). Steam distillation is used as the separation
technique to purify or isolate the products of sensitive temperature such as natural
aromatic compound and to heat and separate components at temperature below their
decomposition point (Giwa et al. 2018). The method will separate miscible liquid
based on their volatilities and the boiling point of products that imitate the atmo-
spheric pressure (Giwa et al. 2018). A study has confirmed that steam distillation has
many benefits in the separation of the natural products to prevent oil from destroying
26 Antibacterial and Insect-Repellent Activities of Cananga … 299
during the distillation process (Sikdar et al. 2016). Hence, this ensures that the quality
of oil is good and will help to minimize any contamination with other compound in
the plant (Yadav et al. 2017). It has the potential to produce the essential oil from
the flower which releases aroma molecules by forcing open the pockets of the oil in
plant material (Yadav et al. 2017).
The aims of this study are to extract the C. odorata essential oil using steam
distillation method and identify the presence of active compounds in essential oil
by using gas chromatography-mass spectroscopy (GC-MS). A further study was
recommended on the insect repellency activity of C. odorata essential oil on house
ants (Monomorium pharaonis) and to determine the antibacterial activities of the
C. odorata essential oil by using disk diffusion method.
26.2 Research Methodology
26.2.1 Sample and Chemicals Preparation
The C. odorata was collected from Alor Setar, Kedah Darul Aman, Malaysia. 70%
ethanol solution was prepared by mixing the 0.7 mL of absolute ethanol with dis-
tilled water to the 1 L volumetric flask. The pH of the solution was recorded as
7. This ethanol was then used to clean the flower from impurities and also used to
disinfect the table and apparatus antibacterial activity experimentation. The fresh
C. odorata flower was immersed in 70% of ethanol to get rid of impurities and dried
approximately for 8 hours in an oven at a temperature of 40 °C. Then the dried flower
was crushed using an electric grinder to increase the effectiveness contact of solvent
with sample (Yahaya et al. 2018) and transferred to a round bottom flask for steam
distillation. Nutrient agar was used for antibacterial activity. 20 g of nutrient agar
was added to 1 L of boiling distilled water in a beaker. It was boiled for 15 min and
cooled to 40 °C and was transferred to a 1 L Scott glass bottle and autoclaved. When
it cools, it was poured in plastic petri dish and let to harden.
26.2.2 Extraction of Essential Oil Using Steam Distillation
A portion of 100 g of dried powdered flowers was transferred in a round bottom flask
with addition of 100 mL of distilled water. The steam distillation for the extraction
of C. odorata was set up in fume hood. The time taken for extraction was approxi-
mately 8 h and the optimum temperature is 100 °C (Hesham et al. 2016). The steam
in the combination of the essential oil was distilled into the cylinder and then was
separated from the aqueous layer. The mixture was separated by using the separat-
ing funnel and the moisture content in the essential oil was removed by using the
anhydrous sodium sulphate (Mahendera and Shah 2014). The percentage yield of
the C. odorata essential oil was calculated and the yield obtained was recorded. One
part of the essential oil was then diluted with pure n-hexane prior analysed by gas
chromatography for determining the compounds present.
26.2.3 Determination of Active Compounds Using Gas

Chromatography Mass Spectroscopy (GC-MS)
The essential oil extracted was analysed by using GC-MS to identify the presence
of active compounds in C. odorata. This GC-MS carry helium gas at a constant
pressure. GC-MS analyses were carried out by using splitless injection volume of 1
μL. The capillary column thickness is 30 m × 0.32 m × 0.25 μm and the solvent
used to rinse the column was 99% of n-hexane GC grade. The injector temperature
was set at 220 °C, transfer line at 240 °C, detector temperature at 250 °C and the
oven temperature programme from 60 to 246 °C. The carrier gas program of GC-MS
was at 1 mL/min (Varkey et al. 2014).
26.2.4 Assessment of Insect-Repellent Activity Against

Monomorium pharaonis
The repellency test was performed according to Su et al. (2009), Yao et al. (2011)
and Caballero-Gallardo et al. (2014) with slight modifications. The repellency of the
oil was determined with area choice tests using food on white paper. On the paper,
two sucrose gummy drops were placed on the middle of the paper and essential oil of
C. odorata flower was used to make a circle around the drops and distilled water was
used as a controlled on the other drops. The experiment was then exposed to ants for
6 h. Observation was recorded for evaluation on the insect repellency activity against
M. pharaonis.
26.2.5 Antibacterial Activity of Cananga odorata Essential

Oil
The microorganisms used in the study were bacteria such as Staphylococcus aureus,
Salmonella typhi, Escherichia coli and Bacillus subtilis. Nutrient agar culture
medium was used to study the antibacterial activity. Antibacterial activity was eval-
uated using Kirby Bauer disk diffusion method. The inhibition zones were reported
in millimetres (mm). Nutrient agar plates were inoculated with bacterial strain under
sterile conditions and sterile discs (diameter = 6 mm) were filled with 200 μL of
the test samples and incubated at 37 °C for 48 h. After the incubation period, the
diameter of the growth inhibition zones was measured (Jahangirian et al. 2013).
26.3.1 The Extraction of Cananga odorata Essential Oil
The extraction of essential oil obtained from the steam distillation was colourless
oil. The percentage yield was calculated at 0.083% (v/w) with 2.2 mL extracted
from approximately 2600 g of the C. odorata flowers. Similar extraction method
conducted by Yahaya et al. (2018) indicated the percentage yield of 0.075%. There
are many factors that could affect the percentage yield of the oils such as the time of
sample collection, the area of sample collection and the type of extraction and solvent
used. Dissimilarity of the oil yield may result from the condition of the extraction,
because it was reported that the cooler the surrounding temperature, the more yield
of essential oil acquired (Yahaya et al. 2018).
26.3.2 Determination of the Active Compounds in Cananga

odorata Essential Oil Using Gas
Chromatography-Mass Spectroscopy (GC-MS)
The essential oil of the flowers of C. odorata was analysed using GC-MS with a
CP-Sil-5-CB column. The identification of the oil constituents was carried out by
using a computer-supported spectral library MassFinder which allowed simultaneous
comparison of retention indices. The relative percentages of the oil components were
calculated by peak normalization using the GC CP-Sil-5-CB capillary column. A total
of 40 compounds were identified, constituting 90% of the oil. Figure 26.1 shows
the chromatogram for the GC-MS analysis of C. odorata essential oil. The major
compounds content that were identified in the essential oil were linalool (21.78%),
acetic acid (15.77%), β-ocimene (13.53%), piperonal (10.02%) and eugenol (7.42%)
as summarised in Table 26.1.
The data indicated that linalool was the highest compound content in the essential
oil followed by carboxyl group of acetic acid and phenylmethyl ester, beta-Ocimene,
piperonal and the lowest compound presence was eugenol. The data was similar to
the study by Teng Hern et al. (2015), which recorded the same finding that has shown
linalool as the highest compound in C. odorata essential oil.
Fig. 26.1 Chromatogram for GC-MS analysis of C. odorata essential oil
Table 26.1 Major active

No. RT Compound Content (%)
compounds found in C.
odorata essential oil 1 8.815 Linalool 21.78
2 9.770 Acetic acid, phenylmethyl 15.77
ester
3 10.995 β-Ocimene 13.53
4 11.978 Piperonal 10.02
5 12.220 Eugenol 7.42
26.3.3 Insect-Repellent Activity of Cananga odorata Extract

Against House Ants
Ants’ repellent activity has been conducted to evaluate the repellency activity of
C. odorata essential oil against M. pharaonis. The essential oil was applied on a paper
surrounding with the moist sucrose gummy drops, and on another paper distilled
water was dropped as controlled sample for this test. The test was conducted outdoor
Fig. 26.2 Setup for the test

of repellency activity of C.
odorata essential oil against
house ants
Fig. 26.3 Observation of the

repellency activity of C.
odorata essential oil after 6 h
of exposure
near ants’ nest and was observed for every 30 min along 6 h. The test was set up as
shown in Fig. 26.2 and the result obtained after 6 h of exposure is shown in Fig. 26.3.
It was found that the ants are present only at the sucrose gummy drop surrounded
by distilled water and that there are no ants surrounded at the other sucrose gummy
drop surrounded by the C. odorata essential oil. The presence of insect-repellent
activity of the extract is as expected. According to Tripathi et al. (2009) ants can
be repelled by linalool compound that contained in essential oil due to the hairs
on the insect such as mosquito antennae that are sensitive. Thus, linalool is able to
interact with the receptors of the insect by blocking its sense of smell. This finding
was aligned with the study on electrophysiological effect of repellents to mosquitoes
(Mgeni et al. 2014). They found that the same odour receptors for mosquitoes that
respond to DEET also gave the same respond to linalool.
26.3.4 Antibacterial Activity Effects of the Cananga odorata

Flowers Extracts
Determination of antibacterial activities of C. odorata extract was confirmed

through disk diffusion test (Kirby-Bauer method). The zone inhibition of S. typhi,
E. coli, S. aureus and B. subtilis by this extract has been shown in Fig. 26.4a–d.
The summary of the figures is indicated in Table 26.2. The controlled used for this
test is ampicillin disc of 10 μg that have overall inhibition zone of approximately
17 mm. The maximum zone of inhibition was observed against S. typhi (16 mm),
followed by B. subtilis (14 mm) and E. coli (13 mm). The lowest zone of inhibition
was observed against S. aureus (10 mm). The results are in agreement with Syam
et al. (2015), which reported that the essential oil of C. odorata flowers showed
antibacterial activity towards S. typhi.
Fig. 26.4 The inhibition

zone of a S. typhi, b E. coli,
c S. aureus and d B. subtilis
Table 26.2 Antibacterial

Sample no. Microorganism Zone of inhibition in mm
activity of C. odorata
essential oil 1 S. typhi (−) 16
2 E. coli (−) 13
3 S. aureus (+) 10
4 B. subtilis (+) 14
26.4 Conclusion
Cananga odorata was successfully extracted by using steam distillation method to

give percentage yield of 0.083% (V/W) and 2.2 mL from 2600 g of the flowers. The
main compounds were linalool (21.78%), acetic acid (15.77%), β-ocimene (13.53%),
piperonal (10.02%) and eugenol (7.42%). These compounds are known to possess
antibacterial activities towards food-borne microorganisms that was revealed by the
result of antibacterial activities against S. typhi, B. subtilis, S. aureus and E. coli. The
essential oil also showed having potential in insect-repellent activity against house
ants (M. pharaonis). Overall, this study emphasizes the potential of C. odorata to
be used as a natural insect repellent and provides sufficient baseline information for
future works and commercial exploitation.
26.5 Recommendation
Further experimental works and analyses are needed for this study. The crude is
needed to undergo further purification and identification of active compounds in
the essential oils. The essential oils may possess other compounds that might be
more effective as insect-repellent effect against other insects. Further works must be
done to study and apply the compound into product that may be useful for making
insect-repellent plastic that can lure insects away from dustbin.
Acknowledgements The authors acknowledge Universiti Teknologi MARA, Perlis for providing
financial support and laboratory facilities for undertaking this research. They would also like to
thank Sharifah Sakinah Syed Sofian for helping in collecting samples and running this project.
References
Burdock GA, Carabin IG (2008) Safety assessment of ylang–ylang (Cananga spp.) as a food
ingredient. Food Chem Toxicol 46(2):433–445
Caballero-Gallardo K, Pino-Benitez N, Pajaro-Castro N, Stashenko E, Olivero-Verbel J (2014)
Plants cultivated in Choco, Colombia, as source of repellents against Tribolium castaneum
(Herbst). J Asia-Pac Entomol 17:753–759
Giang PM, Son PM (2016) GC and GC-MS analysis of the fresh flower essential oil of Cananga
odorata (Lam.) Hook. F. et Th. Var. fruticosa (Craib J. Sincl). J Essent Oils Nat Prod 4(4):9–11
Giwa SO, Muhamad M, Giwa A (2018) Utilizing orange peels for essential oil production. J Eng
Appl Sci 13(1)
Hesham HA, Rassem Nour AH, Yunus RM (2016) Techniques for extraction of essential oils from
plant: a review. Aust J Basic Appl Sci 10(16):117–127
Jahangirian H, Haron MJ, Shah Ismail MH, Rafiee-Moghaddam R, Afsah-Hejri L, Abdollahi Y,
Rezayi M, Vafaet S (2013) Well diffusion method for evaluation of antibacterial activity of
copper phenyl fatty hydroxamate synthesized from cranola and palm kernel oils. Dig J Nanomater
Biostruct 8(3):1263–1270
Mabona U, Viljoen A, Shikanga E, Marston A, Vuuren SV (2013) Antimicrobial activity of southern

African medicinal plants with dermatological relevance: from an ethnopharmacological screening
approach, to combination studies and the isolation of a bioactive compound. J Ethnoparmacol
148(2013):45–55
Mahendera M, Shah M (2014) Extraction and characterization of essential oil of Sweet lime (Citrus
LimettaRisso) peel using microwave: assisted hydro distillation. Res J Chem Sci 4(11):51–55
Mgeni MT, Edgar MM, Brian MM, Sarah JM, Martha FM (2014) Experimental hut evaluation of
linalool spatial repellent agar gel against anopheles gambiae sensu stricto mosquitoes in a semi-
field system in Bagamoyo, Tanzania. Parasit Vectors 7:550. https://doi.org/10.1186/s13071-014-
0550-2
Sikdar DC, Menon R, Duseja K, Kumar P, Swami P (2016) Extraction of citrus oil. Int J Tech Res
Appl 4(3):34
Su YP, Yang CJ, Hua HX, Cai WL, Lin YJ (2009) Bioactivities of ethanol extracts from thirteen
plants against Nilaparvata lugens (stal). Chin Agric Sci Bullet 25:198–202
Syam SK, Anudeep M, Venkata R, Bhaskar C (2015) Screening of antimicrobial activity of flower
extracts on human bacterial pathogens. J Pharmacognosy Phytochem 3(6):153–156
Teng Hern T, Lee LH, Fong Yin W, Chan CK, Abdul Kadir H, Gan Chan K, Goh BH (2015)
Traditional uses, phytochemistry, and bioactivities of Cananga odorata (Ylang-Ylang). eCAM
2015:896314. https://doi.org/10.1155/2015/896314
Tripathi L, Mwangi M, Abele S, Aritua V, Tushemereirwe WK, Bandyopadhyay R (2009)
Xanthomonas Wilt: a threat to banana production in east and central Africa. Plant Dis 93:440–451
Varkey TK, Mathew J, Baby S (2014) Chemical variety of citrus maxima essential oil from South
India. Asian J Chem 26(8):2207–2210
Wathoni N, Sriwidodo Sofian FF, Narsa AC, Mutiara NM (2018) Repellent activity of essential
oils from Cananga odorata Lamk. And Cymbopogon nardus L. on corn starch-based thixogel. J
Young Pharmacists 10(2):118–123
Yadav AA, Chikate SS, Vilat RB, Suryawanshi MA, Kumbhar GB (2017) Review on steam
distillation: a promising technology for extraction of essential oil. Int J Adv Eng Res Dev 4(4)
Yahaya MF, Kubmarawa D, Yelwa JM, Runde M (2018) Antioxidant and antimicrobial activity of
essential oils extracted from aromatic plants. World Sci News 13–25. www.worldsciencetificnews.
com
Yao YJ, Liang YY, Wang LQ, Zhang W, Yang CJ, Lin YJ, Hua HX (2011) Control effect of extract
and compound of Acorusgramineus against Nilaparvatalugens. Chin J Appl Entomol 48:463–467
Chapter 27
Dosimetric Characterization of Corn
Starch/Polyvinyl Alcohol (PVA) Blend
as Potential Radiotherapy Bolus Material
Fairuzdzah Ahmad Lothfy, Salsabila Kamaruddin, Nik Kamarullah Ya Ali

and Norfataha Mohd Daud
Abstract In this research, three types of bolus were fabricated with different compo-
sitions proportion of polyvinyl alcohol (PVA) and corn starch, where the proportion
of corn starch to PVA is in the ratio 10:0, 7:3 and 5:5. Therefore, the objective of this
experiment was to obtain fabricated bolus that had the same dosimetric properties to
water. Hence, physical density, relative electron density and transmission factor of
the samples were measured. The result showed that the physical densities for bolus
10:0 was 0.978 ± 0.01 g/cm3 , bolus 7:3 was 0.995 ± 0.01 g/cm3 and bolus 5:5 was
1.001 ± 0.01 g/cm3 . The density bolus 10:0 differed from water density by 2.2%.
Meanwhile, bolus 7:3 has density differed by 0.5%. Density for bolus 5:5 has very
slight difference with water which is 0.1%. Transmission factor also can be measured
by calculating the ratio of reading electrometer with sample and without sample by
using the 6 MV value. Transmission factor for bolus 10:0 was 0.995, bolus 7:3 was
0.990 and bolus 5:5 was 0.980. The value of transmission factor (<1) was due to the
absorption and scattering process. The physical properties of fabricated bolus showed
that it is free of bubble and not transparent. As conclusion, the dosimetric properties
of corn starch/PVA blend were found to be similar to soft tissue, with the physical
properties considered to be used as radiotherapy bolus only for certain radiotherapy
treatment due to non-fulfilled requirement for transparent characteristic.
Keywords Radiotherapy bolus · Dosimetric properties · Physical density ·

Transmission factor · Physical properties
F. A. Lothfy (B) · S. Kamaruddin

Universiti Teknologi Mara Pahang, Jengka Pahang, Malaysia
e-mail: fairuzdzah@uitm.edu.my
S. Kamaruddin
e-mail: salsabila123212@gmail.com
N. K. Y. Ali · N. M. Daud
Radiology Department, Hospital Universiti Sains Malaysia, Kelantan, Malaysia
e-mail: kamarullah@usm.my
N. M. Daud
e-mail: nfataha@usm.my

308 F. A. Lothfy et al.
27.1 Introduction
In radiotherapy, an ionizing radiation is used to prevent cancer growth. External

radiation using the high-energy linear accelerator (LINAC) is usually and mostly
used for patient treatment (Xu et al. 2014). LINAC can produce either photon (X-
ray) as high in megavolt (MV), or electron as high in mega electron volt (MeV) for
the purpose of tumor therapy in superficial (surface) areas up to 7 cm depth. This is
not always advantageous since using high-energy beam for the treatment of cancer
is the suitable method, although the dose applied is not able to fully reach the target.
The photon beam is increased when the depth is more in the skin surface due to
Compton interaction effect. Hence, using this radiation beam can cause skin sparing
that result from dose build-up effect (Butson et al. 2000). So, by placing bolus over
the treatment area, the problem can be negated. The ability to treat the cancer at the
skin surface can be increased by using the bolus (Hsu et al. 2008; Ricotti 2017). In
this research, the use of cornstarch/PVA blend meets the general characteristics of
the bolus materials which are usually free from any toxic, high of production, sturdy,
low cost and adaptable.
The other requirement of the bolus is that it must have dosimetric properties
with 2% of tissue-equivalent. The tissue-equivalent bolus will make the radiation
dose distribution more homogeneous and need to comprise dosimetric properties
that are equal to water. The density of water is 1 g/cm3 , and thus the density of bolus
should be about 1 g/cm3 . However, alternative ways should be taken by adjusting
the thickness of the bolus material, depending on the proportion of thickness, in
order to acquire the desired tissue-equivalent properties. Table 27.1 shows the mass
density of commercial bolus in radiotherapy. There are many more boluses that were
created by using a different type of material (Supratman 2018). Table 27.2 shows
the percentage of surface dose and relative electron density of boluses derived from
different type of materials.
Table 27.1 Mass density of

Commercial bolus used in Mass density (g/cm3 )
commercial bolus used in
radiotherapy
radiotherapy (Associates JRT
Homepage 2019) RT bolus material 1.70
CIVCO 1.03
Superflab 1.02
Super staff 1.02
Super flex 1.02
Elastometric polymer 1.02
Elastogel 1.02
Aquaplast RT custom bolus 1.02
Bees wax 0.954
Red Rope wax 0.900
Paraffin wax 0.880–0.920
27 Dosimetric Characterization of Corn Starch/Polyvinyl … 309
Table 27.2 Percentage of surface dose and relative electron density of boluses derived from
different type of materials
Types of material Percentage of surface Relative electron References
dose (PSD) density (RED)
3D printed 6 MeV = 95.5% 1.04 Ahove and Bankole
customized bolus (2017)
Brass mesh 6 MeV = 94% 0.993 CIRS tissue
simulation and
phantom technology
(2013)
Water clear 6 MeV = 80% 0.896 Pearce (2004)
polymeric gel
Natural rubber 8 MeV = 94.63% 0.893 Associates JRT
10 MeV = 95.31% Homepage (2019)
In present day, many boluses were usually made from the petroleum-based source.
However, petroleum is well known to have high contribution toward global warm-
ing because it produced a lot of carbon dioxide. Petroleum is not only hazardous to
health but the resources are also limited as it takes millions year to produce (Ahove
and Bankole 2017). As example, paraffin wax can cause heat rash for highly sen-
sitive skin because paraffin wax would release chemicals such as benzene, toluene,
formaldehyde, acetaldehyde, acrolein and soot into the air. The regular boluses using
plastics, paraffin, silicon or synthetic rubbers as their base material is exceptionally
costly. Therefore, it is more unrealistic to dispose the boluses after only one use.
Therefore, in order to reduce this problem, the material used to produce fabricated
bolus was made from corn starch/PVA polymer blend. The benefit from this material
was including high available sources, toxic free and also low cost compared with the
recent material.
27.2 Materials and Methodology
27.2.1 Materials and Instrumentations
Corn starch was acquired straightforward from the basic shop in Bandar Pusat Jengka.
Meanwhile, primary chemicals used were polyvinyl alcohol (PVA), glycerol (99.0%
purify), 0.1 M hydrochloride (HCl, Aldrich, 37% purify) and 0.1 M sodium hydroxide
(NaOH, Aldrich, 37% purify). The instruments that are used for validation process
are computed tomography (by a Toshiba Aquilion Prime SP Computed Tomography
(CT) system + CT Scanner 160 unique slices) and linear accelerator (Varian, Clinac
2100 machine).
Table 27.3 The ratio of corn

Corn starch PVA
starch/PVA polymer blend
10 0
7 3
5 5
27.2.2 Fabrication of Corn Starch/PVA Blend Boluses
First, the corn starch was weighed: 10, 7 and 5 g. Secondly, PVA was weighed for
3 and 5 g. Subsequently, 200 ml of distilled water was added into the PVA. Next,
the mixtures were heated at 80 °C until the PVA turned into liquid. Meanwhile, the
corn starch was added with 30% of glycerol, 30% of 0.1 M hydrochloride (HCl) and
30% of 0.1 M sodium hydroxide (NaOH) and the mixture were heated at 100 °C.
After that, distilled water was added into the solution and stirred constantly until it
standardizes. Then, 3 g PVA and 7 g corn starch were blend together. It was followed
by 5 g PVA with 5 g corn starch and only 10 g of corn starch. The mixture was stirred
until it homogenizes and turns into gel. Once the mixture completely homogenizes
the heat was turned off. The access bubble at the surface of mixtures was removed.
Lastly, the mixtures were spread out into the mold and dried at 27 °C for 48 h. The
composition ratios are followed in Table 27.3.
27.2.3 Validation of the Dosimetric Properties of Fabricated

Boluses
In order to use corn starch as new material for bolus, the dosimetric properties of corn
starch/PVA polymer blend such as mass density, electron density and transmission
factors were measured.
Mass density and relative electron density measurement. Mass density and
relative electron density of the samples were measured from developed calibration
curve, which were relative electron density and mass density versus computer tomog-
raphy (CT) number. For developing calibration curve, setting for the electron density
phantom was started such that the internal computer tomography (by a Toshiba
Aquilion Prime SP Computed Tomography (CT) system + CT Scanner 160 unique
slices) laser is passed through the centre of the electron density phantom (Fig. 27.1a).
The exposure was performed by using protocols as stated in Table 27.4 with 5 mm
slice thickness used. After that, the CT number obtained from each component in
electron density phantom image by using application picture archiving and com-
munication system (PACS) was used to develop the calibration curve by referring
to tissue descriptions for physical densities and relative electron density for each
component in electron density phantom (Table 27.5). Then, the CT value is plot-
ted against the relative electron density and physical density of tissue. Fig. 27.1b
Fig. 27.1 a Laser passed through the centre of electron density phantom (CIRS Model 062). b The
computed tomography image of electron density phantom at (120 kVp, 450 mA) (by a Toshiba
Aquilion Prime SP Computed Tomography (CT) system + CT Scanner 160 unique slices)
Table 27.4 Protocols used for computed tomography images were acquired as guide to develop
calibration curve
Protocols
kV 135 120 120 120 100 80 80 80
mA 450 250 300 450 450 250 300 450
Table 27.5 Tissue descriptions for physical densities and electron densities for each component in
electron density phantom 062 M (CIRS Tissue Simulation and Phantom Technology 2013)
Description Physical density (g/cm3 ) Red (relative to H2 O)
Electron density head insert 1.530 0.998
Electron density body without head insert 1.029 0.998
Lung (inhale) equivalent electron density 0.205 0.200
plug
Lung (exhale) equivalent electron density 0.507 0.496
plug
Breast (50% gland/50% adipose) 0.990 0.976
equivalent electron density plug
Solid trabecular bone (200 mg/cc HA) 1.160 1.117
Liver equivalent electron density plug 1.070 1.052
Muscle equivalent electron density plug 1.060 1.043
Adipose equivalent electron density plug 0.960 0.949
Solid dense bone (800 mg/cc HA) 1.530 1.456
Solid dense bone (1250 mg/cc HA) 1.820 1.695
Water-filled electron density plug, Ø 1” 1.000 1.000
removable vial inside (real water data
provided)
shows the electron density phantom scanned by computed tomography image at 120
kVp, 450 mA. The CT number is obtained from each component of electron density
phantom plug image by using application picture archive and communication system
(PACS). Subsequently, the CT number obtained from PACS was used to develop the
calibration curve by referring to tissue descriptions for physical densities and relative
electron density for each component in electron density phantom (Table 27.5). The
mass density of fabricated bolus from different imaging protocols is measured at the
developed calibration curve (Fig. 27.2a, b).
Transmission factor measurement. The transmitted dose has been measured in
Farmer ionization chamber (PTW, TM30001 model) placed at the inner surface of
samples. The transmission factor was measured by placing the sample on top of the
slab phantom (Fig. 27.3a) and irradiated with 6 MeV photon produced by the linear
accelerator (Varian, Clinac 2100 machine) (Fig. 27.3b).
(a) (b)
1.4
1.2
Relative electron density
1.2
1
Density (g/cm 3)
1
450mA/135kVp 0.8
0.8 250mA/120kVp 450mA/135kVp
300mA/120kVp 0.6 250mA/120kVp
0.6 300mA/120kVp
450mA/120kVp
0.4 450mA/120kVp
0.4 450mA/100kVp
450mA/100kVp
250mA/80kVp 250mA/80kVp
0.2
0.2 300mA/80kVp 300mA/80kVp
450mA/80kVp 450mA/80kVp
0 0
-1000 -500 0 500 -1000 -500 0 500
CT Number CT Number
Fig. 27.2 a Calibration curve for mass density for different imaging protocol (mA/kV). b Calibra-
tion curve for relative electron density at different imaging protocol (mA/kV)
Fig. 27.3 a Fabricated bolus placed on the slab phantom. b The sample was scanned under linear
accelerator (LINAC) (Varian, Clinac 2100 machine)
Afterward, the sample was removed and irradiated without the sample with same
energy. Then, the transmission factor was calculated by the ratio of electrometer
reading with a sample in place to reading without the sample. The electric charge
collected by the ionization chamber was measured using an UNIDOS electrometer.
Dosimetric conditions were reference depth of 5 cm for low energy, 100 MU of
irradiation, and field size equal to 10 × 10 cm2 and SSD = 100 cm.
27.3.1 Dosimetric Properties
Radiation dosimetry is the measurement of absorbed dose in matter and tissue pro-
duced from ionization radiation in a small mass of air (Pearce 2004). The fabricated
bolus should have same properties equivalent to water, H2 O, which means it must
have similar radiological properties such as physical density, electron density, effec-
tive atomic number, and similar absorption and scattering radiation (Montaseri et al.
2012). In general, when the material is similar in terms of mass density and the
number of electrons per unit mass, then that material can be used as a bolus material.
Mass density and Electron density. Density (g/cm3 ) is mass divided by volume.
It is very significant in discriminating the property of tissue, particularly in bone, lung
tissue, fat and linear attenuation coefficient (µ), and tracking linearly with density. In
order to achieve tissue-equivalent properties, the density required is similar to water,
which is around 1 g/cm3 (Montaseri et al. 2012). The density of the bolus material
with various moisture contents can possibly change the density level nearer to the
density of the water. PVA density varies from 1.19 to 1.35 g/cm3 (Mohamed and Evan
2017). The value was almost 1.0 g/cm3 . PVA was picked as the material to improve
the mechanical properties for the fabricated bolus. PVA density value demonstrated
that the mix of corn starch and PVA has the potential to obtain fabricated bolus that
has tissue equivalent density. Table 27.6 shows that the mass density of fabricated
bolus can be obtained from the calibration curve by reading the CT number of
fabricated bolus scanned images. Table 27.7 showed that the mass density value for
fabricated bolus 10:0 was around 0.972–0.978 g/cm3 , bolus 7:3 was around 0.980–
0.995 g/cm3 and bolus 5:5 was around 1.000–1.001 g/cm3 . The density values are
Table 27.6 CT number for sample 10:0, 7:3 and 5:5 by different imaging protocols
Types of CT number (HU) by different imaging protocols (mA/kVp)
samples 450/135 250/120 300/120 450/120 450/100 250/80 300/80 450/80
10:0 135 450 −71 −68 −69 −72 −68 −66
7:3 120 250 −31 −38 −29 −30 −28 −31
5:5 120 300 −3 −2 −1 0 1 1
Table 27.7 Density of water, bolus 10:0, bolus 7:3, bolus 5:5 for different imaging protocols
Imaging protocol Mass density (g/cm3 )
kVp mA Water Bolus 10:0 Bolus 7:3 Bolus 5:5
135 450 0.992 0.972 0.989 1.001
120 250 1.002 0.978 0.990 1.002
120 300 1.002 0.976 0.992 1.000
120 450 1.000 0.980 0.991 1.001
100 450 1.000 0.978 0.989 1.002
80 250 1.001 0.977 0.995 1.000
80 300 1.000 0.978 0.980 1.001
80 450 1.002 0.980 0.990 1.002
obtained from the analyzed CT number data of scanned sample images (Table 27.5)
by using developed calibration curve (Fig. 27.4).
From the experiment, Fig. 27.4a, b shows that the densities of bolus 10:0 and
bolus 7:3 have significant difference with the density of water (p < 0.05). Meanwhile,
Fig. 27.4c showed that no significant difference is noted between bolus 5:5 and water
Fig. 27.4 Two sample t-test results for comparison density between a bolus 10:0 and water, b bolus
7:3 and water, c bolus 5:5 and water, d ANOVA for water, bolus 10:0, bolus 7:3, bolus 5:5 and
commercial bolus (Table 27.4)
(p > 0.05). Generally, the thickness of the fabricated bolus can be adjusted to obtain
the desired tissue-equivalent properties. So, the other two fabricated boluses have
the possibility to achieve the value of water density by increasing their thickness
(Adamson et al. 2017). It can be confirmed with Fig. 27.4d by using the ANOVA
analysis between all fabricated bolus and commercial bolus density (Table 27.7) that
no significant difference is found between all densities (p > 0.05). Therefore, all
fabricated bolus is still acceptable to be used as radiotherapy bolus material.
The density of bolus 10:0 and bolus 7:3 was less than 1.0 g/cm3 and about 0.5–
2.2% compared to tissue-equivalent dosimetric properties. These materials might
have less tissue-equivalent absorption for which it requires that the fabricated bolus
material has to be thicker than the equivalent thickness of tissues, for about 0.5–
2.2% thicker. This may exhibit similar cases for the dosimetric properties of bolus
material that are made from oil gel in previous research. The dosimetric properties
of oil gel include mineral oil and styrenic block copolymer(s) which can deviate
about 5–10% from the desired values as compared to tissue-equivalent dosimetric
properties (Kirkpatrick et al. 2008).
Generally, the deposition of the radiotherapy dose is dependent on the electron
density of the material involved. Therefore it is very important to measure and under-
stand the value of the electron density of the research material. The electron density
is the measure of the probability of an electron being available at a particular area.
Nonetheless, since the Compton effect is the most predominant mode of interac-
tion for megavoltage photon beams in the clinical range, the necessary condition for
water equivalence for such beams is the same electron density (number of electrons
per cubic centimeter) as that of water (Montaseri et al. 2012). The relative electron
density of all fabricated boluses was obtained from the calibration curve, as shown
in Fig. 27.2b and the density obtained from the analysis was shown in Table 27.8.
Table 27.8 showed that the relative electron density value for bolus 10:0 was
around 0.926–0.930, bolus 7:3 was around 0.960–0.972 and bolus 5:5 was around
0.997–1.000. The two samples, which were bolus 10:0 and bolus 7:3, have significant
Table 27.8 Relative electron density of water, bolus 10:0, bolus 7:3, bolus 5:5 for different imaging
protocols
Imaging protocol Relative electron density
kVp mA Water Bolus 10:0 Bolus 7:3 Bolus 5:5
135 450 0.992 0.926 0.960 1.002
120 250 1.002 0.931 0.961 1.002
120 300 1.002 0.929 0.969 0.997
120 450 1.000 0.932 0.962 0.998
100 450 1.000 0.931 0.971 0.999
80 250 1.001 0.928 0.970 1.000
80 300 1.000 0.932 0.972 1.001
80 450 1.002 0.934 0.969 1.001
difference with the relative electron density of water (p < 0.05). The bolus 5:5 has no
significant difference with water (p > 0.05). From Eq. 1, the tissue electron density
(ρe ) was directly proportional to the mass density (ρm. ) (Khan and Gibbons 2014).

Z
ρe = ρm. N A (1)
A
One of the main challenges of corn starch as a bolus material is the slightly lower
density when compared to water. By adjusting the thickness of fabricated bolus, the
electron density will be adjusted accordingly to achieve the tissue-equivalent dosi-
metric properties. During the electron radiotherapy treatment, water equivalence is
useful because the range of the electrons in tissue is highly dependent on the thickness
of the bolus. This effectively enabled to assist the clinicians when accounting as the
requirement thickness of bolus depends on the clinical situation without performing
a dose calculation (Adamson et al. 2017).
Transmission factor. Transmission of ionization radiation in material is charac-
terized by its linear attenuation coefficient (µ) which depends on the photon energy,
atomic number of material and tissue density (Bryan 2009). Typical depth dose max-
imum Dmax for 6 MV is 15 mm (Podgorsak 2005). Transmission through the sample
is obtained by measuring the dose (electric charge) with and without fabricated bolus
in the same geometry (SSD = 100 cm) at the typical depth, Dmax (Malaescu et al.
2015). Transmission factors were measured for the fabricated bolus and shown in
Table 27.9. The result has indicated that the output changed due to the presence of
the fabricated bolus with the thickness of 5 mm. In terms of change in the dose (elec-
tric charge), the transmission factor was 0.995, 0.990 and 0.980, respectively. From
other researches, the transmission factor under Perspex with the thickness 10 mm
was 0.960 (Montaseri et al. 2012). It is lower than the fabricated bolus due to higher
thickness, whereas the fabricated bolus was 5 mm. Dose will be attenuated exponen-
tially after reaching Dmax (Richmond et al. 2016). The photons were exponentially
removed from the beam. This was because of the decrease of percentage depth dose
due to the absorption and scattering process (Richmond et al. 2016).
Table 27.9 Dosimetry outcome for transmission factors of the fabricated bolus
X-ray energy Reading Measurement without Measurement under sample in Dmax
sample in the Dmax (nC) (nC)
Bolus 10:0 Bolus 7:3 Bolus 5:5
6 MeV 1st 1.849 1.839 1.830 1.812
2nd 1.849 1.840 1.830 1.813
Average 1.849 1.840 1.830 1.812
Transmission factor 0.995 0.990 0.980
Fig. 27.5 CT scan images of fabricated bolus
Fig. 27.6 Fabricated bolus
27.3.2 Physical Properties
The requirements for the physical properties of bolus are that it must have free
bubble and opaque features. Figure 27.5 showed that there was absence of bubble in
the scanned fabricated bolus images. The bolus did not have bubble because it leads
to uniform density, causing the hot/cold spots (Terezakis et al. 2015). However, the
fabricated bolus did not fulfill the transparent requirement as in Fig. 27.6.
27.4 Conclusion
The corn starch/PVA blend material has a lot of benefits and can be used in many
ways. One of the benefits is the natural organic polymers of corn starch which has the
potential to be a new resource of bolus in radiotherapy. The analysis results indicated
that the fabricated bolus made from the corn starch/PVA blend had fulfilled the
majority requirements of the bolus used in radiotherapy. For dosimetric properties,
the two samples have slightly lower mass density relative to water. Although mass
density of the sample was not equal to water, it had the potential to be used by
adjusting the thickness of the bolus based on ratio of thickness.
References
Xu G, Bryan B, Paaganetti H (2014) Treatment with respect to second cancer induction. Phys Med
Biol 53(13):1–58
Butson MJ, Cheung T, Yu P, Metcalfe P (2000) Effects On Skin Dose From Unwanted Air Gaps
Under Bolus 32:201–204
Hsu S, Roberson PL, Chen Y, Marsh RB, Pierce LJ, Moran JM (2008) Assessment of skin dose for
breast chest wall radiotherapy as a function of bolus material. Phys Med Biol 53:2593–2606
Ricotti R et al (2017) Dosimetric characterization of 3D printed bolus at different infill percentage
for external photon beam radiotherapy. Phys Medica 39:25–32
Supratman AS et al (2018) Characteristic of natural rubber as bolus material for radiotherapy. Mater
Res Express, 1–9
Associates JRT Homepage (2019). http://jrtassociates.com/bolusmaterial.aspx. Last accessed 1 June
2019
Ahove MA, Bankole SI (2017) Petroleum industry activities and climate change: global to national
perspective. Elsevier Inc., (2017)
CIRS Tissue Simulation & Phantom Technology (2013) CBCT electron density & image quality
phantom system. Computerize Imaging Reference Systems, Inc., (2013)
Pearce JAD (2004) Characterisation of two new ionisation chamber types for use in reference
electron dosimetry in the UK. National Physical Laboratory United Kingdom
Montaseri A, Alinaghizadeh M, Mahdavi SR (2012) Physical properties of ethyl methacrylate as a
bolus in radiotherapy. Iran J Med Phys 9(2):127–134
Mohamed A-MO, Evan KP (2017) Fundamentals of geoenvironmental engineering: understanding
soil, water, and pollutant interaction and transport. Elsvier Inc. (2017)
Adamson JD et al (2017) Characterization of water-clear polymeric gels for use as radiotherapy
bolus. Technol Cancer Res Treat 16(6):923–929
Kirkpatrick JP, Demehri FR, Johnston SE, Stalnecker AM, Cooney TM (2008) Bolus material for
radiation therapy and methods of making and using the same. United States
Khan FM, Gibbons JP Jr (2014) Khan’s the physics of radiation therapy. Lippincott Williams &
Wilkins (2014)
Bryan RN (2009) Introduction to the science of medical imaging, vol 19. Cambridge University
Press, USA, p 326
Podgorsak EB (2005) Radiation oncology physics: a handbook for teachers and students.
International Atomic Energy Agency Vienna, (2005)
Malaescu I, Marin CN, Spunei M (2015) Comparative study on the surface dose of some bolus
materials. Int J Med Phys Clin Eng Radiat Oncol 4(4):348–352
Richmond ND, Daniel JM, Greenhalgh AD (2016) Dosimetric characteristics of brass mesh as
bolus under megavoltage photon irradiation. Br J Radiol 89(1059):1–7
Terezakis SA, Bohle GC, Lo YC, Berry SL, Yahalom J (2015) Innovative approaches to radiation
treatment for mycosis fungoides in the setting of collagen vascular disease. case rep. Oncol Med
Case Rep Oncol Med, 1–6
Chapter 28
Dominant Tree Species Estimation
for Tropical Forest Using Pixel-Based
Classification Support Vector Machine
(SVM) and Object-Based Classification
(OBIA)
Nurul Ain Mohd Zaki, Intan Nur Suhaida Mohd Radzi, Zulkiflee Abd Latif,
Mohd Nazip Suratman, Mohd Zainee Zainal
and Sharifah Norashikin Bohari
Abstract Forests play an important role in mitigating climate change. Nowadays,

the study for conservation and management of forest restoration is increasingly nec-
essary to preserve the biodiversity of forest and retain the valuable species of tropical
forest for the next generation. The information such as the tree species and the loca-
tion of the trees are crucial for seedling production and ecological purposes. Even
though the tropical tree inventories have been conducted around the world, but the
number of species and their distribution remain unknown. For proper forest manage-
ment and planning, the tropical forest needs accurate distinction of tree species, which
need a very accurate dataset and map classification. The objective of this study is to
classify the tropical forest tree using pixel-based classification which is supported by
the vector machine (SVM) and object-based image analysis (OBIA) to calculate the
accuracy assessment, produce dominant tree species, and carbon stock mapping. The
N. A. Mohd Zaki (B) · I. N. S. Mohd Radzi · M. Z. Zainal · S. N. Bohari

Faculty of Architecture Planning and Surveying, Centre of Studies for Surveying Science and
Geomatics, Universiti Teknologi MARA (UiTM), Arau, Perlis, Malaysia
e-mail: nurulainzaki@gmail.com
I. N. S. Mohd Radzi
e-mail: intan_eida@yahoo.com
M. Z. Zainal
e-mail: mohdzaineezainal@gmail.com
S. N. Bohari
e-mail: shnorashikin@gmail.com
Z. A. Latif
Faculty of Architecture Planning and Surveying, Centre of Studies for Surveying Science and
Geomatics, Universiti Teknologi MARA (UiTM), Shah Alam, Selangor, Malaysia
e-mail: zabdlatif@gmail.com
M. N. Suratman
Faculty of Applied Science, Universiti Teknologi MARA (UiTM), Shah Alam, Selangor, Malaysia
e-mail: nazip@uitm.edu.my

320 N. A. Mohd Zaki et al.
accuracy assessment of SVM classification using the confusion matric method will
be compared on class-by-class basis and produce the relationship between ground
truths with the output of the classification. Moreover, the object-based image anal-
ysis (OBIA) was segmented using the scale 60, shape 0.8, and compactness 0.6
of Multiresolution segmentation in eCognition. It was found that the output pro-
duced from object-based image analysis produces 88% accuracy compared to the
pixel-based classification which is 71%. It is believed that this research proposes a
platform in improving the aboveground carbon stock mapping which is useful for
forest management and monitoring.
Keywords Tropical forest · LiDAR · Support vector machine · Object-based

image analysis
28.1 Introduction
28.1.1 Aboveground Carbon Stock
Carbon dioxide (CO2 ), a colorless gas, is produced when carbon and organic com-
pounds are burnt. Besides that, human beings also produce CO2 through the respi-
ration process. Although CO2 constitutes a very small percentage which is approxi-
mately 0.04% in the atmosphere, it plays a very important role in the survival of living
organisms on the earth (Vashum and Jayakumar 2012). One of the reasons why CO2
is an important gas on Earth is CO2 is used by all vegetation during photosynthesis
to produce oxygen and carbohydrate (Vidyasagar 2018). Humans are dependent on
plants as their source of food; thus photosynthesis is necessary for their survival on
Earth. Furthermore, the heat radiated from the Earth’s surface is also being absorbed
by the CO2 (Vidyasagar 2018). This action maintains the Earth’s temperature to
ensure the survival of all living organisms. However, the increasing level of CO2
for a long time might cause climate change. Tree biomass can be divided into two
(2) which are aboveground biomass (AGB) and belowground biomass. The previous
study stated that the AGB of each tree has the largest pool of carbon compared to
belowground biomass (Basuki et al. 2009; Foody et al. 2001; Mohd Zaki et al. 2018).
Thus, it is important to perform AGB estimation for quantifying carbon stock in a
forest.
In pursuance to mitigate the climate change issue regarding deforestation and
forest degradation, the United Nations Framework Convention on Climate Change
(UNFCCC) was established on May 9, 1992 (UNFCC 2015). This organization
purposely stabilizes the greenhouse gas concentration in the atmosphere so that can
prevent the disturbance of dangerous anthropogenic to the climate system. During
the UNFCC congress, a framework had been introducing, which a country will
be financially rewarded for any decrease in emissions and also decrease of forest
conversion to other types of land use (Measurement 2013). REDD provides a window
to reduce large-scale emissions with a low abatement price to pay.
28 Dominant Tree Species Estimation for Tropical Forest … 321
There are two methods of field measurement to estimate the aboveground biomass
which are destructive method (direct method) and non-destructive method (indirect
method). The direct method is a method where the tree will be cut down and oven-
dried until a constant weight is achieved (Basuki et al. 2009). Besides that, applying
the indirect method by developing the allometric equation from the forest inventory
data that had been collected is one of the techniques to estimate the aboveground
biomass and carbon stocks of the forest (Mohd Zaki and Latif 2017).
Besides, in estimating the AGB, the allometric equation method is also often
used in the research. The tree parameter measurement is recorded, for instance, the
tree height, the diameter of the trunk, and diameter at the breast height (DBH). The
existing volume data can be used to estimate the allometric equation of the AGB.
Remote sensing is one of the methods that can be used to quantify the amount of
AGB carbon stock (Asner et al. 2010; Coomes et al. 2017; Hudak et al. 2012; Omar
et al. 2015). Remote sensing approach offered a spatial distribution of forest biomass
at an affordable cost with acceptable accuracy. This method is not directly in contact
with the surface but the technology can penetrate the vegetation structure. Besides
using remote sensing, the light detection and ranging (LiDAR) is also widely used
for estimation aboveground biomass (AGB). However, not all tree parameters can
be detected using LiDAR data images. Thus, a combination of both WorldView-3
satellite images and airborne LiDAR are very reliable data sources for the estimation
of carbon stock (Karna et al. 2013). Therefore, this study aims to examine a different
type of classification using object-based and pixel-based and produce carbon stock
for dominant tree species.
28.2.1 Study Area
The study area that had been selected for this is situated at Ayer Hitam Forest Reserve,
Puchong. The study area cover is the only available logged-over lowland Dipterocarp
forest in an urban setting in Selangor (Shida et al. 2014). This area originally covers
4270 ha and had been gazetted as forest reserve during the year 1906 (Rainforest
Journal 2012). This forest is located at 3° 00 15 N and 101° 38 17 E, situated
20 km to the North of University Putra Malaysia (UPM), and is managed by Faculty
of Forestry as a research center. The interesting about this forest, there were among
127 species found which include several types of rare and almost extinct tree species.
Refer Fig. 28.1.
Fig. 28.1 Location of the study area
28.2.2 WorldView-3 Images
The acquisition date for the WorldView-3 imagery used in this study is on December
9, 2014. The spatial resolution of images is 0.3 m for the panchromatic band while
1.24 m for the multispectral band. The spatial resolution of the images is 0.3 m
for panchromatic band and 1.24 m for the multispectral band. Besides, this satellite
imagery is situated on orbit height at altitude 617 km. Next, the temporal resolution
is less than a day. UTM Zone 47 is the projection system for this image while WGS84
is the datum. The specification of WV-3 is shown in Table 28.1.
28.2.3 Airborne LiDAR
Litemapper-Q560 system was utilized for data collecting of LiDAR raw data. This
system is used for capturing the topography of the Earth’s surface. The pulse fre-
quency is 150 kHz and the scan angle was set up at 45%. Besides, the frontal overlap
is 60% while the side overlap is 40%.
Table 28.1 Specification of

Example Font size and style
the satellite image based on
(DigitalGlobe 2014) Spatial resolution Panchromatic Nadir: 0.31 m
Multispectral Nadir: 1.24 m
Dynamic range 11 bits per pixel
Band wavelength (nm) Band 1: 400–450 (coastal)
Band 2: 450–510 (blue)
Band 3: 510–580 (green)
Band 4: 585–625 (yellow)
Band 5: 630–690 (red)
Band 6: 705–745 (red-edge)
Band 7: 770–895 (NIR-1)
Orbit height Altitude: 617 m
Capacity 68,0000 km
Swath width At nadir: 13.1 km
Projection UTM, Zone 47
Datum WGS84
Revisit frequency Less than one day
28.2.4 Ground Inventory Data
Ground inventory data is necessary to be collected for estimating carbon stock using
the remote sensing approach. In this study, the data that have been collected are
tree location, tree species, tree height, tree ID, and other related parameters. GPS
instrument was used to identify the location of each tree using a static method with
4–5 h observation. After that, each tree was tagged with a unique number. Then, the
species identification process was done with help from species expert from FRIM.
At the same time, the height of each tree was measured using the Distometer. Lastly,
the DBH was measured using tape at 1.3 m above of tree stems. This is because the
height below 1.3 m is considered as root.
28.2.5 Generation of Canopy Height Model
In ArcMap 10.2, there are two main output produced to generate CHM which is
DEM and DSM. To generate DEM, the ground option was selected while for DSM
the non-ground option was selected. Next, the CHM was derived from minus tools
by subtracting DSM and DEM.
28.2.6 Classification Using Object-Based Image Analysis

(OBIA)
Object-Based Image Analysis (OBIA) is a required image segmentation and classi-

fication through the characteristic of spatial, spectral, texture, and temporal scales to
produce a meaningful image of an object (Torres-Sanchez et al. 2018). The fundamen-
tal of OBIA includes image segmentation, image classification, attribution, query, and
linking individual segmented objects in space and time (O’Neil-Dunne et al. 2012).
The process of image segmentation can be defined as the approached partition of
remote sensing image to search the homogenous regions for object classifications
(Lebourgeois et al. 2017). Generally, the image segmentation can be categorized into
three methods such as a pixel or point-based segmentation, edge-based segmentation,
and region-based segmentation which depend on difference application analysis.
28.2.7 Classification Using Pixel-Based
Pixel-based segmentation is an approach in searching the homogeneous objects,

which combined with a data point for segmented features. The output result for
this method does not necessarily fulfill the segmentation requirement because the
grouping of point is not connected (Galletti and Myint 2014). Hence, it would need
to be grouped by clustering the equal value (unique label) into one region.
28.2.8 Accuracy Assessment Segmentation Output

(Object-Based Classification)
All processes that have been done need to be checked to ensure the output is reliable
and correct. There are many methods can be conducted for accuracy assessment
for segmentation output. In this study, the method used was to evaluate the multi-
resolution segmentation by Clinton et al. (2010), where it measures the segmentation
goodness measurement. There are two (2) equations involved in this method, which
are oversegmentation and undersegmentation and measure of the “goodness of fit”
(D) which represent the closeness of the space or ideal segmentation.

area xi ∩ y j
Over Segmentation = 1 − (1)
area (xi )

area xi ∩ y j
Under Segmentation = 1 − (2)
area y j
Oversegmentationi2j + Undersegmentationi2j
Di j = (3)
2
xi refers to training object or the reference polygon and yj is referred to the
set of the segmentation polygon. Refer Eqs. (1) and (2). Segmentation accuracy is
measured based on distance index (D) Eq. (3) range from 0 to 1, where 0 shows
that the classification is an ideal match between xi and yi while 1 is the minimum
mismatch (Clinton et al. 2010).
28.2.9 Accuracy Assessment Segmentation Output

(Pixel-Based Classification)
Accuracy assessment of SVM classification is done using the confusion matric

method. This method is compared on a class-by-class basis: the relationship between
ground truth with the output of the classification. Besides, Producer Accuracy is a
measure of the accuracy of a classification scheme and percentage of the correctness
of the output that had been classified. It is calculated by dividing each of the diagonal
elements in by the total of each column, respectively, (Ahmad and Quegan 2012):
caa
Producer Accuracy = × 100%, (4)
c•a
where
caa element at position ath row and ath column
c•a column sum.
Next, User Accuracy is a measure of how well the classification is done. It indicates
the percentage of probability that the class, which a pixel is classified to an image, is
correctly representing the class on the ground. It is calculated by dividing each of the
diagonal elements in a confusion matrix by the total of the row in which it occurs:
cii
User Accuracy = × 100%, (5)
ci•
where
ci• row sum.
A measure of the overall behavior of the SVM classification can be determined
by the overall accuracy, which is the total percentage of pixels correctly classified:
U
a−1 caa
Overall Accuracy = × 100%, (6)
Q
where
Q total number of pixels

U total number of classes.
Lastly, the Kappa coefficient is the second measure of classification accuracy,
which incorporates the off-diagonal elements as well as the diagonal terms to give a
more robust assessment of accuracy than overall accuracy.
k k
n n ii − i=1 ni + n + i
K = i=1
k (7)
n2 − i=1 ni + n + i
Also, can be determined as
observed accuracy − chance agreement

K = , (8)
1 − chance agreement
where Observed accuracy is determined by diagonal in error matrix, while chance

agreement integrates off-diagonal (product of the row and column totals for each
class).
28.2.10 Aboveground Carbon Stock Calculation
There are many allometric equations developed by previous researchers. However,

to get the best calculation for the carbon stock, the allometric equation used must
be suitable with the study area characteristic. For example, the type of forest and
the location of the study area situated, all these might affect the accuracy amount
of carbon stock calculated. In this study, the allometric equation used the equation
developed by Mohd Zaki et al. (2018).
lnSc = −4.092 + 0.898 ln HL + 2.073ln D B H − 0.058lnC P A, (9)
where
Sc carbon stocks (kg/tree)

HL Height derived from LiDAR
CPA Crown projection area and
DBH diameter at breast height.
There is altogether 911 number of trees that had been recorded on site. Thus, based
on the remark on the data collected, trees which are above 30 m height were selected
Fig. 28.2 Output for object-based classification using E-cognition software
and considered as dominant species. There are altogether twenty (20) species such as
Hopea Sulcata, Dipterocarpus Verrucosus, Shorea longisperma, and many others.
The tree ranges from 30 to 35 m height, which the highest tree was Santiria laevigata.
28.3.1 Output for Object-Based Classification
The output for object-based classification was produced using E-cognition software.
The purple colored areas shown are the dominant trees whose height is more than
30 m (Fig. 28.2).
28.3.2 Output for Pixel-Based Classification
The output of the Support Vector Machine (SVM) is mixing. There are seven dom-
inant species shown in this map such as Hopea Sulcata, Shorea Macroptera, and
Shorea Dasyphylla (Fig. 28.3).
Fig. 28.3 Output for pixel-based classification using ENVI software
28.3.3 Accuracy Assessment for Object-Based Classification
Based on the calculation of oversegmentation, undersegmentation, and goodness of

fit above shown that 88% segmentation accuracy with 12% error was observed. The
result shows that the segmentation output is acceptable and could be used for further
analysis. Table 28.2 shows the summary of accuracy assessment for object-based
classification.
Table 28.2 Accuracy assessment for object-based classification

Table head Accuracy segmentation
Total Total 1:1 Oversegmentation Under D
reference match segmentation
polygon
1:1 20 28
Goodness of 0.40 0.28 0.12
fit (D)
Total 71.4% 88%
accuracy
28.3.4 Accuracy Assessment Using Confusion Matrix

(Pixel-Based Classification)
Accuracy assessment of pixel-based classification was produced using seven class of

species (Refer Table 28.3). Based on SVM classification output, it can be concluded
that the overall accuracy is 71.744% and Kappa coefficient 0. 522. The highest
producer accuracy of tree species for SVM classifier is Shorea dasyphylla with
90.20% (Refer Table 28.4). The lowest accuracy for SVM is Shorea ochrophloia
with 36.22%. Besides, the highest user accuracy for SVM is Shorea dasyphylla tree
species with 75.15%. The lowest accuracy for SVM classification is Koompassia
malaccensis is 52.66%. The tree species class number was elaborate using seven
type of species (Table 28.5).
28.3.5 Dominant Tree Species Map
Based on the result of the dominant tree species shown on the map in Fig. 28.4, it
shows that dominant tree species have a larger tree crown compared to other trees.
Thus, by using the visual observation on the tree crown segmentation output, the tree
crown of dominant tree species can be seen. There are altogether 29 species shown
on the map. Hopea Sulcata (yellow-colored) is one of the species that been found at
Ayer Hitam Forest Reserve based on the classification made. This species is one of
the species which is critically endangered and had been listed in IUCN Red List of
Threatened Species (IUCN 2014). The exact location of the tree can be determined
from this map based on the coordinate.
28.3.6 Aboveground Carbon Stock Map
Based on the result shown in Fig. 28.5, it can be concluded that the amount of
aboveground carbon stocks for dominant species at AHFR ranges from 16 to 2793 kg
per tree. There are eight (8) trees that have the highest amount of carbon stocks in
the study area (as shown in red color on the map). The total amount of carbon stock
calculated in Ayer Hitam Forest Reserve was 54848.957 kg.
28.4 Conclusion
This paper presents a thorough study of the different types of classification of tree
species using object-based and pixel-based classification. This study found that the
output produced from object-based classification has better accuracy which is 88%
330
Table 28.3 Accuracy assessment of pixel-based classification

Ground truth
Predicted Class 1 2 3 4 5 6 7 Total
1 2715 90 142 22 295 173 176 3613
2 25 122 13 0 4 1 1 166
3 73 1 211 0 8 51 9 353
4 19 0 1 66 0 7 3 96
5 28 0 2 0 184 59 3 276
6 79 0 3 10 15 328 10 445
7 71 42 55 3 2 14 208 395
Total 3010 255 427 101 508 633 410 5344
N. A. Mohd Zaki et al.
Table 28.4 Producer and user accuracy

Class Producer accuracy User accuracy (%) Producer accuracy User accuracy
(%) (%) (pixels)
1 90.20 75.15 2715/3010 2715/3613
2 47.84 73.49 122/255 122/166
3 49.41 59.77 211/427 211/353
4 65.35 68.75 66/101 66/96
5 36.22 66.75 184/101 184/276
6 51.82 73.71 328/633 328/445
7 80.73 52.66 208/410 208/395
Table 28.5 Tree species

Type of species Class number
class number
Shorea Dasyphylla 1
Dipterocarpus Verrucosus 2
Scaphium Macropodum 3
Hopea Sulcata 4
Shorea Ochrophloia 5
Shorea Macroptera 6
Koompassia Malaccensis 7
Fig. 28.4 Dominant tree species distribution for Ayer Hitam Forest Reserve
Fig. 28.5 Aboveground carbon stock for Ayer Hitam Forest Reserve
compared to pixel-based classification which is only 71%. Moreover, Hopea Sulcata

is one of the species found at Ayer Hitam Forest Reserve based on the classification
made. This species is one of the critically endangered species that have been listed
in IUCN Red List of Threatened Species. There are two types of a map produced as
the final output of this study, which are the dominant tree species distribution map
and aboveground carbon stocks map. The allometric equation for calculating the
aboveground carbon stocks was developedby Mohd Zaki et al. (2018). There are three
parameters including in the equation which is H L = Height derived from LiDAR,
CPA = Crown projection area, and DBH = diameter at breast height. The amount of
carbon stock for dominant tree species of Ayer Hitam Forest Reserve was calculated
which ranges from 16.93 to 2793 kg per each tree. The total amount of dominant
tree carbon stock calculated in Ayer Hitam Forest Reserve was 54848.957 kg.
References
Ahmad A, Quegan S (2012) Analysis of maximum likelihood classification on multispectral data.

Appl Math Sci 6(129):6425–6436
Asner GP, Powell GVN, Mascaro J, Knapp DE, Clark JK, Jacobson J, Hughes RF (2010)
High-resolution forest carbon stocks and emissions in the Amazon. Proc Natl Acad Sci USA
107(38):16738–16742
Basuki TM, van Laake PE, Skidmore AK, Hussin Ya (2009) Allometric equations for estimating
the above-ground biomass in tropical lowland Dipterocarp forests. For Ecol Manag 257(8):1684–
1694
Clinton N, Holt A, Scarborough J, Yan L, Gong P (2010) Accuracy assessment measures for
object-based Image segmentation goodness. Photogramm Eng Remote Sens 76(3):289–299
Coomes DA, Dalponte M, Jucker T, Asner GP, Banin LF, Burslem DFRP, Qie L (2017) Area-based
vs tree-centric approaches to mapping forest carbon in Southeast Asian forests from airborne
laser scanning data. Remote Sens Environ 194:77–88
DigitalGlobe (2014) WorldView-3
Foody GM, Cutler ME, Mcmorrow J, Pelz D, Tangki H, Boyd DS, Douglas IAN (2001) Mapping
the biomass of Bornean tropical rain forest from remotely sensed data. Glob Ecol Biogeogr
10:379–387
Galletti CS, Myint SW (2014) Land-use mapping in a mixed urban-agricultural arid landscape using
object-based image analysis: a case study from Maricopa, Arizona, 6089–6110
Hudak AT, Strand EK, Vierling LA, Byrne JC, Eitel JUH, Martinuzzi S, Falkowski MJ (2012)
Quantifying aboveground forest carbon pools and fluxes from repeat LiDAR surveys. Remote
Sens Environ 123:25–40. https://doi.org/10.1016/j.rse.2012.02.023
IUCN (2014) The IUCN red list of threatened species
Karna YK, Hussin YA, Gilani H, Bronsveld MC, Murthy M, Qamer FM, Bhattarai T (2013) Inte-
gration of WorldView-2 and airborne LiDAR data for tree species level carbon stock mapping in
Khayar Khola watershed, Nepal. ISPRS J Photogramm Remote Sens Rev, 280–291
Lebourgeois V, Vintrou É, Ameline M, Butler S (2017) A combined random forest and OBIA
classification scheme for mapping smallholder agriculture at different nomenclature levels using
multisource data (Simulated Sentinel-2 Time Series, VHRS and DEM), 1–20
Measurement R (2013) (MRV) Manual
Mohd Zaki NA, Latif ZA (2017) Carbon sinks and tropical forest biomass estimation: a review on
role of remote sensing in aboveground-biomass modelling. Geocarto Int 32(7)
Mohd Zaki NA, Latif ZA, Suratman MN (2018) Modelling above-ground live trees biomass and
carbon stock estimation of tropical lowland Dipterocarp forest: integration of field-based and
remotely sensed estimates. Int J Remote Sens 39(8):2312–2340
Omar H, Ismail MH, Shafri H, Hamzah K (2015) Estimating biomass in logged tropical forest
using L-Band SAR (PALSAR) data and GIS estimating biomass in logged tropical forest using
L-Band. Sains Malays 44(8):1085–1093
O’Neil-Dunne JPM, MacFaden SW, Royar AR, Pelletier KC (2012) An object-based system for
LiDAR data fusion and feature extraction. Geocarto Int, 37–41
Rainforest Journal (2012) Ayer Hitam Forest Reserve, Puchong. https://www.rainforestjournal.com/
ayer-hitam-forest-reserve-puchong/. Accessed 2 Jan 2019
Shida N, Hanum F, Wan Razali WM, Kamziah K (2014) Community structure of trees in Ayer
Hitam Forest Reserve, Puchong. Malays For 77(1):73–86
Torres-Sanchez J, De Castro AI, Peña JM, Jiménez-Brenes FM, Arquero O, Lovera M, Lopez-
Granados F (2018) Mapping the 3D structure of almond trees using UAV acquired photogram-
metric point clouds and object-based image analysis. Biosyst Eng 176
UNFCC (2015) UNFCC. http://unfccc.int/kyoto_protocol/items/2830.php. Accessed 20 May 2015
Vashum KT, Jayakumar S (2012) Methods to estimate above-ground biomass and carbon stock in
natural forests—a review. J Ecosyst Ecogr 2(4):1000116
Vidyasagar A (2018) Live science. https://www.livescience.com/51720-photosynthesis.html.
Accessed 1 Jan 2019
Chapter 29
The Potential Area Estimation for Solar
Installation Based on Insolation Pattern
Derived from LiDAR Points Cloud Data
Nurhafiza Md Saad, Muhammad Khairil Asyraf Mohd Shukair,

Noraain Mohamed Saraf, Juazer Rizal Abdul Hamid, Noorfatekah Talib
Abstract The efficiency of solar power generator requires several parameters to

optimize the produced energy. This study is conducted to assess and analyze poten-
tial areas for solar photovoltaic (PV) installation based on insolation pattern derived
from LiDAR imagery. The main source of electricity in Malaysia is primarily gen-
erated from natural fossil fuels such as coal, oil or natural gases which contribute to
some negative impacts toward the environment. Solar PV technology is an effective
solution to reduce environmental effects and utility cost. This study is significant to
create awareness among Malaysian citizen on the utilization of solar power while
testing the reliability of LiDAR data in modeling the insolation pattern for the entire
year of 2018. The approach of this study comprises three main stages; starting with
the analysis on the aspect and slope of topographic and man-made structures, the
insolation pattern per month and year 2018 and the determination of potential rooftop
areas for solar PV installation. The final output of this study is the map of potential
areas for solar PV installation on rooftops with specific aspect and slope.
Keywords DSM · Geographic information system · LiDAR · Photovoltaic ·

Insolation
N. Md Saad (B) · M. K. A. Mohd Shukair · N. Talib

University Teknologi Mara, Perlis Branch, 02600 Arau, Perlis, Malaysia
e-mail: nurhafizamsaad.uitm@gmail.com
M. K. A. Mohd Shukair
e-mail: asyrafary@gmail.com
N. Talib
e-mail: fatekah@gmail.com
N. Mohamed Saraf · J. R. A. Hamid · A. R. Abdul Rasam
Universiti Teknologi Mara, 40450 Shah Alam, Selangor, Malaysia
e-mail: noraainms@uitm.edu.my
J. R. A. Hamid
e-mail: juazer@salam.uitm.edu.my
A. R. Abdul Rasam
e-mail: rauf@salam.uitm.edu.my

336 M. Md Saad et al.
29.1 Introduction
Nowadays in Malaysia, the existence of solar-based energy systems has been rapidly
expanding in both rural zones in the form of solar farms and in urban zones as part of
house installation (Tahir and Asim 2017). This is an interminably sustainable power
source and any innovations of utilizing it have numerous advantages for sustainable
power resource and effective energy. PV power stations have numerous benefits,
which make it worth to be built and develop (Mierzwiak and Calka 2017). The
solar radiation approaches the earth in many ways. Some are direct, diffused and
reflected while approaching the earth surface. Abundant components and procedures
are linked together to investigate the characteristics of solar radiation arrived to the
earth’s surface.
In order to enhance the understanding on the solar radiation, factors such as terrain,
topography and forest area should be considered in modeling the solar insolation’s
pattern. The characteristics of topography such as aspect, slope and contour are
needed to conduct analysis on the insolation’s pattern. The consequence from the
recent research, LiDAR dataset has the impression to present more solid output
on three-dimensional (3D) natural features and man-made structure’s model which
prompts greater aftereffect for insolation analysis (Md Saad et al. 2014). The dense
information contained in LiDAR data makes it possible to view as much as possible
all related objects in the study area, thus making it reliable to be used in this study.
LiDAR is currently being utilized to obtain high-resolution base data such as digital
surface models (DSMs) (Brown and Hagstrom 2018).
In addition, the development of solar PV installation is very closely related to
the solar energy potential, aspect and the surface slope of the area. Area with these
criteria has optimal chance of installing the solar photovoltaic panels (Akkas et al.
2017). A study by Bahill (2010) made the potential locations for solar panels to
have its own specific characteristics and requirements. The area must be in proper
elevation with suitable aspect and should be facing the correct direction (south, east,
north or west) or flat. The correct orientation of solar panels installation will result
in higher solar power output than those located on incorrect facing slopes.
29.1.1 Study Area
Ampang, Kuala Lumpur has been chosen as the study area to investigate the insolation
pattern on rooftops for the purpose of solar photovoltaic installation. This area was
chosen because of the availability of LiDAR dataset acquired from Public Work
Department of Kuala Lumpur. The area spanning one kilometer square from 416,000
east, 356,000 north and 416,000 east, 357,000 north consist of hundreds of man-
made structures which enable the investigation on rooftops insolation. Various types
of earth surface features also add as an extra credit for this research area. This is
29 The Potential Area Estimation for Solar Installation … 337
Fig. 29.1 Map of study area, Ampang, Kuala Lumpur
because the investigation on the pattern of solar insolation on different earth surface
can also be made. Figure 29.1 shows the study area for this study.
29.1.2 Data Acquisition
The Public Work Department of Kuala Lumpur is the source of LiDAR dataset in
raw format for this research. It is in ASCII format, consisting of the coordinates and
height for each points captured during data collection using Rockwell 690 Turbo
Commander aircraft through the first-class infrared laser sensor mounted under the
aircraft body. This sensor used the Optech system with the capability of sending
24,000 pulse and collect 50,000 return pulse per second with less than 2 m resolution.
The accuracy of this sensor is 30 and 15 cm for its horizontal and vertical, respectively.
The projection of the LiDAR dataset is rectified skew orthomorphic (RSO). The
description of LiDAR dataset is shown in Table 29.1.
Table 29.1 The specification

Aircraft Rockwell 690 turbo commander
of LiDAR dataset
Sensor 1st class infrared sensor
Type Optech system
Format ASCII
Resolution Less than 2 m
Accuracy 30 cm horizontal, 15 cm vertical
Projection Rectified Skew Orthomorphic (RSO)
29.2 Methodology
This research begins with the preliminary study on the research topic and the related
problems. The approach of this study comprises three main stages of analysis; the
analysis on the aspect and slope of topographic and man-made features, the insolation
pattern per month and year 2018 and the determination of potential area on rooftops
for solar PV installation. These three stages are intended to fulfill all three objectives
of this study.
29.2.1 Phase 1: Extraction of Aspect and Slope
The first stage of preliminary study was the extraction of aspect and slope for topo-
graphic features and man-made structure based on DSM. The information from this
extraction was used for the purpose of investigation and analysis on the parameter
required for solar PV installation. Aspect and slope are closely related to the value
of insolation on each point of earth surface.
29.2.2 Phase 2: Insolation Modeling
The next stage was the analysis on monthly and one year insolation pattern of year
2018 based on diffuse and specular reflecting objects. The area of solar radiation
model was used to create the insolation pattern on this study area. This method was
used because of its capability to derive the incoming solar radiation from a raster
surface.
29.2.3 Phase 3: Rooftops PV Installation Area
The final stage was the investigation on the potential area for solar PV installation
based on the aspect, slope and insolation value. The characteristics and parameters for
potential area were determined. The aspect, slope, insolation and building structure
were clipped together to produce map of potential area for solar PV installation on
rooftops. The flowchart of the methodology is shown in Fig. 29.2.
Fig. 29.2 Methodology workflow

The research outcome discusses the aspect and slope derived from LiDAR dataset,
investigation on insolation pattern and the potential area for solar PV installation on
rooftops.
29.3.1 Topographic Condition of Study Area (Digital Surface

Model, DSM)
The topographic features and man-made structures of the study area are represented
in the form of raster DSM, as shown in Fig. 29.3. The total number of cell size
of this raster DSM is 1000 times; 1000 in its columns and rows, respectively. This
contributes to a high resolution data for a better view of all surface features. The
minimum elevation is 63 m and rises to the maximum elevation of 259 m. The
study area comprises natural terrain, trees, roadways, housing, water tanks and other
man-made structures. The elevations of man-made structures are between 63 and
181 m tall. The variations in features on the study area are suitable to be used as the
foundation to execute the analysis on insolation pattern and potential area for solar PV.
Fig. 29.3 Digital surface model

29.3.2 Aspect Against 2018 Mean Global Insolation Value
The results from overlapping aspect with the 2018 mean global insolation value
are shown in the graph and table forms in kWh/m2 unit, as shown in Fig. 29.4 and
Table 29.2. Figure 29.4 clearly shows the highest insolation value fall to features
facing south direction with the value of 1262 kWh/m2 . The second and third highest
insolation values are southwest and southeast facing directions with 1226 and 1176
kWh/m2 . The insolation values facing other directions fall below 1000 kWh/m2 . The
highest insolation below this value is features facing west direction at 924 kWh/m2
followed by east at 912 kWh/m2 . The lowest insolation value goes to north-facing
direction with the ability to capture the solar energy at a maximum of 674 kWh/m2 .
Meanwhile, the other two directions, northeast and northwest are capable of capturing
the solar energy up to 836 and 808 kWh/m2 , respectively. The average difference
between the top-three highest insolation values is at 61 kWh/m2 . The results show that
the highest value of 2018 insolation in kWh/m2 is at southeast, south and southwest-
facing directions. This indicates that the features facing these directions receive the
highest amount of solar energy compared to the other facing directions. Installing
solar PV facing these directions will optimize the amount of solar energy absorbed.
The results from this study are significant with the research made by (Daut et al.
2011; Hashim et al. 2013; Md Saad et al. 2014; Ng et al. 2014) that the highest
insolation value for northern hemisphere countries are facing southeast, south and
southwest direction. This event is a direct consequence of the sun’s position at noon,
which tends to shines longer in the near equator countries. At the equator, the sun
Fig. 29.4 Aspect against 2018 mean global insolation value graph
Table 29.2 Tabulation of aspect against mean global insolation value

Mean/aspect N NE E SE S SW W NW
Global insolation value 674 836 912 1176 1262 1226 924 808
(kWh/m2 )
apparent motion seems to move from left to right resulting with the solar noon is
always at the south of zenith position. Due to this phenomenon, the insolation values
obtained at the study area, Ampang, Kuala Lumpur have higher values for southeast,
south and southwest-facing direction. The total percentage of features facing these
directions is 33.8% of cells count, corresponding to an area of 338 m2 from the total
area.
29.3.3 Slope Against 2018 Mean Global Insolation Value
Figure 29.5 and Table 29.3 are the results extracted from the process of overlapping
slope map with 2018 mean global solar insolation map. The values of insolation
shown are in kWh/m2 unit. Based on the graph, it shows that the value of insolation
decreased steadily as the steepness of slope increases. This indicates that areas with
a lower slope will receive higher solar insolation compared to steep areas. The 10°,
20° and 30° slope has the top-three highest insolation values at 1684, 1568 and
1467 kWh/m2 , respectively. Meanwhile, the top-three lowest insolation values are
at 70°, 80° and 90° slope with 629, 496 and 432 kWh/m2 , respectively. The average
difference of insolation value between 10° to 30° and 70° to 90° slope is 100 kWh/m2 ;
meanwhile, the average difference between 30° and 70° is slightly higher with 200
kWh/m2 .
From the results, a convincing finding on the pattern of slope against the insolation
values is that the slopes with 10° to 30° will receive more than sufficient amount of
solar insolation. The total insolation value on these slopes is 4719 kWh/m2 . The
installation of solar PV on the surface slanting to this slope value will optimize the
capability of solar panel to capture the unlimited energy from the sun. These findings
match with the study made by (Tian et al. 2001; Md Saad et al. 2014; Lin et al. 2017)
Fig. 29.5 Slope against 2018 mean global insolation value graph
Table 29.3 Tabulation of slope against mean global insolation value
Mean/slope (°) 10 20 30 40 50 60 70 80 90
Global insolation value (kWh/m2 ) 1684 1568 1467 1217 1018 814 629 496 432
29 The Potential Area Estimation for Solar Installation …
343
where the gentle slope ranging between 0° and 30° will receive higher amount of
insolation value. This natural phenomenon happens because the surface with gentle
slope has the largest upward viewshed area for the solar radiation to strike the surface.
Compared to the surface with steep slope, this surface has the tendency to slant at
the same angle of solar radiation approaching the earth’s surface which resulted in
less solar radiation strike on these areas.
29.3.4 Monthly Global Solar Radiation
Figure 29.6 shows the graph of 2018 monthly global solar insolation pattern based
on DSM in kWh/m2 unit. From the shape of the line graph, the lowest insolation
value falls at the first and fourth quarter of the year. This is due to the fact that
Malaysia experiences northeast monsoon, which typically starts from late October
to March every year. The rainy seasons caused by the incoming solar radiation are
interfered by the clouds at the atmosphere before it reaches the earth’s surface. The
top highest mean insolation values are on April (83 kWh/m2 ), May (82 kWh/m2 ),
July (80 kWh/m2 ) and August (85 kWh/m2 ). During the period between these months
the insolation value drops to 76 kWh/m2 on June. Similar amount of this value is
also received on September with the mean of 72 kWh/m2 .
Based on Table 29.4, the mean global insolation value throughout 2018 ranged
from 40 kWh/m2 to the maximum of 85 kWh/m2 . This indicates that the insolation
value on the study area is sufficient for the solar panel installation. The difference
of insolation value between months is consistent for every month with the average
of 10 kWh/m2 . However, this value is not valid for the transition between February
Fig. 29.6 Graph of 2018 monthly global insolation pattern based on DSM
Table 29.4 Tabulation of monthly global solar insolation
Mean/monthly 1 2 3 4 5 6 7 8 9 10 11 12
Global (kWh/m2 ) 40 42 60 83 82 76 80 85 72 49 40 38
29 The Potential Area Estimation for Solar Installation …
345
to March and September to October where the insolation value during these periods
drastically increased and decreased, respectively.
29.3.5 Global Solar Radiation
Figure 29.7 shows the insolation pattern of year 2018 in Ampang, Kuala Lumpur.
The maximum insolation value throughout the year is 2580.1 kWh/m2 shaded in dark
red. Meanwhile, the lowest insolation value in dark blue is 0.8 kWh/m2 . This creates
a huge gap between the highest and lowest insolation value with 2579.3 kWh/m2
difference. Most of the natural topographic features such as trees, forest, vegetation
and terrain covered with green area are shaded in blue color. These multiple types
of topographic features are acting as a diffuse shade which blocks the radiation
from reaching one another. The existence of shadows on these areas is also higher,
resulting due to the reflected rays from the sun are blocked from reaching the shadow
area. Meanwhile, the well-developed human living area is mostly shaded in yellow
to dark red color. It can be seen that the man-made structures with higher elevation
have the highest insolation values compared to low structures. This is due to the fact
that higher elevation area has less interference by the surrounding features. The solar
Fig. 29.7 Solar insolation pattern in year 2018 at Ampang, Kuala Lumpur
radiation coming from the sun strikes these areas directly, making it able to receive
higher amount of solar energy.
29.3.6 The Potential Area for Solar Photovoltaic Installation

on Rooftops
Based on Fig. 29.8, it shows that the map of potential area on rooftops for solar
photovoltaic installation is shaded in five different colors. Table 29.5 shows the pro-
portion of insolation values shaded in yellow to dark red. These colors represent the
value of insolation on the rooftops ranging between 1046.3 and 2887.7 kWh/m2 . The
different amount of insolation values between the rooftop areas is due to the factors
such as the sun angle, atmosphere and distance. The thickness of the atmosphere
in which the sun’s rays pass through has significant impact on the insolation value.
Thinner atmosphere where the amount of atoms and small particles in the air are
less make the insolation value higher compared to thick atmosphere. The insolation
value will also be at its highest when the sun’s rays are at overhead direction on the
area. From the map of potential rooftops for solar PV below, it can be seen that most
of the shaded rooftops areas receive a minimum of 1782.9 kWh/m2 , indicating that
these areas are suitable for solar power generation.
Fig. 29.8 Map of potential area for solar PV installation on rooftops

Table 29.5 Tabulation of slope against mean global insolation value

Legend/Area Global Insolation value (kWh/m²)
1046.3 – 1414.6
1414.6 – 1782.9
1782.9 – 2151.1
2151.1 – 2519.4
2519.4 – 2887.7
Table 29.6 Total insolation value on the potential area for solar PV on rooftops
Count Area (m2 ) Global insolation value (kWh/m2 )
Minimum Maximum Total
149 66,257.7 1046.3 2887.7 297,481.3
Based on Table 29.6, the total shaded rooftops for the potential areas of solar PV
contain 149 counts. These shaded areas make a total of 66,257.7 m2 covering 6.6%
of 1 km2 of the whole study area. From this small portion of area, it was discovered
that the total global insolation value that can be captured is 297,481.3 kWh/m2 .
According to a report made by Suruhanjaya Tenaga Malaysia in (2017), the average
electricity consumption in Malaysia per household is 250 kWh per month. Thus,
if daily daylight is 6 h per day, by neglecting the efficiency of solar PV panel, the
maximum solar energy that can be harnessed on these area per month is 3.5 × 1012
kWh which is enough to power hundreds and thousands of houses.
From the results obtained through the intersection and clipping of aspect, slope
and insolation map of year 2018, and buildings extraction process, the total area of
potential rooftops for solar PV installation is 66,257.7 m2 , as shown in Table 29.7.
As this research is intended to identify the potential area for solar PV installation
on rooftops, the calculation on possible number of solar panels can be installed on the
selected rooftops. The standard size of commercial solar panel is measured at 1.7 m
length and 1.0 m width which make up a total of 1.7 m2 of surface area. The total
potential area for solar PV on rooftops is divided into 1.7 m2 to get the total number
of solar panels that can be installed. From the results of calculation, it was found that
38,975 units are the maximum number of solar panels that can be installed on the
rooftops of the residential, shop lot and small industrial buildings on the study area.
Table 29.7 Tabulation of potential number of solar panel on the rooftops

Potential area for solar Standard size of solar panel Possible number of solar
PV on rooftops (m2 ) Length (m) Width (m) Area (m2 ) panels
66,257.7 1.7 1.0 1.7 38,975

These rooftops are the most optimum area for solar PV installation to maximize the
capability of capturing and transforming the solar energy into usable electricity.
29.4 Conclusion
The LiDAR dataset is very reliable for insolation modeling as it offers high accuracy
coordinates and elevation data. The extraction of raster DSM surface from LiDAR
creates better surface visualization on the AOI which enable deeper analysis on the
insolation pattern. From the obtained results, it is clearly seen and proven that the
location of Malaysia slightly above equator to the northern hemisphere receive higher
insolation value at southeast, south and southwest facing direction with 10° to 30°
slope. Installation of solar PV on these directions will optimize the energy captured
from the sun. From the analysis made on the monthly global insolation pattern,
although the insolation values are lower in first and fourth quarter of the year, the
mean insolation value for the whole year 2018 is still more than suffice to harness
the sun’s energy. The aim of this research to assess the potential of solar photovoltaic
installation based on the insolation pattern is successfully achieved together with the
listed objectives. The results and analysis on aspect and slope of topographic features
and man-made structure based on DSM are significant with previous studies made
by other researchers. Meanwhile, the analysis on monthly and yearly insolation of
year 2018 based on diffuse and specular object derived from LiDAR points cloud
shows that the atmospheric condition and topographic features play their role in the
insolation values over specific locations. Last but not the least, the determination
process on potential area for solar PV installation based on the aspect, slope and
insolation value in kWh/m2 is successfully achieved with the total area of 66,257.7
m2 .
References
Akkas OP, Erten MY, Cam E, Inanc N (2017) Optimal site selection for a solar power plant in the
central anatolian region of Turkey. Int J Photoenergy
Bahill AC (2010) Solar panels derived from LiDAR. Sol Energy 45:24–27
Brown M, Hagstrom S (2018) 3D metrics for airborne topographic LiDAR. In: Reference module
in materials sciences and materials engineering. https://doi.org/10.1016/b978-0-12-803581-8.
09419-4
Daut I, Irwanto M, Irwan YM, Gomesh N, Ahmad NS (2011) Clear sky global solar irradiance on
tilt angles of photovoltaic module in Perlis, Northern Malaysia. In: ECCE 2011—international
conference on electrical, control and computer engineering. pp 445–450. https://doi.org/10.1109/
INECCE.2011.5953923
Hashim AM, Ali MAM, Ahmad B, Shafie RM, Rusli R, Aziz MA, Wanik MZC (2013) A preliminary
analysis of solar irradiance measurements at TNB solar research centre for optimal orientation of
fixed solar panels installed in Selangor Malaysia. IOP Conf Ser Earth Environ Sci 16:1. https://
doi.org/10.1088/1755-1315/16/1/012001
Lin I, Ahmad FM, Iftikhar A (2017) Impact of slope, aspect and cloud cover on the distribution of
incoming global solar radiation over Pakistan. Space Earth Inf Sci 3
Mierzwiak M, Calka B (2017) Multi-criteria analysis for solar farm location suitability. Rep Geodesy
Geoinform. https://doi.org/10.1515/rgg-2017-0012
Md Saad N, Abdul Hamid JR, Mohd Suldi A (2014) The reliance of insolation pattern on surface
aspect N. In: Saad NM (ed) International symposium of the digital earth 012165, 6–12. IOP
Publishing. https://doi.org/10.1088/1755-1315/18/1/012165
Ng KM, Adam NM, Inayatullah O, Zainal M, Ab A (2014) Assessment of solar radiation on
diversely oriented surfaces and optimum tilts for solar absorbers in Malaysian tropical latitude.
Energy Environ Eng 5:5. https://doi.org/10.1007/s40095-014-0075-7
Suruhanjaya Tenaga Malaysia (2017) Energy statistics in Malaysia. Putrajaya, Malaysia
Tahir ZR, Asim M (2017) Surface measured solar radiation data and solar energy resource assess-
ment of Pakistan: a review. Renew Sustain Energy Rev 81:1–23. https://doi.org/10.1016/j.rser.
2017.06.090
Tian YQ, Davies-colley RJ, Gong P, Thorrold BW (2001) Estimating solar radiation on slopes of
arbitrary aspect. Agric For Meteorol 109:67–74
Chapter 30
Detecting Speed Violation Using Wireless
Sensor Network to Reduce Road
Accidents Among Commercial Bus
Rashidah Ramle, Haidib Mohd Haider, Muhammad Fakhrul Yusuf,

Norzatul Bazamah Azman Shah, Nur Khairani Kamarudin
and Rafiza Ruslan
Abstract Road accidents involving buses have increased each year because of speed
violation. This may give an impact on regulation enforcement by the government
institution. Consequently, it will disrupt the development continuity when the com-
munity stakeholders question the safety of the commercial vehicle industry. Hence,
the purpose of this research is to reduce speed violation among bus drivers in order
to decrease the number of accidents comprising buses. This research used wireless
sensor network (WSN) technology which contains the usage of speed sensor and
Arduino board. The sensor that has been chosen in this project is IR speed sensor.
Global system for mobile communication (GSM) is used to transmit a notification
by sending SMS. The IR speed sensor generally reads the speed of the wheel, so if
the speed is over the limit, it will notify the user using SMS. This speed violation
alert system is evaluated by its response time in detecting speed violation and giving
alert. Besides, this research has also conducted a survey on usability testing with
respondents rated the system highly on usefulness and ease of use.
Keywords Speed violation · Alert system · WSN · GSM · SMS · Commercial

vehicles
R. Ramle · H. Mohd Haider · N. K. Kamarudin · R. Ruslan

Universiti Teknologi MARA Perlis, Perlis, Malaysia
e-mail: rashidahramle@uitm.edu.my
H. Mohd Haider
e-mail: haidibhaider@gmail.com
N. K. Kamarudin
e-mail: nurkhairani@uitm.edu.my
R. Ruslan
e-mail: rafiza.ruslan@uitm.edu.my
M. F. Yusuf (B)
Universiti Malaysia Pahang, Pahang, Malaysia
e-mail: m.fakhrul@gmail.com
N. B. Azman Shah
Universiti Teknologi MARA Melaka, Melaka, Malaysia
e-mail: norzatulb@uitm.edu.my

352 R. Ramle et al.
30.1 Introduction
Commercial bus accidents have become a serious menace that threatens life and prop-
erties in Malaysia. Statistics show that the total number of commercial bus accident
increased steadily from 2003 to 2012 (Oluwole et al. 2015). Efficient transportation
management plays an important role in transportation system. There are huge num-
bers of accidents because of speed driving. Another study also found that 22% of
commercial buses exceeded the speed limit of 90 km/h (Osman et al. 2010). Safety
precaution is considered vital in transportation management. In Malaysia, speeding
is recognized as one of the leading factors contributing to road crash among public
and private vehicles (Ahmad et al. 2017). While there are speed detection equipment
such as automated enforcement system (AES) and manual capturing speed trap using
speed radar detection handled by Malaysian police, the coverage, however, is limited.
AES is a system which continuously monitors traffic speeds without an operator
and a mobile camera operation which often deployed in vehicles could measure
speeds, at both starting and ending point on roadways. AES is unlike the hidden
cameras system where policeman hides in bushes along the highway. With a very
limited coverage area, it proven to be a disadvantage since whenever the bus drivers
see the signboard of AES, they will decrease the speed immediately, and thus avoiding
the speed trap. According to Hamzah et al. (2013) case study, only 50% of the drivers
comply with the speed limits when they see the signboard. Also, even if AES is one
of the solutions to avoid speed violation and road accidents, it is only implemented
in certain area.
Manual capturing, on the other hand, is a hassle to the policemen because they
need to do it one by one, requiring a large number of manpower (Hamzah et al. 2013).
In addition, if the accident happened because of speed violation, the company that
owns the bus need to be investigated by the police and the result of the investigation
often takes time to be produced.
The proposed method that can be used to overcome this problem is with wireless
sensor network (WSN) technology to develop a bus speed violation alert system using
Arduino and global system for mobile communication (GSM). This will eventually
decrease the numbers of death caused by over speed driving and gives a bus driver
some awareness to not exceed the maximum speed allowed. If the speed exceeds the
limit, the sensor will detect it and automatically sends notification reminder to the bus
driver and his company’s personnel through SMS. This will prevent reckless driver
from continuing to over speed. This research aims to develop a prototype system that
detects bus speed violation using IR speed sensor and gives alert using SMS.
30 Detecting Speed Violation Using Wireless Sensor Network … 353
30.2.1 Bus Users Statistics in Malaysia
Bus plays an important role in the transportation system as a whole because it remains
as the main mode of transportation in areas that do not get any other public transporta-
tion services. In Lembah Klang for the year 2017, the average number of passengers
for buses and rails amounted to 1.2 million, an increase of 3.7% from the previous
year (Bernama 2018).
Furthermore, the number of buses on the road is also relatively high. The gov-
ernment has approved more than 1,500 various types of bus license every year since
2006 with an average of 3% of these buses will be on the road on any particular day
all over Malaysia (Ministry of Transport 2017). It is estimated that an average of 4
million people uses the service in a day.
30.2.2 Road Accident Statistics
The statistics by the Ministry of Transport (2018) showed that the average number
of road traffic accidents is more than 6,000 for each year between 2008 and 2017.
According to the statistics in Table 30.1, it shows that road accidents involving buses
hover between 800 and 10,000 with the lowest in 2017 at 7,258 cases. The statistic
demands for explanations on why does this happen.
Rietveld and Shefer (1998) listed factors such as traffic flow, road type, and road
design as important factors in a driver’s speed preference. While Giles (2004) in her
study suggested that the average speed of vehicles travelling on urban roads was
about 2 km/h lower compared to vehicles travelling on rural roads. In addition, an
analysis conducted on crashes in Hualien Country revealed that speeding and driving
Table 30.1 Road accident

Year Bus
statistics (Ministry of
Transport 2018) 2008 9,356
2009 9,380
2010 9,580
2011 9,986
2012 10,167
2013 10,123
2014 9,193
2015 8,804
2016 9,462
2017 7,258
354 R. Ramle et al.
under influence (DUI) accounted for one-fifth of the primary causes (Li 2007). Li
(2007) further stated that a much higher percentage of speeding was reported out
of the total crashes in rural districts compared to urban districts. Thus, we need a
device to record the speed violation when these bus drivers drive over speed limit.
Then, further action can be taken accordingly, and ultimately road accidents due to
reckless speeding can be reduced.
30.2.3 Bus Speed Violation
Speeding can be defined as a “difference between average speed for a trip and the spot
(instantaneous) speed at which a vehicle may be clocked at one point and place in
time”. Excess speed means a vehicle exceeding the relevant speed limit deliberately
(Ahmad et al. 2017). The term speeding in this paper is referred to the speed above
the stipulated regulation by the government. However, the prototype design in this
research will simulate speed violation at 5, 7, and 9 km/h.
Speed has been identified as the leading cause of road crashes not only among
private vehicles but also commercial road transport and public passenger vehicles.
Ahmad et al. (Ahmad et al. 2017) reported the statistics from the Royal Malaysia
Police (RMP) where the number of drivers or riders involved in road accidents due to
speeding was 4% in 2010 and 4.4% in 2011. In 2012, the highest factor of all accidents
related to buses was caused by speeding (Oluwole et al. 2015). Summons were
issued by the police to curb drivers from exceeding speed limit (Hamzah et al. 2013).
However, it is important for bus companies to maintain discipline between their
drivers rank internally before the speeding violation happens and causes fatalities.
30.2.4 Wireless Sensor Network (WSN)
WSN is a unique component of electrical device that transforms one form of energy
into another with a communication infrastructure on diverse locations which has
been developed for monitoring and recording real-time condition. Its technology
has a prodigious perspective to be employed in critical situations (Padmavathi et al.
2010). It is also a reliable and efficient solution involving sensors to monitor different
parameters such as temperature, moisture, motion, speed, and vital body functions.
A WSN can also enable the interaction between the users and computers, accord-
ingly controlling the environment as needed (Yinbiao 2014). The users of WSN
devices will also be provided with significant processing, memory, and wireless
communication capabilities.
WSN has been used broadly all around the world in numerous applications such
as smart home, industrial civilian, health, habitat monitoring, environmental, office
application, military, smart grid, and in an automobile (Ramle et al. 2018). Users
from various fields such as manufacturers and academic community were relishing
on this technology because of its distinctive benefits (Bagula 2010). Global system
for mobile communication (GSM) is a digital cellular technology used to transmit
the mobile voice and data services. In the second generation of the wireless cellular
system in the world, the one that most widely deployed is GSM for wireless (Gu
and Peng 2010). This research used the well-known notification system that has
been implemented, which is short messaging system (SMS). Since 2005, the SMS
notification alert system technology has become relevant to businesses and organi-
zations that need the alert notification system as one of the communication mediums
(Karolidis et al. 2005).
30.3 Methodology
This research has developed a prototype system that detects bus speed violation using
IR speed sensor before giving out alert using SMS. The architecture started from the
speed sensor which was placed near a DC motor which represents the bus wheel to
produce the real-time data as the input. Then, the information from the sensor will
be conveyed to the system whether it exceeds the limit or not and will forward an
SMS alert to the user for a speed violation.
Figure 30.1 shows the network diagram of the speed violation alert system. The
function of IR speed sensor is to detect the speed violation of a bus driver in order to
send the data to the Arduino board. The sensor that has been used is able to provide
real-time input to the users.
The microcontroller used in this research is Arduino Uno board with a USB cable.
This board is used to send the information of the speed that has been captured. This
prototype also used 12C RTC DS1307 with CR2032 battery which operated as a
timekeeper of date and time information on speed violation of the bus. It also used
L9110 Motor Driver and GSM module for sending alert through SMS. All devices
Fig. 30.1 Network diagram of speed violation alert system

356 R. Ramle et al.
were connected successfully through wireless sensor network technology combined

with GSM technology.
The hardware used for this research is listed in Table 30.2. The DC motor repre-
sented the wheel of a bus. The laptop was used to program this system. The Arduino
IDE software has been downloaded for free.
Figure 30.2 shows the flow of this alert system. The experiment for this prototype
has been set for three different speed violations which are 5, 7, and 9 km/h. The
speed sensor is placed near the dummy bus wheel by DC motor in order to detect the
speed. Then, the sensor will send information on the speed violation to the Arduino
board. Next, the Arduino board sends a message by using a GSM module and the
user will receive an SMS notification through his mobile phone. The user could be
someone that is responsible for the bus, such as the bus driver or the commercial bus
manager. The incoming SMS will alert the bus driver of his speed violation and the
manager could identify any irresponsible driver that has violated the speed limit.
Table 30.2 Hardware

Item Specification
specification
1. Laptop • Brand = LENOVO
• RAM = 8.00 GB
• OS = Windows 8.1
• CPU processor = Intel
Core i5
• CPU speed = 2.50 GHz
2. Arduino UNO • Operating voltage = 5 V
microcontroller • Digital I/O pins = 14
• Flash memory = 32 KB
(ATmega328)
• Clock speed = 16 MHz
3. Sensor • Brand = IR speed sensor
• Supply voltage = 3.3 V
• GHz = 10.525
• Interface = Digital
4. Cable • USB cable
• Female-to-female jump
wire
• Male-to-female jump wire
5. DC motor • Power supply
• Coils of wire
• Magnetic field
• Graphite brushes
• Split ring commutation
6. GSM SIM 900A • Fixed dialing number
(FDN)
• Real-time clock with alarm
management
7. Breadboard • Enables components to be
set using pins and wires
Fig. 30.2 Flowchart of speed violation alert system
Figure 30.3 shows the physical view of this system’s prototype during the
experimental phase.
Fig. 30.3 The prototype of speed violation alert system

358 R. Ramle et al.
Average Response Time for SMS Alert
Time (Millisecond)
Average Response
13000
12000 11899.67
11000 10866.33
9994
10000
9000
5 7 9
Speed (Km/h)
Fig. 30.4 The average response time for SMS alert
30.4 Analysis
30.4.1 Functionality Testing on the Alert System
The first experiment was run to prove that this system can successfully give alert to
the users within an acceptable period of time. It has considered the response time
of alert notification for three different speed limits which were 5, 7, and 9 km/h.
The experiment was repeated three times to ensure that the data is conclusive and
can gain the average value. During this experiment, the GSM board has been put at
a fixed location and the same mobile phone has been used. It has been set so that
whenever the speed is above the limit, the sensor will detect the speed violation and
automatically send an alert notification to the user’s phone by SMS.
Figure 30.4 illustrates the graph of the average response time for three scenarios
that were involved in this experiment. The average response time for receiving an
SMS alert when there was speed violation has been captured and plotted. The speed
limit has been set at a minimal value for this prototype. This value can be programmed
according to a preferred limit.
It is proven that this system has managed to send SMS to the user so as to notify
that there was a speed violation.
From the speed of 5 km/h, the response time of the system to send an alert
notification is 9994 ms. At 7 km/h, the response time is 10866.33 ms while at the
speed of 9 km/h, the response is 11899.67 ms. The average of the response time to
alert the speed violation is 10,920 ms.
30.4.2 Usability Testing
The usability testing on the wireless sensor network prototype of bus speed violation
alert system was accomplished by having 30 respondents. The demonstration on the
system has been performed according to the task given as well as sending the alert
notification to a number that has been coded in the system. The questionnaire has
been distributed to these respondents for the feedback after the demonstration of the
Table 30.3 Usefulness and ease of use

Question No. Mean Score
1. By using this system, we can know if the bus violated the speed limit 4.3 High
2. By using this system, early monitoring can be done to avoid dangerous 4.37 High
driving
3. This system can give an alert to the bus driver’s company if speed violation 4.27 High
happens
4. Learning to manage the system would be easy 4.1 High
5. I would find the system is easy to use 4.2 High
system. Five-point Likert scale has been used in this questionnaire. Questions 1–3
reflect the usefulness of the system, while questions 4 and 5 ask whether it is easy
to use the system and the user’s satisfaction towards the system.
Table 30.3 depicted the results of the survey. To be systematic and easy to analyse,
the mean result is differentiated to low, medium, and high. The low scores will be
below 2.3 [1 + 4/3], high scores above 3.7 [5 − 4/3], and medium scores in between
those two.
From the table, the mean for questions 1–3 scored high with all answers towards
the higher end of the score. It shows that the system can give an alert to the bus
driver’s company if speed violation occurs which concur with the objective of the
research.
The mean result for ease of use questions also scored highly albeit on the lower end
of the score chart. These results are expected since the system is new and the respon-
dent is not familiar yet with the system. These respondents, however, acknowledge
that the system, in general, is rather easy to use with further training and improvement.
30.5 Conclusion
As conclusion, this research would be beneficial for commercial vehicle sector, not
only for bus companies, in order to provide the best way in managing the problem of
speed violation; hence, preventing road accident. This research can become an effec-
tive solution to measure and prevent speed violation as it provides a cost-effective
and simple speed monitoring alert system for bus companies. Moreover, with minor
training, the system is easy to be used by commercial vehicles companies.
For future recommendation, it is suggested that this system will be powered by
solar instead of a battery as the current prototype. The solar-powered version will
automatically activate the system according to requirement and automatically switch
off to save power when not required by the speed monitoring system.
Acknowledgements This research was partly supported by Lecturer’s Training fund from
Universiti Teknologi Mara (Perlis) and a grant from Universiti Malaysia Pahang (RDU182202).
360 R. Ramle et al.
References
Ahmad MS et al (2017) An observational study on speeding among malaysian express bus drivers.
J Soc Automot Eng Malays 1(2):94–102
Bagula AB (2010) Modelling and Implementation of QoS in Wireless Sensor Networks: a
multiconstrained traffic engineering model. EURASIP J Wirel Commun Netw 2010(1):468737
Bernama (2018) Jumlah penumpang harian pengangkutan awam meningkat—SPAD. Astro Awani,
07-Mar-2018
Giles MJ (2004) Driver speed compliance in Western Australia: a multivariate analysis. Transp
Policy 11(3):227–235
Gu G, Peng G (2010) The survey of GSM wireless communication system. In: Proceedings of ICCIA
2010–2010 international conference on computer and information application, pp 121–124
Hamzah MK, Ng CP, Khairuddin FH, Yusof MA (2013) The automated speed enforcement system—
a case study in Putrajaya. J East Asia Soc Transp Stud 10:2133–2146
Karolidis D, Papadakis A, Prentakis P, Samarakou M (2005) MoBINo : An integrated mobile and
web based environment for automatic SMS notification. In: ICCOM’05 proceedings of the 9th
WSEAS international conference on communications
Li Y-M (2007) Road traffic casualties and risky driving behavior in Hualien County, 2001–2005.
Tzu Chi Med J 19(3):152–158
Ministry of Transport (2017) Malaysia transport statistics 2016. Ministry of Transport
Ministry of Transport (2018) Malaysia transport Statistics 2017. Ministry of Transport
Oluwole AM, Rani MRA, Rohani JM (2015) Commercial bus accident analysis through accident
database. J Transp Syst Eng 2(1):7–14
Osman MR et al (2010) Safety practices among bus operators during wee hour operations. Int J
Econ Manag Eng 4(11):287–292
Padmavathi G, Shanmugapriya D, Kalaivani M (2010) A study on vehicle detection and tracking
using wireless sensor networks. Wirel Sens Netw 02(02):173–185
Ramle R, Adanan SNM, Yusuf MF, Azman Shah NB, Osman A, Ahmad H (2018) Baby’s here!
: mobile alert system using Arduino and GSM application to prevent baby fatalities in parked
vehicle. J Fundam Appl Sci 10(2S):1028–1033
Rietveld P, Shefer D (1998) Speed choice, speed variance, and speed limits: a second-best instrument
to correct for road transport externalities. J Transp Econ Policy 32(2):187–202
Yinbiao S et al (2014) Internet of things: wireless sensor networks
Chapter 31
Data Verification of LiDAR-Derived
DEM from Different Interpolation
Techniques
Noraain Mohamed Saraf, Khairun Najwa Kamarolzaman,

Nurhafiza Md Saad, Nafisah Khalid, Abdul Rauf Abdul Rasam
and Ainon Nisa Othman
Abstract Sustainable development makes light detection and ranging (LiDAR) as

an accurate technology in providing the accurate data sources for deriving digital
terrain model (DTM) and digital elevation model (DEM). This study is focusing
on accuracy assessment of generated LiDAR DEM based on different interpola-
tion techniques in GIS environment. In the beginning, LiDAR point clouds were
used to generate DEM surface based upon three different interpolation methods
: (i) inverse distance weighting (IDW), (ii) Kriging and (iii) Spline. Next, 31 ground
control points (GCP) from global positioning system (GPS) observation were used
to perform accuracy assessment of LiDAR DEM that generate through IDW, Kriging
and Spline interpolation techniques. As result, LiDAR data used in this study met the
requirement of LiDAR accuracy with root mean square error (RMSE) below 0.3m.
The finding reveals that the overall RMSE (x, y) for IDW, Kriging and Spline methods
is between 0.0124 and 0.1120 m. Besides, the RMSE (z) for Kriging stated the small-
est value of 0.2135 m, followed by Spline with values of 0.2141 m. Concurrently,
IDW techniques gave the highest RMSE (z) value with 0.2276 m. In conclusion,
Kriging interpolation technique has been proved as the best methods which gave the
highest accuracy of LiDAR-derived DEM compared to other interpolation methods.
N. M. Saraf (B) · K. N. Kamarolzaman · N. M. Saad · N. Khalid · A. R. Abdul Rasam ·

A. N. Othman
Faculty of Architecture, Planning and Surveying, Centre of Studies for Surveying Science and
Geomatics, Universiti Teknologi MARA, Shah Alam, Malaysia
K. N. Kamarolzaman
e-mail: najwa.94njj@gmail.com
N. M. Saad
e-mail: nurhafizasaad@uitm.edu.my
N. Khalid
e-mail: nafisahkhalid@uitm.edu.my
A. R. Abdul Rasam
e-mail: rauf@uitm.edu.my
A. N. Othman
e-mail: ainonnisa6941@uitm.edu.my
362 N. M. Saraf et al.
Keywords LiDAR · Interpolation · RMSE
31.1 Introduction
LiDAR or light detection and ranging is one of the surveying methods that uses laser
light pulses for capturing three-dimensional point clouds of the earth surface. LiDAR
provides a huge source of information for diverse application and offers some advan-
tages over conventional methods for aerial mapping. Besides, LiDAR has become
hanging concept of terrain mapping and gained much popularity, especially in flood-
plain mapping, forest inventory, hydrology, urban and regional planning, coastal
engineering, survey assessment and volumetric assessment (Ismail et al. 2016).
From LiDAR point clouds, digital earth surface model can be generated such as
digital elevation model (DEM) and digital terrain model (DTM). DEM is the adopted
data source that is structured and store topographical information and uses interpo-
lation process created by height values of entire terrain. In other words, DEM is the
representation of elevation data and also principle data for aspect and slope map that
is used in geographic information system (GIS) analysis. Moreover, most of GIS
applications are relying on DEM; for example, urban assessment studies, hydrolog-
ical model, erosion analysis and soil distribution (Rizeei and Pradhan 2018). This is
because topography is a vital parameter that controls the changes and behaviour of
natural systems, and DEM has become the most valuable source to cope up with the
environmental phenomena.
In contrast, the interpolation methods used to create DEM range are from simple
technique (e.g. nearest neighbour) to complex technique (e.g. Kriging) in gridding
routines and able to produce slight difference of surface. The most common surfaces
created are from triangulated irregular network (TIN) and inverse distance weighting
(IDW) method. The appropriate interpolation technique depends on the data and the
desired output used for DEM when conducting certain research (Stereńczak et al.
2016). Interpolation is the technique of predicting values at unsampled sites from
measurements made at point locations within the same area. In general, interpolation
consists of two types which are deterministic and geostatistical interpolations. Deter-
ministic interpolation creates surface based on measured points but does ignore any
spatial process occurred. However, geostatistical interpolations estimate the surface
values between known values and predicted values using the statistical approaches
(Liu and Zhang 2007).
Nevertheless, there are several factors that are able to affect the quality of DEM.
The basic LiDAR errors can be determined by few modules consisting of surveying
error, LiDAR system measurements uncertainty, interpolation errors and horizontal
displacement malfunction (Bater and Coops 2009). In geomorphometry research,
good quality DEM is the basis as small errors in DEM elevation values can produce
large errors in the result maps (Szypuła 2016). The available methods that include
the very high resolution of ground-based or air-borne automatic laser scanner are
suitable for small areas, while the conventional topographic surveys with centimetre
31 Data Verification of LiDAR-Derived DEM from Different … 363
accuracy and use of existing maps are appropriate for large area (Darboux and Huang
2003). It is also proved that the quality of distribution errors in DEM was strongly
related to interpolation algorithm (Szypuła 2016).
Therefore, the study intent to verify the accuracy of generated LiDAR DEM is
based upon different interpolation techniques used. From that, the final results will
show how different interpolation methods influence the accuracy of DEM creation.
Various interpolation techniques have been implemented on geospatial application
for surface generation from point clouds data such as IDW, Kriging and Spline
where it generates by using geostatistical analyst tool in ArcGIS environment. As
by using LiDAR and Total Station that have been broadly used in GIS works, a few
researchers are still discovering which interpolation method is precise on discrete
points with respect to different types of area such as mixed, hilly and flat terrain
(Ashraf et al. 2017). Hence, LiDAR data used different interpolation methods (IDW,
Kriging and Spline) and compared the DEM surface with reference to GPS obser-
vation. The study is implemented on hilly area of UiTM Shah Alam where various
interpolation methods are compared together in terms of elevation accuracy and
visual representation.
First, the visual presentation is analysed with maximum and minimum elevation on
each method. Second, assessment of the vertical and horizontal accuracy of LiDAR-
derived DEM was done by comparing the x, y and elevation obtained corresponding
to the ground control points (GCPs) so that the RMSE can be calculated. Next,
assessing of the vertical (z) or elevation accuracy of LiDAR-derived DEM based on
various number of searching neighbourhood and RMSE was performed. The study
also wants to know how well each model predicts the values at unknown location by
using the best prediction tools of geostatistical analyst tool in ArcGIS software by
removing the unwanted data and continue to predict the data at the locations with
mathematical computation. The calculated statistic was then able to indicate whether
the model with its parameter values is reasonable or not.
31.2 A Review of LiDAR DEM
Nowadays, LiDAR has been the most preferred approach to use DEM that is cru-
cial in environmental surveying and planning applications. Besides, various studies
were conducted to determine the accurateness of LiDAR data with diverse physical
environment and any other external factors that will give an influence to the quality
of DEM or DTM such as land use, land cover type and land forms (Garófano-
Gómez et al. 2011). DEM is represented as bare earth surface of earth and selected
as data structures for storing various forms of topographic information and under-
goes interpolation process to formed surface with values of entire points (Brovelli
and Cannata 2004). DEM represents an array of squared cells or pixel with an ele-
vation value associated to each pixel and obtained from various sources such as
contour line, topographic maps, ground surveys, photogrammetry techniques, radar
interferometry and laser altimetry.
Previous researches had shown that the significant effects on the accuracy of
LiDAR-derived DEM are topographic variability, LiDAR sampling density, interpo-
lation methods and spatial resolution (Guo et al. 2010). However, they most focus on
coarse resolution DEM more than 1m and examine two of influencing factors. In the
study, the topographic variability factor has become the main source of uncertainties
for DEM production and used 20 data sets with different topographic characteris-
tics to generate DEM and estimated the interpolation errors. Coefficient of variation
(CV) was used to measure the topographic variability, as CV strongly correlated
with the slope. Various interpolation techniques are applied to generate DEM at
different number of resolution. The accuracy of DEM was different depending on
spatial resolution and interpolation methods. Different type of surface areas such as
vegetation structure also play an important role in LiDAR accuracy. Hodgson et al.
(2005) obtained higher RMSE in area with tall vegetation as the control points mostly
constrained to the paved areas which resulted in an underestimate of the instrument
error.
Meanwhile, it is impossible to measure all true values and compute all errors
when dealing with continuous surfaces representation in GIS. Thus, the true value
should be estimated or predicted from suitable interpolation methods. Besides, it is
also not possible to measure true elevation from ground because of time-consuming
and accessibility. Therefore, the accuracy of predicted values should be accessed and
verified.
31.3 Study Area
The study area is located in UiTM Shah Alam, Selangor (see Fig. 31.1). The area
is covered mainly with various features, for instance, buildings and trees. This area
is considered as hilly area. The LiDAR data were collected on May 2018 and the
data were provided in the LAS format of three-dimensional point clouds. The average
density of LiDAR points cloud data sampling across the area is about 1 point per meter
square and covered the area within 1 km2 . Ground survey data is collected by using
GPS observation technique and the total collected GCPs were 31 points. The total
number of 31 GCPs is good enough which exceed the minimum of 20 checkpoints
as recommended by American Society for Photogrammetry and Remote Sensing
(ASPRS) and Inter-Governmental Committee on Surveying and Mapping (ICSM).
The observation of sample data is distributed evenly and cover throughout the study
area.
Fig. 31.1 Map of study area (UiTM Shah Alam)
31.4.1 Methodology
Flowchart of the methodology consists of four phases, as shown in Fig. 31.2. The
initial stage covers the procedure of reconnaissance survey where the study area
is in UiTM Shah Alam. The next phase is data acquisition. In this phase, LiDAR
and GPS data are acquired. The third phase is data processing where LiDAR point
clouds data were extracted into two different models, which are ground (DEM)
and non-ground (DTM) by using automatic and manual classification across the
study area. Further improvement in the quality of data classification is performed by
manual checking and editing. Then the LiDAR data undergo DEM generation with
different interpolation techniques using geostatistical analyst tools in ArcGIS. After
that, cross validation is performed to evaluate the model in geostatistical analyst
tools. For the purposes of predicting data value at the point location, geostatistical
analyst eliminates one data point at a time and it uses the remaining data points for
interpolation process. Lastly, the predicted values are compared to the actual values
at the location of eliminated data point to measure the performance of interpolation
techniques.
Fig. 31.2 Flowchart of the methodology
31.4.2 Data Processing
The classification of LiDAR points is the initial step of LiDAR data processing and
able to handle in proper way since the DEM generation directly uses the classification
point clouds. The different classification method can be seen in recent researches and
for this study automatic classification was conducted. The automatic classification
of buildings, ground and non-ground class was done using Global Mapper software.
Fig. 31.3 Classification process in global mapper software
The unclassified points will reclassify manually so that the DEM generation can
be run smoothly. Figure 31.3 shows the classification process in Global Mapper
software. By using path profile tool, the unclassified of point cloud were manually
selected and changed to appropriate class such as ground, building or vegetation.
The reclassification process was done to make sure the next DEM generation will
run smoothly and to avoid unexpected error.
Based on the several previous studies, the results of DEM creation using differ-
ent filtering methods and software used tend to perform well in flat terrain. Com-
plex terrains like urban area, steep forest terrain or river channel are hard to filter
(Montealegre et al. 2015). The types of errors are predominantly large when char-
acteristics of the topographic surface traditionally used to discriminate non-ground
from similar magnitude to morphological features (Faux et al. 2009).
31.4.3 Interpolation Techniques
LiDAR is an effective tool in providing high resolution and high accuracy DEM for
a large area. The output of LiDAR technique is a huge point cloud data that needs
to be filtered and interpolated so that the end users can get a generated continu-
ous surface for any purposes. The choice of interpolation performs a vital function
for determining the best of LiDAR-derived DEM (Bater and Coops 2009). One of
the interpolation techniques used in this study is Kriging. Kriging technique can
be defined as a geostatistical interpolation method that used variogram where it
depends on the spatial distribution of data rather than on actual values. The technique
is purely used to produce DEM from ground control data because of its broad per-
formance. Kriging estimates of the direction or distance between the sample points
reflect a spatial correlation that can be used to describe variation in the surface
(Ismail et al. 2016). This basically is a weighted average method but its weight
depends not only on the distance between sample points and predicted locations but
also on the mutual distances among sample points (Ismail and Jaafar 2013).
However, Spline interpolation technique assumes values using a mathematical
function that minimizes the total surface curvature and fits a flexible surface that
result in a smooth surface as it was stretching like a rubber sheet across all the
known point values. The stretching effect is able to estimate values that are below
the minimum or above the maximum values found in the sample data. The limitation
of Spline interpolation is where it does not work well when the sample points are close
together and have extreme differences in value. This is due to Spline interpolation
uses slope calculation or change over distance to estimate the shape of the flexible
rubber sheet. Besides, the advantages of Spline interpolation are that it can produce
adequate accurate surfaces from only a few sampled points and they preserve small
features. A weakness is that they may have different minimum and maximum values
compared to the data set and the functions are sensitive to outliers due to the inclusion
of the original data values at the sample points.
Additionally, inverse distance weighted (IDW) is a deterministic and exact inter-
polator. The assigned weight of IDW depends on the distance of measured values
from prediction location. The closer the measured value to the prediction, the greater
the influence on the predicted value than those are far away (Asal 2016). Besides,
IDW is used when the points are dense enough to capture the extent of local sur-
face variation needed for analysis. This technique determines cell values using a
linear-weighted combination set of sample points. It weights the points closer to
the prediction location greater than those farther away, hence the name inverse dis-
tance weighted (Amante 2012). Like Kriging, IDW uses a weighted average where
the outside range of maximum and minimum sample point value is not estimated.
Therefore, some topographical features are hard to generate such as valley and ridges
unless they have been sampled.
In conclusion, both Spline and IDW techniques are deterministic that create
surface based on the similarity of the sample and degree of smoothing. However,
Spline passed exactly through measured points, while IDW will pass through none
of the points and Kriging is geostatistical that uses advance and powerful statistical
technique for assuming value.
31.4.4 Root Mean Square Error
The prediction of horizontal and vertical values from LiDAR-derived DEM is auto-
matically generated in an attribute table with the resultant error. The error computed
from LiDAR-derived DEM was opened using Microsoft Excel software, as shown
in Fig. 31.4, for vertical accuracy assessment (elevation). The elevation values are
from the ground truth data (GCPs) while predicted values are elevation from LiDAR-
derived DEM. The RMSE were calculated using the formula as shown below. This
calculation is repeated on each interpolation method used.
Fig. 31.4 RMSE results for Z (elevation) values

2
Zi − Zj
RMSE = (31.1)
n
where
Z i elevation from the LiDAR point clouds
Z j elevation from GPS observation points
n total number of points
This section presented the data and required result of data classification from LiDAR-
derived DEM by ArcGIS, RMSE resultant values from different interpolation tech-
niques, RMSE result of elevation on interpolation methods with different search-
ing neighbourhood, result of different interpolation techniques in three-dimensional
views; all the results were analysed and discussed.
31.5.1 Results of Data Classification from LiDAR DEM
The classification of LiDAR points cloud was generated in Global Software as it

is able to conduct automatic and manual classification smoothly. The statistic of
raw LiDAR data before conducting automatic and manual classification in Fig. 31.5
stated the 1,002,996 points cloud that are unclassified yet. Besides, the minimum and
maximum of z-value obtained are 6.71 and 143.80 m. After classification process,
there are 509,719 of ground point clouds generated, 313,968 of high vegetation and
159,696 is buildings. The remained of 19,610 point clouds is unclassified.
Fig. 31.5 Results of data classification from LiDAR derived DEM

31.5.2 RMSE Values from Different Interpolation Techniques
Table 31.1 indicates the results for RMSE of x, y and z values for the DEM and
Fig. 31.6 highlights the bar chart of the RMSE value towards horizontal and vertical
accuracy (x, y and z) from DEM LiDAR creation.
From this RMSE result of x-value in Fig. 31.6a, Spline obtains 0.0124 m, Kriging
was 0.0357 m and IDW was 0.1120 m. For y-value in Fig. 31.6b, Spline obtains
0.0402 m, Kriging was 0.0845 m and IDW was 0.0444 m. Both parameters (x, y)
show that Kriging produced better accuracy compared to Spline and IDW. However,
Tan and Xu (2014) concluded from their experiment on terrain modelling that IDW
gave a better surface model in terms of accuracy than Spline or Kriging. Whereas,
for z value in Fig. 31.6c, Spline obtained RMSE of 0.2135 m, Kriging of 0.2141 m
and IDW of 0.2276 m. These results are slightly similar with Ikechukwu et al. (2017)
that found Spline provides a more accurate surface model for elevation followed by
IDW and Kriging. Generally, the overall result from this study indicates that Krig-
ing method produced more accurate DEM, but was computationally intensive and
time-consuming process. IDW and Spline were simple and better in DEM genera-
tion, but their performance was less than Kriging method. Kriging was an advanced
geostatistical procedure that quantifies the spatial variation by using semivairogram
that computed from the input point data set. However, IDW performance was low
in Fig. 31.6c for elevation error which makes Kriging techniques good for elevation
error at this study area.
Table 31.1 RMSE value of

Method X (m) Y (m) Z (m)
LiDAR DEM
Kriging ±0.0357 ±0.0402 ±0.2135
Spline ±0.0124 ±0.0845 ±0.2141
IDW ±0.1120 ±0.0444 ±0.2276
Fig. 31.6 Results of Validation data a Easting, x values, b northing, y values and c elevation,
z values
Table 31.2 RMSE of Z

Search neighbour Method RMSE
values with different
searching neighbourhood Maximum = 8 Kriging ±0.163
Minimum = 7 Spline ±0.208
IDW ±0.206
Maximum = 4 Kriging ±0.207
Minimum = 3 Spline ±0.212
IDW ±0.208
31.5.3 RMSE of Elevation on Interpolation Methods

with Different Searching Neighbourhood
Table 31.2 shows two types of result conducted by using different search neighbour-
hood in DEM generation. Local interpolation uses sample of known point as it is
crucial to select the sample. The number of points might assume that with more
points will result in accurate LiDAR estimates. Thus, the validity of the assumption
depends on the distribution of known point relative to the cell to be estimated, the
extent of spatial autocorrelation and the guilty of the data (Gallay et al. 2013). The
first was by using maximum of 8 and minimum of 7 of searching neighbourhood
surrounding the predicted point. Second, maximum of 4 and minimum of 3 searching
neighbourhood points were used. The value of RMSE of first result by using Kriging
method was obtained as 0.163 m, Spline was 0.208 m and IDW was 0.206 m. For
the second result, Kriging obtained was 0.207 m, Spline was 0.212 m and IDW was
0.208 m.
From the overall result shown in Table 31.2 it was observed that there was not
much significant difference in selecting different number of searching neighbour
as for Kriging; the difference was 0.044 m lower after number of neighbourhood
increased. The same goes to Spline method where it decreased to 0.004 m as the
number of neighbourhood increased. For IDW, the result showed the increase in
accuracy after increase in the neighbour of 0.002 m. As conclusion, Kriging, IDW
and Spline show the increase in DEM accuracy after more neighbourhood points
are selected during interpolation. These results matched with experimental study by
Ikechukwu et al. (2017), which found that the accuracy of IDW, Kriging and Spline
are increasing or decreasing depending on neighbourhood size.
31.5.4 3D View of Different Interpolation Techniques
The following figures show the three-dimensional presentation of LiDAR-derived

DEM based on Fig. 31.7a for Kriging, Fig. 31.7b for Spline and Fig. 31.7c for
IDW of the relief distribution and characteristic of land form. These three DEMs
were compared with each other visually. As can be seen in the result, the overall
Fig. 31.7 Three dimensional of a Kriging technique, b Spline technique and c IDW technique
spatial distributions of the terrain relief are similar. But there are small differences of
elevation in each generated DEM. The IDW method shows minimum and maximum
elevation of 6.738 and 76.858 m, whereas Kriging obtains maximum and minimum
elevation of 6.681 and 76.932 m and Spline obtained 6.77 and 77.083 m of minimum
and maximum elevation value. Spline method shows the highest elevation produced,
77.083 m and Kriging obtained the lowest elevation of 6.681 m. Besides, Kriging
shows more detail surface. Hence, for visual analysis, good surface representation
makes the better details of the terrain surface.
31.6 Conclusions
The study was conducted to identify the accuracy of generated LiDAR DEM based
upon various interpolation techniques using the geostatistical tools in ArcGIS soft-
ware and to compare the DEM generated by different interpolation methods against
the number of searching neighbourhood and RMSE value obtained. The results of
RMSE (x, y, z) met the requirement of LiDAR accuracy between 0.2 and 0.3 m (Idris
et al. 2012). The analyses have been done by evaluating LiDAR data with reference
to GPS through different searching neighbourhood and RMSE of elevation value.
Based on the results of RMSE (z) using different interpolation techniques, it can be
concluded that Kriging (0.2135 m) technique gives better results of DEM generated
compared to Spline (0.2141 m) and IDW (0.2276 m). Hence, the results found that
the capability of LiDAR data with high accuracy is proved. The knowledge of the
source of data may therefore be of importance in the choice of interpolation method
(Ikechukwu et al. 2017).
References
Amante CJ (2012) Accuracy of interpolated bathymetric digital elevation models. Geography

Graduate Theses & Di
Asal FF (2016) Evaluating the effects of reductions in lidar data on the visual and statistical character-
istics of the created digital elevation models, pp 12–19, 2016. https://doi.org/10.5194/isprsannals-
III-2-91-2016
Ashraf I, Hur S, Park Y (2017) An investigation of interpolation techniques to generate 2D intensity
image from LIDAR data 3536(c). https://doi.org/10.1109/ACCESS.2017.2699686
Bater CW, Coops NC (2009) Evaluating error associated with lidar-derived DEM interpolation.
Comput Geosci 35:289–300. https://doi.org/10.1016/j.cageo.2008.09.001
Brovelli MA, Cannata M (2004) LIDAR data filtering and DTM interpolation within GRASS
8(2):155–174
Darboux F, Huang C (2003) An instantaneous-profile laser scanner to measure soil surface
microtopography. Soil Sci Soc Am J 67(1):92. https://doi.org/10.2136/sssaj2003.9200
Faux RN, Buffington JM, Whitley MG, Lanigan SH, Roper BB (2009) Use of airborne near-infrared
LiDAR for determining channel cross-section characteristics and monitoring aquatic habitat in
Pacific northwest rivers: a preliminary analysis. In: PNAMP special publication: remote sensing
applications for aquatic resource monitoring. Pacific Northwest Aquatic Monitoring partnership,
Cook, WA, pp 43–60
Gallay M, Lloyd CD, McKinley J, Barry L (2013) Assessing modern ground survey methods and
airborne laser scanning for digital terrain modelling: a case study from the Lake District, England.
Comput Geosci 216–227. https://doi.org/10.1016/j.cageo.2012.08.015
Garófano-Gómez V, Martínez-Capel F, Peredo-Parada M, Marín EJO, Mas RM, Costa RMS,
Pinar-Arenas JL (2011) Assessing hydromorphological and floristic patterns along a regulated
Mediterranean river: The Serpis River (Spain). Limnetica 30(2):307–328. https://doi.org/10.
1002/rra
Guo Q, Li W, Yu H, Alvarez O (2010) Effects of topographic variability and lidar sampling density
on several DEM interpolation methods. Photogramm Eng Remote Sens 76(6):701–712. https://
doi.org/10.14358/PERS.76.6.701
Hodgson ME, Jensen J, Raber G, Tullis J, Davis BA, Thompson G, Schuckman K (2005) An
evaluation of lidar-derived elevation and terrain slope in leaf-off conditions. Photogramm Eng
Remote Sens 71(7):817–823. https://doi.org/10.14358/pers.71.7.817
Idris R, Latif ZA, Jaafar J, Rani NM, Yunus F (2012) Quantitative assessment of LiDAR dataset for
topographic maps revision. In: International conference on system engineering and technology
(ICSET 2012), pp 1–4. https://doi.org/10.1109/icsengt.2012.6339288
Ikechukwu MN, Ebinne E, Idorenyin U, Raphael NI (2017) Accuracy assessment and compara-
tive analysis of IDW, Spline and Kriging in Spatial interpolation of landform (topography): an
experimental study. J Geogr Inf Syst 9:354–371. https://doi.org/10.4236/jgis.2017.93022
Ismail Z, Jaafar J (2013) DEM derived from photogrammetric generated DSM using morpholog-
ical filter. In: Proceedings—2013 IEEE 4th control and system graduate research colloquium,
ICSGRC 2013, pp 103–106. https://doi.org/10.1109/ICSGRC.2013.6653284
Ismail Z, Khanan MFA, Omar FZ, Rahman MZA, Salleh MRM (2016) Evaluating error of lidar
derived dem interpolation for vegetation area, XLII(October):3–5. https://doi.org/10.5194/isprs-
archives-XLII-4-W1-141-2016
Liu X, Zhang Z (2007) The effect of LiDAR data density on DEM accuracy. In: International
congress on modelling and simulation (MODSIM07), pp 1363–1369. http://eprints.usq.edu.au/
3781
Montealegre AL, Lamelas MT, De La Riva J (2015) A comparison of open—source LiDAR filtering
algorithms in a mediterranean forest environment. IEEE J Sel Top Appl Earth Obs Remote Sens
8(8):4072–4085. https://doi.org/10.1109/JSTARS.2015.2436974
Rizeei HM, Pradhan B (2018) Extraction and accuracy assessment of DTMs derived from remotely
sensed and field surveying approaches in GIS framework. In: IOP conference series: earth and
environmental science, vol 169
Stereńczak K, Ciesielski M, Bałazy R, Zawiła-Niedźwiecki T (2016) Comparison of various algo-
rithms for DTM interpolation from LIDAR data in dense mountain forests. Eur J Remote Sens
49:599–621. https://doi.org/10.5721/EuJRS20164932
Szypuła B (2016) Geomorphometric comparison of DEMs built by different interpolation methods.
Landf Anal 32:45–58. https://doi.org/10.12657/landfana.032.004
Tan Q, Xu X (2014) comparative analysis of spatial interpolation methods. Sens Transducers
165:155–163
Chapter 32
An Application of Presumptive Diagnosis
for Urinary Tract Infection via kNN
Algorithm Approach
Muhammad Nabil Fikri Jamaluddin, Siti Norfahana Abdul Malik,

Shukor Sanim Mohd Fauzi, Tajul Rosli Razak, Iman Hazwam Abd Halim,
Abdul Hapes Mohammed and Ray Adderley JM Gining
Abstract Urinary tract infection (UTI) is a disease related to infection of the urethra,
bladder, ureters, or the kidneys. That comprises the urinary tract caused by pathogenic
organisms such as bacteria, fungi, and parasites. Diagnosing the UTI in preliminary
stages requires experts in a related field where it can be detected clinically. This paper
presents the configuration evaluation by the k-nearest neighbors (KNN) approach,
that is, to find the best value of k that classifies with the highest accuracy. The
approach is then used to build a simple application with a user interface for the
diagnosis of UTI disease, whether cystitis, pyelonephritis, both, or no infection.
Moreover, the application is implemented using the JAVA programming language,
and the diagnosis is established based on six symptoms. That is, the temperature
of the patient, occurrence of nausea, lumbar pain, urine pushing, micturition pains
and burning, itch or swelling of urethra outlet which affected the patient. The result
indicates that the algorithm performed best with 97.4% accuracy when applying
M. N. F. Jamaluddin (B) · S. N. A. Malik · S. S. M. Fauzi · T. R. Razak · I. H. A. Halim ·

A. H. Mohammed · R. A. J. Gining
Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, 02600 Arau,
Malaysia
e-mail: nabilfikri@uitm.edu.my
S. N. A. Malik
e-mail: fahanamalik@yahoo.com
S. S. M. Fauzi
e-mail: shukorsanim@uitm.edu.my
T. R. Razak
e-mail: tajulrosli@uitm.edu.my
I. H. A. Halim
e-mail: hazwam688@uitm.edu.my
A. H. Mohammed
e-mail: hapes@uitm.edu.my
R. A. J. Gining
e-mail: ray_adderley@uitm.edu.my

378 M. N. F. Jamaluddin et al.
the suggested value of k = 6. This also gives insight into the performance of an
application developed, with the ability to classify UTI-related disease correctly.
Keywords k-Nearest neighbors · Urinary tract infection · Classification
32.1 Introduction
Urinary tract infection (UTI) is a disease related to infection of urethra, bladder,

ureters, or the kidneys, which comprises the urinary tract caused by pathogenic
organisms such as bacteria, fungi, and parasites (Komala et al. 2013). The disease
is infectious across various age range from infant, toddlers (Millner and Becknell
2019), young adults (Tan and Chlebicki 2016), pregnant women (Schmiemann et al.
2010), older adults (Rowe and Juthani-Mehta 2013), and kidney transplant recipients
(Glover and Sheerin 2019). The risk factors for UTIs include any condition that may
slow down the urine flow; for example, enlarged prostate, inherited urinary tract
abnormalities, and inflammation (Komala et al. 2013). Its complication may lead
to pyelonephritis that requires hospitalization and can cause permanent damage on
renal (Chu and Lowder 2018). UTI is classified into lower and upper urinary tract
infection, where the lower infection involves bladder and urethra, while the upper
infection involves kidney and pelvis ureter (Loh and Nalliah 2007). The disease
can cause problems that range from dysuria (pain, burning when urinating) to organ
damage and even death (Komala et al. 2013).
The process of diagnosis in medical is a complicated task even for experienced
doctors due to confusing, inconsistency, and insufficient information obtained from
patients. Most of the diagnosis procedure is carried out only by expertise which
is doctor. Usually the diagnosis procedure cannot be done without the presence of
expertise in specific domain (Khan et al. 2013). Accurate diagnosis is required to
provide precise treatment, which is suitable for the disease; otherwise, incorrect
treatment if given might worsen the patient’s condition. Continuous assessment of
UTI patients requires iteration of procedure, where in each iteration, diagnosis might
be reconfigured, refined, or rejected (Khan et al. 2013).
This paper presents an application of k-nearest neighbors (kNN) algorithm to
automatically diagnose the UTI diseases. The prediction is based on symptoms, such
as high temperature of patient, occurrence of nausea, lumbar pain, urine pushing,
micturition pains and burning of urethra, itch or swelling of urethra outlet, which
affected the patient in preliminary stages.
The rest of the paper is organized as follows: Sect. 32.2 discusses the background
of urinary tract infection, k-nearest neighbors, and the related works. This is fol-
lowed by Sect. 32.3 that introduces the k-nearest neighbors approach. Section 32.4
presents the experimental works which consist of two key parts that include: (i) the
configuration of the k-nearest neighbors, that is, to find the best value of k; and (ii)
the KNN approach then will be used to automatically diagnose the UTI diseases.
Finally, Sect. 32.5 presents the conclusion and future works.
32 An Application of Presumptive Diagnosis for Urinary … 379
32.2 Background
In this section, the background in respect to the urinary tract infection and k-nearest
neighbors is briefly described.
32.2.1 Urinary Tract Infection
According to Kidney and Urology Foundation of America (KUFA), several diseases

can be related to urinary system, in which one of them is UTI. The disease is caused by
the infection of pathogenic organisms such as bacteria (Escherichia coli), fungi, and
parasites in urinary tract that includes kidneys, ureters, bladder, and urethra (Komala
et al. 2013). The infection is as a result of the presence of pathogenic microorganism
in urinary tracts which causes a symptomatic inflammation as signified by pyuria,
while the presence of bacteria in urine is defined as bacteriuria. The colonization or
asymptomatic bacteriuria (ABU) is the presence of bacteria without pyuria (Millner
and Becknell 2019). Anatomically, the urinary tract can be classified into two, which
are known as lower urinary tract that consists of bladders and urethra, while upper
urinary tract consists of ureters and kidneys (Mahadevan 2016).
Acute cystitis or inflammation of the bladder in lower urinary tract is often caused
by a bacterial infection which has a direct effect on bladder function. Signs to this
problem include a strong push to urinate frequently, burning feeling during urina-
tion, passing small or frequent amounts of urine, low-grade fever, cloudy or strong-
smelling urine, blood in the urine, pelvic area discomfort, and pressure in the lower
abdomen (Mehnert-Kay 2005). Acute pyelonephritis is caused by an inflammation
of the kidneys which is upper urinary tract. This inflammation usually results from
bacterial infection of the bladder (cystitis). Symptoms of acute pyelonephritis typi-
cally include fever, burning or frequent urination, aching pain on one or both sides
of the lower back or abdomen, cloudy or bloody urine, low energy, nausea, and diar-
rhea. Untreated pyelonephritis can lead to a chronic condition that may damage and
possibly lead to loss of kidney function (Car 2006).
The disease is infectious across various age ranges. Owing to anatomy, females
have higher risks compared to males (Komala et al. 2013). House patients with
catheters having undergone urinary surgery and men with enlarged prostates are
also potentially to be infected (Komala et al. 2013). UTI can be categorized into
uncomplicated and complicated where the uncomplicated UTI is detected for the
presence or absence of bacteriuria in urine, while complicated UTI is classified for
patients with abnormal anatomy and functions of urinary tract (Millner and Becknell
2019; Glover and Sheerin 2019).
There are many complications that resulted from UTI, where usually patients
display the symptoms of dysuria, urinary frequency, urinary urgency, and/or supra-
pubic pain. Patients with fever or costovertebral angle tenderness show the sign of
upper urinary tract involvement (Mehnert-Kay 2005). The effects of UTI may pose
serious risks which are caused by urosepsis, renal abscess formation, and acute kid-
ney injury that results in an acute morbidity and renal scars, followed by chronic
renal insufficiency, proteinuria, and hypertension, which may pose chronic risk of
morbidity (Millner and Becknell 2019). Various complications of UTI may include
dehydration, sepsis, kidney failure, and even death (Komala et al. 2013). Usually,
complication involving pyelonephritis requires hospitalization and if untreated may
cause a permanent renal damage (Chu and Lowder 2018).
Diagnosis is usually made based on symptoms presented, and precision of diag-
nostic is further improved by urinalysis (Glover and Sheerin 2019). The diagnosis at
laboratory level includes dipstick urinalysis, microscopic urinalysis, and urine culture
(Chu and Lowder 2018). Dipstick urinalysis is the most commonly used diagnostic
testing of urine (Schmiemann et al. 2010) due to availability and only takes minutes
for the result (Chu and Lowder 2018). This allows checking multiple components
such as leukocyte esterase (LE), nitrite, and red blood cells. LE is represented by
the presence of white blood cells (WBC) which raised during infection while nitrite
may indicate the presence of bacteria, and red blood cells might indicate probability
of UTI with detection of LE and nitrate (Chu and Lowder 2018). Usage of dipsticks
is not advisable for patients over 65 years as high false-positive rate makes the result
inaccurate (Glover and Sheerin 2019).
Microscopic urinalysis can be done manually or automated light microscopy
where the reason is to check the presence of leukocytes or bacteria (Chu and Lowder
2018). Urine culture is vital when the diagnosis is ambiguous for patients such as
children and elderly with severe, recurrent, or complicated infection (Glover and
Sheerin 2019). A presumptive diagnosis can be done based on history and clinical
examination when the common symptoms of UTI is present; however, the presump-
tive diagnosis is not advisable for patients with age >65 years as they may pose
delirium and may not present any common symptoms (Glover and Sheerin 2019).
32.2.2 k-Nearest Neighbors
k-Nearest neighbor (kNN) is a simple and easy to understand algorithm for solving
problems related to classification, regression, and pattern recognition (Song et al.
2017; Chen 2018). The idea behind this algorithm is objects that are closest to each
other belong to the same group posed by similar attributes (Khamis et al. 2014).
It is considered as lazy algorithm due to no generalization done and uses training
data during the testing phase (Song et al. 2017; Md Isa et al. 2017). Known as
instance-based learning, the non-parametric model memorizes the training data set
to perform classification (Md Isa et al. 2017). The population is a major concern in
kNN as the large population may affect the performance and requires extra memories
(Song et al. 2017). It is categorized as supervised learning algorithm that performs
its classification based on distance between classes in training data and testing data
(Giri et al. 2016).
Fig. 32.1 An example of kNN classification task with k = 5 Taken from (Cheng et al. 2014)
The similarity calculation is necessary for classification between the sample to be

classified, and the training sample data set obtains k nearest samples (Chen 2018).
kNN relies on distance metric in identifying the k nearest neighbors from query
points (Khamis et al. 2014). The purpose of distance metrics is to measure distance
between new sample and existing samples in data set (Md Isa et al. 2017). The
k-nearest neighbors from training set are considered and take majority vote as the
class and it should be in odd number to avoid ambiguity (Bablani et al. 2018). Label
belonging to these neighbors is taken as reference and assigned as a class to the
query point (Giri et al. 2016). The procedure is meant to group new sample or query
point based on most common or majority class among its k closest neighbors (Md Isa
et al. 2017). Figure 32.1 shows an example of kNN for given value k. Small positive
value integer is used for the value of k (Khamis et al. 2014), k = 5 represents the
classification of sample to nearest five neighbors (Md Isa et al. 2017).
Various formulas have been introduced to perform calculation and to find sim-
ilarity classes in kNN algorithm; this includes Euclidean, Mahalanobis, City-
block, Chebyshev, Minkowski, and standardized Euclidean (Chomboon et al. 2015).
Euclidean distance is the most common and popular distance calculation being used
in kNN (Khamis et al. 2014; Jabbar et al. 2013; Ahmed Medjahed et al. 2013). Dis-
tance between two points in space can be measured to find the similarity using the
formula (Giri et al. 2016). The Euclidean definition to calculate distance (d) of two
points in Cartesian coordinates is as follows (Md Isa et al. 2017):

n

d(x, y) = (xi − yi )2 (32.1)
i=1
where
• x train data set
• y query point or test data set
• n number of train set
Chomboon et al. carried out experiment on 11 distance metrics for evaluating

the difference in accuracy. The result shows that there is no difference in terms of
accuracy, and Euclidean distance is among the highest accuracy with other six metrics
(Chomboon et al. 2015). Kataria and Singh have the same results when the best
accuracy is obtained with the use of Euclidean distance and claims that the distance
metric has higher efficiency (Kataria and Singh 2008). Medjahed et al. stated that
the distance metric is effective in classification and performance, but in contrast it is
time-consuming classification (Ahmed Medjahed et al. 2013). The use of Euclidean
distance is common in kNN as being published by Chen to perform text categorization
(Chen 2018) and Bablani et al. use it to classify electroencephalography (EEG) data
into innocent and guilty (Bablani et al. 2018).
In general, kNN involves two main steps: (i) find the number of nearest neighbors;
and (ii) classify the data point into appropriate class (Bablani et al. 2018). The detailed
steps of kNN algorithm can be illustrated as in Algorithm 1.
Algorithm 1: K-nearest neighbors Algorithm [17].

Step 1: Determine the value of k.
Step 2: Compute the distance between each record of the training set and the
testing record.
Step 3: Sort the neighbors in the increasing order of the distances.
Step 4: Select the first k neighbors from the sorted list.
Step 5: Check for the class, that majority of the neighbors belong to and
assign that class to the training data
kNN algorithm has been applied in various fields such as text mining, agricul-
ture, finance, and medicine to solve problems related to classification and regression
(Imandoust and Bolandraftar 2013). Al-Sheri et al. compared k-nearest neighbors
with support vector machine (SVM) to predict students grade based on 16 features,
and the result shows SVM slightly outperforms kNN by 0.01 correlation coefficient
(Al-Shehri H 2017). The diagnosis of breast cancer carried out by Medjahed et al.
using kNN shows the promising classification accuracy (Ahmed Medjahed et al.
2013). Chen et al. proposed modified version of kNN, namely Quick kNN to allow
reduced number of samples and speed up the searches in text categorization (Chen
2018). Md Isa et al. and Bablani et al. applied kNN to classify signals in EEG using
various distance metrics (Md Isa et al. 2017; Bablani et al. 2018).
32.3 A kNN Approach
This section discusses methodology for the development of application which begins
with obtaining the data from UCI machine learning repository and its pre-processing,
k-nearest neighbor algorithm, user interface design, and process of developing the
application. The development for this project can be categorized into two parts.
Fig. 32.2 Proposed process flow of algorithm performance testing
32.3.1 Part 1: Configuration of the kNN
The first part of this approach is to purposely evaluate the performance of the
algorithm, as can be illustrated in Fig. 32.2.
Figure 32.2 shows the proposed process flow for performance testing purpose.
Initially, data set is obtained from UCI machine learning repository (“Acute Inflam-
mations Data Set”, 2009) website by contributors Czerniak and Zarzycki (Czerniak J
Zarzycki 2012). The data consists of six attributes which include discrete binary data
(occurrence of nausea, lumbar pain, urine pushing, micturition pains, burning, or itch
of urethra outlet) and continuous data (temperature of patient). Classes include cysti-
tis, pyelonephritis, both, or no infection. The data is converted into comma separated
value (.csv) file and simple filtering is carried out to remove duplicate instances of
attributes and its class. The data is then divided into train and test set where 60% are
used for learning purposes by the algorithm and remaining 40% are for evaluating
the performance of the algorithm. The same ratio is also applied to the available class
type.
k-Nearest neighbor (kNN) algorithm is used in this project to automatically clas-
sify whether the patient is infected with the disease classified as cystitis, pyelonephri-
tis, both, or not. Euclidean distance calculation is used to determine the nearest neigh-
bors available in train data set. For testing purposes, a few values of k are used; train
data set is prepared as a comparator associated with its classes, then the test data
set is fed as attributes to the algorithm to perform an automatic classification and
check its correctness. The number of correct classifications is counted and measured
as percentage of accuracy together with the value of k. From this testing, the optimal
value of k that classifies with highest accuracy is determined.
32.3.2 Part 2: Application on Diagnosis of the UTI Diseases

Based on the KNN
The second part of this approach is to illustrate the application on diagnosis of the
UTI disease based on the kNN, as can be described in Fig. 32.3.
Figure 32.3 shows proposed process flow in application perspective. A simple
application with user interface is developed to obtain input, which consists of six
Fig. 32.3 Process flow of the proposed application
attributes from user to be fed into kNN algorithm to determine its class. The applica-
tion used the optimal value of k, which results from testing, to perform classification.
Then, the distance with the train set is calculated to perform an automatic classifica-
tion and finally to determine whether the symptoms cause the cystitis, pyelonephritis,
both, or not. Whole development uses Java programming language with Eclipse IDE.
The first part of this project presented the testing where the purpose is to obtain
the optimal value of k from kNN algorithm. The initial work begins with data pre-
processing where redundant instances are removed. This results in total of 99 records
left. The number of instances according to classes, train set and test set, are divided
as in Table 32.1.
The results for testing can be depicted in Fig. 32.4 Various values of k are tested
to obtain the best classification accuracy. Note that in this paper, the value k is chosen
to be started with 6 due to similar accuracy obtained from the initial tests with values
of k = 2 until k = 6. For the purpose of trends observation and decreasing trends in
accuracy, the following test values of k in multiples of 6 are chosen. Random selection
is done if there is tied value in majority voting count. Among tests conducted, the
best accuracy is obtained when the value of k is 2 until 6 with 97.44% accuracy.
The higher the value of k, decreasing is the trend in classification accuracy. For the
purpose of application development in second part of this project, only one value of
k (k = 6) is chosen.
Table 32.1 The distribution of data sets according to classes of UTI diseases
Class All (100%) Train set (60%) Test set (40%)
Cystitis 30 18 12
Pyelonephritis 28 17 11
Both 16 10 6
Not infected 25 15 10
Classification performance based on value of k

Matched Not Matched
97.44%
84.62%
71.79%
58.97%
53.85%
46.15%
41.03%
28.21%
15.38%
2.56%
k=6 k=12 k=18 k=24 k=30
Fig. 32.4 Classification accuracy by comparing the different value of k
Figure 32.5 shows the application developed, which consists of simple interface
to receive inputs from the user. These inputs include patient’s temperature followed
by symptoms such as occurrence of nausea, lumbar pain, urine pushing, micturition
pain and feeling of burning, itching or swelling of urethra outlet. Once check button
is clicked, all the attributes are fetched from UI, converted into attributes, and passed
to kNN to perform the automatic diagnosis. The result of the diagnosis is displayed
to the user on the following UI depicted in Fig. 32.6. The diagnosis result should
suggest the classified disease, whether cystitis, pyelonephritis, both, or not infected;
consequently, this would assist medical staff to decide suitable treatment for the
patient.
Fig. 32.5 UI for requesting user inputs

Fig. 32.6 UI for displaying classification result
Clearly, the configuration on the kNN approach adopted in this paper is not unique,
and the other different strategies may be appropriate. Additionally, there are also other
classification techniques in diagnosis of the UTI disease that can be used. Therefore,
in this context, further work is required to find the best configuration of the kNN
approach and then comparing the classification accuracy with other classification
techniques.
32.5 Conclusion and Future Works
In conclusion, this paper has presented a way to configure the kNN approach. Next,
the kNN approach with the best configuration was used in application to perform
UTI diagnosis based on given symptoms to determine whether the patient is infected
by cystitis, pyelonephritis, both, or not infected. It is crucial for a diagnosis to be as
accurate as possible to provide a correct treatment for patients. Automatic classifica-
tion obtained 97.44% accuracy with a value of k = 6, which shows that the algorithm
is able to understand and find the relationships in the data set. Use of Euclidean dis-
tance calculation shows the promising results. The tests conducted show decreasing
trend in accuracy as the value of k is increasing. This project contributes medical staff
in efficient UTI diagnosis with the mentioned symptoms and helps sustainability in
diagnosis for accurate treatment.
Future research work will focus on enhancing the configuration of the kNN
approach, which can also be implemented to the other kNN approaches such as
adaptive, quick, and so on. Additionally, further work may also be undertaken to
improve the application on diagnosis of UIT disease by adding extra features, for
example, giving explanation feature for the suggestion diagnosis result.
References
Ahmed Medjahed S, Ait Saadi T, Benyettou A (2013) Breast cancer diagnosis by using k-Nearest
neighbor with different distances and classification rules. Int J Comput Appl 62(1):1–5
Al-Shehri H et al. (2017) Student performance prediction using support vector machine and k-
Nearest neighbor. Can Conf Electr Comput Eng 17–20
Bablani A, Edla DR, Dodia S (2018) Classification of EEG data using k-Nearest neighbor approach
for concealed information test. Procedia Comput Sci 143:242–249
Car J (2006) Urinary tract infections in women diagnosis and management in primary care. 332,
January
Chen S (2018) k-Nearest neighbor algorithm optimization in text categorization. IOP Conf Ser:
Earth Environ Sci 108(5)
Cheng D, Zhang S, Deng Z, Zhu Y, Zong M (2014) KNN algorithm with data-driven k value.
499–512
Chomboon K, Chujai P, Teerarassammee P, Kerdprasop K, Kerdprasop N (2015) An empirical study
of distance metrics for K-Nearest neighbor algorithm. 280–285
Chu CM, Lowder JL (2018) Diagnosis and treatment of urinary tract infections across age groups.
Am J Obstet Gynecol 219(1):40–51
Czerniak J, Zarzycki H (2012) Application of rough sets in the presumptive diagnosis of urinary
system diseases. In: Artificial intelligence and security in computing systems
Giri A, Bhagavath MVV, Pruthvi B, Dubey N (2016) A placement prediction system using k-Nearest
neighbors classifier. In: 2016 Proceedings of 2nd international conference on cognitive computing
and information processing, CCIP 2016, pp 3–6
Glover EK, Sheerin NS (2019) Urinary tract infection. Medicine 6–10
Imandoust SB, Bolandraftar M (2013) Application of k-Nearest neighbor (KNN) approach for
predicting economic events: theoretical background. Int J Eng Res Appl 3(5): 605–610
Jabbar MA, Deekshatulu BL, Chandra P (2013) Classification of heart disease using k-Nearest
neighbor and genetic Algorithm. Procedia Technol 10:85–94
Kataria A, Singh MD (2008) International journal of emerging technology and advanced engineering
a review of data classification using k-Nearest neighbour algorithm. Certif J 9001(6):354–360
Khamis HS, Cheruiyot KW, Kimani S (2014) Application of k-Nearest neighbour classification in
medical data mining 4(4):121–128
Khan IY, Zope PH, Suralkar SR (2013) Importance of artificial neural network in medical diagnosis
disease Like acute nephritis disease and heart disease. Int J Eng Sci Innov Technol (IJESIT)
2(2):210–217
Komala M, Bhowmik D, Sampath Kumar KP (2013) Urinary tract infection: causes, symptoms,
diagnosis and it’s management. J Chem Pharm Sci 6(1): 22–28
Loh KY, Nalliah S (2007) Urinary Tract Infections in Pregnancy. Malays Fam Physician 2(2):54–57
Mahadevan V (2016) Anatomy of the lower urinary tract. Surg (U K) 34(7):318–325
Md Isa NE, Amir A, Ilyas MZ, Razalli MS (2017) The performance analysis of k-Nearest neighbors
(k-NN) algorithm for motor imagery classification based on EEG signal. In: MATEC web of
conferences, vol 140, p 01024
Mehnert-Kay SA (2005) Diagnosis and management of uncomplicated urinary tract infections. Am
Fam Physician 72(3):451–456
Millner R, Becknell B (2019) Urinary tract infections. Pediatr Clin North Am 66(1):1–13
Rowe TA, Juthani-Mehta M (2013) Urinary tract infection in older adults. Aging Health 9(5):519–
528
Schmiemann G, Kniehl E, Gebhardt K, Matejczyk MM, Hummers-Pradier E (2010) The diagnosis

of urinary tract infection: a systematic review. DtschEs ArzteblT Int 107(21):361–367
Song Y, Liang J, Lu J, Zhao X (2017) An efficient instance selection algorithm for k nearest neighbor
regression. Neurocomputing 251:26–34
Tan CW, Chlebicki MP (2016) Urinary tract infections in adults. Singapore Med J 57(9):485–490
Chapter 33
The Investigation on the Implementation
of Industrialised Building System (IBS)
in Infrastructure Project: A Case Study
in Selangor
Juzailah Nur Yunus, Nur Atiqah Halim, Raja Nor Husna Raja Mohd Noor,
Nurol Huda Dahalan and Nor Janna Tammy
Abstract Infrastructure is one of the biggest and significant industries in Malaysia.

Proper management in infrastructure development will produce a high-quality prod-
uct. Many researchers move towards implementing the industrialised building system
(IBS) as a key that contributes to increasing the quality of construction projects. Thus,
to make sure the IBS method can contribute to a productive and efficient construc-
tion development process, good management is required. Therefore, the objective of
this study is to investigate how the implementation of IBS can ease the construction
management in infrastructure projects. The method of the study involved a literature
review and data collection through a survey questionnaire. The questionnaires were
distributed to the respondents involving professionals from the construction project.
Data gathered were analysed using Statistical Package for the Social Sciences (SPSS)
software. The results revealed that the majority of the construction players agreed
that site works can be reduced if IBS is implemented in the infrastructure project and
hence ease the construction management. Encouragement and full support from the
government undoubtedly helps to improve the usage of IBS and work productivity
in an infrastructure project in Malaysia.
Keywords IBS · Construction management · Infrastructure project
J. N. Yunus (B) · N. A. Halim · R. N. H. R. M. Noor · N. H. Dahalan · N. J. Tammy

Universiti Teknologi MARA, Cawangan Pulau Pinang, 13500 Permatang Pauh, Pulau Pinang,
Malaysia
e-mail: juzailah.nur@uitm.edu.my
N. A. Halim
e-mail: nuratiqahhalim94@gmail.com
R. N. H. R. M. Noor
e-mail: rajanorhusna@uitm.edu.my
N. H. Dahalan
e-mail: nurolhuda@uitm.edu.my
N. J. Tammy
e-mail: norjanna@uitm.edu.my

390 J. N. Yunus et al.
33.1 Introduction
The construction industry contributes to a substantial role in the infrastructure devel-

opment and economic sectors in Malaysia. The contribution from the public trans-
portation projects such as the Light Rail Transit (LRT) 3 project, Mass Rapid Transit
(MRT) and High-Speed Rail helps to improve economic productivity and the coun-
try’s revenue (Ching 2016). Malaysia is one of the South-East Asian nations that
budgeted to spend billions on infrastructure developments to further enhance the
country’s economy and to cater the people’s needs. The Ministry of Work Malaysia
announced that 20 new infrastructure projects with the value of RM5.26 billion will
be implemented in 2019 which will help to motivate Malaysia’s economy (20 new
infrastructure projects to be implemented this year-Baru Bian 2019). This means
that the construction industry must adapt a faster method with high productivity and
accelerate its implementation to succeed in those infrastructure projects. Since the
construction industry has been one of the sub-performers of productivity in Malaysia,
the government sees that the IBS method is an initiative to strengthen the construction
industry (CIDB 2019).
However, the IBS usage in Malaysia is still at a lower scale. According to the
Implementation Coordination Unit of Prime Minister’s Department (ICUJPM), the
adoption scale for IBS in government projects had achieved 70 IBS score hit 69.4%
in 2016 and the figure increased to 8.4% in 2017, giving a total of 1578 out of 2101
government projects adopting the IBS. In contrast, adoption in the private sector
stood at 35% as of January 2019, while the target set to be achieved by 2020 is
50% (CIDB 2017). The statistic comprises public projects that are for the residential
buildings and non-residential buildings, including infrastructure projects. Since the
infrastructure project is more complex than residential buildings, the integration of
IBS in the infrastructure projects will ensure that the projects can be managed easily
and improve productivity levels in the construction industry. Hence, this study was
initiated to investigate how the IBS can ease the construction management in the
infrastructure project.
33.2 IBS in Malaysian Construction Industry
The Malaysian government has encouraged the construction industry to move

towards industrialised building system (IBS) in order to implement an innovative
approach in the construction sector. The Malaysian construction industry is endur-
ing a transitional change from an industry employing the conventional method to
the latest technologies which are more systematic and mechanised. In Malaysia, the
industrialised building system (IBS) was initiated in the 1960s where it was focusing
on developing the residential buildings in order to fulfil Malaysian people’s needs
(Othuman Mydin et al. 2014). The conventional construction methods have not been
able to meet the demand because of their slow pace and higher cost. Other than
33 The Investigation on the Implementation … 391
that, via the IBS method, the cost for the labour workers can be reduced, speeds up
the completion of the project and provide smooth and good quality buildings (Badir
et al. 2002). The IBS system is necessary to be implemented when the construc-
tion requires speed accuracy and work that involves a lot of repetition. Generally,
the implementation of IBS may reduce the problems that occur in the construction
project since the components are manufactured in a controlled environment either
on-site or off-site. Then, the components are being transported to the site, positioned
and assembled into a structure with minimal work done on site (CIDB 2012).
CIDB Malaysia categorised IBS into five types:
a. Pre-cast concrete framing, panel and box systems, such as pre-cast columns,
beams, slabs, 3-D components (balconies, staircases, toilets, lift chambers),
permanent concrete formwork, and so on;
b. Steel formwork systems, such as tunnel forms, beams and columns moulding
forms, permanent steel formworks (metal decks), and so on;
c. Steel framing systems, such as steel beams and columns, portal frames, roof
trusses, and so on;
d. Pre-fabricated timber framing systems, such as timber frames, roof trusses,
weight block, and so on;
e. Block work systems, such as interlocking concrete masonry units (CMU), light
weight concrete blocks, and so on.
The CIDB has been actively promoting and facilitating IBS implementation in
Malaysia’s construction sector since 1998. The IBS Strategic Plan was launched, and
the IBS Steering Committee was established in the following year. Then, the Ninth
Malaysia Plan (9MP) 2006–2010, the IBS Roadmap 2003–2010, the IBS Roadmap
2011–2015 and the Construction Industry Master Plan (CIMP) 2006–2015 reaffirmed
the IBS agenda and further strengthened the CIDB’s efforts to accelerate achieving
all targets set (CITP Report No. 3 Q4 2017 2019).
Regardless of these intensive efforts and its abundant advantages, the usage of
IBS, especially in private construction projects, has still been way far from the levels
that have been observed in developed countries such as Thailand and Singapore.
Malaysia is evidently trailing behind as perhaps there are areas where the public is
still not convinced (CIDB 2019). The incomplete adoption of new technology and
modern methods of construction such as the industrialised building system (IBS)
and dependency on low-skilled workers are among the reasons for low productivity
performance. Currently, IBS continues to be the federal government’s focus area
apart from being chosen as one of the 21 initiatives under the Productivity Thrust
of the Construction Industry Transformation Programme (CITP) 2016–2020. The
first part of the IBS-specific initiative aims to extend further the IBS adoption in
government projects while accelerating IBS usage in private projects (CIDB 2019).
33.2.1 Benefits of IBS over Conventional System
Most of the construction industries still did not realise that IBS is the better alternative
for conventional construction method. The main benefits offered by IBS are:
High Quality of Products. IBS will provide high quality of products (Abidin
2007; Chong 2006; Kamar et al. 2012; Nawi et al. 2011). This is because all the com-
ponents are manufactured in a controlled environment where critical factors includ-
ing temperature, mix design and stripping time are being checked and monitored.
However, to compare with conventional method, the components are manufactured
in uncontrolled environment. IBS meets the common criteria of what constitutes as
a quality building due to factory-controlled environment, such as (MIDF Research
Malaysia 2014):
a. Built using high-quality components
b. Aesthetically pleasant and serves the purpose it was built for
c. Built in cost-effective and environmentally friendly way
d. It does not give problems to the owners such as leakage issues
e. Adaptable for future needs of the owners for renovation or extension works.
Cleaner and Safer Construction Site. Usage of IBS will automatically reduce the
using of machineries and raw materials (Abidin 2007). As the usage of machineries is
reduced, the safety at the sites will increase. This is because the usage of machineries
needs a proper handling; otherwise it may cause accident to happen. In conventional
system that requires more site works such as preparing formwork, preparing scaf-
folding and other construction works, IBS can provide cleaner sites due to (MIDF
Research Malaysia 2014):
a. Systematic storage and just-in-time material delivery
b. The reduce usage of raw materials at the worksite
c. When the building elements are prepared in a factory, it will reduce the waste
materials at the site
d. Reduce the usage of formwork and materials at the sites.
In conventional construction method, more complex activities can be done on-
site compared to IBS system. Therefore, it will increase the usage of raw materials,
formwork and other materials at the site. So, there will be an increase in the waste
materials because of these activities.
Faster Construction. Generally, through the IBS method, construction time can
be reduced due to advance off-site preparation and the process of installation is much
easier compared to the conventional methods. Implementation of IBS in construction
will help to save valuable time and reduce the risk of delay and losses (Abidin
2007). This is due to the reduction of site works such as formworks. Formworks are
done by mechanical equipment which is faster than manual method. The weather
in Malaysia is surprisingly unexpected. So, it will cause the project to delay and
will cause losses if the concrete materials cannot be used anymore. This is what
happens in conventional construction method. In contrast with IBS, the elements are
constructed in a closed place where it is not affected by the weather. The design
of IBS can begin while the site is still under survey and in the earthwork phase.
Therefore, it fastened the construction time. As an example, the average duration
for a complete house construction using IBS is approximately 3–5 months while the
conventional system normally takes up about 18 months (MIDF Research Malaysia
2014). That is large different construction time between using IBS and conventional
system.
Cost Savings. From the above benefits, the simplified construction process, an
increase in productivity, better quality and safety will help to reduce the cost of the
construction (Chong 2006; Kamar et al. 2012; Nawi et al. 2011).
Minimal Wastage. The wastage at the site, especially conventional timber form-
work, may be reduced by implementing IBS in the construction. This wastage causes
the cash flow to become higher because managing the wastage is a complicated pro-
cess, starting from the cost for the waste storage at the site, the cost for the trans-
portation and cost of the workers to dispose it. Construction waste must be disposed
in a proper way so that it will not harm the environment.
Simplified Construction Process. Simplified construction plus reduction of some
construction activities such as formworks can reduce the wastage and the cost of
construction. The implementation of IBS can reduce the wastage and consequently
will reduce costs by approximately 5–6% (MIDF Research Malaysia 2014).
Less Number of Unskilled Workers. The adoption of IBS also reduces the unskilled
workers in the construction industry where they were needed in the conventional
construction system. By reducing the number of unskilled workers, the quality of
overall construction may be enhanced and able to reduce the cost of the losses made
by the workers.
Reduce Site Services. In a conventional construction system, works like plastering,
concrete mixing and other on-site works increase the number of the workers at the
site, which may cause congestion of works. By applying IBS in construction process,
all the workers are no longer needed on-site but only in the IBS factory wherein all
the works can be done by a less number of people.
33.2.2 Infrastructure Project Development in Malaysia
Infrastructure projects commonly involve huge investment costs, but they are very
important to the country’s economic development. The focus of managing infrastruc-
ture projects is mainly on the management of the content of work, times, resources
and costs. The construction of a large infrastructure project may involve complex
process and many expert roles in the organisations which required good collabo-
ration and relations among the parties, such as the project owner, main contractor,
consultant, subcontractor, designer, supervisor, suppliers and workers. Infrastructure
projects normally involve the arrangement of an infrastructure building into environ-
ment which the success of the project depends, not only on the client and contractor
but to a large extent related to the environment. Infrastructure projects are partic-
ularly sensitive to the risk that might cause negative impact on the progress of the
project, particularly on the execution time, on the costs, and often on the quality
of the project deliverables (Rihar et al. 2018). A good construction management
with the involvement of new technologies could lead to successful completion of
infrastructure project.
33.3 Methodology
The research used literature reviews to gather information prior to the questionnaire
survey. Quantitative research which uses questionnaire techniques form among the
contractors that have implemented the IBS in the infrastructure project was used. The
selection of this method has been made due to time constraints. The questionnaire
form was structured in three sections: Section A consists of demographic data of
the respondents, section B determining respondents’ opinion on the success factors
involved in IBS project in terms of project management and section C figures out the
opinion on the process of IBS implemented in construction work. Table 33.1 shows
the Likert scale that has been used to quantify the respondents’ level of agreement. A
pilot study was conducted to ensure that the questionnaires are reliable and suitable
for the research.
A total of 100 survey questionnaires were handed to the contractors in Selangor
that had achieved a score of over 50% of IBS technology in their construction for both
public and private projects. This IBS score was chosen based on the IBS Roadmap
2003–2010 where the government has mandated that public projects will carry 70%
IBS content while in IBS Roadmap 2011–2015 promoted private sector to achieve
usage of 50% IBS content.
The data collected from the questionnaires were analysed to evaluate the respon-
dents’ perspective in bringing the IBS into infrastructure projects. All qualitative data
collected were computed into quantitative data for the measurement of the one-third
level of agreement. Frequency and ranking analysis by mean value were used via
Statistical Package for the Social Sciences (SPSS) software to compute the strength
of frequency and ranked agreements of specific questions.
Table 33.1 Likert scale

1 2 3 4 5
Strongly disagree Disagree Uncertain Agree Strongly agree
33.4 Findings and Discussion
33.4.1 Respondents’ Background
A total of 60 respondents had responded to the questionnaire. The analysis shows

that the majority of the respondents (46.7%) are the engineers followed by 20% of
the project managers, while 6% are assistant engineers and the rest are construction
managers, architect, surveyors and drafter. The results of respondents’ profile as
presented in Table 33.2 indicate that the respondent’s opinion is reliable and valid.
Table 33.3 presents the respondents’ years of experience in the IBS project. Out
of 60 respondents, 58.3% have experience in the IBS project for more than 5 years,
while 36.7% of respondents have experience between 1 and 5 years and only 5%
have experience less than 1 year.
Table 33.4 shows the frequencies of types of IBS that had been used in their
projects. The type of IBS mostly used among the respondents is pre-cast concrete
framing, panel and box system with a value of 70%. This type of IBS method is
widely used in Malaysia construction industry. Meanwhile, none of the respondents
used a timber framing system in their project.
Table 33.2 Respondents’

Items Profile Frequency Percentage (%)
profile
Position Construction 2 3.3
manager
Project manager 12 20.0
Engineer 28 46.7
Architect 1 1.7
Surveyor 2 3.3
Assistant 6 10.0
engineer
Drafter 1 1.7
Other 8 13.3
Table 33.3 Respondents’

years of experience
Experience Less than 3 5.0
5 years
1–5 years 22 36.7
More than 35 58.3
5 years
Table 33.4 Types of IBS used

Types of IBS used Pre-cast concrete framing, panel and box 42 70.0
system
Steel formwork system 5 8.3
Steel framing system 2 3.3
Timber framing system 0 0
Blockwork system 2 3.3
Others 9 15.0
33.4.2 Factors that Can Ease Construction Management
The factors of IBS could ease the construction management in the infrastructure
project, which were taken from the literature reviews as shown in Table 33.3. The
mean of each factor was calculated, and the ranking of these factors has been done
to determine the most effective success factor of IBS which could help to ease the
construction management in the infrastructure project.
From Table 33.5, the result obviously shows that IBS can reduce the works at
the site if the method is integrated into the infrastructure project. The reduction of
activities in the construction leads to the easier planning of resources. This is related
to the second higher success factor which is the adequacy of job site personnel. By
implementing IBS in the infrastructure project which is commonly very complex,
the number of personnel required in the project can be minimised. Consequently,
the cost of the losses from the site work reduces. In addition, the reduction of the
worker also will help to ease the construction management as the components were
Table 33.5 Ranking of the

Success factor of IBS Mean value Ranking
factors of IBS could ease the
construction management in Site work reduce 4.150 1
the infrastructure project Adequacy of job site personnel 4.067 2
among respondents
Project quality 4.050 3
Material quality 4.033 4
Site cleanliness 4.031 5
Environment effect reduce 3.950 6
Quality of workmanship 3.883 7
Equipment quality 3.850 8
Knowledge of the project 3.767 9
Project closeout 3.633 10
Adequacy of processing change 3.000 11
orders
Total cost reduces 2.667 12
produced at the factories. The management can reduce some of the cost for foreign
workers too, especially in managing their visa fees and leads to saving the cost for
the wages. Besides that, construction site wastes were reduced as the site works
were also reduced. The waste management will be easier since less in situ activ-
ities implemented on site. Therefore, the management team can focus to manage
the construction work in a proper manner. Research findings by Jaillon et al. (2009)
suggested for the use of fabrication construction with considerable benefits, such as
waste and time reduction, increase in quality, on-site safety and better construction
management through quality control. Overall, as per top five rankings, well managed
working environment comprising the minimal site works and personnel, tidier con-
struction site blends together with a high quality of project and material will highly
contribute to the successful implementation of IBS projects.
Apart from that, majority of the respondents do not agree with that the cost of the
projects can be reduced when IBS is implemented in the construction. A respondent
commented that the cost of the project had remained even though after proposing
IBS in the project. Nevertheless, the duration and the number of workers in the
construction have reduced by 15 and 30%, respectively. The reduction cost is not
achieved as claimed by previous researchers because of other factors need to be
considered in adopting IBS. According to the respondents, the cost for transportation
to the site is still high, including the cost of renting a trailer as the IBS components are
normally large and massive. Furthermore, the additional cost for the fuel to transport
the components is also needed to be counted in. Research done by Hanafi et al.
(2015) revealed that most IBS projects are primarily designed using the conventional
construction method, but then far along changed to IBS design. This has resulted in a
waste of time and cost to redesign and modify the initial plan. In addition, the cost of
high-quality machineries used to fabricate the component is also high. Consequently,
the total cost of the projects is higher when implementing IBS. When the cost of the
project increases, effective planning of resources is required in order to achieve
targeted cost, time and quality of the project.
33.5 Conclusions
Numerous evidences show that by using technologies such as IBS gives a reflective
impact on the construction industry where IBS can enhance many aspects in the con-
struction such as the level of productivity, quality, safety and enables construction
industry players to achieve better cost-effectiveness in the long run. All those aspects
are vital in developing infrastructure projects which are known as a high-cost invest-
ment and complex processes to be managed. The main challenge in implementing
the IBS is the lack of skilled personnel and training. The cost that can be reduced
unfortunately becomes higher than expected due to improper construction project
management in the initial phase. These issues contributed to the trend of the cost in
implementing IBS in the infrastructure project and should be considered in order to
ensure that IBS can be fully used in Malaysia. Thus, exposure and knowledge of IBS
which can help to ease the construction management for the infrastructure project
through course and training and as well as support from the government and related
agencies in the construction industry should be highlighted in achieving the project
objectives.
References
20 new infrastructure projects to be implemented this year-Baru Bian (2019) New Straits Time,
March 14. https://www.nst.com.my. Last accessed 1 Aug 2019
Abidin ARBZ (2007) Simulation of industrialised building system formation for housing construc-
tion. Master thesis, University Technology Malaysia, Unpublished
Badir YF, Abdul Kadir MR, Hashim AH (2002) Industrialized building systems construction in
Malaysia. J Arch Eng
Ching OT (2016) Infrastructure projects key catalyst. New Straits Time, January 29. https://www.
nst.com.my. Last accessed 25 June 2019
Chong LP (2006) Implementation strategy for industrialised building system. University Teknologi
Malaysia
CIDB (2012) Types of IBS. http://www.cidb.gov.my. Last accessed 9 Aug 2019
CIDB (2017) Annual report 2017: spearheading construction transformation. http://www.cidb.
gov.my. Last accessed 9 Aug 2019
CIDB (2019) Dynamism and sustainability through IBS: a cost-benefit analysis for the industrialised
building system industry in Malaysia. http://www.cidb.gov.my. Last accessed 25 June 2019
CITP Report No. 3 Q4 2017 (2019) http://www.citp.my. Last accessed 25 June 2019
Hanafi MH, Abdul Razak A, Abdullah S, Ismail R, Mohd Nawi, MN (2015) Contributing factors
of steel formwork usage in Malaysian construction industry: housing scheme. Adv Environ Biol
9(3):130–132. ISSN 1995–0756 (2015)
Jaillon L, Poon CS, Chiang YH (2009) Quantifying the waste reduction potential of using prefab-
rication in building construction in Hong Kong. Waste Manag 29:309–320. https://doi.org/10.
1016/j.wasman.2008.02.015. Last accessed 25 June 2019
Kamar KAM, Kamar M, Abd Z, Maria H, Mohd Z, Ahmad Z, Abd H et al (2012) Drivers and
barriers of industrialised building system (IBS) roadmaps in Malaysia. Malays Constr Res J
9:1–8 (2012)
MIDF Research Malaysia (2014) Construction IBS practical solution to rising cost. MIDF Research,
Kuala Lumpur
Nawi MNM, Lee A, Nor KM (2011) Barriers to implementation of the industrialised building
system (IBS) in Malaysia. Built Hum Environ Rev 4:22–35
Othuman Mydin MA, Md Sani N, Taib M (2014) Industrialised building system in Malaysia: a
review
Rihar L, Žužek T, Berlec T, Kušar J (2018) Standard risk management model for infrastructure
projects. Published: January 8th, 2019, https://doi.org/10.5772/intechopen.83389. https://www.
intechopen.com. Last accessed 1 Aug 2019
Chapter 34
Fuzzy Logic Water Quality Index
(FWQI) Model in Determining the Water
Quality Status of River in Penang Island
Siti Nor Nadrah Muhamad, Mohd Fazril Izhar Mohd Idris,

Nurul Izzati Husna Wahab and Wan Nurshazelin Wan Shahidan
Abstract The benchmark of water quality status of a river or any other water suppli-
ers is difficult to determine. Thus, it is essential to have a good model in determining
the status of water quality. The conventional water quality used by Development of
Environment (DOE) has some limitations, by which many researchers have devel-
oped and used varieties of water quality measurements, but the value of water quality
index (WQI) is still not accurate. In recent years, the methods of fuzzy logic have
been proved where it is suitable to deal with the vagueness in environmental issues.
Therefore, in this study, the development of a new index which is called the fuzzy
logic water quality index (FWQI) is proposed to determine the water quality status
of rivers in Penang Island, which are at Juru River, Pinang River and Dondang River
by using six parameters, namely dissolved oxygen (DO), biological oxygen demand
(BOD), chemical oxygen demand (COD), total suspended solid (TSS), ammoniacal
nitrogen (NH3 -N) and pH value. FWQI is a suitable model to be used in determining
the status of water quality since the overall rate of accuracy is high. The result from
this study shows that the status of the rivers for both stations at Juru River and Pinang
River are polluted, while the status is slightly polluted for Dondang River.
Keywords Fuzzy logic · Water quality status · WQI · FWQI
S. N. N. Muhamad (B) · M. F. I. M. Idris · N. I. H. Wahab · W. N. W. Shahidan

Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA Perlis Branch,
02600 Arau, Perlis, Malaysia
e-mail: nadrahmuhamad@uitm.edu.my
M. F. I. M. Idris
e-mail: fazrilizhar@uitm.edu.my
N. I. H. Wahab
e-mail: izzatina96@gmail.com
W. N. W. Shahidan
e-mail: shazelin804@uitm.edu.my

400 S. N. N. Muhamad et al.
34.1 Introduction
Water is the core of sustainable development and it is critical for socio-economic

development, healthy ecosystems and for human survival itself. It is also important
in reducing the global warming problem and improving the health, welfare and pro-
ductivity of population. There are many benefits of water and it is considered as
an important compound of element towards any species on our planet, not only for
human kind but also the heart for many sectors, especially in cultivation, fisheries,
industrial activities, livestock production, hydropower generation and other activi-
ties. Therefore, water can be a renewable energy if human can manage it properly,
which is fundamental to human well-being. However, due to a lot of functions of
water they can be a reason for water pollution. Although there is still a lot of water
resource, it may not be sufficient for all users if water pollution prolongs. Therefore,
in the era of the contemporary economic process in Malaysia, many issues are being
talked about and the vital issue is pollution of the river, rural or urban (Salmiati and
Salim 2017). Nowadays, one of the foremost crucial problems is the convenience of
clean water for human utilization. In this case, the classification of water resource is
important to satisfy the water quality standards. According to UNEP (2007), many
researchers have developed and used various water quality measurements, but the
value of water quality index (WQI) is still not accurate. As problem-related water is
on the rise, WQI modelling is an important tool to help researchers predict the quality
of water, specifically from a river. But the main problem is most of the environmental
managers are difficult to convey their complex environment data into information
that is understandable in obtaining the water quality of a river.
Penang Island has been chosen as the location for this study. In Penang Island,
there are many rivers, but this study is just only focused on water pollution in three
rivers, Juru River which has two stations (2JR01 and 2JR12), Pinang River (2PG01)
and Dondang River (2PG04). There were 41 data collected monthly from year 2016
until 2017, with six parameters based on stations, respectively. Besides, the data is
obtained from the Department of Environment (DOE) under the Ministry of Energy,
Science, Technology, Environment and Climate Change, Putrajaya, Malaysia. The
focus of this study is to develop a model of water quality by using fuzzy logic which
is based on six different parameters.
34.2 Literature Reviews
Studies on Water Quality Index (WQI). Among the early people who proposed the
use of the water quality index (WQI) is Horton (1965). Many researchers have applied
the WQI to observe and measure the water quality of the river system, including
the classification of rivers (Suratman et al. 2009). According to Zainudin (2010),
there are two primary qualitative methods observed, which are the interim national
water quality standards (INWQS) and water quality index (WQI). The idea of WQI
34 Fuzzy Logic Water Quality Index (FWQI) Model … 401
method is based on INWQS method. The INWQS method is a set of standards

derived based on beneficial uses of water. One of the most efficient ways to explain
the quality of water is by the water quality index (WQI). WQI could be defined by
three characteristics, which are physical, chemical, or biological character and they
are established to measure the status of water quality index and river classification
in Malaysia. By considering multiple parameters, WQI could predict the trends and
fluctuations in water quality (Nasir et al. 2012). Therefore, in Malaysia an appraisal
by the expert panel made a conclusion that only six primary parameters needed to
be measured to determine the Malaysian DOE-WQI (Suratman et al. 2015).
Limitation on Water Quality Index (WQI). According to Babaei et al. (2011),
there are two explanations about why water quality information cannot communicate
precisely with an index. First, most indexes are based on a pre-recognized set of
water quality parts. At a certain place, we could obtain an excellent result of WQI
even though some parts of the water are polluted because it is not included in the
index. Secondly, an accumulation of data on water quality problems may be over-
emphasized in a short term. For example, a station that has an acceptable WQI does
not necessarily receive good water quality because a good score may include the
index of poor water quality.
Application of Fuzzy Logic on Water Quality Index (WQI). Fuzzy set is a
generalization of the classical set theory since membership of the elements to the
fuzzy set could be considered as a number in the interval [0, 1]. It has been applied
in many things in real life, like in using washing machines, video, cameras, cranes
and others in order to solve human problems (Kiurski-Milosevic et al. 2015). There-
fore, in solving the problems of complex modelling like uncertainty or inadequate
information, fuzzy logic could help in handling these difficulties. The membership
function is important as it assists to describe the membership degree of an individual
to the given fuzzy set (Sellitto et al. 2018). In addition, Gharibi et al. (2012) stated
that environmental conditions would affect the result if an expert uses his mind to
predict the water quality because measuring the environmental conditions is complex
and Zadeh (1973) has reported that this difficulty is associated to the “principle of
incompatibility”. Therefore, there is one method called artificial intelligence (AI)
method that has been commonly used in the WQI development which is fuzzy logic.
34.3 Methodology
The definition of fuzzy inference system (FIS) is the process of conveying from
an input determinant to an output determinant using fuzzy reasoning. The fuzzy
inference system is also known as fuzzy expert, fuzzy model, system of fuzzy rule-
based and fuzzy associative memory (Hndoosh et al. 2012). In decision-making, this
system is a vital part of the whole system as it develops suitable rules. In the fuzzy
system, there are three crucial parts, which are fuzzification, evaluation of fuzzy
inference and defuzzification, as shown in Fig. 34.1.
Fig. 34.1 System of fuzzy logic
Fuzzification. Testing samples or crisp values are transformed into fuzzy input
values that are called fuzzification. Here, the input variables are submitted which
is transformed from a numerical value or crisp value of any water quality. This is
known as a fuzzy number derived through membership function. This process is
applied to obtain the membership grade to a fuzzy set. The values for input variables
are based on the six different parameters, namely dissolved oxygen (DO), biological
oxygen demand (BOD), chemical oxygen demand (COD), ammoniacal nitrogen
(NH3 -N), total suspended solid (TSS), pH and one output which is fuzzy logic water
quality index (FWQI). Figures 34.2, 34.3, 34.4, 34.5, 34.6, 34.7 and 34.8 present the
membership function of six input variables that are attained from MATLAB.
Evaluation of Fuzzy Inference. The input and output of the membership func-
tions are applied in the fuzzy inference evaluation process. In generating the output,
the rules and information are important. An “IF–THEN” rule has the form: “If m is
B then n is D”, where B and D are the linguistic values to formulate the conditional
Fig. 34.2 Membership function for variable DO

Fig. 34.3 Membership function for variable BOD
Fig. 34.4 Membership function for variable COD
statement. This rule is a simplified representation of the behaviour of a system that

contains a condition and conclusion in order to help the user understand easily. In
this study, 729 rules were applied in relation to the selected six water quality deter-
minants. The output membership function for each rule was determined based on
Mamdani modeling.
Defuzzification. This is a final process of FIS where the value of the fuzzy set
must convert into a numerical value or a single number which is called defuzzifica-
tion. Defuzzification is completed based on the membership function of the output
variable. The most common defuzzification methods are centroid method or the cen-
tre of gravity, bisector and middle of maxima. The centroid method has been used
in this study.
Fig. 34.5 Membership function for variable TSS
Fig. 34.6 Membership function for variable pH
The formula for the centroid method is expressed as follows:
∫ µc (x) · xdx
z= (34.1)
∫ µc (x)dx
where z is the defuzzified output, µc is a membership function and x is the output

variable.
Fig. 34.7 Membership function for variable NH-3N
Fig. 34.8 Membership function for variable FWQI
34.4.1 Parameters Used in Determining the Fuzzy Logic

Water Quality Index (FWQI)
There were six different parameters of water quality index (WQI) that contain dis-
solved oxygen (DO), biological oxygen demand (BOD), chemical oxygen demand
(COD), ammoniacal nitrogen (NH3 -N), total suspended solid (TSS) and pH. All the
parameters used in this study are based on the parameters that have been used by the
Department of Environment (DOE) in their conventional technique to determine the
water quality index (WQI).
34.4.2 FWQI in Determining the Water Quality of Rivers
By using fuzzy logic water quality index (FWQI), the status of water quality at Juru
River, Dondang River and Pinang River can be obtained. This can be implemented
by using the fuzzy inference system editor in MATLAB software. For example, if
the value of input parameters for DO is 3.41, BOD is 7, COD is 21, TSS is 29, pH
is 7.09 and NH-3 is 4.7, then the value of FWQI is 70. Figure 34.9 shows the value
of the parameters and the result of fuzzy logic water quality index (FWQI) by fuzzy
inference system editor in MATLAB.
In manual calculation of fuzzy logic water quality index (FWQI), this can be
shown as the step of defuzzification method below:
Input parameters value: DO = 3.41 (ADE), BOD = 7 (ADE), COD = 21 (ADE),
TSS = 29 (HAC), pH = 7.09 (HAC) and NH-3 = 4.7 (ADE).
Then, by using the Mamdani compositional rule of inference technique, the graph
of the output has been obtained as shown in Fig. 34.10.
To calculate the output value that is the FWQI, the centroid method has been used
in the defuzzification step.
Fig. 34.9 MATLAB—result for FWQI

Fig. 34.10 Defuzzification

of FWQI
⎧
⎪
⎪ x − 59, 59 ≤ x ≤ 60
⎨
1, 60 ≤ x ≤ 80
µSlighty Polluted (x) =
⎪ 81 − x, 80 ≤ x ≤ 81
⎪
⎩
0, otherwise
The calculation for defuzzification from Eq. 34.1 is as follows:
∫60
59 (x − 59)xdx + ∫60 (1)xdx + ∫80 (81 − x)xdx
80 81
z=
∫59 (x − 59)dx + ∫60 (1)dx + ∫80 (81 − x)dx
60 80 81
29.83 + 1400 + 40.17

z=
0.5 + 20 + 0.5
1470
z=
21
z = 70
34.4.3 The Results of Fuzzy Logic Water Quality Index

(FWQI) and Comparison with Water Quality Index
(WQI)
Tables 34.1, 34.2, 34.3 and 34.4 present the comparison between the actual data of
the water quality index (WQI) and the fuzzy logic water quality index (FWQI). The
location was at the Penang Island, but the study only focused on three locations,
Juru River, which has two stations (2JR01 and 2JR12), Pinang River (2PG01) and
Dondang River (2PG04). There were 41 monthly series of data obtained by Devel-
opment of Environment (DOE) monthly with six parameters based on the stations,
respectively.
Table 34.1 Results of comparison between WQI and FWQI at Juru River (2JR01)
No. Juru River (2JR01) WQI Linguistic value FWQI Linguistic value
1 11-Feb-16 75 Slightly polluted 70 Slightly polluted
2 21-Apr-16 61 Slightly polluted 38.4 Polluted
3 22-Jun-16 61 Slightly polluted 32.1 Polluted
4 21-Oct-16 63 Slightly polluted 70 Slightly polluted
5 23-Nov-16 67 Slightly polluted 70 Slightly Polluted
6 17-Feb-17 44 Polluted 32.1 Polluted
7 4-Apr-17 63 Slightly polluted 70 Slightly polluted
8 11-Jul-17 50 Polluted 32.1 Polluted
9 13-Sep-17 52 Polluted 32.1 Polluted
10 21-Nov-17 60 Slightly polluted 70 Slightly polluted
Table 34.2 Results of comparison between WQI and FWQI at Juru River (2JR12)
No Juru River (2JR12) WQI Linguistic value FWQI Linguistic value
12 21-Apr-16 66 Slightly polluted 70.1 Slightly polluted
13 22-Jun-16 57 Polluted 70 Slightly polluted
14 17-Aug-16 40 Polluted 32.1 Polluted
15 21-Oct-16 53 Polluted 32.1 Polluted
16 23-Nov-16 53 Polluted 32.1 Polluted
18 4-Apr-17 61 Slightly polluted 70 Slightly polluted
19 11-Jul-17 71 Slightly polluted 70 Slightly polluted
21 21-Nov-17 52 Polluted 32.1 Polluted
Table 34.3 Results of comparison between WQI and FWQI at Pinang River (2PG01)
No Pinang River (2PG01) WQI Linguistic value FWQI Linguistic value
22 5-Jan-16 46 Polluted 32.1 Polluted
23 2-Mar-16 54 Polluted 70 Slightly polluted
24 3-May-16 41 Polluted 32.1 Polluted
27 1-Nov-16 72 Slightly polluted 33.1 Polluted
28 5-Jan-17 58 Polluted 32.1 Polluted
29 3-Mar-17 70 Slightly polluted 70 Slightly polluted
30 14-Dec-17 64 Slightly polluted 70 Slightly polluted
Table 34.4 Results of comparison between WQI and FWQI at Dondang River (2PG04)
No Dondang River WQI Linguistic value FWQI Linguistic value
(2PG04)
31 5-Jan-16 60 Slightly polluted 70 Slightly polluted
32 2-Mar-16 70 Slightly polluted 70 Slightly polluted
33 3-May-16 59 Polluted 35.6 Polluted
35 2-Sep-16 74 Slightly polluted 70 Slightly polluted
36 1-Nov-16 74 Slightly polluted 32.3 Polluted
37 5-Jan-17 67 Slightly polluted 70 Slightly polluted
38 3-Mar-17 71 Slightly polluted 33.3 Polluted
39 10-Jul-17 82 Clean 70 Slightly polluted
40 21-Sep-17 68 Slightly polluted 70 Slightly polluted
41 16-Nov-17 76 Slightly polluted 70 Slightly polluted
34.4.4 Accuracy Rate of FWQI Model
The simple bar chart in Fig. 34.11 shows the accuracy between four stations to
determine the water quality of rivers by using fuzzy logic water quality index (FWQI)
model. An inspection of the data in the simple bar chart clearly shows that accuracy of
the FWQI model is good enough by which the highest accuracy is 91%. Furthermore,
the figure shows that the FWQI model has the ability to determine the water quality
of rivers since the percentage accuracy is 80 and 91% for both stations in Juru River.
Next, the accuracy between Pinang River and Dondang River is broadly in the same
range, which is 78 and 73%. Even though their accuracy rate is lower than Juru
River but that percentages are still in the good range of accuracy. In general, it can
be concluded that FWQI is the suitable model due to high percentage accuracy in
determining the water quality of rivers for all the stations.
RATE OF ACCURACY
100% 9
8 7
80%
7
60%
40%
20%
0%
JURU (2JR01) JURU (2JR12) PINANG DONGDANG
(2PG01) (2PG04)
STATIONS OF RIVERS
Fig. 34.11 Accuracy rate for four stations

34.5 Conclusion
As a conclusion, the flexibility of the fuzzy logic to develop the FWQI model with a
simple framework and construct with the natural language can make the water quality
assessment to be more understandable, especially in terms of public consideration.
Moreover, FWQI model is believed to assist the decision-makers since the overall
rate of accuracy is high, 80% and it is clear that FWQI model has slight difference
with the actual model, which is WQI. Therefore, FWQI is a suitable model to be
used in determining the status of water quality. As an outcome, this study is able to
determine the water quality of Penang Island Rivers by using the fuzzy logic water
quality index (FWQI).
References
Babaei SF, Hassani AH, Torabian A, Hosseinzadeh LF (2011) Water quality index development
using fuzzy logic: a case study of the Karoon River of Iran. Afr J Biotechnol, 10(50):10125–10133
Gharibi H, Mahvi AH, Nabizadeh R, Arabalibeik H, Yunesian M, Sowlat MH (2012) A novel
approach in water quality assessment based on fuzzy logic. J Environ Manage 112:87–95
Hndoosh R, Saroa M, Kumar S (2012) Fuzzy and adaptive neuro-fuzzy inference system of washing
machine. Eur J Sci Res 86(3): 443–459. ISSN 1450-216X
Horton RK (1965) An index number system for rating water quality. J Walter Poll Cont Fed
37(3):300–306
Kiurski-Milosevic J, Vojinovic-Miloradov M, Ralevic N (2015) Fuzzy model for determination and
assessment of groundwater quality in the city of Zrenjanin, Serbia. 69(1):17–28
Nasir MFM, Zali MA, Juahir H, Hussain H, Zain SM, Ramli N (2012) Application of receptor
models on water quality data in source apportionment in Kuantan River Basin. Iran J Environ
Health Sci & Eng 9(1):18
Salmiati NZA, Salim MR (2017) Integrated approaches in water quality monitoring for river health
assessment: scenario of Malaysian River
Sellitto MA, Balugani E, Gamberini R, Rimini B (2018) A fuzzy logic control application to the
cement industry. IFAC-PapersOnLine 51(11):1542–1547
Suratman S, Awang M, Loh AL, Mohd Tahir N (2009) Water quality index study in Paka River
Basin, Terengganu (in Malay). Sains Malays 38:125–131
Suratman S, Sailan MM, Hee YY, Latif MT (2015) A preliminary study of water quality index
in Terengganu River Basin, Malaysia (Kajian Awal Indeks Kualiti Air di Lembangan Sungai
Terengganu, Malaysia). Sains Malays 44(1):67–73
UNEP G (2007) Global drinking water quality index development and sensitivity analysis report.
Water Programme Office, Ontario, Canada
Zadeh LA (1973) Outline of a new approach to the analysis of complex systems and decision
processes. IEEE Trans Syst, Man, Cybern 3(1):28–44
Zainudin Z (2010) Benchmarking river water quality in Malaysia. Jurutera, 12–15
Chapter 35
Concrete Performance Using Treated
POFA as a Partial Replacement
of Cement
Nik Farhanim Imran, Mohd Afiq Mohd Azham, Md Rasul Mohamad Nor,
Noor Syafeekha Mohamad Sakdun, Nor Hafida Hashim,
Siti Rahimah Rosseli, Hafizah Muhamad Azlan
and Muhd Norhasri Muhd Sidek
Abstract Palm oil is used to produce cooking oil and its waste is called palm oil fuel
ash (POFA). POFA is one of the wastes that have same chemical properties as cement,
which is silica and calcium oxide. Demand for cement used in concrete was high. The
cement is not suitable for a sustainable environment as cement industry is the primary
producers of carbon dioxide (CO2 ). The aim of this study is to investigate water
absorption on various molarity of treated POFA in 10% of replacement of cement
in concrete and to study the effect of optimum molarity of treated POFA towards
the compressive strength with 10% replacement of cement in concrete. POFA was
treated in the environmental laboratory by using various molarity of sulphuric acid,
H2 SO4 . Then, the treated POFA has been partially replaced by cement of 10% in
order to cast a concrete mix on 50 × 50 × 50 mm mould. The cubes samples were
N. F. Imran (B) · M. A. Mohd Azham · M. R. Mohamad Nor · N. S. Mohamad Sakdun ·

N. H. Hashim · S. R. Rosseli · H. Muhamad Azlan
Faculty of Civil Engineering, Universiti Teknologi MARA, Cawangan Pulau Pinang, Malaysia
e-mail: farhanim4611@uitm.edu.my
M. A. Mohd Azham
e-mail: afiqazham95@gmail.com
M. R. Mohamad Nor
e-mail: rasul@uitm.edu.my
N. S. Mohamad Sakdun
e-mail: syafeekha518@uitm.edu.my
N. H. Hashim
e-mail: norhafida995@uitm.edu.my
S. R. Rosseli
e-mail: rahimahrosseli@uitm.edu.my
H. Muhamad Azlan
e-mail: hafizahazlan@uitm.edu.my
M. N. Muhd Sidek
Faculty of Civil Engineering, Universiti Teknologi MARA Shah Alam, Shah Alam, Malaysia
e-mail: muhdnorhasri@uitm.edu.my

412 N. F. Imran et al.
being produced to test the compressive strength and water absorption by following
the British Standard to check the effect of the treatment of the POFA. From the result
obtained, concrete with partially replacement of cement by using POFA treated 5M
of sulphuric acid is the optimum value that gets from the compressive strength test
and achieved the design strength which is M30. The values for the 5M treated POFA
and ordinary portland cement (OPC) were compared and the result is 44.77 and
47.26 N/mm2 , respectively. The higher the molarity of the sulphuric acid, the lower
the compressive strength achieved.
Keywords Partial replacement · POFA · Treated POFA
35.1 Introduction
Nowadays, there is a huge development in buildings, bridges, and many more.

Because of development, the demand for cement used in concrete is high. A sus-
tainable environment cannot be achieved if the cement is continuously used, since it
produces a lot of carbon dioxide (CO2 ). Furthermore, cement is also the primary pro-
ducers of CO2 . The natural resources were affected because of the huge production
of CO2 caused by cement production and it cannot be used for other purposes.
Besides cement issue, agriculture also plays an important part in the current sit-
uation in Malaysia. There were various agricultural products and one of it is palm
oil which is used as cooking oil and its waste is called palm oil fuel ash (POFA).
POFA is one of the wastes that have the same chemical properties as cement, which
is silica and calcium oxide. Owing to the chemical properties of POFA being similar
to cement, there is a lot of research that is trying to study about using this material
to produce sustainable environment concrete. Therefore, POFA will be one of the
interesting materials of research since there is no enough data to be used for con-
crete purpose. POFA does not need to be produced compared to cement because it
is generated from cooking oil process.
In addition, it was proven that POFA had the possibility of being used as a partial
replacement of cement to produce durable, lightweight and cheap concrete. This
journal is aimed to study the cementitious properties of POFA as partial replacement
material in concrete. The workability of the concrete would decrease when the POFA
content increases (Oyejobi et al. 2016). Based on these interesting facts of POFA,
this study was carried out in order to investigate the ability of water absorption on
various molarity-treated POFA in 10% of cement replacement by concrete. It has to
be defined which molarity of treated POFA is most suitable for the good concrete
application.
35 Concrete Performance Using Treated POFA as a Partial … 413
35.2 Methodology
35.2.1 Materials
The materials used in this study were cement, fine and coarse aggregates, and water,
which are used in the common concrete. These basic materials are normally for the
normal or control sample. The result of treated POFA in concrete with the normal
concrete used nowadays is compared. The following sub-topics are the materials
used to treat POFA for the 10% cement replacement in concrete.
Raw POFA. In this study, POFA is an absolutely waste produced from the industry
of cooking oil. POFA had been at an industry landfill located at United Palm Oil
Industries Sdn. Bhd. at Nibong Tebal, Penang, Malaysia. Then it was transported to
the environment laboratory for treatment process. Figure 35.1 shows POFA material
before sieving process.
Sulphuric acid, H2 SO4 . The sulphuric acid, as shown in Fig. 35.2, is used for
the treatment process of POFA. This acid is used in environmental laboratory with
the guidance of assistant engineer of the lab.
Fig. 35.1 POFA before

sieving
Fig. 35.2 Sulphuric acid,

H2 SO4
Fig. 35.3 Distilled water
Distilled water. Figure 35.3 shows the distilled water that was used in this study
during open reflux process, which is one of the POFA treatment process, and it was
carried out in the environmental laboratory also.
35.2.2 Treatment of POFA
POFA had been treated by using sulphuric acid, H2 SO4 . This method is known as
leaching method. The raw POFA has been refluxed with sulphuric acid, H2 SO4 at
110 °C at different concentrations, which are 3, 5, 7 and 9 M. POFA with sulphuric
acid, H2 SO4 , is poured into the separating funnel to be filtered and dried under a
temperature of 200 °C. Before the treatment process, POFA were sieved by using
212 µm of sieving size to ensure that POFA was in the finest condition. This part
is needed to be done to enhance the properties of the POFA, such as durability,
lightweight, and cheap concrete. This treatment process followed previous research
to do the leaching process (Panda et al. 2010). Then the other steps are as follows:
Open reflux process. The chemical activation was carried out by preparing 10 g
of passing sieved POFA. The apparatus which is digital magnetic stirrer and 200 ml
beaker was set up and the prepared distilled water and sulphuric acid, H2 SO4 are
poured into the beaker. Then, the digital magnetic stirrer was started at 110 °C.
Figure 35.4 shows the POFA during the treatment process.
Sedimentation process. After the solution is stirred, the solution was poured into
the separating funnel. This is to ensure that all of the POFA were settled as sediment
at the bottom of the funnel and a layer of POFA will be formed at the separating
funnel, as shown in Fig. 35.5.
Fig. 35.4 POFA during

treatment process
Fig. 35.5 The sedimentation

process
Fig. 35.6 Filtration process
Filtration and drying process. Figure 35.6 shows the filtration process whereby
the solution in the separating funnel was filtered by using filter paper (Ø110 µm).
After filtration, the sample was collected and added to the ceramic bowl which is
placed in the oven for the drying process. The sample has been dried at 200 °C
followed by 105 °C in the oven to make sure the sample is completely dry.
Powder process. After the sample was dried, the sample is taken to make the
sample in a powdered form before proceeding to the next experiment. POFA in the
ceramic bowl has been pounded into a powdered form and it is ready to use for the
next experiment.
35.2.3 Concrete Casting and Compressive Strength Test
In order to cast the concrete according to BS 1881, all the materials need to be
prepared based on the calculation in the concrete mix design form. The experiment
started with mixed material by adding the cement (90% from the calculation), sand,
water, aggregates and POFA (10% of treated POFA from the cement calculation) as
shown in Table 35.1.
The concrete is then poured into the mould and tempered properly so that no
voids occurred. The surface of the concrete was even and smooth to ensure we will
get accurate reading at compression machine at the testing level. The mould is then
removed after 24 h and the cubes sample was dropped into the curing tank for the
curing purpose. The curing aged needed to be tested, which are 3, 14 and 28 days as
Table 35.1 Concrete mix design

Type of mix Content
Cement (kg) Aggregates (kg) Water (l) 10% replacement
(kg)
Coarse Fine
OPC 0.576 0.93 1.139 0.291 –
POFA 0.518 0.93 1.139 0.291 0.058
Treated POFA 3M 0.518 0.93 1.139 0.291 0.058
5M 0.518 0.93 1.139 0.291 0.058
7M 0.518 0.93 1.139 0.291 0.058
9M 0.518 0.93 1.139 0.291 0.058
according to the BS 1881-22:1983 (BS1881 1983). The steps were being repeated
for non-treatment POFA, and for the ordinary portland cement (OPC), there is 0%
of POFA used for this step. The result was collected for each of curing aged and for
each sample cubes.
35.2.4 Water Absorption Test
Water absorption test was used to determine the amount of water absorbed when
the sample is immersed in water. The sample had been tested at 28 days of curing
age. The test was conducted according to the procedure that is stated in BS 1881-
22:1983 (BS1881 1983). The concrete cube sample was oven dried to ensure that the
mass was constant. It was dried at 105 °C for 3 days. Then, the sample was stored
in air before testing. After that, the concrete specimen was weighed (Wd ) before
immersed in water for 24 h. After 24 h, the concrete was weighed again (Ww ). The
percentage by weight of water absorption for each sample was recorded according
to the Eq. (35.1).
(W d − W w)
% of water absorption = × 100% (35.1)
Wd
35.3.1 Compressive Strength
Table 35.2 shows the result gained after compressive strength test of the concrete
that had been replaced 10% of the cement (treated POFA with various molarity),
non-treated POFA and the control sample (OPC).
From the result in Fig. 35.7, it is shown that the highest compressive strength for
various molarity samples is 5M treated POFA which is 44.77 N/mm2 compared to the
other samples. Besides, the result of the compressive strength for 5M was compared
with the control sample. There were only slight difference in strength between the
5M and OPC. The difference in the strength between optimum-treated POFA and
OPC was only 5.3%.
35.3.2 Water Absorption
The durability of the concrete in water can be determined through the water absorp-
tion test of concrete which has been conducted in the laboratory. Usually, concrete
Table 35.2 Result of

Material Compressive strength (N/mm2 )
compressive strength test
Day 3 Day 14 Day 28
3M treated POFA 16.43 21.57 23.96
5M treated POFA 16.57 29.70 44.77
7M treated POFA 11.31 23.60 27.91
9M treated POFA 12.42 24.65 28.96
Non-treated POFA 27.81 37.09 43.83
OPC 31.24 38.61 47.26
Fig. 35.7 Graph Compressive Strength Vs Day of Curing

Compressive Strength, N/mm2
compressive strength against 60

day of curing for every
40
sample
20
0
Day 3 Day 14 Day 28
Days of Curing
3M treated POFA 5M treated POFA
7M treated POFA 9M treated POFA
non- treated POFA OPC
Chart of Percentage of water Absorption, %

3.5
3 2.86 2.77
2.72
Percentage of water 2.5
absorption,% 2.13
1.99 1.87
2
1.5
0.5
0
OPC Non-Treated 3M Treated 5M Treated 7M Treated 9M Treated
POFA POFA POFA POFA POFA
Fig. 35.8 Graph percentage of water absorption at 28 days of curing age
with low water absorption was being better than the concrete with high water absorp-
tion. Concrete that has high water absorption shows that there is porosity or void in
the concrete that can affect the reinforcement in the concrete. For this study, water
absorption test was being done to see the effect of the treatment of POFA as partially
replacement of cement in concrete.
From the chart in Fig. 35.8, it is apparent that sample of 5M treated POFA is the
lowest in absorption of water, which is 1.87% among the others sample. The percent
of water absorption keeps increasing for the 7 and 9M treated POFA sample. This
result shows that replacement of treated POFA in cement produces a good result than
an OPC, even though OPC is widely used all over the world.
This result can be complemented with the journal studied by Ofuyatan et al.
(2015). It shows that the value of water absorption decreased by the increase of curing
age. Other researcher stated in his paper about the influence of water absorption on the
durability of concrete materials. From the result study by Zhang and Zong (2014),
it was totally shown that the increase of water absorption caused decrease in the
strength of the concrete. This means that the higher amount of water absorption was
not good to the concrete. However, it is also stated that the strength of the concrete is
not wholly affected by the water absorption. It can be summarized that when POFA
partially replaced by the cement can reduce the percentage of water absorption of
the concrete.
35.4 Conclusion and Recommendation
This study presents the result of compressive strength and water absorption test of
partial replacement of cement for various molarity of sulphuric acid, H2 SO4 used
for the treatment of POFA. From the lab test, the highest compressive strength for
partial replacement of cement is 44.77 N/mm2 which is 5M of sulphuric acid. So
we know that the strength of the concrete was optimum at the 5M of sulphuric acid
used, and the strength of the concrete decreased when the molarity of acid is higher
than 5M.
Based on the result, the concrete sample with 5M of sulphuric acid treated POFA
also shows that the percentage of water absorption is the lowest between the other
samples which are 1.87%, where it can produce a better performance of concrete
compared to other molarity of treated POFA.
Other than reduced water absorption of concrete, POFA is more resistant to heat
rise (Awal and Hussin 1999). The result from this study shows that the temperature
of POFA concrete is lower than OPC concrete after casting. This is the advantage of
using POFA as partial replacement of cement in order to make sure the environment
would be sustained. The same research also stated POFA also has high resistance
to chloride penetration and acid attack. Due to chloride penetration, OPC concrete
is higher than POFA concrete: OPC concrete is 9.58 (10−3 mm2 /h) while the POFA
concrete is 3.44 (10−3 mm2 /h) in 28 days.
From this study, it is shown that the POFA can be used as partial replacement
of cement because of lot of advantages in order to maintain and sustain the natural
resources for recycling the waste produce from the process of cooking oil. It is good
to find new source to ensure the world is under the environment quality. Therefore,
POFA is one of the waste materials that can be used for construction which can
reduce it at landfill.
Therefore, the other researchers can make a new research by using different type
of acid rather than sulphuric acid; or maybe can use higher molarity than 9M of
sulphuric acid for the treatment of POFA; from there, maybe they will come out with
the new findings.
Acknowledgements The authors would like to thank to Faculty of Civil Engineering, Universiti
Teknologi MARA (UiTM) Pulau Pinang for the facilities provided and for those who are involved
in this research and their support throughout the study.
References
Awal A, Hussin MW (1999) Durability of high performance concrete containing palm oil fuel ash.
Durab Build Mater Compon 8(5):465–474
BS1881 (1983) Testing Concete (Part 116)—Method for determination of compresive strength of
concrete cubes. Bsi, (December), 11
Ofuyatan T, Olutoge FA, Olowofoyeku A (2015) Durability properties of palm oil fuel ash self
compacting concrete. Eng, Technol & Appl Sci Res 5(1):753–756
Oyejobi D, Abdulkadir TS, Ahmed AT (2016) A study of partial replacement of cement with palm
oil fuel ash in concrete production. J Agric Technol 12(4):619–631
Panda AK, Mishra BG, Mishra DK, Singh RK (2010) Effect of sulphuric acid treatment on the
physico-chemical characteristics of kaolin clay. Colloids Surf, A: PhysChemical Eng Asp 363(1–
3):98–104
Zhang SP, Zong L (2014) Evaluation of relationship between water absorption and durability of
concrete materials. Adv Mater Sci Eng
Chapter 36
Characterization of Pectin Extracted
from Guava Peels Using Deep Eutectic
Solvent and Citric Acid
Rizana Yusof , Siti Zawani Ahmad Zaini and Mohd Azhar Azman
Abstract Pectin was extracted from guava peels using the environmentally friendly
deep eutectic solvent (DES) and citric acid solution. The chemical characteristics
of guava peel pectin were investigated and compared to assess the potential of two
different DES as an alternative to the conventional solvent. In this study, two different
DES, 10% ChCl:Urea (1:2) and 10% ChCl:EG (1:2), were prepared to extract pectin
from guava peels. The extracted pectin was calculated, characterized and compared
to the pectin extracted with the conventional method using 10% citric acid. DES of
10% ChCl:EG is able to extract the highest pectin content (37.1%) compared to 10%
citric acid (29.2%) and 10% ChCl:Urea (16.4%). The results showed that the pectin
extracted using 10% ChCl:EG produced pectin with high ability to form gel as the
ash content was lower (2.02%), and both methoxyl content (15.6%) and degree of
esterification (98.47%) are high, which are compared with the pectin extracted from
10% citric acid. The pectin extracted from 10% ChCl:EG has a stable foam; even
their foaming capacity is low compared to pectin extracted with 10% citric acid.
To sum up, the DES of 10% ChCl:EG shows high potential to extract pectin as the
percentage yield is high and the extracted pectin can form gel rapidly, which will be
an advantage in food processing as a gelling agent.
Keywords Guava peels · Pectin extraction · Deep eutectic solvent ·

Characterization
R. Yusof (B) · S. Z. A. Zaini · M. A. Azman

Faculty of Applied Sciences, Universiti Teknologi MARA (UiTM), Kampus Perlis, 02600 Arau,
Perlis, Malaysia
e-mail: rizana@uitm.edu.my
S. Z. A. Zaini
e-mail: sitizawanizaini@gmail.com
M. A. Azman
e-mail: azharazman93@gmail.com

422 R. Yusof et al.
36.1 Introduction
The polysaccharides that derived from natural resources can be used as a biopolymer
with several uses in many industries such as food, healthcare and polymer processing
(Dranca and Oroian 2018). Pectin, a naturally occurring polysaccharide, is always
used as a gelling agent, thickening agent and stabilizer in food. Other than that, it is
used in fillings, medicines, laxatives as well as a source of dietary fibre. Pectin can
be obtained from fruits or plants. For the fact, guava has the most abundant content
of polysaccharides. Many alternative methods can be used in order to extract the
pectin. The selection of method to extract pectin is important to ensure high yield
of pectin can be obtained without interrupting their structures. The most common
pectin extraction technique is by using strong mineral acids such as hydrochloric
acid, sulphuric acid or nitric acid through heating method (Dranca and Oroian 2018).
However, the main drawbacks of using strong mineral acids are their toxicity and
corrosive effluents that can be potential threats to human health.
Therefore, effective and environmentally friendly extraction techniques are
required for the production of safe pectin as food additives as well as safe to the
environment (Yang et al. 2018). Deep eutectic solvent (DES) has been selected as
the best alternative solvent since it is easily synthesized, cost-effective, biodegrad-
able, less toxic, greener and safer to the human and environment (García-Argüelles
et al. 2013; Zdanowicz et al. 2018). Hence, the potential of DES as a new solvent for
pectin extraction process was determined using guava as pectin source.
Psidium guajava L. guava peels were collected at a local market in Ipoh, Perak. The
guava peels were washed with cold water to get rid of any adherent dirt, and then
peeled. After that, they were placed inside boiled water for 5 min to inactivate the
enzymes activity which can affect the result. Next, the peels were dried and grinded
into powdered form for extraction.
36.2.2 Preparation of DES
There are two types of DES produced to extract pectin from the samples of guava
peels. The first DES, ChCl:Urea was prepared in moles ratio of 1:2 (3.49:3.0 g) by
using heating method according to Abbot et al. (2003). The mixtures were stirred at
500 rpm and heated at 90 °C until clear homogenous liquid was formed. The DES was
36 Characterization of Pectin Extracted from Guava Peels … 423
allowed to settle down at room temperature prior to being used for extraction. The
same procedure was repeated to prepare ChCl:EG at moles ratio of 1:2 (3.49:9.3 ml).
36.2.3 Extraction of Pectin
Citric acid pectin extraction. The extraction of pectin from guava peels was per-
formed based on the method described by Devi et al. (2014) with some modifications.
1 g of guava peel powder was mixed with 25 ml of distilled water, followed by 50 ml
of 10% diluted citric acid. The extraction was performed using water bath while
maintaining the solution at pH 2. Thereafter, the mixture was stirred and heated at
85 °C for 1 h. Next, the hot citric acid extracts were filtered through muslin cloth
and the filtrate was cooled to 4 °C temperature. Ethanol was then added to the filtrate
in volume ratio (1:2) and was kept for 1 h to precipitate the pectin. The coagulated
pectin was placed in a glass petri dish. Later on, the mixed pectin was dried in oven
at 70 °C for 30 min to allow the water to evaporate. The dried pectin formed a solid
layer that was scraped to become powder. The powdered pectin was kept in an airtight
vial.
Deep eutectic solvent (DES) pectin extraction. ChCl:Urea (1:2) and ChCl:EG
(1:2) were used for the extraction of pectin according to the modified method from
Liew et al. (2017). 1 g of dry guava peel powder was mixed with 50 ml of 10%
diluted DES in a water bath at 80 °C for 2 h. The liquid was filtered using muslin
cloth and the filtrate was precipitated with 95% ethanol in volume ratio of 1:2. The
samples were stored in a dark place at room temperature for 24 h to allow pectin
flotation to take place. The floated jelly-like pectin was subsequently separated and
placed in a glass petri dish. Based on the method described by Girma and Worku
(2016), an effective method to dry the jelly-like pectin was adding the pectin to water
at volume ratio of (1:2) followed by stirring until the pectin was dissolved. Then, the
mixed pectin was dried in oven at 70 °C for 30 min to allow the water to evaporate.
The dried pectin formed a solid layer which later scraped to become powder. The
powdered pectin was kept in an airtight vial for prior use.
Calculation percent yield. The percentage yield of the extracted pectin from acid
extraction and DES extraction was calculated by using the Eq. (36.1):
Pectin obtained (g)

Pectin yield (%) = × 100. (36.1)
Initial grinded guava peel
36.2.4 Characterization of Pectin Extracted
Moisture content. The determination of moisture content in pectin was performed

according to the method described by Devi et al. (2014), where 1 g of dry extracted
424 R. Yusof et al.
pectin was weighed and dried in oven at 100 °C for 4 h. The sample was cooled in
a desiccator. The value of moisture content loss in pectin was calculated using the
Eq. (36.2), where Ma is the mass of dry pectin after oven drying (g) and Mb is the
mass of dry pectin before oven drying (g).
Mb − Ma
Moisture Content (%) = × 100 (36.2)
Ma
Ash content. The ash content was determined according to the method described
by Devi et al. (2014). 2 g of dry pectin was placed in an empty crucible that was
weighed beforehand. The pectin was ignited slowly and heated using furnace at
600 °C for 3–4 h. The crucible was cooled to room temperature in a desiccator
and weighed. This process was repeated until constant weight was achieved. The
percentage of ash content was calculated using the Eq. (36.3), where Ma is the mass
of ignited crucible with pectin (g), Mb is the mass of ignited crucible with pectin
after ignition (g) and m is the original mass of sample (g).
Ma − Mb
Ash Content (%) = × 100 (36.3)
m
Methoxyl content. The determination of methoxyl content was conducted accord-
ing to the method by Bhat and Singh (2014). Approximately 0.5 g of pectin was
mixed with 100 ml of distilled water, 4 ml of ethanol, 1 g of sodium chloride and 6
drops of phenol red indicator. 25 ml of 0.25 N sodium hydroxide was added, stirred
thoroughly for 2 min and kept at room temperature for half an hour. Next, 25 ml of
0.25 N hydrochloric acid was added and was titrated against 0.1 N sodium hydroxide.
The end point was observed as purple colour solution was appeared. The methoxyl
content of pectin extracted was calculated using the Eq. (36.4):
volume of NaOH × 0.1N NaOH

Methoxyl content (%) = × 100 (36.4)
weight of sample × 1000
Anhydrouronic acid content. Anhydrouronic acid (AUA) content in pectin was

used to observe the purity and degree of esterification of pectin. As its equivalent
weight and methoxyl content were observed, the anhydrouronic acid content was
determined using the following Eq. (36.5), where Q is the volume of NaOH (ml)
from equivalent weight determination and M is the volume of NaOH (ml) from
methoxyl content determination.
176 × (0.1 × Q) × 100 176 × (0.1 × M) × 100

AUA (%) = + × 100
weight of sample × 1000 weight of sample × 1000
(36.5)
Degree of esterification. Degree of esterification of the galacturonic acids affects

both the charge density of the polymer and the number of sites for hydrophobic
interaction. Pectin molecules with a high degree of esterification can form gel at a
high pH and temperature. The degree of esterification (DE) of pectin was determined
using the following Eq. (36.6).
(176 × %Methoxyl content)

DE (%) = × 100 (36.6)
(31 × %AUA)
Water solubility. Water solubility of pectin was determined by applying the

procedure reported by Liew et al. (2017). 0.5 g of dry extracted pectin was mixed
with 50 ml of distilled water and stirred for a minute. Next, the sample was centrifuged
at 4200 rpm for 20 min at 25 °C. The supernatant formed was transferred to a beaker
and was allowed to evaporate in water bath at 90 °C. After that, the evaporated
sample was dried in an oven at 105 °C until constant weight was achieved. The water
solubility of pectin was determined using the following Eq. (36.7):
constant weight of dried supernatant (g)

Water solubility (%) = × 100 (36.7)
weight of sample (g)
Foaming capacity and foaming stability. Foaming capacity was determined

based on the method outlined by Yancheva et al. (2016), with slight modifications.
About 20 ml at different concentrations (1, 3 and 5%) of pectin solution were hand
shaken for 5 min. Then, the whipped samples were immediately transferred into
a graduated measuring cylinder and the total volume was measured. The foaming
capacity of pectin was calculated using the Eq. (36.8):
Pectin foam volume

Foaming capacity (%) = × 100 (36.8)
Initial pectin foam volume
The same foaming capacity determination was used to determine foaming stabil-
ity. The foam was allowed to stand at room temperature for 1 h with 15 min interval
to measure foam remains. The volume of the foam produced including the drained
liquid was measured after 1 h (Cano-Medina et al. 2011). The foam stability was
calculated using the Eq. (36.9):
Pectin foam volume after each 15min

Foam stability (%) = × 100 (36.9)
Initial pectin foam volume
426 R. Yusof et al.
36.3.1 Extraction of Pectin
It was observed that the pectin was rapidly coagulated in less than 30 min when
precipitated with ethanol. However, the pectin extracted with 10% ChCl:Urea started
to dissolve if the precipitation process was over 30 min. The physical appearances
and percent yields of pectin extracted from three different extracting medium were
summarized in Table 36.1.
The percentage yield of the pectin extracted using 10% citric acid (29.2%) was
higher than the previous research done by Bhat and Singh (2014) in which only
11.2% of pectin extracted from guava peels used pure citric acid. The existence of
water in the solvent aided the process of pectin extraction as the water loosened the
guava’s cell walls and enhanced the interaction of pectin with the solvent (Castillo-
Israel et al. 2015; Meng et al. 2016). Besides, the low pH of 10% citric acid (pH 2.0)
Table 36.1 Physical

Extracting Physical appearance of pectin Pectin yield
appearance and percent yield
medium (%)
of pectin extracted using 10%
citric acid, 10% ChCl:Urea 10% Citric 29.2
and 10% ChCl:EG from acid
grinded guava peels
Dark brown colour

10% 16.4
ChCl:Urea
Light brown colour

10% 37.1
ChCl:EG
Light brown colour

had increased the effectiveness of extraction process. The statement was also agreed
by Castillo-Israel et al. (2015) who obtained 17.05% of pectin from banana peels
when the extraction was conducted at low pH of 1.5.
The pectin extracted using 10% ChCl:EG (1:2) was observed to give higher pectin
yield (37.1%) compared to pectin extracted using 10% ChCl:Urea (1:2), which is
only 16.4%. This is due to ChCl:EG that has higher polarity of hydrogen bonding
of O–H group than the hydrogen bonding (N–H) existed in ChCl:Urea. The high
polar hydrogen bonding between ChCl (Cl− anion) and EG (O–H group) caused the
DES to penetrate guava tissue, interact with the pectin substances that exist between
the cell walls, thus increasing the pectin yield. The percentage yield obtained using
10% ChCl:EG was also higher than the previous study by Liew et al. (2017) who
successfully extracted 23.04% of pectin from pomelo peels using diluted lactic acid-
based DES. Hence, the results proved that the percentage yield of pectin obtained
from fruits is strongly affected by the type of DES used for extraction. Dranca and
Oroian (2018) stated that DES combination of ChCl and EG has high capability to
extract pectin as the DES dissolved pectin to great extent. However, the extraction
of pectin using DES took 2 h to complete the extraction process compared to acid
extraction which took only 1 h. In recent studies by Shafie et al. (2019), it was
reported that 2 h is the optimum extraction time for pectin to be completely released
to the DES solution.
The extracted pectin from DES was observed to be light brown and produced very
soft gel, which was similar to previous study done by Devi et al. (2014). Meanwhile,
the pectin extracted from 10% citric acid appeared to be dark brown due to high pH
value of the solvent used. Other than that, demethoxylation of pectin might cause the
formation of dark brown colour on its surface (Sayah et al. 2016). Devi et al. (2014)
reported that the brown colour of pectin from the extraction using citric acid was
affected by acid hydrolysis and due to the reaction of citric acid with unsaturated
oligogalacturonides in the plant. Previous studies showed that the extracted pectin
from pomelo peels (Liew et al. 2017) and grapefruits (Yang et al. 2018) using pure
citric acid were light yellow in colour.
36.3.2 Characterization of Extracted Pectin
Table 36.2 shows the characterization of pectin extracted from citric acid and DES in
terms of moisture content, ash content, methoxyl content, anhydrouronic acid (AUA)
and water solubility.
Moisture content. As shown in Table 36.2, pectin extracted using 10% hydrated
citric acid is suitable for long-term storing as it has lower moisture content (4%). In
contrast, the moisture content of pectin extracted by DESs was higher which were
10% and 19% for 10% ChCl:Urea and 10% ChCl:EG, respectively. High moisture
content will reduce the quality of pectin due to the presence of microorganism that
is able to produce high pectinase enzymes in the pectin (Omar and Ku Abdullah
2000). Figure 36.1 shows the physical of pectin extracted after drying process prior
428 R. Yusof et al.
Table 36.2 Moisture content, ash content, methoxyl content, degree of esterification, AUA content
and water solubility of pectin extracted with different solvents
Solvent Moisture Ash Methoxyl Degree of AUA Water
extraction content content content esterification content solubility
(%) (%) (%) (%) (%) (%)
10% Citric 4 3.5 15.6 95.17 39.98 50
acid
10% 10 12.0 11.7 65.88 27.38 75
ChCl:Urea
10% 19 2.0 15.7 98.47 26.96 60
ChCl:EG
Fig. 36.1 The condition of pectin after drying process, a pectin extracted using 10% citric acid,
b pectin extracted using 10% ChCl:Urea, c pectin extracted using 10% ChCl:EG
to measurement of moisture content in pectin. The pectin extracted using citric acid
was completely dried and brittle. Meanwhile, the pectins extracted using DESs were
not completely dried as they were clumped together, forming semi-permeable surface
crust during drying process that caused the moisture to retain in the clumps. Thus, the
clumped pectin caused the drying process to occur incompletely and consequently,
the value of moisture content is high.
Besides extracting solvent, time taken and temperature used during drying pro-
cess also affect the moisture content determination. Omar and Ku Abdullah (2000)
reported that a compromise temperature and time are important to remove moisture,
but too long drying time might cause significant thermal decomposition on the food
matrix. Thus, the moisture content of pectin extracted using three different extracting
solvents varied because the pectin extracted are physically different.
Ash content. Based on the results shown in Table 36.2, the low ash content
with value of 2.0 and 3.5% was observed for pectin extracted using 10% ChCl:EG
and 10% citric acid, respectively. A low ash content of pectin with value less than
10% is reported to be suitable for the gelling formation. Few previous studies also
reported on low ash content of pectin such as 3.46% ash content of pectin from
citrus waste (Maria et al. 2015) and 6.88% ash content of pectin from dragon fruit
(Ismail et al. 2012). The highest ash content was determined from pectin extracted in
10% ChCl:Urea because of its gelling structure formation. Based on recent study by
Begum et al. (2017), high ash content in the pectin extracted might occur due to the
short time taken to precipitate the pectin. The longer the time required precipitating
the pectin, the higher the ability of pectin to become gel. High ash content can be
reduced by washing the pectin precipitate with acidify alcohol to enhance the gelling
structure. Hence, both 10% ChCl:EG and 10% citric acid were able to extract pectin
with low ash contents, which are suitable for the gelling formation.
Methoxyl content. Methoxyl content was determined by the saponification of
pectin and titration of the liberated carboxyl group (Cui et al. 2017). The methoxyl
content of pectin extracted using 10% citric acid (15.6%), 10% ChCl:Urea (11.7%)
and 10% ChCl: EG (15.7%) as referred in Table 36.2 was almost similar to pectin
obtained from guava fruit (11.4%) by Omar and Ku Abdullah (2000), who used
hydrochloric acid as extracting medium. The pectin from guava peels obtained in
this study can be categorized as high methoxyl pectin (HMP) because the methoxyl
content is more than 7% (Ismail et al. 2012). According to Das et al. (2016), HMP
can form gels with low addition of solvent that resulted from the stabilization of
hydrogen bond and the hydrophobic interaction between the methyl esters group.
Hence, both 10% citric acid and 10% ChCl:EG have successfully extracted HMP
that is expected to perform gel easily. The ability of these two solvents to extract
pectin that forms gel rapidly have been proved through the ash content determination,
previously.
Anhydrouronic acid (AUA) content. AUA content was a crucial factor to deter-
mine the pectin purity and to calculate its degree of esterification. Based on the results
in Table 36.2, the values of AUA content obtained from pectin extracted using 10%
citric acid (39.98%), 10% ChCl:Urea (27.38%) and 10% ChCl:EG (26.96%) were
lower than pectin extracted from apple pomace (65%) using citric acid (Sharma et al.
2014). All the AUA content values in this study were less than 65%, which indicate
low purity of pectin was produced. Omar and Ku Abdullah (2000) stated that low
AUA content was obtained due to the presence of starch, sugar and protein in the
precipitated pectin. Therefore, it is suggested to purify the pectin extracted in order
to obtain high purity of pectin.
Degree of esterification (DE). Based on the results, pectin extracted using 10%
ChCl:EG (1:2) and 10% citric acid both showed the highest DE values of 98.47 and
95.17%, respectively. According to Naghshineh et al. (2013), the DE values of pectin
that are more than 70% are considered as rapid gelling rate while less than 60% was
considered as slow gelling rate. Hence, the determination of DE had confirmed the
ability of both 10% ChCl:EG and 10% citric acid to extract pectin with high potential
of producing gel. Low DE value of pectin extracted using ChCl:Urea (65.88%) was
almost similar to DE values of pectin extracted from guava fruit peels using citric
acid (53.4%), as reported by Bhat and Singh (2014).
Water solubility. In the first part of testing, the extracted pectin was stirred at
20 °C for 25 min, centrifuged, dried and weighed for the measurement of water
solubility. As shown in Table 36.2, the water solubility of pectin extracted using
430 R. Yusof et al.
DES, 10% ChCl:Urea (75%) and 10% ChCl:EG (60%), was reported to be higher
than pectin extracted with 10% citric acid (50%). In the second part of testing, the
extracted pectin was stirred and incubated at 40 °C for 30 min. Figure 36.2 shows
that the pectin extracted using 10% ChCl:Urea was completely soluble in water.
Meanwhile, the pectin extracted with 10% citric acid and 10% ChCl:Urea was not
fully soluble and the gelation was produced in the pectin solution extracted with
ChCl:EG. According to Gan et al. (2010), low solubility of pectin was due to the
hydrolysis of glycosidic linkages that caused pectin degradation at low pH. The
extracting solvent features such as temperature, pH, nature and its concentration
affect the solubility of pectin. A high solubility of pectin will be useful in food
processing.
Foaming capacity and foaming stability. Figure 36.3 shows the foaming capac-
ity of pectin extracted using 10% citric acid, 10% ChCl:Urea and 10% ChCl:EG at
three different concentrations (1, 3 and 5%). From the results, it was observed that
Fig. 36.2 The water solubility of pectin extracted using a 10% citric acid, b 10% ChCl:Urea and
c 10% ChCl:EG
PecƟn extracted using 10% citric acid

70 PecƟn extracted using 10% ChCl:Urea
PecƟn extracted using 10% ChCl:EG
Foaming capacity (%)
60
50
40
30
20
10
0
1% 3% 5%
Concentration of pectin (cm3)
Fig. 36.3 Foaming capacity of pectin extracted using 10% citric acid, 10% ChCl:Urea and 10%
ChCl:EG at different concentrations of 1, 3 and 5%
10% citric acid 10% ChCl:Urea 10% ChCl:EG

80
Foaming stability %
60 65 65
55 55
50
40
30 30
25 25 25
20 20 20 20 20 20
0
0 mins 15 mins 30 mins 45 mins 60 mins
Times taken
Fig. 36.4 Foaming stability of pectin extracted using 10% citric acid, 10% ChCl:Urea and 10%
ChCl:EG in 5% pectin concentration after each 15 min
the foaming capacity increased as the concentration of pectin increased. The high-
est foaming capacity was found in 5% concentration of pectin extracted using 10%
citric acid (58%), followed by 10% ChCl:EG (27%) and 10% ChCl:Urea (20.76%).
Hence, both DESs show lower ability in extracting pectin produce and more foam
compared to citric acid. Figure 36.4 shows the foaming stability of all pectins at 5%
concentration after each 15 min. It was observed that although pectin extracted using
10% citric acid show high foaming capacity, but the foaming stability slowly reduced
after 15 min, from 65 to 55%. Even though pectin extracted using 10% ChCl:Urea
and 10% ChCl:EG show low foaming capacity, their foam are much more stable
than pectin extracted using 10% citric acid. The foam from pectin extracted with
10% ChCl:Urea reduced in 5% after 15 min, while the foam from pectin extracted
with 10% ChCl:EG was maintained unchanged even after 60 min.
36.4 Conclusion
In a nutshell, two ChCl-based DESs with different hydrogen bond donors of urea and
ethylene glycol (EG) were successfully synthesized and able to extract pectin from
grinded guava peels. The results indicated that the best extraction method to replace
conventional method was by using 10% ChCl:EG (1:2), which gave higher pectin
yield of 37.1% compared to 10% citric acid and 10% ChCl:Urea with values of 29.2
and 16.4%, respectively. From the results, it was interesting to find that 10% ChCl:EG
is the best solvent to extract pectin with better gelling properties (2% ash content,
15.7% methoxyl content and 98.47% DE), which are comparable to the citric acid.
Hence, 10% ChCl:EG (1:2) shows a high potential to extract pectin as it was able to
produce high percent yield as well as producing pectin with high ability to form gel
rapidly, which can be suggested to be used as gelling agent in food processing.
Acknowledgements The authors acknowledge support from the Fundamental Research Grant
Scheme (FRGS/1/2018/STG01/UITM//02/17) of the Ministry of Higher Education, Malaysia. They
would also like to thank Universiti Teknologi MARA Perlis for providing the facilities used in this
work.
432 R. Yusof et al.
References
Abbott AP, Capper G, Davies DL, Rasheed RK, Tambyrajah V (2003) Novel solvent properties of
choline chloride/urea mixtures. Chem Commun 70–71
Begum R, Aziz MG, Yusof YA, Burhan M (2017) Extraction and characterization of pectin from
jackfruit (Artocarpus heterophyllus Lam) waste. IOSR J Pharm Biol Sci (IOSR-JPBS) 12(6):42–
49
Bhat SA, Singh ER (2014) Extraction and characterization of pectin from guava fruit peel. Int J Res
Eng Adv Technol 2(3):1–7
Cano-Medina A, Jiménez-Islas H, Dendooven L, Herrera RP, González-Alatorre G, Escamilla-Silva
EM (2011) Emulsifying and foaming capacity and emulsion and foam stability of sesame protein
concentrates. Food Res Int 44(3):684–692
Castillo-Israel KAT, Baguio SF, Diasanta MDB, Lizardo RCM, Dizon EI, Mejico MIF (2015)
Extraction and characterization of pectin from Saba banana [Musa’saba’(Musa acuminata x Musa
balbisiana)] peel wastes: a preliminary study. Int Food Res J 22(1):202–207
Cui S, Yao B, Gao M, Sun X, Gou D, Hu J, Liu Y (2017) Effects of pectin structure and crosslinking
method on the properties of crosslinked pectin nanofibers. Carbohyd Polym 157:766–774
Das AK, Sharma M, Mondal D, Prasad K (2016) Deep eutectic solvents as efficient solvent system
for the extraction of κ-carrageenan from Kappaphycus alvarezii. Carbohyd Polym 136:930–935
Devi WE, Shukla RN, Abraham A, Jarpula S, Kaushik U (2014) Optimized extraction condition
and characterization of pectin from from orange peel. Int J Res Eng Adv Technol 2(2):1–9
Dranca F, Oroian M (2018) Extraction, purification and characterization of pectin from alternative
sources with potential technological applications. Food Res Int 113:327–350
Gan CY, Abdul Manaf NH, Latiff AA (2010) Physico-chemical properties of alcohol precipitate
pectin-like polysaccharides from Parkia speciosa pod. Food Hydrocoll 24(5):471–478
García-Argüelles S, Serrano MC, Gutiérrez MC, Ferrer ML, Yuste L, Rojo F, Del Monte F (2013)
Deep eutectic solvent-assisted synthesis of biodegradable polyesters with antibacterial properties.
Langmuir 29(30):9525–9534
Girma E, Worku T (2016) Extraction and Characterization of pectin from selected fruit peel waste.
Int J Sci Res Publ 6(2):447–454
Ismail NS, Ramli NM, Hani N, Zainuddin (2012) Extraction and characterization of pectin from
dragon fruit (Hylocereus polyrhizus) using various extraction conditions. Sains Malays 41(1):41–
45
Liew SQ, Ngoh GC, Yusoff R, Teoh WH (2017) Acid and deep eutectic solvent (des) extraction of
pectin from pomelo (Citrus grandis (L.) Osbeck) peels. Biocatal Agric Biotechnol 17:26
Maria B, Gama V, Eduardo C, Silva DFOLM, Karla A, Abud DS (2015) Extraction and
characterization of pectin from citric waste. Ital Assoc Chem Eng 44:259–264
Meng X, Ballerat-Busserolles K, Pascale H, Jean-Michel A (2016) Impact of water on the melting
temperature of urea + choline chloride deep eutectic solvent. New J Chem 1–19
Naghshineh M, Olsen K, Georgiou CA (2013) Sustainable production of pectin from lime peel by
high hydrostatic pressure treatment. Food Chem 136(2):472–478
Omar N, Ku Abdullah KH (2000) Pectin content of selected local fruit by-products. J Trop Agric
Food Sci 28(2):195–201
Sayah MY, Chabir R, Benyahia H, Kandri YR, Chahdi FO, Touzani H, Errachidi F (2016)
Yield, esterification degree and molecular weight evaluation of pectins isolated from orange
and grapefruit peels under different conditions. Public Libr Sci (PLOS) 11(9):1–16
Shafie MH, Yusof R, Gan CY (2019) Deep eutectic solvents (DES) mediated extraction of
pectin from Averrhoa bilimbi: optimization and characterization studies. Carbohyd Polym
216(January):303–311
Sharma PC, Gupta A, Kaushal P (2014) Optimization of method for extraction of pectin from apple
pomace. Indian J Nat Prod Resour 5(2):184–189
Yancheva N, Markova D, Murdzheva D, Vasileva I, Slavov A (2016) Foaming and emulsifying

properties of pectin isolated from different plant materials Acta Scientifica Naturalis Foaming and
emulsifying properties of pectin isolated from different plant materials. Acta Sci Nat 3(1):7–12
Yang Y, Wang Z, Hu D, Xiao K, Wu JY (2018) Efficient extraction of pectin from sisal waste by
combined enzymatic and ultrasonic process. Food Hydrocoll 79:189–196
Zdanowicz M, Wilpiszewska K, Spychaj T (2018) Deep eutectic solvents for polysaccharides
processing. A review. Carbohydr Polym
Chapter 37
Mechanical Properties of Silane-Treated
Eggshell Powder on Unsaturated
Polyester Composite
Nor Mazlina Abdul Wahab, Mohammad Azri Md Hanafiah,

Dalina Samsudin, Mohd Syamaizar Mustafa, Zuliahani Ahmad
and Sharifah Nafisah Syed Ismail
Abstract The unsaturated polyester (UPE) filled silane-treated eggshell powder

(ESP) composite was successfully prepared by hand lay-up technique. Different
amount of treated ESP (0, 10, 20, 30 and 40 php) were incorporated into UPE in
order to produce UPE/ESP composite. The effect of treatment on ESP was evalu-
ated by FTIR. The FTIR spectrum showed the removal of hydroxyl group at peak
3345.08 cm−1 after treated with silane. There is presence of silanol group at peak 1086
and 849.73 cm−1 that appear for treated ESP as well. Tensile and hardness tests were
done to determine the effect of treated filler loading on mechanical properties of com-
posite. Increased amount of ESP loading has gradually decreased the tensile strength
and percentage elongation at break of the composites. However, tensile modulus and
hardness has gradually increased with increased amount of ESP loading. Further-
more, composites with greater ESP loading exhibit more water absorption. Thus,
treated ESP can be used as a potential filler in development of polymer composite.
Keywords Unsaturated polyester · Eggshell · Silane coupling agent · Polymer

composite
N. M. Abdul Wahab (B) · M. A. Md Hanafiah · D. Samsudin · M. S. Mustafa · Z. Ahmad ·

S. N. Syed Ismail
Perlis, Malaysia
M. A. Md Hanafiah
e-mail: azrihanafiah96@gmail.com
D. Samsudin
e-mail: dalina@uitm.edu.my
Z. Ahmad
e-mail: zuliahani@uitm.edu.my
S. N. Syed Ismail
e-mail: sharifahnafisah@uitm.edu.my

436 N. M. Abdul Wahab et al.
37.1 Introduction
Eggshell, known as bio-filler, presents abundantly as waste material from household

and food industry. Most eggshell waste is disposed in landfills or turned into low
value protein supplements for animal feed (Iyer and Torkelson 2014). According to
Department of Veterinary Services Ministry of Agriculture and Agro-Based Industry,
the output of livestock products in Malaysia from 2011 to 2017 had been increasing
year by year. This includes the production of egg. Eggshell represents 11% of the
weight of eggs (Zieleniewska et al. 2016), which is easily obtained as a waste from
cafeteria, restaurant and other places. This waste may lead to pollution because
it favours the microbial action (Sasikumar and Vijayaraghavan 2006). The eggshell
biomaterial is composed of 95% by weight of calcium carbonate which is in the form
of calcite, while the other 5% is composed of organic materials such as aluminium
oxide, silicone oxide, sulphur, chlorine, chromium (III) oxide and manganese (II)
oxide (Zieleniewska et al. 2016; Hassan et al. 2012).
Recently, there are studies done using eggshell as a filler in natural rubber (Ramesh
et al. 2018) and thermoset materials like epoxy and polyester resin (Ahmer et al.
2018; Pavan et al. 2016; Heriyanto et al. 2019) to investigate the potential used of
this material in preparing polymer composite for cost reduction and preservation of
environment from solid waste disposal. Eggshell is the right choice of filler because
they are made up of calcium carbonate (Ramesh et al. 2018). Stanislav Petrasek and
Miroslav (2017) used different amount of eggshell microparticles filler in epoxy resin
to evaluate its effect on mechanical properties of composite.
In development of polymer composite, compatibility of constituents’ material
needs to be considered in the first place. Chemical modification of filler surface helps
in improving compatibility by dispersing filler in polymer matrix more effectively.
Inorganic materials usually require chemical modifications to increase filler/polymer
interaction (Shuhadah and Supri 2009). Silane coupling agent was used for improv-
ing fibre/matrix interaction, hence, better interlocking with the polyester matrix
occurs due to rougher surface topography of silane-treated fibres surface existed
(Pothan et al. 2006). According to Heriyanto et al. (2019) with addition of amino
silane coupling agent, the adhesion between epoxy resin and powder filler were
improved significantly, hence, mechanical properties of the composite is significantly
improved.
In this study, the mechanical properties of UPE/ESP composites obtained with
coupling the surface with 3-aminopropyltriethoxysilane were investigated. There-
fore, the potential of eggshell waste as a filler in polymer composite could be deter-
mined. Perhaps, this solid waste can be used with beneficial along with the cost
reduction of composite produced.
37 Mechanical Properties of Silane-Treated Eggshell Powder … 437
37.2 Experimental
37.2.1 Materials
The eggshell (ES) was obtained from a local area in Perlis, Malaysia and was
ground until it became powder. Unsaturated polyester (UPE) with the grade Reversol
P 9509, methyl ethyl ketone poroxide (MEKP) catalyst, ethanol and silane coupling
agent, 3-aminopropyltriethoxysilane (3-APE) were obtained from Zarm Scientific
and Supplies Sdn. Bhd., Butterworth, Pulau Pinang.
37.2.2 Preparation of Eggshell Powder (ESP)
The eggshell (ES) was cleaned with water manually to remove a white inner mem-
brane and dried at 70 °C for 24 h. The dried ES was crushed and ground into powder
form in a pulverizer. The powder was then sieved with a 150 µm size sieve.
37.2.3 Filler Treatment
3-APE was diluted in ethanol solution. The amount of 3-APE used is 3% by weight
of filler. The filler was charged into a chamber mixer and the solution was added
slowly to ensure uniform distribution of 3-APE. The filler was then continuously
mixed for 1 h by mechanical stirrer at 200 rpm. The treated filler then dried at 70 °C
for 24 h to enable complete evaporation of ethanol.
37.2.4 Preparation of Composites
The hand lay-up technique has been used for preparation of UPE/ESP composites.
Initially, the ESP was added into UPE and stirrer manually at room temperature
and then, 2 php of MEKP catalyst was added. The gelling time of the mixture has
been observed and recorded. The composites were poured into a mould (150 mm
× 150 mm × 2 mm) and cured in an oven at 70 °C at 10 min. The composition of
treated ESP in preparation of UPE/ESP composites are 0, 10, 20, 30 and 40 php.
37.2.5 Fourier-Transform Infrared Spectroscopy (FTIR)
The FTIR analysis for the untreated and treated ESP was performed by Spectrum-
RX1. The spectrum was run using the range of frequencies from 4000 to 400 cm−1
with scanning period of 20 s. The KBr pellet technique was applied in preparation
of sample for FTIR.
37.2.6 Mechanical Testing
Tensile Test. Tensile test was carried out according to ASTM D 638 using a tensile
tester machine, Model HZ-1003B with 20 kN load cell at laboratory temperature.
Rectangular bar specimen, with the dimensions of 150 mm in length, 15 mm in
width and 3 mm in thickness were cut by using cutter machine. The gauge length of
samples was set at 100 and the test was performed at cross head speed of 5 mm/min.
Tensile properties of five identical samples on each composition were measured and
the average values were reported. Tensile strength, tensile modulus and elongation
at break were recorded and automatically calculated by the instrument software.
Hardness Test. The Shore Durometer hardness tester type D was used to measure
the hardness of composite specimens based on standard ASTM D-2240 by measuring
the depth of an indentation in the material using constant force. Hardness test was
done at laboratory temperature. The readings at five different positions of samples
were taken after 10 s during the test period.
37.2.7 Physical Testing
Water Absorption Test. The water absorption test was performed based on the
ASTM standard D750-95. Specimens with dimension of (1 cm × 3 cm × 0.2 cm)
were dried in an oven at 50 °C for 24 h (Pothan et al. 2006). Dry specimens were
immersed in distilled water at room temperature. The water absorption has been
identified by weighing the specimen at certain period. The weight was measured
using an electronic balance. The percentage of the water absorption (Mt) has been
determined by using this formula:
Mt = (W N − Wd )/Wd × 100% (37.1)
where W N is the wet specimen weight and W d is the dry specimen weight. The
average weight of specimens that has been used was taken.
37.3.1 FTIR
The FTIR analysis was carried out to identify the presence of functional groups on
the surface of ESP to reveal the possible changes in the functional groups, which
occurred after the surface treatment. Thus, FTIR analysis was undergone in order
to acquire the peak equivalent to the functional group present in the treated and
untreated ESP. Figure 37.1 displays the FTIR spectra for treated and untreated ESP.
The FTIR spectra for treated ESP show the peak with wavelength of 1085.5 cm−1 .
The wavelength is referring to Si–O–C stretching (chain) that was assigned to
the region around 1086 cm−1 (Prapainainar et al. 2016). In addition, the peak of
849.73 cm−1 in treated ESP spectra revealed the presence of Si–O–H chain (Yamaura
et al. 2004). Besides, the major important evidence to confirm the success of the sur-
face modification using 3-APE was shown by the decrease in intensity of the OH
(hydroxyl) groups with peaks at 3345.18 cm−1 that has been shown in untreated FTIR
spectra (Wang et al. 2010). This was due to the OH group of ESPs reacting with the
alkoxy group of silanes (Prapainainar et al. 2016). Thus, the OH groups suddenly
disappeared. Thus, it can be confirmed that the success of the silane treatment on
ESP is achieved.
100
95
90
TransmiƩance (%)
85
80
75 1085.5cm-1
70 849.73cm-1
65
60
55
4000 3750 3500 3250 3000 2750 2500 2250 2000 1750 1500 1250 1000 750
Wavenumbers (cm-1)
Untreated ESP Treated ESP
Fig. 37.1 The FTIR spectra of untreated and treated ESP

37.3.2 Tensile Properties
Figure 37.2 reveals the trends of tensile strength for UPE/ESP composites. The
increasing of filler loadings led to gradual decreasing of tensile strength of com-
posites, which is due to poor wettability and dispersion of ESP in UPE matrix. At
lower loading (10 php ESP), rich area of UPE matrix contributed to higher tensile
strength of the composite, because of good wettability of ESP filler in UPE resin. In
addition, good interfacial adhesion between ESP and UPE because of silane coupling
agent improved surface interaction between filler and matrix which contributed to
comparable results between neat UPE and UPE incorporated with 10 php of ESP.
There is formation of agglomeration of the filler as more amount are used. Hence,
it resulted in non-uniform dispersion of filler particulates, which caused the forma-
tion of stress concentration points. Thus, it further reduced the tensile strength of
composite (Nayak et al. 2015). The poor interfacial adhesion with the matrix also
existed due to the increasing agglomeration of ESP in UPE matrix as the amount
of ESP increased. There was an area of composite with the weakest spot, where the
crack tended to be initiated and propagated, which led to failure. This result agrees
with Abdullah et al. (2011) who used eggshell as a filler in high-density polyethylene
(HDPE) polymer matrix.
The tensile modulus of the composite in Fig. 37.3 gradually increased as the filler
loading increased from 10 to 40 phr, which showed addition of ESP increased the
stiffness of composites, meaning, the composite has better resistant to deformation
by the increasing amount of ESP filler in UPE matrix. It can withstand higher loads
during deformation process. Hence, tensile modulus was higher. Syuhadah and Supri
(2009) stated that at higher filler loading, the composite will be able to withstand
greater loads. Nayak et al. (2015) observed similar trend of observation, where addi-
tion of eggshell filler has increased tensile modulus of the composite. On top of that,
the increase in modulus can be related to well-dispersed rigid eggshell filler that
23.5
25 22.6
20
Tensile strength (MPa)
20 18.1 17.5
15
10
0
0 10 20 30 40
ESP filler loading (php)
Fig. 37.2 The effect of ESP filler loading on tensile strength of UPE/ESP composite
2500 2213
2057 2082
Tensile modulus (MPa)
2000 1806
1547
1500
1000
500
0
0 10 20 30 40
Fig. 37.3 The effect of ESP filler loading on tensile modulus of UPE/ESP composite
enhanced the modulus of the composites as well, as claimed by Krishnan and John
(Iyer and Torkelson 2014). Therefore, based on this research, it can also be due to
better interaction and adhesion between ESP and UPE since the eggshell used in this
study has been treated with silane coupling agent. The presence of silane coupling
agent (3-APE) improved the compatibility and fibre/matrix adhesion between filler
and matrix, which resulted in increase in the stiffness of composite (Nor Mazlina
and Salmah 2017). Other than that, increasing of ESP filler loading tended to reduce
the molecular mobility of polymer matrix, which resulted in less flexible material
and higher stiffness (modulus) of the composite obtained. Ardhyananta et al. (2007)
found that increased modulus with increasing filler loading was due to the presence
of more rigid filler and good interaction between the filler and the matrix. Hence, the
increased modulus corresponds to more filler incorporated in polymer matrix.
The effect of ESP filler loading on elongation at break of UPE/ESP composite
are presented in Fig. 37.4. The elongation at break of UPE incorporated with ESP
3
2.5
ElongaƟon at break (%)
2.3
2.5
2 1.74 1.64
1.52
1.5
0.5
0
0 10 20 30 40
Fig. 37.4 The effect of ESP filler loading on elongation at break of UPE/ESP composite
composites decreased with the increased amount of ESP. This observation agrees
with the increasing stiffness as discussed above. The less flexible material obtained,
the composite became more brittle as the amount of ESP increased. Hence, it reduced
the percentage elongation at break of the composite. Ardhyananta et al. (2007) found
the similar trend of observation. The reduction of elongation at break when the filler
was loaded was increasing due to the stiffening and hardening of the composites when
incorporated with high amount of filler into polymer matrix (Shuhadah and Supri
2009). Shuhadah and Supri (2009) also claimed that the decreasing of elongation at
break with the increasing of filler loading was due to the incapability of the filler to
support the stress transferred from the filler to polymer matrix. Stanislav Petrasek
and Miroslav (2017) also found the similar trend of result, where addition of eggshell
filler from 10 to 40 wt% has reduced elongation at break of epoxy composite.
37.3.3 Hardness
Figure 37.5 demonstrated the results for hardness of UPE/ESP composites. It is

clearly seen that the hardness of the UPE/ESP composites at different filler loading
(10, 20, 30, 40 phr) was higher.
It is gradually increased, as the above properties. This finding is parallel and
supported by the above results on the increase in tensile modulus and decrease in
percentage elongation at break of the composite. Hardness is a very simple and quick
method used as the evident to indicate the stiffness of the material. Generally, higher
hardness result represents the higher stiffness of the material. This observation agrees
with the study by Onuoha et al. (2017) who found the increase in hardness of the
composite as filler loading increased. The higher the filler loading incorporated, the
harder the material, and the more rigid it becomes. Similar trend was also found
by Krishnan and John (Iyer and Torkelson 2014) and Ruaa Haithan Abdel-Rahim
(2019) when using eggshell as a filler in preparing polymer composite.
65
64 64.2
Hardness (Shore D)
63 63.8
62 63
62.4
61
60 60
59
58
57
0 10 20 30 40
Fig. 37.5 The effect of ESP filler loading on hardness of UPE/ESP composite
8
7
Percentage of water
6 6.78 6.17
absorpƟon (%)
5 5.29
4 4.28
3 3.79
2
1
0
0 10 20 30 40
Fig. 37.6 The effect of ESP filler loading on water absorption of UPE/ESP composite
37.3.4 Water Absorption Test
Figure 37.6 depicts the result of water absorption as increased amount of ESP is
incorporated in UPE resin. From this figure, the composite with relatively higher
ESP filler content has more percentage of water absorption. However, at the highest
amount of ESP (40 php), there is a little bit reduction in the value. The eggshell
surface is hydrophilic in nature. Calcium carbonate (CaCO3 ) content in ESP which
is up to 95% has led to this characteristic. Oxygen in CaCO3 has the capability to have
bonding with water molecule. Hence, as greater amount of ESP is incorporated in the
composite, it results in more water absorption. Moreover, as the ESP filler content
increases, there is formation of agglomeration of ESP filler in UPE that tends to result
in inhomogeneity between the two components of constituent’s material. Therefore,
it increases water absorption of the composite. According to Abdullah et al. (2011),
water absorption of the composite increases as higher amount of ESP incorporated
in the polymer matrix, which is due to agglomeration of the filler inside the matrix.
This result also agrees with Shuhadah and Supri (2009) on the similar type of filler
incorporated in polymer matrix.
37.4 Conclusion
In conclusion, the influence of treated ESP filler loading on mechanical properties

and water absorption of ESP/UPE composites were investigated. Tensile strength
and elongation at break of the composite is reduced; meanwhile tensile modulus and
hardness is better by the increased amount of ESP in UPE matrix. Water absorption
of the composites increased due to the agglomeration of filler as filler loading is
increased. The FTIR spectra confirm the interaction between ESP and matrix is
enhanced by addition of silane coupling agent as the new peak exists. The possible
application of produced composites is in construction part, body for vehicle like boat
and train and panel in car.
References
Abdullah AH, Rusel DS, Abdulwahab AS (2011) Water absorption and mechanical properties
of high—density polyethylene/egg shell composite. Journal of Basrah Researches (Sciences)
37(3A):36–42
Ahmer HS, Yuqi Z, Xiaodong X, Abdul QD, Xiao L, Shuo W, Wenbin L (2018) Reinforcement of
stearic acid treated egg shell particles in epoxy thermosets: structural, thermal, and mechanical
characterization. Materials 11:1872
Ardhyananta H, Ismail H, Takeichi T (2007) Effects of organoclay loading and ethylene gly-
col on mechanical, morphology and thermal properties of ethylene vinyl acetate/organoclay
nanocomposites. J Reinf Plast Compos 26(8):789–806
Hassan SB, Aigbodion VS, Patrick SN (2012) Development of polyester/egg shell particulate
composites. Tribol Indsutry 34(4):217–225
Heriyanto B, Farshid P, Veena S (2019) Effect of different waste filler and silane coupling agent on
the mechanical properties of powder-resin composite. J Clean Prod 224:940–956
Iyer KA, Torkelson JM (2014) Green composite of polypropylene and eggshell: effecive biofiller size
reduction and dispersion by single step processing with solid state-shear pulverization. Compos
Sci Technol 10:152–160
Nayak SY, Srinivas Shenoy H, Sharma P, Aman I, Dey S (2015) Use of egg shell particulate as
fillers in e-glass/epoxy composites. In: proceeding of international conference on mechanical
engineering and industrial automation. Research Gate, Dubai, pp. 21–25
Nor Mazlina AW, Salmah H (2017) The influence of filler loading and the chemically modified
filler surface on the mechanical properties of palm kernel shell reinforced polyester composites.
Solid State Sci Technol 25(2):71–78
Onuoha C, Onyemaobi OO, Anyakwo CN, Onuegbu GC (2017) Effect of filler loading and particle
size on the mechanical properties of periwinkle shell-filled recycled polypropylene. Am J Eng
Res 4:72–79
Pavan H, Manjunath S, Gowri Shankar MC, Mohan NS (2016) Investigation on effect of egg shell
powder on mechanical properties of GRFP composites. Mater Today Proc 5(1):3014–3018
Pothan LA, Thomas S, Groeninckx G (2006) The role of fiber/matrix interactions on the dynamic
mechanical properties of chemically modified banana fiber/polyester composites. Compos Part
A: Appl Sci Manuf 37:1260–1269
Prapainainar C, Kanjanapaisit S, Kongkachuichay P, Holmes SM, Prapainainar P (2016) Surface
modification of mordenite in nafion composite membrane for direct ethanol fuel cell and its
characterizations: effect of types of silane coupling agent. J Environ Chem Eng 4(3):2637–2646
Ramesh G, Jayabalakrishnan D, Rameshkumar C (2018) Mechanical and thermal characterization
of heat/surface treated egg shell filler diffused natural rubber green composite. J Optoelectron
Biomed Mater 10(1):21–28
Ruaa Haithan Abdel-Rahim (2019) Experimental investigation of some properties of epoxy
reinforced by egg shell particles. Int J Mech Eng Technol 10:152–163
Sasikumar S, Vijayaraghavan R (2006) Low temperature synthesis of nanocrystalline hydroxyap-
atite from egg shells by combustion method. Artif Organs 19:70–73
Shuhadah S, Supri AG (2009) LDPE-isophthalic acid-modified egg shell powder composites
(LDPE/ESPI). J Phys Sci 20(1):87–98
Stanislav P, Miroslav M (2017) Polymeric particle composites based on filler from hen egg-shells.
In: Proceedings of 16th international scientific conference engineering for rural development.
Latvia University of Agriculture, Jelgava, Latvia, pp 175–180
Wang Y, Jiang Z, Li H, Yang D (2010) Chitosan membranes filled by GPT MS-modified zeolite
beta particles with low methanol permeability for DMFC. Chem Eng Process 49(3):278–285
Yamaura M, Camilo RL, Sampaio LC, Macedo MA, Nakamura M, Toma HE (2004) Preparation
and characterization of (3-aminopropyl) triethoxysilane-coated magnetite nanoparticles. J Magn
Magn Mater 279(2–3):210–217
Zieleniewska M, Leszczynski MK, Szczepkowski L, Bryskiewicz A, Krzyzowska M, Bien K,
Ryszkowska J (2016) Development and applicational evaluation of the rigid polyurethanefoam
composites with egg shell waste. Polym Degrad Stab 132:78–86
Chapter 38
Pineapple Leaf Fibre Filled Natural
Rubber Composite: The Effect of Filler
Loading
Mohd Syamaizar Mustafa, Sharifah Nafisah Syed Ismail,

Shafeera Mohd Shaipul Amini, Nor Mazlina Abdul Wahab,
Noor Aishatun Majid and Muhamad Naiman Sarip
Abstract Pineapple leaf fibres (PALF) are a waste of cultivation which is not only
non-carcinogen but it is also cost-effective renewable sources. PALF has high cel-
lulose content which can enhance the mechanical properties of natural rubber. This
study was conducted to investigate the mechanical properties of natural rubber filled
with PALF. Four types of samples with different PALF loadings which were 0, 10,
20 and 30 phr were prepared. 20% phr of PALF gave the highest value in tensile
strength, tensile modulus, hardness and elongation at break of the rubber compound.
The increase in tensile modulus at 100 and 300% elongation indicated that PALF has
improved the stiffness of natural rubber composite. The research shows that PALF
fibre-filled natural rubber compound can be good replacement for synthetic fillers
in the future since they have been environmentally friendly and promote low cost in
production.
Keywords Pineapple leaf fibre · Natural rubber · Natural filler
M. S. Mustafa (B) · S. N. Syed Ismail · S. Mohd Shaipul Amini · N. M. Abdul Wahab ·

N. A. Majid · M. N. Sarip
Perlis, Malaysia
e-mail: syammustafa36@gmail.com
S. N. Syed Ismail
e-mail: sh.nafisah22@gmail.com
S. Mohd Shaipul Amini
e-mail: shafeera@gmail.com
N. M. Abdul Wahab
N. A. Majid
e-mail: nooraishatun@uitm.edu.my
M. N. Sarip
e-mail: naimansarip@uitm.edu.my

448 M. S. Mustafa et al.
38.1 Introduction
Pineapple leaf fibres (PALFs) are regularly alluded to as vegetable filaments (sep-
arated from the leaves) which are harsh and tough and they frame some portions
of the plant’s transportation framework called leaf strands. PALFs are gotten from
the leaves of the plant Ananas Cosomos, having a place with Bromeliaceae family.
As these filaments are indicating an unrivalled of mechanical properties, they have
the potential as strengthening fillers in thermosets, thermoplastics and elastomers.
PALFs are effectively accessible and they have superb mechanical properties. These
filaments indicate high extreme rigidity and beginning modulus since they have high
cellulose content and similarly low microfibrillar edge (Kim and Netravali 2010).
Fewer researches have proven that mechanical properties of polymer composites
can be improved by PALFs as reinforcement filler. Among those researchers, Kasim
et al. (2015) reported on mechanical properties of pineapple leaf fibre reinforced
polypropylene composite with different loadings of fibres. The study found that the
tensile stress of the composite has increased with the increment of PALFs loading
by 12.9 at 30 wt% of PALFs loading. However, the addition of PALF has resulted in
the decrease in hardness and elasticity of Polypropylene (PP) (Kasim et al. 2015).
Another study by Eze et al. (2016) on mechanical properties of pineapple leaf
powder-filled high-density polyethylene (HDPE) showed that the tensile strength,
tensile modulus, flexural strength, abrasion resistance and hardness of the composites
increased as the filler content increased for all the filler contents while the elongation
at break (EB) for PALP/HDPE composites was found to decrease as the filler content
increased for all the filler contents. The tensile strength of PALP/HDPE composites
was increased by 6.49 at 2 wt% of filler content and 30.39 at 10 wt% of filler content.
But for the elongation at break of PALP/HDPE composites was decreased by 2.40
at 2 wt% of filler content and 10.24 at 10 wt% filler content (Eze et al. 2016). There
is a different trend for natural rubber (NR) filled jute fibre for a study conducted by
Pruttipong et al. (2014). This study revealed that the increasing filler content tended
to increase modulus and hardness but decreased tensile strength of NR composite.
Hence, in this study, the effect of PALF loadings on mechanical properties of natural
rubber composite is reported.
38.2.1 Materials
Pineapple leaf fibres (PALFs) were collected at Kg. Rambai, Pauh Perlis, Malaysia.
SMR-L was obtained from Mardec Polymer Sdn. Bhd. Zinc oxide, stearic acid,
2-Mercaptobenzothiazyl Disulfide (MBTS) accelerator, maleic anhydride, sodium
hydroxide (NaOH) and sulphur were purchased from Sigma Aldrich Sdn. Bhd.
38 Pineapple Leaf Fibre Filled Natural Rubber Composite … 449
38.2.2 Surface Modification of PALFs
PALFs were washed thoroughly in the water solution under room temperature. This
cleaning step removed the foreign object and impurities on pineapple leaves. Then,
the fibres were dried in an oven at 70 °C for 24 h. For chemical treatment step, the
fibres were dipped in 5% of NaOH solution for 1 h, washed with distilled water
and dried in air. The treatment was done to promote better adhesion between rubber
matrix and fibre when all the artificial impurities eliminated. In this case, the hydro-
gen bonding in cellulose hydroxyl group of PALFs fibres was destroyed, therefore,
making them strongly bond to the rubber matrix (Geethamma et al. 1998). After
drying, the PALFs were ground into fibre form by using pulveriser with 0.2-µm size
sieve.
38.2.3 Rubber Compounding
The rubber composite was prepared by compounding of rubber with fibre according
to formulations in Table 38.1 by using two roll mills. Maleic anhydride was used
as a coupling agent to improve the adhesion between the fibre and rubber. Natural
rubber was mixed with PALF in an open chamber mixer for 20 min. Then, 5.0 phr
zinc oxide, 2.0 phr of steric acid, 1.0 phr of MBTS, 3.5 phr of maleic anhydride
and 2.5 phr of sulphur were added, respectively. The compounding of rubber was
given 6 mm thickness of the sheet of rubber. It was kept at 25 °C for 24 h prior
to cure assessment on a Moving Die Rheometer, Hung Ta Instrument according to
ASTM D-2084. Then, they were compressed in compression moulding (Yong-Fong
machinery, Ltd., Model YFY HM-100T) a 120 °C, 8 min for vulcanization.
Table 38.1 Formulation of

Ingredients Content (phr)
rubber compounding filled
PALF Natural rubber (Standard Malaysian Rubber, 100
SMR-5L)
Zinc oxide 5
Stearic acid 2
2-Mercaptobenzothiazyl disulfide (MBTS) 1
Pineapple leaf fibre (PALF) 0, 10, 20, 30
Maleic anhydride 0, 3.5
Sulphur 2.5
Tensile testing was done with dumbbell-shaped specimens in accordance to ASTM

D412 and five replicate specimens were subjected to Instron Universal Testing
Machine at crosshead speed of 500 mm/min. Hardness test was measured by using
Shore A Hildebrand hardness tester with random five different points of each sample
were recorded and tested according to ASTM DIN 53505.
38.3.1 Hardness Test
The hardness readings are observed to be directly proportional to the PALF loading,
as the graph of hardness value shown in Fig. 38.1 increases with the increase in PALF
loading. At 0 phr of fibre loading, the value of hardness is 35.35 and at 10 phr of fibre
loading, the value increases to 35.66. At 20 phr of fibre loading, the hardness value is
37.85 and it increases to 48 as the fibre loading at 30 phr. This increasing trend shows
that the addition of PALF in natural rubber (SMR L) leads to the increase of linear
segment in the material (Pittayavinai et al. 2016). This result is expected because as
more filler particles enter the rubber, the elasticity of the rubber chain is reduced,
resulting in more rigid vulcanisates (Kevin et al. 2019). Generally, higher hardness
result represents the higher stiffness of the material. This observation agrees with
the study by Onuoha et al. (2017) who found as the filler loading increases, hardness
reading of the composite increases. The higher the filler loading incorporated, the
harder the material and the more rigid it becomes. According to Ismail et al. (2004),
an increment in hardness can be additionally because of the fortification impact of
the filler and in addition higher degrees of cross-linking of the polymeric materials.
60
Hardness (Shore A)
50
40
30
20
10
0
0 10 20 30
PALF loading (phr)
Fig. 38.1 Effect of different loadings of PALF on hardness

0.5
0.45
Tensile strength (MPa)

0.4
0.35
0.3
0.25
0.2
0.15
0.1
0.05
0
0 10 20 30
PALF loading (phr)
Fig. 38.2 Effect of different loadings of PALF on tensile strength
38.3.2 Tensile Test
The result in Fig. 38.2 indicates that the tensile strength starting to increase to 0.44
from 0.37 MPa.
The tensile strength started to increase at 20 phr and directly proportional
decreased as the increase of the PALF loading. The increasing trend of the tensile
strength at low PALF loading (10 phr) is due to the good fibre–rubber cooperation as
a result of better fibre dispersion in the rubber matrix. As indicated by Ismail et al.
(2004), the more grounded rubber– fibre association would build, the viability of the
stress exchanged from rubber matrix to fibre particles scattered in the rubber matrix.
However, the diminishment in strength at higher fibre loading (more than 20 phr)
presumably is because of the poor dispersion of PALF rubber matrix. This result
agrees with Aji et al. (2013).
38.3.3 Tensile Modulus
Figure 38.3 shows the result of the tensile modulus at 100% (MPa) and 300% (MPa),
respectively. Tensile modulus at 100 and 300% slightly increased with the increase
of PALF loading. According to Muniandy et al. (2012) M100 and M300 are influ-
enced by few factors, for example, surface reactivity which decides the polymer-fibre
cooperation, aggregates, size and state of particles, structure and fibre loading in rub-
ber. The presence of PALF in rubber matrix promotes the formation of rubber-filler
interaction system that leads to increase the stiffness of the rubber (Poh et al. 2002,
Mohd and Othman 2016).
6 5.2
Tensile modulus (MPa )

4.16
5 3.73
Tensile
modulus at
4 300%
3
Tensile
modulus at
2 100%
0.44
0.83 0.84 1.01
1
0 0.19
0 10 20 30
PALF loading (phr)
Fig. 38.3 Effect of different loadings of PALF on M100 and M300
38.3.4 Elongation at Break
Elongation at break is the capacity of material to oppose changes in shape with-

out crack formation and is expressed in percentage, in which the level of unique
benchmark length accomplished before break. The graph trend in Fig. 38.4 shows
the increase in the value of elongation at break as the PALF loading increases to
20 phr. The unfilled PALF shows the value of elongation at break is 66.81%. The
value of elongation at break starting to increase with the value 366.81% initially and
continues to increase to 441.67% as the PALF loading is 20 phr. However, the value
of elongation at break upon addition of PALF loading at 30 phr in which the reading
recorded is 348.75%. According to Ismail et al. (2004), as more filler is joined into
0.5
0.45
0.4
Elongation at break (%)
0.35
0.3
0.25
0.2
0.15
0.1
0.05
0
0 10 20 30
PALF loading (phr)
Fig. 38.4 Effect of different loadings of PALF on elongation at break

the elastic network, the elasticity and flexibility of the rubber chain are diminished,
bringing about more inflexible rubber vulcanizates. Hence, the increase of PALF
loading in rubber matrix resulted in composites becoming stiffer and harder. This
will reduce the composite resilience and toughness and leads to lower elongation at
break.
38.4 Conclusion
PALF filled natural rubber composite improves hardness value, tensile modulus and
elongation at break as compared to unfilled natural rubber. The consequences of
the present investigation demonstrate that a valuable composite with great quality
could be effectively created utilizing PALF as the support material for natural rubber
matrix.
References
Aji I, Zainudin E, Abdan K, Sapuan S, Khairul M (2013) Mechanical properties and water
absorption behavior of hybridized kenaf/pineapple leaf fibre-reinforced high-density polyethylene
composite. J Compos Mater 47(8):979–990
Eze IO, Igwe IO, Ogbobe O, Anyanwu EE, Nwachukwu I (2016) mechanical properties of pineapple
leaf powder filled high density polyethylene. Int J Eng Technol 9:13–19
Geethamma VG, Mathew KT, Lakshminarayanan R, Thomas S (1998) Composite of short coir fibres
and natural rubber: effect of chemical modification, loading and orientation of fibre. Polymer
39:1483–1491
Ismail H, Osman H, Ariffin A (2004) A comparative study on curing characteristics, mechanical
properties, swelling behavior, thermal stability, and morphology of feldspar and silica in SMR L
vulcanizates. Polym-Plast Technol Eng 43(5):1323–1344
Kasim AN, Selamat MZ, Aznan N, Sahadan SN, Daud MAM, Jumaidin R, Salleh S (2015) Effect of
pineapple leaf fiber loading on the mechanical properties of pineapple leaf fiber—Polypropylene
composite. Jurnal Teknologi, 77(21)
Kevin SO, Adewale GA, Ayo MD, Joshua OI (2019) Assessment of carbonised wood-flour fillers
on the mechanical properties of natural rubber vulcanisates. Eur J Sustain Dev Res 3(4):1–10
Kim JT, Netravali AN (2010) Mercerization of sisal fibers: effect of tension on mechanical properties
of sisal fiber and fiber-reinforced composites. Compos Part A: Appl Sci Manuf 41(9):1245–1252
Mohd NNA, Othman N (2016) Effect of filler loading on curing characteristic and tensile properties
of palygorskit enatural rubber nanocomposites. Procedia Chem 19:351–358
Muniandy K, Ismail H, Othman N (2012) Effects of partial replacement of rattan powder by
commercial fillers on the properties of natural rubber composites. BioResources 7(4):4640–4657
Onuoha C, Onyemaobi OO, Anyakwo CN, Onuegbu GC (2017) Effect of filler loading and particle
size on the mechanical properties of periwinkle shell-filled recycled polypropylene. Am J Eng
Res 4:72–79
Pittayavinai P, Thanawan S, Amornsakchai T (2016) Manipulation of mechanical properties of short
pineapple leaf fiber reinforced natural rubber composites through variations in cross-link density
and carbon black loading. Polym Test 54:84–89
Poh BT, Ismail H, Tan KS (2002) Effect of filler loading on tensile and tear properties of SMR
L/ENR 25 and SMR L/SBR blends cured via a semi-efficient vulcanization system, 21, 801–806
Pruttipong P, Warunee A, Tawatchai M, Rattiyakorn S, Ketsana A, Hiroyuki H (2014) Effect of

modified jute fiber on mechanical properties of green rubber composite. Energy Procedia 56:641–
647
Chapter 39
Green Synthesis of Silver Nanoparticles
from Ananas comosus Core Extract
and Their Antibacterial Activity
Zainab Razali, Nur Wajihah Masdar, Nor Atikah Husna Ahmad Nasir,
Nur Syafiqah Rahim and Roejhan Md Kawi
Abstract Some research has been made for the green synthesis of silver nanoparti-
cles from plant extracts however it is still limited. Therefore, this study was conducted
to study the presence of green silver nanoparticles and antibacterial activity from
Ananas comosus core extract. The core was extracted with sterile distilled water and
centrifuge at 6000 rpm before incubated at 70 °C for 12 h. Bioreduction of Ag+ to
Ag0 was identified through visual observation from the changes of resultant extract
colour from colourless to dark brown. The formation of nanoparticles was identi-
fied at 24 and 72 h using UV-vis spectroscopy. The antibacterial activity of AgNPs
was investigated at concentration ratios of 1:2 and 1:4 against Escherichia coli and
Staphylococcus aureus. From the result, the spectrum showed a peak between 421
and 424 nm corresponding to the plasmon absorbance of the AgNPs at 72 h of reac-
tion time for both ratios. The results also indicated that at concentration ratio of 1:2
and 1:4 able to inhibit bacterial growth for E. coli and S. aureus with the highest
inhibition zone at 17.67 ± 1.15 mm and 11.67 ± 0.57 mm for E. coli while S. aureus
at 14.0 ± 1.0 mm and 13.0 ± 1.0 mm, respectively. The green approach demonstrated
the potential to synthesis silver nanoparticles using plant extract and have capability
to inhibit the bacterial.
Keywords Green · Silver · Nanoparticles · Ananas comosus · Antibacterial
Z. Razali (B) · N. W. Masdar · N. A. H. A. Nasir · N. S. Rahim

Department of Biology, Faculty of Applied Sciences, Universiti Teknologi MARA, 02600 Arau,
Perlis, Malaysia
e-mail: zainab215@uitm.edu.my
N. W. Masdar
e-mail: nurwajihahms@gmail.com
N. A. H. A. Nasir
N. S. Rahim
e-mail: nursyafiqahrahim@gmail.com
R. M. Kawi
Faculty of Engineering Technology, Universiti Malaysia Perlis, 02100 Padang Besar, Perlis,
Malaysia
e-mail: roejhan@unimap.edu.my

456 Z. Razali et al.
39.1 Introduction
Antibacterial properties of silver have long been known, however currently the greater
proficiency of silver nanoparticles has led to an outburst interest of the industry activ-
ities implemented into applications including treatment of wound, sterilization, food
hygiene, antibacterial fabrics, and more recently drug delivery (Arulvasu et al. 2014).
Nanoparticles are particles between 1 and 100 nm in size (Khan et al. 2017). Pos-
sessing larger surface to volume ratio made these nanosized metallic particles are
unique made and can significantly change physical, chemical, and biological proper-
ties (Zhang et al. 2016). Biological methods under optimized conditions are easy, fast,
non-harmless, reliable, and green methodologies that able to produce definite size
and morphology for translational research among other several synthetic methods
for AgNPs. The conventional physical and chemical methods of silver nanoparticles
synthesis also are expensive and unsafe (Zhang et al. 2016; Gudikandula and Charya
Maringanti 2016).
Nano-sized silver systems present some advantages that make them very fascinat-
ing for a use as antimicrobial agents involve the destruction of cell walls or injury to
cell membrane or proteins and nucleic acids synthesis inhibition of bacteria (Zharfan
et al. 2017). At only a few mg/ml concentrations, full growth inhibition of bacteria
still can occur. Silver present very little systemic toxicity toward humans at these
doses, and is somewhat low-priced (Le Ouay and Stellacci 2015). Silver and its
compounds are also extremely toxic to major species of microorganisms including
bacteria, fungus and viruses.
In the study of metal nanoparticles, it is a concern to evaluate the toxicity effect
as some metal possesses a heavy toxicity in soluble form. The toxicity of silver
nanoparticles mainly depends on the availability of chemical and or biological coat-
ings on the nanoparticle surface (Bindhu and Umadevi 2015; Khan et al. 2017.) The
AgNPs are highly toxic to healthy and normal cells (Sharifi et al. 2012), however
Okafor et al. (2013) argued that AgNPs are not toxic to human cells at low con-
centration but toxic to bacteria cell. Therefore, the aims of these research are to
identify the presence of silver nanoparticles from bioreduction of aqueous AgNO3
using A. comosus core extract, to determine the characterization of silver nanoparti-
cles synthesis from A. comosus core extract using UV-Vis spectrophotometer and to
identify the antibacterial activity of silver nanoparticles synthesized from A. comosus.
39.2 Methods
39.2.1 Preparation of A. Comosus Extract
The core of A. comosus were washed thoroughly with distilled water before being
chopped and blended. Later, were extracted and agitated with distilled water in ratio
1:10 (w/v) at 70 °C and filtered using no. 1 Whatman filter paper. The filtrate was
39 Green Synthesis of Silver Nanoparticles from Ananas comosus … 457
collected and centrifuged at 6000 rpm before incubated at 70 °C for 12 h and kept at
4 °C before further used for the synthesis of nanoparticles.
39.2.2 Synthesis of Silver Nanoparticles Using

the A. Comosus Core Extract
The filtrate of A. comosus core extract was added into 1 mM aqueous AgNO3 to
prepare 1:2 and 1:4 concentration ratios. Then, both solutions were put in shaker
for 30 min. The colour change of the medium after addition of the extract into flask
containing silver nitrate solution into dark brown indicated the formation of silver
nanoparticles.
39.2.3 Characterization
UV-vis spectrophotometer was used to monitor the bioreduction of silver, Ag+ to

Ag0 . The optical absorbance of the spectrophotometer was recorded in 200–800
wavelength range with samples in cuvette operated at 24–72 h interval.
39.2.4 Determination of Antibacterial Activity
Four regions were divided in the Mueller Hinton agar plate as A. comosus extract,
silver nanoparticles biosynthesized from A. comosus extract, a positive control and a
negative control region. The bacteria culture (which has been adjusted to 0.5 McFar-
land standard), was used to lawn Muller Hinton agar plates evenly using a sterile
hockey stick. By using a hockey stick, an amount of 100 µl of bacteria from the sub-
cultured broth was transferred and spread on the agar plate. Disc diffusion method
was used to determine the antibacterial activity of the sample against the selected
bacteria. Gentamicin was used as positive control. These steps were repeated to other
agar plate of another test bacterium. The plates were stored upside down and incu-
bated at 37 °C for 18 h before measuring the diameter of zone of bacterial inhibition
by using a ruler.
39.3.1 Green Synthesis of Silver Nanoparticles from A.

Comosus Core Extract
In this present study, 1:2 and 1:4 concentration ratio of A. comosus core extract to
AgNO3 were used. There is a visible colour change where the intensity of colour
changes from pale yellow and enhanced into dark brown colour after 12 h of incu-
bation at 70 °C. The appearance of dark brown in the reaction mixture indicated
the formation of silver nanoparticles (Ahmad and Sharma 2012; Emeka et al. 2014;
Kagithoju et al. 2015; Anandalakshmi et al. 2016). The synthesized A. comosus core
silver nanoparticles electrons undergoes reduction process of Ag+ into Ag0 caused
the extract turned brown in aqueous solution (Emeka et al. 2014).
The extraction from plants may act both as reducing and stabilizing agent in
nanoparticle synthesis (Sur et al. 2018; Mohammadlou et al. 2016). The colour devel-
opment is due to the excitation of surface plasmon vibration in the metal nanoparticles
(Kagithoju et al. 2015). These colour change from colourless into dark brown indi-
cated that the A. comosus able to reduce silver ion in AgNO3 solution and forming
nanoparticles.
39.3.2 Characterization of AgNP Using UV-Vis

Spectrophotometer
UV-Vis absorption spectra have been proved to be quite sensitive to the formation of
silver colloids because silver nanoparticles exhibit an intense absorption peak due to
the surface plasmon excitation where the absorption band in the 380–450 nm region
is typical for synthesis of AgNPs (Aslan et al. 2005; Rashid et al. 2013; Krishnaraj
et al. 2010). The prepared aqueous solution at different concentration ratio of silver
nanoparticles biosynthesized from A. comosus extract showed different absorption
band at 24–72 h as shown in Figs. 39.1 and 39.2.
The samples for both concentration ratios displayed an absorbance band peak at
around 420 nm which is the typical absorbance reading for silver nanoparticles after
72 h (Ahmad and Sharma 2012; Emeka et al. 2014; Anandalakshmi et al. 2016). They
stated that absorption bands located between 200 to 230 nm involves the transition
of Ag+ ions while the transition of metallic Ag0 appear in the 250–330 nm spectral
range (Mansouri and Ghader 2009) while Ahmad and Sharma (2012) wrote that
weak absorbance at 200 nm showed that the presence of several organic compound
that interact with silver ions in the solution disturbances between 200 and 320 nm
was probably the capping reaction after the reduction of silver nanoparticles. Similar
to this experiment, the UV-VIS spectra of all samples analyzed at 24 h in this study
Fig. 39.1 UV-Vis 72 hours 24 hours

absorption spectra of 0.8
synthesized silver
nanoparticles solution at 1:2 0.7
concentrations at 24 and 72 h 0.6
Absorbance
0.5
0.4
0.3
0.2
0.1
0
200 300 400 500 600
Wavelength (nm)
Fig. 39.2 UV-Vis 24 hours 72 hours

1
absorption spectra of
synthesized silver 0.9
nanoparticles solution at 1:4 0.8
concentrations at 24 and 72 h 0.7
Absorbance
0.6
0.5
0.4
0.3
0.2
0.1
0
200 300 400 500 600
Wavelength (nm)
show distinct absorption signals around 230 nm due to the electronic transitions
involving Ag+ ions.
It can be observed that the value of band peak increase along with time which
corresponds to the study by Ahmad and Sharma (2012), they suggested the effect of
the reaction time on AgNPs synthesis that was evaluated by UV-Vis spectra. Increase
in time reaction cause the peak becomes sharper. It is evident from this study that the
wavelength value varies differently between 24 and 72 h of incubation time. 24 h of
incubation time read the highest absorbance at 220 nm to 230 nm for sample 1:4 and
1:2 concentration ratio while the highest absorbance for 72 h of incubation were at
421 nm and 424 nm respectively (Table 39.1).
Table 39.1 The highest absorbance and wavelength reading from UV-vis spectra
AgNP concentration (mM) 24 h 72 h
Wavelength Absorbance Wavelength Absorbance
1:4 230 0.25 424 0.92
1:2 220 0.42 421 0.74
39.3.3 Antibacterial Activities of Silver Nanoparticles

from A. Comosus Core Extract
From the result shown among all samples, the highest antibacterial activities achieved
by AgNPs in ratio 1:2 with 17.67 ± 1.15 mm and followed by AgNO3 (15.0 ±
1.0 mm) and plant extract (9.0 ± 1.0 mm) for E. coli as illustrated in Table 39.2. Then,
AgNPs from similar ratio showed 14.0 ± 1.0 mm, AgNO3 with 11.33 ± 1.53 mm
and pure plant extract (9.67 ± 0.58 mm) against S. aureus. Next, the AgNPs sample
with ratio 1:4 showed a lower zone of inhibition towards E. coli at 11.67 ± 0.57 mm
followed by AgNO3 at 10.66 ± 1.15 mm and pure plant extract at 8.33 ± 0.58 mm.
Similar concentration ratio of AgNPs showed 13.0 ± 1.0 mm against S. aureus while
10.67 ± 0.57 mm for AgNO3 and 9.33 ± 0.58 mm for plant extract.
According to Table 39.2 and Fig. 39.3 both sample of 1:2 and 1:4 exhibited
inhibition zone towards E. coli and S. aureus using disc diffusion method. According
to study by (Dabesor et al. 2017), the aqueous extract of pineapple showed 15.0 ±
0.10 mm towards E. coli and 14.0 ± 0.11 mm towards S. aureus. The difference
between these values from previous study as compared to the present might be due
to the process of extraction. Ksouri et al. (2009) was claimed about factors such as
Table 39.2 The antibacterial

Bacteria Disc Zone of inhibition
activities of AgNPs from A.
comosus core extract Concentration ratio of A.
comosus extract
1:2 1:4
E. coli Plant extract 9.0 ± 1.0 8.33 ± 0.58
AgNPs 17.67 ± 1.15 11.67 ± 0.57
AgNO3 15.0 ± 1.0 10.66 ± 1.15
Gentamicin 21.67 ± 1.15 23.67 ± 1.15
Distilled water – –
S. aureus Plant extract 9.67 ± 0.58 9.33 ± 0.58
AgNPs 14.0 ± 1.0 13.0 ± 1.0
AgNO3 11.33 ± 1.53 10.67 ± 0.57
Gentamicin 19.33 ± 1.53 18.0 ± 1.73
Distilled water – –
1:2 with E. coli

30
1:4 with E. coli

1:2 with S. aureus
20 1:4 with S. aureus
10
0
Extract AgNPs AgNO Gentamicin
Fig. 39.3 The zone of inhibition of different plant extract towards E. coli and S. aureus
temperature, nature of solvent, extraction time and method significantly affected the
extract composition.
The efficacy of the silver ion solution showed better activity against the gram-
negative E. coli than against the gram-positive S. aureus may be resulted from effect
of the thickness of the peptidoglycan layer, which may prevent the action of the
silver ions through the bacterial cell wall (Pal et al. 2007; Kim and Aga 2007).
Silver nanoparticles also able to anchor, penetrate and cause structural changes to
the permeability of the bacterial cell membrane which leads to death of the cell
(Prabhu and Poulose 2012).
The positive control disc, Gentamicin displayed a high zone of inhibition towards
both bacteria. The aqueous extract of A. comosus showed a remarkable zone of
inhibition for E. coli at 21 mm to 23.67 ± 1.15 mm and S. aureus at 19 mm to 18
± 1.73 mm respectively. It is noted that the zone of inhibition is higher in E. coli as
compared to S. aureus. Sample of AgNPs from 1:2 concentration ratio was suscepti-
ble towards E. coli and was intermediate susceptible towards S. aureus. Meanwhile
AgNPs from 1:4 concentration ratio was resistance towards E. coli but was inter-
mediate susceptible towards S. aureus. Gram negative bacteria are more resistant to
antimicrobial agents due to the existence of an outer membrane permeability barrier
(Ngele and Ibe 2014). These limits access of the antimicrobial agents to their targets
bacterial cell. Based on this present study, the inhibition zone is higher in E. coli
rather than S. aureus made that the biosynthesized AgNPs of pineapple core extract
is a possible antibacterial agent.
39.4 Conclusion
In conclusion, the formation of AgNPs from the synthesized silver nanoparticles

from A. comosus extract in different concentration ratios of 1:4 and 1:2 together with
their antibacterial and toxicity activities has been identified in this present study. The
resulting solution of the synthesized extract turned into dark brown indicating the
reduction of Ag into AgNPs and formation of nanoparticles after 12 h of incubation

at 70 °C for both samples. From the UV-vis spectra, the absorbance value peak at
420 nm, successfully indicating the formation of silver nanoparticles after 72 h left for
reaction. The synthesized silver nanoparticles from A. comosus core extract are able
to inhibit the growth of E. coli and S. aureus at both 1:4 and 1:2 concentration ratios.
The synthesized AgNPs at ratio 1:2 showed higher zone of inhibition as compared
to the AgNPs at ratio 1:4 for both test organisms.
References
Ahmad N, Sharma S (2012) Green synthesis of silver nanoparticles using extracts of Ananas
comosus. Green Sustain Chem 2(04):141
Anandalakshmi K, Venugobal J, Ramasamy V (2016) Characterization of silver nanoparticles by
green synthesis method using Pedalium murex leaf extract and their antibacterial activity. Appl
Nanosci 6(3):399–408
Arulvasu C, Jennifer SM, Prabhu D, Chandhirasekar D (2014) Toxicity effect of silver nanoparticles
in brine shrimp Artemia. Sci World J (1):1–12
Aslan K, Lakowicz JR, Geddes CD (2005) Metal-enhanced fluorescence using anisotropic silver
nanostructures: critical progress to date. Anal Bioanal Chem 382(4):926–933
Bindhu MR, Umadevi M (2015) Antibacterial and catalytic activities of green synthesized silver
nanoparticles. Spectrochim Acta Part A Mol Biomol Spectrosc 135:373–378
Dabesor AP, Asowata-Ayodele AM, Umoiette P (2017) Phytochemical compositions and antimi-
crobial activities of Ananas comosus peel (M.) and Cocos nucifera Kernel (L.) on selected food
borne pathogens. Am J Plant Biol 2(2):73–76
Emeka EE, Ojiefoh OC, Aleruchi C, Hassan LA, Christiana OM, Rebecca M, Temitope AE (2014)
Evaluation of antibacterial activities of silver nanoparticles green-synthesized using pineapple
leaf (Ananas comosus). Micron 57:1–5
Gudikandula K, Charya Maringanti S (2016) Synthesis of silver nanoparticles by chemical and
biological methods and their antimicrobial properties. J Exp Nanosci 11(9):714–721
Kagithoju S, Godishala V, Nanna RS (2015) Eco-friendly and green synthesis of silver nanoparticles
using leaf extract of Strychnos potatorum Linn. F. and their bactericidal activities. 3 Biotech
5(5):709–714
Khan I, Saeed K, Khan I (2017) Nanoparticles: properties, applications and toxicities. Arab J Chem
5(11):1–13
Kim S, Aga DS (2007) Potential ecological and human health impacts of antibiotics and antibiotic-
resistant bacteria from wastewater treatment plants. J Toxicol Environ Health, Part B 10(8):559–
573
Krishnaraj C, Jagan EG, Rajasekar S, Selvakumar P, Kalaichelvan PT, Mohan N (2010) Synthesis
of silver nanoparticles using Acalypha indica leaf extracts and its antibacterial activity against
water borne pathogens. Colloids Surf, B Biointerfaces 76(1):50–56
Ksouri R, Falleh H, Megdiche W, Trabelsi N, Mhamdi B, Chaieb K, Bakrouf A, Magne C, Abdelly
C (2009) Antioxidant and antimicrobial activities of the edible medicinal halophyte Tamarix
gallica L. and related polyphenolic constituents. Food Chem Toxicol 47(8):2083–2091
Le Ouay B, Stellacci F (2015) Antibacterial activity of silver nanoparticles: a surface science insight.
Nano Today 10(3):339–354
Mansouri SS, Ghader S (2009) Experimental study on effect of different parameters on size and
shape of triangular silver nanoparticles prepared by a simple and rapid method in aqueous solution.
Arab J Chem 2(1):47–53
Mohammadlou M, Maghsoudi H, Jafarizadeh-Malmiri H (2016) A review on green silver nanopar-

ticles based on plants: synthesis, potential applications and eco-friendly approach. Int Food Res
J 23(2)
Ngele KK, Ibe E (2014) Prevalence of Fasciolopsis on cattle slaughtered at Eke Market Abattoir
Afikpo, Ebonyi State, Nigeria. Niger J Parasitol 35(1):53–57
Okafor F, Janen A, Kukhtareva T, Edwards V, Curley M (2013) Green synthesis of silver nanoparti-
cles, their characterization, application and antibacterial activity. Int J Environ Res Public Health
10(10):5221–5238
Pal S, Tak YK, Song JM (2007) Does the antibacterial activity of silver nanoparticles depend on
the shape of the nanoparticle? A study of the gram-negative bacterium Escherichia coli. Appl
Environ Microbiol 73(6):1712–1720
Prabhu S, Poulose EK (2012) Silver nanoparticles: mechanism of antimicrobial action, synthesis,
medical applications, and toxicity effects. Int Nano Lett 2(1):32
Rashid MU, Bhuiyan MKH, Quayum ME (2013) Synthesis of silver nano particles (Ag-NPs) and
their uses for quantitative analysis of vitamin C tablets. Dhaka Univ J Pharm Sci 12(1):29–33
Sharifi S, Behzadi S, Laurent S, Forrest ML, Stroeve P, Mahmoudi M (2012) Toxicity of
nanomaterials. Chem Soc Rev 41(6):2323–2343
Sur UK, Ankamwar B, Karmakar S, Halder A, Das P (2018) Green synthesis of silver nanoparticles
using the plant extract of Shikakai and Reetha. Mater Today: Proc 5(1):2321–2329
Zhang XF, Liu ZG, Shen W, Gurunathan S (2016) Silver nanoparticles: synthesis, characterization,
properties, applications, and therapeutic approaches. Int J Mol Sci 17(9):1534
Zharfan RS, Purwono PB, Mustika A (2017) Antimicrobial activity of pineapple (Ananas Como-
sus L. Merr) extract against multidrug-resistant of Pseudomonas Aeruginosa: an in vitro study.
Indones J Trop Infect Dis 6(5):118–123
Chapter 40
Effects of Different Ratios of 45% N,
N-Dimethylformamide (DMF) Solvent
in Reaction with Derived 2D Hybrid
Perovskite C6 H8 N2 PbI3 Prepared
via Nitrogen-Less Method
Azliana Ramli , Mohd Nazari Abu Bakar, Suhaila Sepeai,

Ab Malik Marwan Ali, Nafisah Osman and Wan Izhan Nawawi Wan Ismail
Abstract Contrarily to conventional methylammonium lead iodide of

CH3 NH3 PbI3 , a novel derived 2D hybrid perovskite C6 H8 N2 PbI3 was alterna-
tively produced by reflux method under ambient air condition. In this work, the
effect of different ratios of 45% N, N-dimethylformamide (DMF) in reaction of
dilution with 1 g hybrid perovskite C6 H8 N2 PbI3 crystals was successfully prepared.
Simple solar cells were fabricated by spin-coating method of deposition titanium
dioxide (TiO2 ) layer and liquid-precursor of various 45% DMF ratios onto ITO sub-
strates. The chemical bonding consists of ammonium (NH3 + ), pyridinium (C5 H6 N+ )
and Ar-H ions in both solid and liquid compounds confirmed by FTIR analysis.
A bulk conductivities detected by electrochemical impedance spectroscopy (EIS)
within the range of 10 MHz to 100 kHz and show that the conductivity values are in
between the range of 5.073 × 10−6 and 1.587 × 10−5 S cm−1 which is classified as
semiconductor materials. The stability of the solar cell to produce VDC(max) value of
0.55 ± 0.06 V under sunlight irradiance was systematically retrieved over 30 days.
A. Ramli (B) · M. N. A. Bakar · N. Osman · W. I. N. W. Ismail

Faculty of Applied Sciences, Universiti Teknologi MARA, 02600 Arau, Perlis, Malaysia
e-mail: azliana@uitm.edu.my
M. N. A. Bakar
e-mail: mohdnazari@uitm.edu.my
N. Osman
e-mail: fisha@uitm.edu.my
W. I. N. W. Ismail
e-mail: wi_nawawi@uitm.edu.my
S. Sepeai
Solar Energy Research Institute, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor,
Malaysia
e-mail: suhailas@ukm.edu.my
A. M. M. Ali
Faculty of Applied Sciences, Universiti Teknologi MARA, 40450 Shah Alam, Selangor, Malaysia
e-mail: ammali@salam.uitm.edu.my
466 A. Ramli et al.
Overall, the sustainability and performance of the cells meet the requirements of
light-sensitizer material in future PSCs.
Keywords Amino(methyl)pyridine · Hybrid perovskite · Nitrogen-less method ·

Solar cell · Solar energy materials
40.1 Introduction
Renewable energy is energy collected from renewable resources that can be replen-
ished with the passage of time such as sunlight, wind, tides, waves and geothermal
heat. Renewable energy is one of the solutions to the problem faced by advance
countries over long-standing energy demand. For decades, electricity is generated
in particular from hydropower, wind and solar resources. Evolution of technologies
to transform renewable energy into electricity is necessary for societal progression
(Qiu et al. 2017). Solar energy is one of the clean and free renewable energies and the
conversion of sunlight into electricity energy via a device called photovoltaic (PV).
Various PV generations have been invented and developed in the past half-century
(Kabir et al. 2018). In addition, alternative solar energy provides a solution to the
augmentative care of global warming and greenhouse gases by fossil fuels (Assadi
et al. 2017).
There are several PV technologies using different types of materials and the degree
of maturity levels (Gangopadhyay et al. 2013; Lacerda and Van Den Bergh 2016).
The first generation is a silicon-based (Si) solar cell (Assadi et al. 2017). However,
it is expensive to be manufactured due to high temperature during annealing pro-
cess (Jeon et al. 2014). The second generation of PV changed into organic solar cell
and dye-sensitized solar cell (DSSC). These alternatives are based on thin-film PV
technologies and generally encompass three primary groups of cadmium telluride
(CdTe), copper indium selenide (CIS) and copper indium gallium selenide (CIGS)
(Placzek-Popko 2017). However, these cells suffer from some issues like low power
conversion efficiency (PCE), loss of long-term stability and low conversion efficiency
due to fundamental energy losses related to the interface for charge separation (Jeon
et al. 2014). Perovskite solar cells (PSCs) were developed in 2012 with 15% power
conversion efficiency (PCE) and became a major breakthrough to the transforma-
tion in PV generation (Burschka et al. 2013). Currently, the efficiency of PSCs is
increasing to 20% (Marinova et al. 2017).
Conventionally, one of the multilayers in PSCs is the light-sensitizer of methy-
lammonium lead iodide (CH3 NH3 PbI3 ) consists of hybrid structure of organic and
inorganic perovskite. The preference of the perovskite materials in solar cells is
due to preferable optical properties such as good bandgap tenability, long ambipolar
diffusion length, high optical absorption coefficient, low exciton binding energy,
low possibility of formation of defect-free crystalline film at low temperature,
solution-process and usage of cheap input materials (Jung et al. 2017).
40 Effects of Different Ratios of 45% … 467
By tailoring on the organic part, methylammonium was replaced by

amino(methyl)pyridine (AMP) cation (Li et al. 2007; Yu et al. 2017) to form a novel
nitrogen-less derived 2D hybrid perovskite of C6 H8 N2 PbBr3 (Ramli et al. 2018;
Ramli et al. 2017). The application of N,N-Dimethylformamide (DMF) as solvent
for perovskite has been widely reported by others (Li et al. 2015; Kojima et al. 2009;
Rashad et al. 2016). Yet, there is no detail report on the solvent to transform the crys-
tal form of synthesized hybrid perovskite crystal of AMP-based into liquid-precursor
to be applied as thin film onto certain conductive substrate.
In the present work, the effects of different ratios of 45% DMF solvent in reaction
with novel 2D hybrid perovskite of C6 H8 N2 PbI3 under ambient condition may fill the
gap of knowledge. Properties of the produced materials in terms of chemical, bulk
conductivity and voltage response under sunlight irradiance are presented. The out-
come of this work signifies a potential of AMP-based hybrid perovskite incorporated
with DMF solvent as light-sensitizer medium in layers of future PSCs.
40.2 Experimental
40.2.1 Preparation of Perovskite Crystal
Perovskite crystal was synthesized with the reaction of 1 mL 2-am

ino(methyl)pyridine (2-AMP) and 3.67 g Lead (II) iodide (PbI2 ) in 40% hydroiodic
acid (HI) acid by reflux method at 70 °C within 2 h. The reflux solution was cooled
in ice bath until the temperature drops to 10 °C. Dark-yellowish crystal named as 2D
sample was slowly filtered and dried overnight.
40.2.2 Preparation of Perovskite Liquid-Precursor
The liquid-precursor of the sample was obtained by diluting 1 g of 2D crystal sample

with 45% DMF of 10, 15 and 20 mL The mixture was stirred for 24 h to ensure the
homogeneity of the solution.
40.2.3 Fabrication of Half-ETL Layer Solar Cell
Indium Tin Oxide (ITO)-coated glass (thickness ~3.21 mm) was placed in an ultra-
sonic bath immersed with ethanol for 30 min. TiO2 slurry was prepared by adding
2 g of TiO2 Degussa P25 powder with 5 mL of distilled water. This TiO2 com-
pound will act as an electron transport layer (ETL) in the half-fabricated cell.
Layers of TiO2 and 2D liquid-precursor perovskite samples (various 45% DMF
468 A. Ramli et al.
ratios) were separately deposited onto two different ITO glass substrates using drop-
casting method and dried at room temperature. The coated ITO glass substrates were
sandwiched-attached named as half-fabricated solar cell device.
40.2.4 Characterization
Analysis of functional group of both synthesized perovskite crystal in solid and

liquid-precursor form was done by using the Nicholet FT-IR spectrometer. Bulk
conductivity of the cell was analysed via electrochemical impedance spectroscopy
(EIS) method ranging frequency from 10 MHz to 100 kHz under room tempera-
ture. The thicknesses of the ETL and perovskite layers were observed by scanning
electron microscope (SEM) and image J software. By using digital voltmeter model
Pro’sKit MT-1210, the voltage (VDC ) produced by the half-fabricated solar cell were
consistently measured under sunlight illumination for 30 consecutive days.
The FTIR spectra in Fig. 40.1a shows absorption bands of solid crystal sample in
the regions of 755, 1463 and 3375 cm−1 . These peaks are attributed to the Ar–H,
pyridinium and NH3 + ions, respectively. Meanwhile, Fig. 40.1b shows absorption
bands of liquid-precursor sample after being diluted with 10 mL of 45% DMF. The
result peaks of detected comparable similar to previous research done by Li et al.
(2007) although the synthesis process was done under glove box with N2 atmosphere.
The sample after diluted with 10 mL 45% DMF shows more absorption compared to
solid form as can be seen in Fig. 40.1c. This was related to vibrational energy level
whereby molecules have covalent bonds that contributed to stretch and vibration. The
arrangement of particles in solid and liquid are different. The molecules in liquid
form are loosely arranged, but contrarily in solid, where the molecules are packed
together. Overcome to that, particles in liquid form will move around faster and
collides with each other as it has more space and the attraction force is weaker. It is
supported by the FTIR spectra results which agree that liquid-precursor form absorbs
more energy than solid form.
Bulk conductivity, σ of the fabricated solar cell was measured by ZIVE LAB
WonATech under 210.5 W/m2 of light irradiation by using the formula as below:
t
σ = , (40.1)
RA
where t, R and A are the thickness of layer, resistivity and area of the effective layer,
respectively. The typical Nyquist plots of the cell were shown in Fig. 40.2a–c with
various DMF ratio mixtures.
(a)
86
85
84
Transmission (%)
83
82
3375 cm-1
81
80
79
78 1463 cm-1
77 755 cm-1
76
0 1000 2000 3000 4000 5000
Wavelength (cm-1 )
(b)
80
70
60
Transmission (%)
50
755 cm-1
40 3159 cm-1
30
20
10 1386 cm-1
0
0 1000 2000 3000 4000 5000
Wavelength (cm-1)
(c)
90
80
70
Transmission (%)
60
50
40 solid
30 liquid
20
10
0
0 500 1000 1500 2000 2500 3000 3500 4000 4500
Wavelength (cm-1)
Fig. 40.1 a FTIR spectrum for perovskite in solid form, b FTIR spectrum for perovskite in liquid
form and c overlap FTIR spectra for both solid and liquid-precursor perovskite sample
470 A. Ramli et al.
Fig. 40.2 Nyquist plot of

Zimaginary versus Zreal for
a 10 mL of 45% DMF,
b 15 mL of 45% DMF and
c 20 mL of 45% DMF
Fig. 40.3 The graph of voltage (VDC ) values collected by solar cell under sunlight irradiance for
30 days
The cells have the ability to conduct the electron under direct light irradiation as
the ETL layer interface-up from the metal highlight lamp source. Based on Fig. 40.2,
the bulk conductivity values for various 45% DMF were 4.477 × 10−5 S cm−1 (a),
1.587 × 10−5 S cm−1 (b) and 5.073 × 10−6 S cm−1 (c), respectively. From the value
obtained, the synthesized perovskite can be classified into semiconductor materials
(10−8 < σ < 103 S cm−1 ) (Singh et al. 2013).
The voltage respond of half-fabricated solar cell under real sunlight irradiation
was investigated as a preliminary study. According to graph voltage versus exposure
hours to solar irradiance as illustrated in Fig. 40.3, the voltage produced from the
cell shows good consistency over 30 days and directly proportional with sunlight
irradiance value recorded on time the solar cell was measured.
40.4 Conclusion
2-AMP hybrid perovskite has successfully been synthesized without glove box or
any complicated procedure. By applying a simple-coating fabrication method, free-
hole transport layer (HTL) and an air-stable perovskite solar cell were developed.
The cell shows significant voltage respond under sunlight irradiance which becomes
a potential candidate in future PV technology. Perhaps, further investigations of
different liquid-precursor solvents such as Dimethyl Sulfoxide (DMSO), Dimethy-
lacetamide (DMAc) and N-Methyl-2-pyrrolidone (NMP) can be carried out for better
understanding of the role of solvent in the hybrid perovskite.
472 A. Ramli et al.
Acknowledgements The authors would like to thank the Ministry of Higher Education (MOHE)
of Malaysia for the financial support via Fundamental Research Grant Scheme (FRGS/1/2018) and
Universiti Teknologi MARA (UiTM) for the facilities support.
References
Assadi MK, Bakhoda S, Saidur R, Hanaei H (2017) Recent progress in perovskite solar cells. Renew
Sustain Energy Rev 81:2812–2822. https://doi.org/10.1016/j.rser.2017.06.088
Burschka J, Pellet N, Moon SJ, Humphry-Baker R, Gao P, Nazeeruddin MK, Gratzel M (2013)
Sequential deposition as a route to high-performance perovskite-sensitized solar cells. Nature
499:316–319
Gangopadhyay U, Jana S, Das S (2013) State of art of solar photovoltaic technology. Conference
Papers in Science, ID 764132, pp 1–9. https://doi.org/10.1155/2013/764132
Jeon NJ, Noh JH, Kim YC, Yang WS, Ryu S, Seok S (2014) Solvent engineering for high-
performance inorganic-organic hybrid perovskite solar cells. Nat Mater 13:897–903
Jung MH, Rhim SH, Moon D (2017) TiO2 /RbPbI3 halide perovskite solar cells. Sol Energy Mater
Sol Cells 172:44–54. https://doi.org/10.1016/j.solmat.2017.07.011
Kabir E, Kumar P, Kumar S, Adelodun AA, Kim KH (2018) Solar energy: potential and future
prospects. Renew Sustain Energy Rev 82:894–900. https://doi.org/10.1016/j.rser.2017.09.094
Kojima A, Teshima K, Shirai Y, Miyasaka T (2009) Organometal halide perovskites as visible-light
sensitizers for photovoltaic cells. J Am Chem Soc 131(17):6050–6051. https://doi.org/10.1021/
ja809598r
Lacerda JS, Van Den Bergh JCM (2016) Diversity in solar photovoltaic energy: implications for
innovation and policy. Renew Sustain Energy Rev 54:331–340. https://doi.org/10.1016/j.rser.
2015.10.032
Li Y, Zheng G, Lin C, Lin J (2007) Synthesis, structure and optical properties of different
dimensional organic-inorganic perovskites. Solid State Sci 9:855–861. https://doi.org/10.1016/j.
solidstatesciences.2007.06.011
Li X, Wang X, Zhang W, Wu Y, Gao F, Fang J (2015) The effect of external electric field on the
performance of perovskite solar cells. Org Electron 18:107–112. https://doi.org/10.1016/j.orgel.
2015.01.024
Marinova N, Valero S, Luis J (2017) Organic and perovskite solar cells: working principles, materials
and interfaces. J Colloid Interface Sci 488:373–389. https://doi.org/10.1016/j.jcis.2016.11.021
Placzek-Popko E (2017) Top PV market solar cells 2016. Opto-Electron Rev 55–64. https://doi.
org/10.1016/j.opelre.2017.03.002
Qiu L, Ono LK, Qi Y (2017) Advances and challenges to the commercialization of organic and
inorganic halide perovskite solar cell technology. Mater Today Energy 7:169–189. https://doi.
org/10.1016/j.mtener.2017.09.008
Ramli A, Rostan NFM, Osman N, Othman F (2017) Characterization of organic-inorganic
perovskite based on reaction of aminomethyl pyridine. Solid State Sci Technol 1:1–8
Ramli A, Bakar MNA, Osman N, Ismail WINW, Sepeai S (2018) Characterization of novel nitrogen-
less derived 2D hybrid perovskite of C6H8N2PbBr 3 as a light-harvesting material for perovskite
solar cell application. Mater Lett 227:62–65. https://doi.org/10.1016/j.matlet.2018.05.040
Rashad MM, Elseman AM, Hassan AM (2016) Facile synthesis, characterization and structural evo-
lution of nanorods single-crystalline (C4 H9 NH3 )2 PbI2 X2 mixed halide organometal perovskite
for solar cell application. Optik 127:9775–9787. https://doi.org/10.1016/j.ijleo.2016.07.054
Singh K, Nowotny J, Thangadurai V (2013) Amphoteric oxide semiconductors for energy
conversion devices: a tutorial review. Chem Soc Rev 42:1961–1972
Yu H, Wei Z, Hao Y, Liang Z, Fu Z, Cai H (2017) Reversible solid-state thermochromism of a
2D organic-inorganic hybrid perovskite structure based on iodoplumbate and 2-aminomethyl-
pyridine. New J Chem 41:9586–9589
Chapter 41
Detection of Integron and Antibiotic
Resistance Genes of Aeromonas spp.
Isolated from Freshwater Fish in Pahang,
Malaysia
Fazlina Fauzi, Ruhil Hayati Hamdan, Maizan Mohamed and Li Peng Tan
Abstract Aeromonas species are known as food and waterborne pathogens. This
study aims to detect integrons and antibiotic resistance genes in Aeromonas spp. iso-
lated from diseased red hybrid tilapia (Orechromis sp.), African catfish (C. gariepi-
nus) and striped catfish (P. hypopthalmus) in Pahang, Malaysia. Samples from kid-
ney, spleen and liver were cultured onto Rimler Shott agar to isolate the bacteria.
Pathogenicity of the bacterial was observed through hemolytic activity of the bacteria
on sheep blood agar. Polymerase chain reaction using specific gene was conducted
for species identification. The isolates were tested for sensitivity to 14 antibiotics
using the Kirby-Bauer method. Aeromonas veronii (19 isolates), A. sobria (17 iso-
lates) and A. hydrophila (6 isolates) were isolated from freshwater fish. Interestingly,
almost all (40/42) isolates showed β-hemolysis on sheep blood agar which indicates
early pathogenicity. The frequencies of resistance were observed against ampicillin
(69%), neomycin (52%), oxytetracycline (48%), streptomycin (48%), nalidixic acid
(40%), tetracycline (36%), kanamycin (17%), chloramphenicol (10%), sulfamethox-
azole (10%), nitrofurantoin (7%), gentamicin (5%) and doxycycline (2%). Multiple
Antibiotic Resistance (MAR) index for the bacterial isolates was found to range from
0.14 to 0.57. Three out of 42 isolates contain integron class 1. MAR index indicated
that the farmed fish in these areas might have been indiscriminately and continuously
exposed to the tested antibiotics during its culture stages. Regular monitoring should
be carried out to gather more information on antibiotic sensitivity of Aeromonas spp.
Furthermore, increasing the resistance of Aeromonads to oxytetracycline will also
pose a challenge in the treatment of Aeromonas infection.
F. Fauzi (B) · R. H. Hamdan · M. Mohamed · L. P. Tan

Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, 16100 Kota Bharu, Kelantan,
Malaysia
e-mail: nnfazlina@gmail.com
R. H. Hamdan
e-mail: ruhil@umk.edu.my
M. Mohamed
e-mail: maizan.m@umk.edu.my
L. P. Tan
e-mail: li.peng@umk.edu.my

474 F. Fauzi et al.
Keywords Aeromonas spp. · Freshwater fish · MAR index · Antibiotic

susceptibility · Integron
41.1 Introduction
In 2012, the Ministry of Agriculture declared aquaculture as the potential food indus-
try in Malaysia. Since then the sector has been included under the National Key Eco-
nomic Area (NKEA) in the country transformation program (Department of Fisheries
2015). In intensive farming, fish are susceptible to various bacterial diseases such as
haemorrhagic septicemia caused by Aeromonas spp. (Dong et al. 2017). An infectious
disease caused by motile aeromonads usually links to Aeromonas hydrophila.
Aeromonas spp. has been identified to develop antibiotic resistance and multiple
resistance in and recognised as a severe global health threat. The extensive use of
antibiotics in intensive food animal farms in some countries has resulted in the
emergence of resistance among foodborne pathogens, opportunistic pathogens and
commensal flora of food animals and significantly contributed to the development
of antibiotic resistance in human commensal flora. Resistant bacteria from aquatic
environments can infect humans through the food chain or direct contact and transfer
their resistance genes to human flora or related human pathogens (Nguyen et al.
2014).
Transposons, plasmid and integrons can hold antibiotic-resistant genes and trans-
fer between microorganisms horizontally (Sarria-Guzmán et al. 2014; van Essen-
Zandbergen et al. 2007). Integrons are rare DNA components that include genes
encoding a site-specific DNA recombinase, a DNA integrase and an adjacent site
where a wide range of antibiotic resistance and other genes are found as inserts (Hall
and Stokes 1993). To date, five different classes of mobile integrons have been iden-
tified. Variations in the sequence of the encoded integrase (40–58% identity) were
used to distinguish the types. Classes 1 and 2 integrons are the most common in many
antibiotic-resistant bacteria and are of concern due to their capacity for mobilisation,
which allows spread within and between species (Nguyen et al. 2014). Despite not
being mobile, integrons are found to be associated with mobile genetic elements such
as plasmids and transposons (Ndi and Barton 2011). It has also been reported that
isolates from aquatic sources carry integrons and other genes that code for resistance
determinants (Rhodes et al. 2000; Schmidt et al. 2001a; Jacobs and Chenia 2007;
Nawaz et al. 2010; Lukkana et al. 2012).
This present study was aimed to characterise Aeromonas spp. isolated from red
hybrid tilapia (Orechromis sp.), African catfish (C. gariepinus) and striped catfish
(P. hypopthalmus) at three cage culture sites in Pahang, Malaysia. On the other hand,
this study also investigates the presence of integron and antibiotic resistance genes
in Aeromonas spp.
41 Detection of Integron and Antibiotic Resistance Genes … 475
41.2.1 Bacterial Isolation
Red hybrid tilapia (Orechromis sp.), African catfish (C. gariepinus), striped catfish
(P. hypopthalmus) were collected from three cage culture sites in Pahang, Malaysia.
The fish showed clinical signs such as haemorrhage, exophthalmia and fin rot. Spec-
imen of kidney, spleen and liver were collected from these fishes and inoculated onto
Rimler Shott agar (RSA) (HiMedia, India). The bacteria were incubated at 30 °C for
24 h. Yellow colonies on RSA were chosen and further sub-culture on Trypticase
Soy Agar (TSA) (Oxoid, Hampshire, UK) for purity. Gram staining, oxidase and
catalase test were done for possible identification.
41.2.2 Confirmation Using PCR Assay
The genomic DNA was extracted from the bacteria using Bacteria Genomic DNA
kit (Geneaid, USA) following the manufacturer’s instruction. The 16S rRNA and
specific gene PCR assay used in this study were described by Wang et al. (Wang et al.
2013). This assay was used to further confirm the Aeromonas spp. Polymerase Chain
Reaction (PCR) amplification was carried out using a Mastercycler Gradient (Biorad,
USA). A final PCR volume of 25 μl contained 12.5 μl Go Taq® Green Master Mix
(Promega, USA), of each forward and reverse primer and DNA template. Amplified
products were electrophoresed on 2.0% agarose gels. The gel was visualised and
captured by using GelDoc (Biorad, US).
41.2.3 Pathogenicity Test
The bacterial culture was inoculated onto sheep blood agar. The plates were incubated
at 30 °C. Zone of hemolysis was observed after 24 h incubation.
41.2.4 Antibiotic Susceptibility Test and MAR Index
The isolates were tested for sensitivity to 14 antibiotics, namely, ampicillin,

gentamicin, neomycin, streptomycin, kanamycin, tetracycline, oxytetracycline,
ciprofloxacin, norfloxacin, nalidixic acid, chloramphenicol, sulfamethoxazole, doxy-
cycline and nitrofurantoin. Kirby-Bauer’s disc diffusion method was used to assess
the patterns of antibiotic sensitivity of isolates. Inhibition zones results have been
476 F. Fauzi et al.
interpreted as sensitive (S), intermediate (I) and resistant (R) according to the ref-
erence standard provided by the Clinical and Laboratory Standard Institute, CLSI
(2016).
Calculation of Multiple Antibiotic Resistance (MAR) index (Sarter et al. 2007):
X/(Y × Z) (41.1)
where X = Total cases of antibiotic resistance; Y = Total number of isolates; Z =

Total number of isolates.
MAR index value of equal or less than 0.2 was defined as antibiotics that were
seldom or never used.
41.2.5 Identification of Integrons, Integron Associated Genes

and Antibiotic Resistance Genes
Integrons and resistance genes were detected using PCR amplification with the dif-
ferent primers described in Table 41.1. All PCR amplifications were performed in
a Mastercycler (Eppendorf, Germany). Assays were conducted in 25 μL volumes
according to the protocol of manufacturer (Promega, USA). All PCRs were subjected
to amplification according to cycling parameter suggested by previous researcher
(Table 41.1). PCR amplicons were run on 2.0% agarose gel, and a 100-bp ladder was
used as the molecular size marker. The gel was visualised and captured by using Gel
Doc (Biorad, USA).
Fourteen isolates of Aeromonas jandaei and four isolates of A. veronii were obtained
in the present study. Colonies of Aeromonas spp. appeared in creamy colour, round
and convex on TSA, while colonies of Aeromonas on RSA agar were yellow, round
and convex. Austin and Austin (Austin and Austin 2012) reported that the produc-
tion of H2 S is one of the pathogenic piscine strains of Aeromonas spp. Shotts and
Rimler (Shotts and Rimler 1973) noted that Aeromonas spp. indicated yellow colonies
on RS medium. Nevertheless, it was also shown that all the yellow colonies with
black centres would subsequently be tested for oxidase activity in order to remove
Citrobacter spp. and/or other species’ possibilities. Almost all (17/18) isolates
displayed β-hemolysis on sheep blood agar suggesting early pathogenicity.
All isolates were susceptible to ciprofloxacin and norfloxacin. Conversely, the
frequencies of resistance were observed against ampicillin (69%), neomycin (52%),
oxytetracycline (48%), streptomycin (48%), nalidixic acid (40%), tetracycline
Table 41.1 List of primers used for detection of integrons, integron associated and antibiotic
resistance genes
Primer Nucleotide sequence (5 –3 ) Product size References
(bp)
Int1-F CAGTGGACATAAGCCTGTTC 160 Koeleman et al.
Int1-R CCCGAGGCATAGACTGTA (2001)
Int2-F GTAGCAAACGAGTGACGAAATG 788 Mazel et al.
Int2-R CACGGATATGCGACAAAAAGGT (2000)
Int3-F GCCTCCGGCAGCGACTTTCAG 979 Mazel et al.
Int3-R ACGGATCTGCCAAACCTGACT (2000)
sul1-F CTTCGATGAGACCCGGCGGC 436 Sundström
sul1-R GCAAGGCGGAAACCCGCGCC et al. (1988)
qacED1-F ATCGCAATAGTTGGCGAAGT 250 Stokes and Hall
qacED1-R CAAGCTTTTGCCCATGAAGC (1989)
hep58 TCATGGCTTGTTATGACTGT Variable White et al.
hep59 GTAGGGCTTATTATGCACGC (2000)
aadA-F GAGAACATAGCGTTGCCTTGGTCG 198 Sunde and
aadA-R GCGCGATTTTGCCGGTTA Norström
(2005)
strA-strB-F TTGAATCGAACTAATAT 1640 Han et al.
strA-strB-R CTAGTATGACGTCTGTCG (2004)
blaTEM-F ATGAGTATTCAACATTTCCG 867 Rasheed et al.
blaTEM-R CTGACAGTTACCAATGCTTA (1997)
blaSHV-F GGTTATGCGTTATATTCGCC 867 Rasheed et al.
blaSHV-R TTAGCTTTGCCAGTGCTC (1997)
tetA-F GTAATTCTGAGCACTGTCGC 956 Schmidt et al.
tetA-R CTGCCTGGACAACATTGCTT (2001a, b)
tetB-F CTCAGTATTCCAAGCCTTTG 535 Schmidt et al.
tetB-R CTAAGCACTTGTCTCCTGTT (2001a, b)
tetC-F TCTAACAATGCGCTCATCGT 588 Schmidt et al.
tetC-R GGTTGAAGGCTCTCAAGGGC (2001a; b)
tetD-F ATTACACTGCTGGACGCGAT 1070 Schmidt et al.
tetD-R CTGATCAGCAGACAGATTGC (2001a, b)
tetE-F GTGATGATGGCACTGGTCAT 1198 Schmidt et al.
tetE-R CTCTGCTGTACATCGCTCTT (2001a; b)
tetM-F GTTAAATAGTGTTCTTGGAG 650 Aarestrup et al.
tetM-R CTAAGATATGGCTCTAACAA (2000)
478 F. Fauzi et al.
(36%), kanamycin (17%), chloramphenicol (10%), sulfamethoxazole (10%), nitrofu-

rantoin (7%), gentamicin (5%) and doxycycline (2%). You et al. (2016) stated that due
to their intrinsic resistance, the resistance of Gram-negative bacteria to erythromycin
is expected. Since 1960, ampicillin has been extensively used and ampicillin resis-
tance is also frequently reported (You et al. 2016; Laganà et al. 2011). The bacterial
isolates for multiple antibiotic resistance (MAR) index have been found to range
from 0.14 to 0.57. These results suggested that the farmed fish in these areas might
have been continuously exposed to the tested antibiotics during its culture stages.
In Malaysia, Aeromonas spp., A. veronii biovar sobria, A. hydrophila and A. caviae
were reported in the retail market at the state of Selangor by Son Radu (Radu et al.
2003). The author also stated that hemolytic activity in isolated strains varied widely.
Although all isolates were resistant to three or more of the antibiotics tested, they
were all susceptible to ceftazidime. These results reveal that there is a rapid recovery
of hemolytic, multiple antibiotic-resistant and genetically diverse aeromonads from
fish in this area.
Antimicrobial resistance is a complex global epidemiological issue, adapted to a
broad, integrated One Health approach. Resistant species occur in humans, animals,
food and the environment, and antimicrobial use is the main driver of this resistance
(Queenan et al. 2016). Antibiotics were mixed with oral feed for the treatment and
prevention of bacterial infections in aquaculture. Drugs of similar classes have been
used in humans and veterinary implementations for medical treatment. One partic-
ular concern is that inappropriate and excessive use of antibiotics contributes to the
development and dissemination of antimicrobial resistance among aquatic bacte-
rial pathogens—this including A. hydrophila which could be transferred to humans
(Lukkana et al. 2012).
Motile Aeromonas spp. is regularly found in the intestines and freshwater fish gills.
This genus quickly establishes single or multiple antibiotic resistances, indicating that
this genus could be used as useful markers of antimicrobial resistance in the fresh-
water aquaculture environment (Nguyen et al. 2014). In this study, A. hydrophila
isolates showed higher ampicillin resistance, possibly due to the high intrinsic
β-lactam resistance of this genus, which is improved by an active efflux mecha-
nism and/or coordination between external membrane impermeability or secondary
resistance mechanisms such as β-lactamases or antibiotic efflux pumps (Nguyen et al.
2014; Janda and Abbott 2010).
Common drugs used in agriculture, livestock operations, aquaculture and human
therapy, are sulfonamides (sulfa drugs) (Suzuki et al. 2013). This class of antibiotics
is widely used all over the world especially in developing Asian countries as a result
of their inexpensiveness and wide-spectrum antimicrobial activity (Luo et al. 2011;
Suzuki and Hoa 2012). Resistance to sulfonamides has been reported in clinical,
aquaculture and aquatic environments from different geographical regions (Suzuki
et al. 2013; Hoa et al. 2008; Hoa et al. 2011; You et al. 2012; Das et al. 2014).
Consequently, inputs from domestic sewage might be a cause of notable frequency
of sulfonamide-resistant bacteria detected in diseased fish.
The resistance patterns of all the Aeromonas spp. isolates are shown in Table 41.2.
Multiple antibiotic resistances were observed and all Aeromonas spp. isolates showed
different resistance patterns. The MAR index of ranging from 0.14 to 0.57 indicating
Table 41.2 Resistance phenotype, class 1 integron and antibiotic resistance genes in Aeromonas
spp. Isolated from freshwater fishes
No. Isolate Identification Origin District Resistance Class 1 integrons and MAR
no. of phenotype antibiotic resistance index
origin genes detected by
PCR
1. P1T2 A. veronii Red Pekan NA30, tetA + blaTEM + 0.21
tilapia OT30, blaSHV
AMP10
2. P1T6 A. veronii Red Pekan CN10, tetA + blaTEM 0.50
tilapia N30, S10,
K30,
NA30,
OT30,
AMP10
3. P1T9 A. veronii Red Pekan N30, S10, blaTEM 0.43
tilapia K30,
NA30,
OT30,
AMP10
4. P3T7 A. veronii Red Kuantan NA30, blaTEM 0.21
(a) tilapia AMP10,
SXT25
5. P3T7 A. veronii Red Kuantan N30, S10, tetA + blaTEM 0.43
(b) tilapia TE30,
NA30,
OT30,
AMP10
6. P3T10 A. veronii Red Kuantan N30, S10, tetA + blaTEM 0.43
tilapia NA30,
TE30,
OT30,
AMP10
7. P1K1 A. sobria African Pekan N30, S10, Int1 + tetA + 0.43
(a) catfish SXT25, blaTEM + blaSHV
TE30,
OT30,
AMP10
8. P1K1 A. sobria African Pekan N30, S10, blaTEM 0.21
(b) catfish AMP10
9. P1K3 A. veronii African Pekan N30, S10, blaTEM 0.29
catfish NA30,
AMP10
(continued)
480 F. Fauzi et al.

PCR
10. P1K4 A. sobria African Pekan N30, S10, – 0.29
(a) catfish K30,
SXT25
11. P1K4 A. sobria African Pekan N30, S10, blaTEM 0.29
(b) catfish C30,
AMP10
(a) catfish C30,
F300,
AMP10
catfish AMP10
14. P2K1 A. sobria African Pekan F300, blaSHV 0.14
catfish AMP10
15. P2K2 A. veronii African Pekan N30, S10, tetA + blaTEM + strA 0.43
catfish NA30, − strB
TE30,
OT30,
AMP10
16. P2K4 A. sobria African Pekan TE30, Int1 + tetA + 0.43
(b) catfish OT30, blaTEM + blaSHV
DO30,
F300,
AMP10
17. P3K8 A. African Kuantan OT30, blaTEM + blaSHV 0.14
hydrophila catfish AMP10
18. P1P1 A. sobria Striped Pekan N30, S10, blaTEM 0.29
catfish K30,
AMP10
19. P1P2 A. sobria Striped Pekan N30, S10, tetE + blaTEM 0.43
(a) catfish NA30,
TE30,
OT30,
AMP10
20. P1P2 A. veronii Striped Pekan N30, blaTEM 0.43
(b) catfish NA30,
TE30,
OT30,
C30,
AMP10
21. P1P3 A. Striped Pekan N30, S10, tetA + blaTEM 0.36
(a) hydrophila catfish TE30,
OT30,
AMP10
(continued)

PCR
22. P1P3 A. Striped Pekan N30, S10, Int1 + tetA + blaTEM 0.57
(b) hydrophila catfish NA30,
K30,
TE30,
OT30,
AMP10,
SXT25
24. P1P4 A. veronii Striped Pekan NA30, tetE + blaTEM 0.29
(c) catfish TE30,
OT30,
AMP10
25. P1P5 A. Striped Pekan S10, tetA + blaTEM 0.36
(a) hydrophila catfish NA30,
TE30,
OT30,
AMP10
26. P1P5 A. veronii Striped Pekan NA30, tetE + blaTEM 0.36
(b) catfish S10,
TE30,
OT30,
AMP10
27. P1P6 A. veronii Striped Pekan N30, S10, tetA + blaTEM 0.43
(a) catfish NA30,
TE30,
OT30,
AMP10
28. P1P6 A. veronii Striped Pekan N30, S10 – 0.14
(b) catfish
29. P1P7 A. sobria Striped Pekan N30, tetE + blaTEM 0.29
(a) catfish NA30,
OT30,
AMP10
30. P1P7 A. veronii Striped Pekan N30, S10, blaTEM + blaSHV 0.29
(b) catfish K30,
AMP10
31. P1P10 A. veronii Striped Pekan N30, S10, tetA 0.43
catfish K30,
CN10,
TE30,
OT30
AMP 10: Ampicillin 10 μg/ml, CN 10: Gentamycin 10 μg/ml, C 30: Chloramphenicol 30 μg/ml, DO30:
Doxycycline 30 μg/ml; F 300: Nitrofurantoin 300 μg/ml, K 30: Kanamycin 30 μg/ml, NA 30: Nalidixic
Acid 30 μg/ml, N 30: Neomycin 30 μg/ml, OT30: Oxytetracycline 30 μg/ml, S 10: Streptomycin 10 μg/ml,
SXT 25: Sulfamethoxazole 25 μg/ml, TE30: Tetracycline 30 μg/ml
482 F. Fauzi et al.
the Aeromonas spp. in these farmed fish might have been indiscriminately and con-
tinuously exposed to those antibiotics during culturing stages of the fish. There were
no visible species-specific antibiotic resistance patterns in this study. The current
results are in agreement with other studies showing multi-resistance incidence in
Aeromonas spp. from aquatic environments and seafood samples (Dias et al. 2012;
Lijon et al. 2015; Deng et al. 2016).
The current study seems to be consistent with Belém-Costa and Cyrino (2006),
which found that lack of effectiveness of tetracycline to A. hydrophila isolated from
Pacu, Piaractus mesopotamicus. The author also reported that the isolates were
susceptible to gentamicin, chloramphenicol, kanamycin and streptomycin. Other
than that, Son et al. (1997) also have reported that A. hydrophila isolated from Telapia
mossambica was resistant to tetracycline. Scoaris et al. (2008) and Pandove et al.
(2011) also discovered that A. hydrophila isolated from drinking water and surface
water was resistant to ampicillin, which is in line with the study described.
It is well known that integrons are present in fish-farming environments. A previ-
ous study conducted by Ndi and Barton (2011) found that class 1 integron in 28/90
(31%) isolates of Aeromonas spp. from rainbow trout farms in Australia. Nawaz et al.
(2010) were investigated class 1 integron in 48% of A. veronii isolates from catfish.
Jacobs and Chenia (2007) have identified Aeromonas spp. isolates from tilapia, trout
and koi aquaculture environment in South Africa hold class 1 integrons with gene
cassettes ant(3 )Ia, aac(6 )Ia, dhfr1, oxa2a and/or pse1. The prevalence of class
1 integrons with the dhfr, ant (3 ) 1a and catB2 genes were identified in motile
Aeromonads from the fish-farming environment in Denmark (Schmidt et al. 2001).
Sarria-Guzmán et al. (2014) noted that there are not always multidrug-resistant strains
with integrons. This non-integral multidrug-resistant could contain extrachromoso-
mal genetic plasmid or transposons which carrying antibiotic resistance genes. This
can be seen in the previous study, in which tetracycline resistance is associated com-
monly with the presence of transposons, such as Tn1721 and Tn10 located in plasmid
(Bello-López et al. 2012; Ross et al. 2013).
Fish farms may have been polluted by surface run-off from other agricultural
activities or streptomycin resistance may be a sign of past use off-label (Ndi and
Barton 2011). In Aeromonas spp. isolated from freshwater fish, two types of tetra-
cycline resistance genes, tetA and tetE have been observed. This result was partially
in agreement with Ndi and Barton (2011), the author has identified tetA and tetC in
Aeromonas spp. from rainbow trout farms in Australia. Interestingly, various distri-
butions of tet genes found in Australian marine tropical isolates where tetM, tetE,
tetA and tetD were the most common determinants (Akinbowale et al. 2007). The
present study also indicates that two tet genes were simultaneously present in correla-
tion with the antibiotic sensitivity test. Oxytetracycline resistance evens an alarming
issue in this study because it is the antibiotic that has been allowed by Malaysian
government.
41.4 Conclusion
Continuous monitoring of antibiotic-resistant Aeromonas spp. should be conducted

on freshwater fish, especially tilapia, African catfish and striped catfish as these
fishes are relevant aquatic protein sources. Even Food and Agriculture Organisation
(FAO), World Organisation for Animal Health (OIE) and World Health Organisation
(WHO) concluded that the presence of antimicrobial residues in foods poses a lower
risk to human health than the presence of antimicrobial-resistant bacteria and the
presence of such bacteria in foods poses a potential threat to human health because
resistance can spread among bacteria and prevent disease treatment.
Acknowledgements This study was supported by the Fundamental Research Grant Scheme
(FRGS/1/2015/WAB01/UMK/03/2) under Ministry of Higher Education, Malaysia. Authors also
would like to thank Department of Fisheries, Malaysia.
References
Aarestrup FM, Agerso Y, Gerner-Smidt P, Madsen M, Jensen LB (2000) Comparison of antimi-

crobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus
faecium from humans in the community, broilers and pigs in Denmark. Diagn Microbiol Infect
Dis 37(2):127–137. https://doi.org/10.1016/S0732-8893(00)00130-9
Akinbowale OL, Peng H, Grant P, Barton MD (2007) Antibiotic and heavy metal resistance in motile
aeromonads and pseudomonads from rainbow trout (Oncorhynchus mykiss) farms in Australia.
Int J Antimicrob Agents 30(2):177–182. https://doi.org/10.1016/j.ijantimicag.2007.03.012
Austin B, Austin DA (2012) Bacterial fish pathogens, disease of farmed and wild fish, 5th edn.
Springer-Science, London
Belém-Costa A, Cyrino JEP (2006) Antibiotic resistence of Aeromonas hydrophila isolated from
Piaractus mesopotamicus (Holmberg, 1887) and Oreochromis niloticus (Linnaeus, 1758). Sci
Agric 63(3):281–284. https://doi.org/10.1590/S0103-90162006000300011
Bello-López JM, Vázquez-Ocampo NJ, Fernández-Rendón E, Curiel-Quesada E (2012) Inability
of some Aeromonas hydrophila strains to act as recipients of plasmid pRAS1 in conjugal transfer
experiments. Curr Microbiol 64(4):332–337. https://doi.org/10.1007/s00284-011-0076-1
CLSI (2016) Performance standards for antimicrobial susceptibility testing. In: 9th informational
supplement, vol 26, no 1. CLSI document M100-S26. Pennsylvania, USA
Das SK, Rahman A, Chisti MJ, Ahmed S, Malek MA, Salam MA, Bardhan PK, Faruque ASG
(2014) Changing patient population in Dhaka Hospital and Matlab Hospital of icddr, b. Tropical
Med Int Health 19(2):240–243. https://doi.org/10.1111/tmi.12231
Deng Y, Wu Y, Jiang L, Tan A, Zhang R, Luo L (2016) Multi-drug resistance mediated by class 1
integrons in Aeromonas isolated from farmed freshwater animals. Front Microbiol 7:1–7. https://
doi.org/10.3389/fmicb.2016.00935
Department of Fisheries (2015) Retrieved 2 June 2019 from https://www.dof.gov.my/epms/index.
php/pages/view/2614. Accessed 2 June 2019
Dias C, Mota V, Martinez-Murcia A, Saavedra MJ (2012) Antimicrobial resistance patterns of
Aeromonas spp. Isolated from ornamental fish. J Aquac Res Dev 3(3). https://doi.org/10.4172/
2155-9546.1000131
484 F. Fauzi et al.
Dong HT, Siriroob S, Meemetta W, Santimanawong W, Gangnonngiw W, Pirarat N, Senapin S

(2017) Emergence of tilapia lake virus in Thailand and an alternative semi-nested RT-PCR for
detection. Aquaculture 476:111–118. https://doi.org/10.1016/j.aquaculture.2017.04.019
Hall RM, Stokes HW (1993) Integrons: novel DNA elements which capture genes by site-specific
recombination. Genetica 90(2–3):115–132. https://doi.org/10.1007/BF01435034
Han HS, Koh YJ, Hur JS, Jung JS (2004) Occurrence of the strA-strB streptomycin resis-
tance genes in Pseudomonas species isolated from kiwifruit plants. J Microbiol 42(4):365–368
PMID:15650697
Hoa PTP, Nonaka L, Viet PH, Suzuki S (2008) Detection of the sul1, sul2, and sul3 genes in
sulfonamide resistant bacteria from wastewater and shrimp ponds of North Vietnam. Sci Total
Environ 405:377–384. https://doi.org/10.1016/j.scitotenv.2008.06.023
Hoa PHP, Managaki S, Nakada N, Takada H, Shimizu A, Anh DH, Viet PH, Suzuki S (2011)
Antibiotic contamination and antibiotic-resistant bacteria in animal farms, city canal and aqua-
culture environments of North Vietnam. Sci Total Environ 409:2894–2901. https://doi.org/10.
1016/j.scitotenv.2011.04.030
Jacobs L, Chenia HY (2007) Characterization of integrons and tetracycline resistance determi-
nants in Aeromonas spp. isolated from South African aquaculture systems. Int J Food Microbiol
114(3):295–306. https://doi.org/10.1016/j.ijfoodmicro.2006.09.030
Janda JM, Abbott SL (2010) The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin
Microbiol Rev 23(1):35–73. https://doi.org/10.1016/j.ijantimicag.2016.06.014
Koeleman JGM, Stoof J, Van Der Bijl MW, Vandenbroucke-Grauls CMJE, Savelkoul PHM (2001)
Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J Clin
Microbiol 39(1):8–13. https://doi.org/10.1128/jcm.39.1.8-13.2001
Laganà P, Caruso G, Minutoli E, Zaccone R, Delia S (2011) Susceptibility to antibiotics of Vibrio
spp. and Photobacterium damsela ssp. piscicida strains isolated from Italian aquaculture farms.
New Microbiol 34:53–63 PMID:21344147
Lijon MB, Khatun MM, Islam A, Khatun MM, Islam MA (2015) Detection of multidrug resistance
Aeromonas hydrophila in farm raised fresh water prawns. J Adv Vet Anim Res 2(4):469–474.
https://doi.org/10.5455/javar.2015.b120
Lukkana M, Wongtavatchai J, Chuanchuen R (2012) Class 1 Integrons in Aeromonas hydrophila
Isolates from Farmed Nile Tilapia (Oreochromis nilotica). J Vet Med Sci 74(4):435–440. https://
doi.org/10.1292/jvms.11-0441
Luo Y, Xu L, Rysz M, Wang Y, Zhang H, Alvarez PJJ (2011) Occurrence and transport of tetracy-
cline, sulfonamide, quinolone, and macrolide antibiotics in the Haihe River basin, China. Environ
Sci Technol 45:1827–1833. https://doi.org/10.1021/es104009s
Mazel D, Dychinco B, Webb VA, Davies J (2000) Antibiotic resistance in the ECOR collection:
integrons and identification of a novel aad gene. Antimicrob Agents Chemother 44(6):1568–1574.
https://doi.org/10.1128/AAC.44.6.1568-1574.2000
Nawaz M, Khan SA, Khan AA, Sung K, Tran Q, Kerdahi K, Steele R (2010) Detection and char-
acterization of virulence genes and integrons in Aeromonas veronii isolated from catfish. Food
Microbiol 27(3):327–331. https://doi.org/10.1016/j.fm.2009.11.007
Ndi OL, Barton MD (2011) Incidence of class 1 integron and other antibiotic resistance determinants
in Aeromonas spp. from rainbow trout farms in Australia. J Fish Dis 34(8):589–599. https://doi.
org/10.1111/j.1365-2761.2011.01272.x
Nguyen HNK, Van TTH, Nguyen HT, Smooker PM, Shimeta J, Coloe PJ (2014) Molecular char-
acterization of antibiotic resistance in Pseudomonas and Aeromonas isolates from catfish of
the Mekong Delta, Vietnam. Vet Microbiol 171(3–4):397–405. https://doi.org/10.1016/j.vetmic.
2014.01.028
Pandove G, Sahota PP, Achal V, Vikal Y (2011) Detection of Aeromonas hydrophila in water
using PCR. J—Am Water Work Assoc 103(11):59–65. https://doi.org/10.1002/j.1551-8833.2011.
tb11566.x
Queenan K, Häsler B, Rushton J (2016) A one health approach to antimicrobial resistance
surveillance: is there a business case for it? Int J Antimicrob Agents 48(4):422–427
Radu S, Ahmad N, Foo HL, Reezal A (2003) Prevalence and resistance to antibiotics for Aeromonas
species from retail fish in Malaysia. Int J Food Microbiol 81:261–266. https://doi.org/10.1016/
s0168-1605(02)00228-3
Rasheed JK, Jay C, Metchock B, Berkowitz F, Weigel L, Crellin J, Tenover FC (1997) Evolution
of extended-spectrum β-lactam resistance (SHV-8) in a strain of Escherichia coli during multiple
episodes of bacteremia. Antimicrob Agents Chemother 41(3):647–653 PMID:9056008
Rhodes G, Huys G, Swings J, McGann P, Hiney M, Smith P, Pickup RW (2000) Distribution of
oxytetracycline resistance plasmids between aeromonads in hospital and aquaculture environ-
ments: implication of Tn1721 in dissemination of the tetracycline resistance determinant Tet A.
Appl Environ Microbiol 66(9):3883–3890. https://doi.org/10.1128/AEM.66.9.3883-3890.2000
Ross EM, Moate PJ, Marett L, Cocks BG, Hayes BJ (2013) Investigating the effect of two methane-
mitigating diets on the rumen microbiome using massively parallel sequencing. J Dairy Sci
96(9):6030–6046. https://doi.org/10.3168/jds.2013-6766
Sarria-Guzmán Y, López-Ramírez MP, Chávez-Romero Y, Ruiz-Romero E, Dendooven L, Bello-
López JM (2014) Identification of antibiotic resistance cassettes in class 1 integrons in Aeromonas
spp. strains isolated from fresh fish (Cyprinus Carpio L.). Curr Microbiol 68(5):581–586. https://
doi.org/10.1007/s00284-013-0511-6
Sarter S, Kha Nguyen HN, Hung LT, Lazard J, Montet D (2007) Antibiotic resistance in Gram-
negative bacteria isolated from farmed catfish. Food Control 18(11):1391–1396. https://doi.org/
10.1016/j.foodcont.2006.10.003
Schmidt AS, Bruun MS, Larsen JL, Dalsgaard I (2001a) Characterization of class 1 integrons
associated with R-plasmids in clinical Aeromonas salmonicida isolates from various geographical
areas. J Antimicrob Chemother 47(6):735–743. https://doi.org/10.1093/jac/47.6.735
Schmidt AS, Bruun MS, Dalsgaard I, Larsen L (2001b) Incidence, distribution and spread of tetra-
cycline resistance determinants and integron-associated antibiotic resistance genes among motile
aromonads from a fish farming environment. Appl Environ Microbiol 67(12):5675–5682. https://
doi.org/10.1128/AEM.67.12.5675-5682.2001
Scoaris DDO, Colacite J, Nakamura CV, Ueda-Nakamura T, Filho BA de A, Filho BPD (2008)
Virulence and antibiotic susceptibility of Aeromonas spp. isolated from drinking water. Antonie
Van Leeuwenhoe 93(1–2):111–122. https://doi.org/10.1007/s10482-007-9185-z
Shotts EB, Rimler R (1973) Medium for the isolation of Aeromonas hydrophila. Appl Microbiol
26:550–553 PMID:4584594
Son R, Rusul G, Sahilah AM, Zainuri A, Raha AR, Salmah I (1997) Antibiotic resistance and plasmid
profile of Aeromonas hydrophila isolates from cultured fish, Telapia (Telapia mossambica). Lett
Appl Microbiol 24:479–482. https://doi.org/10.1046/j.1472-765X.1997.00156.x
Stokes HW, Hall RM (1989) A novel family of potentially mobile DNA elements encoding site-
specific gene-integration functions: integrons. Mol Microbiol 3(12):1669–1683. https://doi.org/
10.1111/j.1365-2958.1989.tb00153.x
Sunde M, Norström M (2005) The genetic background for streptomycin resistance in Escherichia
coli influences the distribution of MICs. J Antimicrob Chemother 56(1):87–90. https://doi.org/
10.1093/jac/dki150
Sundström L, Rådström P, Swedberg G, Sköld O (1988) Site-specific recombination promotes
linkage between trimethoprim- and sulfonamide resistance genes. Sequence characterization of
dhfrV and sulI and a recombination active locus of Tn 21. MGG Mol Gen Genet 213(2–3):191–
201. https://doi.org/10.1007/bf00339581
Suzuki S, Hoa PTP (2012) Distribution of quinolone, sulfonamides, tetracyclines in aquatic envi-
ronment and antibiotic resistance in Indochina. Front Microbiol 3(67). https://doi.org/10.3389/
fmicb.2012.00067
Suzuki S, Ogo M, Miller TW, Shimizu A, Takada H, Siringan MA (2013) Who possesses drug
resistance genes in the aquatic environment? Sulfamethoxazole (SMX) resistance genes among
the bacterial community in water environment of Metro-Manila, Philippines. Front Microbiol
4(102). https://doi.org/10.3389/fmicb.2013.00102
486 F. Fauzi et al.
van Essen-Zandbergen A, Smith H, Veldman K, Mevius D (2007) Occurrence and characteristics

of class 1, 2 and 3 integrons in Escherichia coli, Salmonella and Campylobacter spp. in the
Netherlands. J Antimicrob Chemother 59(4):746–750. https://doi.org/10.1093/jac/dkl549
Wang G, Clark CG, Liu C, Pucknell C, Munro CK, Kruk TMAC, Caldeira R, Woodward DL,
Rodgers FG (2013) Detection and characterization of the hemolysin genes in Aeromonas
hydrophila and Aeromonas sobria by multiplex PCR. J Clin Microbiol 41(3):1048–1054. https://
doi.org/10.1128/JCM.41.3.1048
White PA, McIver CJ, Deng Y, Rawlinson WD (2000) Characterisation of two new gene cas-
settes, aadA5 and dfrA17. FEMS Microbiol Lett 182(265–269). https://doi.org/10.1016/s0378-
1097(99)00600-x
You KG, Bong CW, Lee CW (2012) Antimicrobial resistance in bacteria isolated from tropical
coastal waters of Peninsular Malaysia. Malays J Sci 31(2):111–120. https://doi.org/10.22452/
mjs.vol31no2.9
You KG, Bong CW, Lee CW (2016) Antibiotic resistance and plasmid profiling of Vibrio spp.
in tropical waters of Peninsular Malaysia. Environ Monit Assess 188(3):171. https://doi.org/10.
1007/s10661-016-5163-0
Chapter 42
Characterization of Untreated and Acid
Treated Natural Filler from L. Oryza
Sativa
Iqmal Che Hanah, Mohd Lias Kamal, Noor Aishatun Majid,

Wahida Abdul Rahman, Sharifah Nafisah Syed Ismail,
Nor Mazlina Abdul Wahab, Nur Fairuz Wahida Ibrahim,
Noor Faezah Mohd Sani and Siti Nur Liyana Mamauod
Abstract Natural filler has been proved as potential ingredient that can replace the
existing synthetic filler in polymer industry. Among the main intent of using this filler
is that it can promote better cost saving and safe for human and environment. How-
ever, it also offered the hydrophilicity property and existence impurities that coated
around the main filler component. Thus, it is important to ensure an appropriate
treatment for better performance of natural filler as a potent filler. The effect of acid
treatment on L. Oryza sativa (Rice Husk, RH) as natural filler was investigated in this
study. Through this investigation, hydrochloric acid (HCl) was used to hydrolyse the
I. C. Hanah · M. L. Kamal (B) · N. A. Majid · W. A. Rahman · S. N. S. Ismail · N. M. A. Wahab ·

N. F. W. Ibrahim
Faculty of Applied Sciences, Universiti Teknologi MARA Cawangan Perlis, 02600 Arau, Perlis,
Malaysia
I. C. Hanah
e-mail: iqmalhanah@gmail.com
N. A. Majid
e-mail: nooraishatun@uitm.edu.my
W. A. Rahman
e-mail: wahida811@uitm.edu.my
S. N. S. Ismail
e-mail: sharifahnafisah@uitm.edu.my
N. M. A. Wahab
N. F. M. Sani
Faculty of Applied Sciences, Universiti Teknologi MARA Cawangan Perak Kampus Tapah,
35400 Tapah Road, Perak, Malaysia
e-mail: faezah125@uitm.edu.my
S. N. L. Mamauod
Centre of Polymer Composites Research & Technology (PoCReST), Institute of Science (IOS),
Universiti Teknologi MARA Shah Alam, 40450 Shah Alam, Selangor, Malaysia
e-mail: nurliyana2219@uitm.edu.my

488 I. C. Hanah et al.
organic substance including cellulose and expose more hydroxyl (–OH) groups on
RH surface. The treated and untreated RH were characterized using Attenuated Total
Reflectance Fourier Transform Infrared (ATR-FTIR), Thermogravimetry Analysis
(TGA) and Scanning Electron Microscopy (SEM). The ATR-FTIR spectra of RH
showed higher intensity of –OH groups due to the acid that reduce intermolecular
hydrogen bonding. In addition, the SEM image showed rougher surface with more
pores presence on the treated compared to untreated RH. Meanwhile, in TGA anal-
ysis, it can be seen that treated RH possess higher thermal stability compared to
untreated RH. Apart from that, a significant mass change can be observed from the
treated RH where it is reduced from 60.22% to 55.51%; which indicated that few
materials in this natural filler have been partly removed from/during the acid treat-
ment process. As noted that acid treated RH became as ‘cleaned surfaces material’
that able to enhance the efficacy filler-polymer matrix bonding, thus, possibly can
cause on the enhancement of polymer composites performance.
Keywords L. oryza sativa · Acid treatment · Natural filler · Intermolecular

hydrogen bonding · Thermal stability
42.1 Introduction
Usage of petroleum-based plastics such as the commodity and engineering plastics

has been providing the world with tremendous benefits in life. These petro-based
plastics have greatly contributed in the development of high performance materials
where they were used to make various products. However, its non-biodegradability
properties increase the level of environmental pollutions since they have not been
disposed properly (Yang et al. 2004). To overcome this issue, natural fibres are being
used to reinforce main matrix in the plastics production and become the biodegradable
plastics. The needs of these natural-based materials is due to the non-toxic effect on
human body and environment.
In recent years, L. Oryza sativa also known as Rice Husk (RH) has became one
of the well-known natural-based filler that have been studied for its application as
potential reinforcing natural fibre in polymer matrix after specific treatment. It is a
by- product of rice hulling industry which can be obtained in huge amount at one
place. RH are fibrous and take comparatively small amount of input energy to be
processed. RH contains 35% cellulose, 21% hemicellulose, 31% lignin and 17%
ash (94% silica) by weight. These percentage compositions of RH are yet different
according to atmosphere, region conditions of growth, paddy type and techniques of
investigation.
The main crucial limitation in preparing RH is its low affinity with hydrophobic
matrices due to their hydrophilic property and the existence of waxes and natural
fats (Majeed et al. 2017). The hydrophilic RH can prevent itself to be mixed and
dispersed well in plastics matrix. Weak particle-matrix adhesion resulted by the poor
interaction between RH and matrix materials (Arjmandi et al. 2015). According to
42 Characterization of Untreated and Acid Treated Natural Filler … 489
Nabinejad et al. (2017) a higher amount of microcavities and water molecule clump
in the composite causes poor fibre-matrix adhesion.
Based on this specific intention, many researchers found few techniques to modify
natural fiber surfaces through physical and chemical treatments. One of the well-
known physical treatments of natural fiber is the steam treatment where it requires
the application of high-pressure steam in a steam explosion unit (Cherian et al. 2010).
However, such mechanical treatment on natural filler surfaces can contribute to high-
energy consumption and time consuming (Rahman et al. 2016). Besides, alkaline and
acid pre-treatments have been categorized under chemical treatment for natural fiber
surface modification. Alkaline treatment using sodium hydroxide (NaOH) solution
is a common surface modification technique of rice husk done by Chen et al. (2015),
Ndazi et al. (2007) and Nishata et al. (2017). Chen et al. (2015) found that alkaline
treated rice husk possesses a rougher surface. Moreover, research by Chanda et al.
(2015) discovered that NaOH treatment was able to remove the glue-like materials
or non-cellulosic materials from the natural fibres/fillers.
In addition, there is a recent research of RH surface modification using nitric
acid (HNO3 ) by Emdadi et al. (2015) that showed better improvement compared
to alkaline treatment. Nitric acid improved thermal stability of RH by enhancing
the temperature range of the degradation of primary hemicellulose and cellulose
which then followed by the decomposition of lignin. This is due to the elimination of
cellulose and hemicellulose more than lignin. However, nitric acid does not remove
a significant amount of hydroxyl (–OH) groups which results in high value water
absorbance. Another research done by Ang et al. (2013), hydrochloric acid as pre-
treatment of RH was used to modify its surface. As compared to alkaline treatment
using NaOH, hydrochloric acid exposes higher amount of –OH groups with more
cost saving method. It makes the surface of the natural fibres/fillers modestly cleaned
with less sharp cracks and edges. Thus, in this study, further investigations had been
designed and conducted in order to study the properties of RH after acid treatment
and compared with the untreated RH in terms of thermal stability properties and their
surface morphology.
42.2 Experimental
42.2.1 Materials
The Rice Husk (RH) was obtained from Kilang Beras BERNAS, Simpang Empat,
Perlis, Malaysia and was ground until it became powder. This powder form of RH
filler was used for surface pre-treatment with acid. Meanwhile, the Hydrochloric acid
(1 M) was obtained from Zarm Scientific & Supplies Sdn. Bhd., Butterworth, Pulau
Pinang, Malaysia.
42.2.2 Preparation of Rice Husk (RH) Powder
Rice husk (RH) was washed and dried in the oven at 100 °C to remove its humidity.
The 1 M hydrochloric (HCl) solution was prepared from the bottle reagent containing
37% HCl. Then, the dried RH was soaked and mixed with HCl solution by magnetic
stirrer. The mixture was heated at 120 °C. The treated RH (tRH) was washed with
tap water until the acid was completely removed which was checked using litmus
paper. It was then dried overnight at 80 °C before being used. Finally, it was kept in
an air-tight container for further analysis.
42.2.3 Characterization Analysis on untreated Rice Husk

(uRH) and treated Rice Husk (tRH)
Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR) Anal-

ysis. The FTIR spectra was obtained using ATR-FTIR Spectrometer Frontier
Perkin-Elmer for the uRH and tRH. The samples in the form of powder (uRH and
tRH) were analyzed within the wavenumber in the range of 400–4000 cm−1 .
Thermogravimetry Analysis (TGA). Thermal stability of uRH and tRH were
determined using Netzsch TG 209 F3 Tarsus. The amount of each samples was 5–
10 mg. The measurements were performed under nitrogen atmosphere from 30 °C
to 900 °C for uRH and tRH with a heating rate of 10 °C/min and a nitrogen flow rate
of 50 mL/min (Johar et al. 2012).
Scanning Electron Microscopy (SEM). Analysis Surface morphology of uRH
and tRH were investigated using Desktop Scanning Electron Microscopy at 500 ×
and 1000 × magnification. The sample was held at 5 kVe of a large negative potential
that relative to the fluorescent screen.
42.3.1 ATR-FTIR Spectra Analysis of uRH and tRH
Figure 42.1 shows the difference of ATR-FTIR spectra on untreated rice husk (uRH)
and treated rice husk (tRH). There is a slight difference in term of intensities of the
uRH and tRH. A broad peak in the range of 3200–3500 cm-1 indicates the presence
of stretching vibration hydroxyl (–OH) groups (Chen et al. 2015; Nishata et al. 2017).
This peak is sharper for the tRH as the acid treatment using hydrochloric acid (HCl)
successfully derange the structure of RH and exposes more –OH groups on its surface
and reduce the intermolecular hydrogen bonding.
In addition, O–H bending appears on both spectra due to the adsorbed water
at 1632 cm−1 which also been reported by Anh Tuan et al. (2017), Bathla et al.
Fig. 42.1 ATR-FTIR spectra of untreated rice husk (uRH) and treated rice husk (tRH)
(2018) and Das et al. (2014) which studied on the characterization of silica from rice
husk ash. This peak intensity increases on the tRH indicating the increase of –OH
groups on the surface after acid treatment. A similar trend of increasing intensity
at 2924 cm−1 indicating the stretching and vibration of C–H on both spectra due to
acid treatment. This peak belongs to aliphatic-saturated compounds presence in the
cellulose (Santana Costa and Paranhos 2018) which proves that the acid was able to
expose the cellulose part of RH.
The peak at 1727 cm−1 (Chen et al. 2015) on both spectra represents the carbonyl
stretching in the hemicellulose and lignin (Chanda et al. 2015). It implies that acid
treatment has merely distort the structure of RH instead of fully removing it.
The large peaks at 1029 and 1025 cm−1 on the uRH and tRH, respectively, are
related to the O-Si-O stretching vibration (Nishata et al. 2017; Athinarayanan et al.
2014). The intensity of this peak decreases on the tRH due to the acid treatment on
RH and causes the reduction of silica content on its surface. A similar trend where
the peak at 788 cm−1 that indicates the silica vibration almost disappeared which
was also reported by Emdadi et al. (2015) that studied the water absorption property
of treated RH using acid and alkali which are HNO3 and KOH respectively.
42.3.2 TGA Analysis of uRH and tRH
The thermal stability of uRH and tRH were investigated and the results as shown
in Figs. 42.2 and 42.3, respectively. Both curves showed there are three different
degradation stages involved and this can be supported by Nabinejad et al. (2017)
which studied on alkali treatment of RH filled polyester composites.
Fig. 42.2 Thermogravimetric (TGA) curves of uRH and tRH
Fig. 42.3 Derivative thermogravimetric (DTG) curves of uRH and tRH
In the first stage, moisture is being removed by the water evaporation which
occur between 20 °C to 110 °C. Meanwhile, for the second stage referred to the
decomposition of hemicellulose and other secondary volatile materials (120–250 °C)
(Martin et al. 2010; Stefani et al. 2005). Whereas, the final stage is lignin degradation
which occur between 250 and 380 °C (Martin et al. 2010; Stefani et al. 2005).
After the degradation of lignin, it proceeds to further considerable weight loss
where the uRH is only up to 610 °C which different compared to tRH that still
proceed after 800 °C (Martin et al. 2010). A significant mass change can be observed
for the tRH where it is reduced from 60.22% to 55.51% indicating few materials in the
RH has been partly removed due to the acid treatment. This statement is agreed with
the previous research done by Ang et al. (2013) that found through acid pre-treatment
on RH caused the removal of amorphous hemicellulose and cellulose. Based on both
curves, it can be seen that tRH possess higher thermal stability compared to uRH.
Fig. 42.4 Scanning Electron Microscopy of (a) untreated rice husk and (b) treated rice husk
42.3.3 SEM Analysis of uRH and tRH
Figure 42.4a and b show the scanning electron micrographs of the surface of uRH
and tRH, respectively.
The result shows that the surface of tRH is rougher than uRH due to the removal
glue-like materials such as lignin and hemicellulose (Chanda et al. 2015; Ang et al.
2013). This statement is also claimed by Nishata et al. (2017) which used acid as
chemical treatment on the RH.
In addition, it can be seen that more pores are presence with high volume and
bigger size on the surface of tRH, hence, it responsible for the higher interaction
of filler and polymer matrix and improve the mechanical properties of polymer
composites in future works (Nabinejad et al. 2017).
42.4 Conclusion
This study was successfully conducted and it was found that the acid pre-treatment
on rice husk (RH) as filler gave the same expected results through characterization
studies and can be used later in polymer matrix. The RH was soaked in Hydrochloric
acid (HCl) for two hours and due to the acid pre-treatment, the surface of treated rice
husk (tRH) appeared to be rougher than the untreated rice husk (uRH); and through
FTIR analysis, acid treated RH with higher –OH groups intensity had been traced.
In addition, thermal stability of tRH also increased compared to the uRH by the
reduction of mass change.
References
Ang TN, Ngoh GC, Chua ASM (2013) Comparative study of various pretreatment reagents on rice
husk and structural changes assessment of the optimized pretreated rice husk. Bioresour Technol
135:116–119
Anh Tuan LN, Kim Dung LT, Thanh Ha LD, Hien NQ, Phu D Van, Du BD (2017) Preparation
and characterization of nanosilica from rice husk ash by chemical treatment combined with
calcination. Vietnam J Chem 55(4):455–459
Arjmandi R, Hassan A, Majeed K, Zakaria Z (2015) Rice husk filled polymer composites. Int J
Polym Sci 2015:1–32
Athinarayanan J, Periasamy VS, Alhazmi M, Alatiah KA, Alshatwi AA (2014) Synthesis of biogenic
silica nanoparticles from rice husks for biomedical applications. Ceram Int 41(1):275–281
Bathla A, Narula C, Chauhan RP (2018) Hydrothermal synthesis and characterization of silica
nanowires using rice husk ash: an agricultural waste. J Mater Sci: Mater Electron 29(8):6225–6231
Chanda AK, Hazra A, Praveen Kumar M, Neogi S, Neogi S (2015) Chemical treatments of rice
husk filler and jute fiber for the use in green composites. Fibers Polym 16(4):902–910
Chen RS, Salleh MN, Ab Ghani MH, Ahmad S, Gan S (2015) Biocomposites based on rice husk
flour and recycled polymer blend: effects of interfacial modification and high fibre loading.
BioResources 10(4):6872–6885
Cherian BM, Leão AL, de Souza SF, Thomas S, Pothan LA, Kottaisamy M (2010) Isolation of
nanocellulose from pineapple leaf fibres by steam explosion. Carbohydr Polym 81(3):720–725
Das AM, Ali AA, Hazarika MP (2014) Synthesis and characterization of cellulose acetate from rice
husk: eco-friendly condition. Carbohydr Polym 112:342–349
Emdadi Z, Asim N, Yarmo MA, Sopian K (2015) Effect of Chemical Treatments on Rice Husk
(RH) Water Absorption Property. Int J Chem Eng Appl 6(4):273–276
Johar N, Ahmad I, Dufresne A (2012) Extraction, preparation and characterization of cellulose
fibres and nanocrystals from rice husk. Ind Crop Prod 37(1):93–99
Majeed K, Arjmandi R, Al-Maadeed MA, Hassan A, Ali Z, Khan AU, Khanam PN (2017) Structural
properties of rice husk and its polymer matrix composites: an overview. In: Lignocellulosic fibre
and biomass-based composite materials: processing, properties and applications, (December). pp
473–490
Martin AR et al (2010) Studies on the thermal properties of sisal fiber and its constituents.
Thermochim Acta 506(1–2):14–19
Nabinejad O, Debnath S, Ying TJ, Liew WYH, Davies IJ (2017) Influence of alkali treatment and
nanoclay content on the properties of rice husk filled polyester composites. Mater Sci Forum
882:89–100
Ndazi BS, Karlsson S, Tesha JV, Nyahumwa CW (2007) Chemical and physical modifications of
rice husks for use as composite panels. Compos Part A: Appl Sci Manuf 38(3):925–935
Nishata RRR, Sulong AB, Yuliana NY, Sahrim A (2017) Effect of surface modified rice husk
(RH) on the flexural properties of recycled HDPE/RH composite. Adv Mater Process Technol
3(4):482–489
Rahman WA, Ismail SNAS, Rosli M (2016) Morphology and properties of durian cellulose
nanofibres reinforced polyvinyl alcohol/starch based composite. AIP Conf Proc 1774(1):020005
Santana Costa JA, Paranhos CM (2018) Systematic evaluation of amorphous silica production from
rice husk ashes. J Clean Prod 192:688–697
Stefani PM, Garcia D, Lopez J, Jimenez A (2005) Thermogravimetric analysis of composites
obtained from sintering of rice husk-scrap tire mixtures. J Therm Anal Calorim 81(2):315–320
Yang HS, Kim HJ, Son J, Park HJ, Lee BJ, Hwang TS (2004) Rice-husk flour filled polypropylene
composites; mechanical and morphological study. Compos Struct 63(3–4):305–312
Chapter 43
Disease Mapping and Health Analysis
Using Free and Open Source Software
for Geospatial (FOSS4G):
An Exploratory Qualitative Study
of Tuberculosis
Muhammad Dinie Haqim Azewan and Abdul Rauf Abdul Rasam
Abstract Geographical information and communications technology (GeoICT)

have the potential to greatly improve the quality of healthcare and disease control
management system. Local health departments in some developing countries may
need to expense high costs to process the disease datasets using commercial or pro-
prietary geospatial technologies. This study aimed at exploratory studying on the GIS
function capabilities of Free and Open Source Software for Geospatial (FOSS4G)
disease mapping and analysing of tuberculosis (TB) in Petaling, specifically QGIS,
SAGA GIS and desktop software (ArcGIS). ArcGIS was utilised as a comparative
benchmark to the selected FOSS due to its advanced GIS functions of proprietary
and well-established software. The disease mapping and statistical analysis were
conducted using spatial patterns and hotspot map statistics toolbox in the software to
explore the local TB pattern. From comparative studies of the software capabilities, it
reveals that these GIS software have basic functions of disease mapping and analysis,
but a better performance was expected in ArcGIS software due to enhanced statis-
tical advancements. In the analytical aspect of FOSS, QGIS can perform slightly
better than SAGA GIS since QGIS can process both vector and raster analysis of the
disease datasets. Inclusively, SAGA GIS and QGIS have basic GIS capabilities and
special features such as practical, minimal cost and easy to use by the local health
departments.
Keywords Geospatial · FOSS4G · Disease mapping · Geohealth analysis ·

Tuberculosis
M. D. H. Azewan · A. R. Abdul Rasam (B)

Centre of Studies for Surveying Science and Geomatics, Faculty of Architecture Planning and
Surveying, Universiti Teknologi MARA Shah Alam, 40450 Selangor, Malaysia
M. D. H. Azewan
e-mail: diniehaqim19@gmail.com
A. R. Abdul Rasam
Environmental and Social Health Research Group Green Technology and Sustainable
Development (GTSD), Universiti Teknologi MARA Shah Alam, 40450 Selangor, Malaysia

496 M. D. H. Azewan and A. R. Abdul Rasam
43.1 Introduction
Open source GIS application nowadays has developed rapidly over the decades.
Free and open source software for geospatial (FOSS4G) applications provides more
benefit especially for universities, researchers and public. One of the first FOSS GIS
project—GRASS GIS—started its development in the early 80s (Neteler et al. 2012).
The first open source GIS application, Geographical Resources Analysis Support
System (GRASS) had been developed more than 20 years. With open sources GIS
application, users can process, analyse and map the GIS datasets.
Modelling and simulation also can be performed using FOSS or applications.
Open source GIS has been applied in health and disease studies such as in vector-
borne, food-borne and airborne diseases. Tuberculosis (TB) is an airborne disease
caused by bacteria, Mycobacterium tuberculosis through the air that most often affect
the lungs (WHO: Tuberculosis (TB) 2018). In the early 1940s and 1950s, TB was
the number one cause of death in Malaysia (Iyawoo 2004). Currently, the reported
cases of TB in 2016 are 7717 cases, an increase of 13.0% compared to 6815 cases
reported in 2015.
By several techniques provided by open source GIS software, distribution pattern
of TB disease can be mapped, analysed and can assist local health departments to
monitor and identify hot spot the infected area. Purchasing proprietary GIS software
(example ArcGIS) in developing countries is a bit expensive and technical constraint
for health departments. Thus, this study is conducted to examine the potentials of
FOSS4G in disease analysis and then it is hopefully can help the health department to
practically analyse the pattern of diseases using GIS free and open source platform.
Specifically, as an exploratory study, this study is carried out with several lim-
itation and purposes: (i) to map and analyse the spatial pattern of TB distribution
using selected GIS open sources (QGIS and SAGA GIS) and ArcGIS software, and
(ii) to examine the functional capabilities of the QGIS and SAGA GIS to map and
analyse the disease datasets. ArcGIS used in this study as a benchmark platform only
in comparing its GIS operations with the selected open source platform.
43.2 Review on Free and Open GIS Source Software

for Infectious Disease Epidemiology
43.2.1 GIS and Open Source Software
Geographical information system (GIS) consists of hardware, software, method, data

and people to organise, update, manipulate, analyse, store and display the geograph-
ical data (Koroleva and Nikitin 2014). In the past, desktop-based or commercial GIS
software have been widely used for environmental tasks such as land use and utilities
mapping, ecosystems modelling, landscape assessment and planning, transportation
43 Disease Mapping and Health Analysis Using Free and Open … 497
and infrastructure development, market analysis, visual impact analysis and many
more.
These days, open source GIS has been mainly chosen due to practical capabilities
and cost consideration. Open source software is a software where the source code
of software is available for modification and sending by the general public (Ramsey
and Street 2006). Open source software is not only created to give free source code,
but also the open source software is made to serve people who are interested in the
growth of the communities.
Domain free and open source software (FOSS) plays historically a strong role in
GIS. In the early 80s, one of the first FOSS GIS project—GRASS GIS—started its
development (Neteler et al. 2012). Many other FOSS GIS projects were developed
later in the 90s and mainly after 2000. A series of open source GIS software projects
for both desktop and server systems was established in different GIS sectors, includ-
ing software libraries for map projection and data format conversion, desktop GIS,
Web mapping/Web GIS, spatial SQL databases, geostatistics, and metadata inven-
tories in the 1990s (Neteler et al. 2012). Later in 2006, Open Source Geospatial
Consortium (OSGeo) was established to promote the applications of the software
globally.
GIS software have been considerably applied in numerous applications world-
wide. In Malaysia, this geospatial-based platform have been practically utilised in
research and industrial implementation, including vector disease (Bazlan et al. 2014),
waterborne and food-borne disease (Mohd Noor et al. 2011), airborne disease (Abdul
Rasam et al. 2019b, c), and non-communicable disease (Jamaluddin et al. 2018). In
the contexts of local TB case applications, the majority of the GIS software used are
commercial or desktop-based platform as conducted by researchers (Shariff et al.
2018; Rasam et al. 2017). Although commercial or proprietary software (such as
ArcGIS) have technical advantages in sophisticated analysis techniques, cost and
technical constraints should be also taken into consideration in a local health sec-
tor implementation especially for low-income country applications and sustainable
practices.
43.2.2 Tuberculosis in Malaysia
Tuberculosis (TB) notified cases have been discovered among the immigrant pop-
ulation, particularly those from high TB burden neighbouring countries especially
in Malaysia (Nissapatorn et al 2003). Malaysia is classified as a country with an
intermediate TB burden (Razak 2016). TB has been discovered among the immi-
grant population, particularly those from high TB burden neighbouring countries
that affected Malaysia (Nissapatorn et al. 2003).
People who are infected by TB because of several factors including demographic
factors, such as people who live in high population areas and then immigrate to the
low-income country (Li et al. 2014; Srivastava et al. 2015). In addition, people who
are poor socio-demographic and live in closed or crowded areas such as apartments
or flat, limited space and house are also the main characterization of the high-risk
groups of TB (Rasam et al. 2016). Furthermore, air pollutant is also one of the factors
contributing to TB infection. In 2016, the highest TB cases were recorded in Sabah
followed by Selangor and Sarawak. This study is conducted in one of the highest
TB cases in the country, which is Selangor (Razak 2016) by applying free and open
source GIS.
43.2.3 Roles of Free and Open Source GIS for Disease

and Health Applications
GIS applications in public health have been widely used by health organisations
worldwide, especially to detect the source of the disease outbreak (Fisher and Myers
2011; Douglas et al. 2019). An example role of GIS in health is that when John
Snow in London mapped cholera in the 1800s and then detected the sources of the
disease outbreak. Nowadays, GIS application has been used in health departments
to update the patient address and store in the database. GIS can provide information
support in health, which is the distribution in health service. GIS can also improve
the spatial information management of health datasets. In addition, health data can
be modelled in providing a better understanding and interactive representation of
disease transmission. For example, tools in ArcGIS can map diseases in order to
easily understand sources of location disease and how it spreads.
In terms of GIS in global tuberculosis (TB), Goswami et al. (2012) demonstrated
the potential of geographical-based community outreach to provide an integrated
disease screening for high-risk populations, with reasonable yield and opportunities
to re-engage infected persons in health care using GIS-based screening for TB,
HIV and syphilis (GIS-THIS). The study applied ArcGIS Desktop 9.3 to map the
residences of tuberculosis, HIV and syphilis cases incident and designated the hotspot
and simultaneously and the health department is referred by participants with positive
tests of TB.
Another related study about TB transmission patterns is conducted by Munch
et al. (2003) who stated that unemployment and its associated poverty emerged
as the strongest association to the high tuberculosis notifications. Map was also
produced showing the distribution of all selected tuberculosis cases in dot-density
maps. In addition, Boulos and Honda (2006) applied Web GIS in publishing people’s
health maps and connecting to remote WMS sources using the Open Source UMN
MapServer and DM Solutions MapLab.
The study stated that a stage of maturity, sophistication, robustness and stability,
and usability and user-friendliness rivalling that of commercial or proprietary GIS
and Web GIS server products has reached by Open Source Web GIS software sys-
tems. Previous studies have shown that using merely FOSS have the potentials to
deliver functions necessary or to disseminates health and environmental datasets eas-
ily (Smith and Hayward 2016; Evans and Sabel 2012). Local GIS-based mapping and
analyses of TB are also conducted in Malaysia, but most of the GIS platforms used
are commercial software (Abdul Rasam and Mohd Shariff 2019a) due to advanced
simulation or predictive modelling capabilities.
43.3 Data and Methods
The main methods involved in this study are started from project planning to result
and analysis. The first stage is that project planning where all process was given
understanding about each process and how it will be carried out. Project planning
consists of several factors that need to be considered before conducting data process-
ing such as tools and site selection. Petaling District in Selangor (see in Fig. 43.1)
was selected as a study area because it has the most population and most tuberculosis
cases reported in this state.
Fig. 43.1 Location of the study area: Petaling district in Selangor

ArcGIS Desktop 10.3, QGIS 2.18 and SAGA, Google Earth are the main software
utilised in this study. Tuberculosis cases data were acquired from the Selangor Depart-
ment of Health in excel (.xls) file format and then were processed using QGIS, SAGA
GIS and ArcGIS. The disease mapping and analysis were produced using Average
Nearest Neighbour, High/Low Clustering (Getis-Ord General G), Spatial Autocorre-
lation, Optimized Hotspot Analysis, Heatmap (Kernel Density Estimation). Finally,
the operational comparison was made between ArcGIS, QGIS and SAGA GIS based
on their geospatial capability in the disease analysis and mapping of TB pattern.
43.4.1 Mapping Tuberculosis Distribution and Pattern
Mapping of tuberculosis distribution pattern is a basic function in GIS software. TB

map in point and surface forms were created in ArcGIS and two selected GIS open
source software which are QGIS and SAGA GIS. The maps show the concentration
of TB cases in Petaling in 2017.
Comparison of TB Point Map between ArcGIS, QGIS and SAGA GIS.
Table 43.1 shows the capability of GIS using ArcGIS, QGIS and SAGA GIS in
creating point disease map. For ArcGIS, the platform can create a map with map
elements such as legend, north arrow, scale, title and grid. Similarly, QGIS can also
map the disease with basic map elements but the map composer is more complex
than the layout view created in ArcGIS. QGIS colour can provide the same as created
in ArcGIS but the colour selection in SAGA GIS is limited choice. SAGA GIS also
has a limited map composition for showing a basic map element of diseases.
Comparison of TB Surface Mapping between ArcGIS, QGIS and SAGA GIS.
Table 43.2 illustrates the surface map generated by ArcGIS, QGIS and SAGA GIS
software. Each software has supported the map capability. For ArcGIS map creator,
it consists of a complete set of map elements to create the disease map. Meanwhile,
the QGIS map composer also has several map elements as created by ArcGIS, but
several map elements need to be specified and put on the map composer. In different
with SAGA GIS, there is limited in a proper map creator, but the map element can
put on the data and save the map as an image.
43.4.2 Comparison of Disease Analysis Using ArcGIS, QGIS

and Saga GIS
Statistical Analysis Using Average Nearest Neighbour Analysis. Table 43.3 dis-
plays the statistical comparison on the average nearest neighbour analysis between
Table 43.1 Point maps of tuberculosis cases

ArcGIS QGIS
SAGA GIS
ArcGIS and QGIS and the acceptance results in terms of parameters are quite differ-
ent but acceptable for the spatial disease analysis such as average nearest neighbour
analysis. Meanwhile, statistical results in SAGA GIS are limited applications to be
applied by users for disease analysis purposes.
Heat Map Analysis between ArcGIS, QGIS and SAGA GIS. After running
the hotspot analysis and map classification with 5 classes, then the data of TB cases
are overlaid in the maps. Map in ArcGIS shows the TB hotspot area is displayed in
red colour, while for the moderate hotspot and low hotspot area are shown in yellow
and green, respectively. Similarly, QGIS can also show the hotspot area in different
colours, including red, yellow, and green. Meanwhile, SAGA GIS only plots the map
based on the point concentration at an area as shown in Table 43.4.
GIS Potentials of ArcGIS, QGIS and SAGA GIS for Basic Geospatial
(FOSS4G) Disease and Health Applications. Table 43.5 indicates the basic capa-
Table 43.2 Surface map of tuberculosis cases

ArcGIS QGIS
SAGA GIS
bility of the selected software in the mapping of TB cases. All the selected GIS
software can map the disease, but in terms of mapping element, ArcGIS is easier
to use and has completed elements than the QGIS and SAGA GIS in TB mapping.
For heat map analysis, all software can do the heat map analysis, but in statistical
analysis, ArcGIS contains more tools than others since it can make an advanced
statistical analysis for tuberculosis pattern, In specifically ArcGIS has 6 tools used
compared to QGIS tool, but SAGA GIS has limited function for statistical analysis
of the disease distribution.
43.5 Conclusion
This paper has examined the GIS operation capabilities of ArcGIS and another two
GIS open source software for health and disease applications, especially to map
and analyse tuberculosis (TB) cases in the Petaling, Selangor. ArcGIS, QGIS and
SAGA GIS are specific software used in this study. ArcGIS-Desktop platform, a
commercial well-known tool is utilised as a benchmarking software in comparing it
Table 43.3 Comparison of average nearest neighbour analysis between ArcGIS and QGIS
ArcGIS QGIS
Observed Mean Distance: 160.3242 Observed Mean Distance: 166.230174356

Expected Mean Distance: 358.8599 Expected Mean Distance: 383.679829035
Nearest Neighbour Ratio: 0.446760 Nearest Neighbour Ratio: 0.433252315541
z-score: −40.260489 z-score: −40.7415910954
Differences
Observed Mean Distance: −5.9059743
Expected Mean Distance: −24.819929
Nearest Neighbour Ratio: 0.013507684
z-score: −0.48110209
with the selected open source software for TB applications. As expected, ArcGIS is
a compatible platform with many tools for disease mapping and health analysis since
the software is a well-established source, especially for spatial statistical analysis.
QGIS software has also the same capability of statistical analysis as ArcGIS but it
has limitations in terms of advanced numerical analysis, such as less providing in the
file format support in QGIS as posed by ArcGIS. Furthermore, several analyses in
QGIS, in general, need to do a coding (Python language) to solve the error and some
of the analysis tool that is called plugin need to install to use it. Similarly, SAGA GIS
has capable to do spatial analysis, but this software is more to analyse raster data than
vector data. In this pilot study, the QGIS and SAGA GIS software may have limitation
to perform advanced analysis as made by ArcGIS, but these open source platforms
could conduct basic functions of disease mapping and analysis that are relevant to
the local health applications especially for the implementation of TB/Leprosy Unit
in Malaysia. The benefit of FOSS4G in this study is that it can convey the disease
datasets to non-experts alike without the requirement of commercial or proprietary
software. A comprehensive exploration of the functions of the common FOSS4G
platform for the local disease applications is highly recommended for the subsequent
study.
Table 43.4 Comparison of heat map analysis between ArcGIS, QGIS and SAGA GIS
ArcGIS QGIS
SAGA GIS
Table 43.5 Exploratory evaluation of geospatial capabilities between ArcGIS, QGIS and SAGA
GIS for TB mapping and analysis
GIS functional capability ArcGIS QGIS SAGA GIS
Mapping
√ √ √
Point map
√ √ √
Surface map
Heat map analysis
√
Kernel density
√ √
Heat map
Hotspot analysis
√
Cluster and outlier analysis
√
Hotspot analysis (Getis-Ord Gi)
√
Optimized hotspot analysis
Statistical analysis
√ √ √
Average nearest neighbour
√
High/Low clustering (Getis-Ord General G)
√
Spatial autocorrelation (Moran’s 1)
Acknowledgements The authors would like to acknowledge the Selangor States Health Depart-
ment for providing TB data in this research paper. This study has been registered in the National
Medical Research Register, Malaysia (ID: NMR R-15-2499-24207). Thanks also to the Institute
of Research Management and Innovation (IRMI) UiTM Shah Alam for providing the LESTARI
research grant, 600-IRMI 5/3/LESTARI (005/2018).
References
Abdul Rasam AR, Mohd Shariff N (2019a) Disease mapping and spatial landscape characterization
of tuberculosis ecology in Malaysia. Abstr. Int. Cartogr. Assoc 1(1). https://doi.org/10.5194/ica-
abs-1-1-2019,
Abdul Rasam AR, Shariff NM, Dony JF (2019b) Geospatial-based model for diagnosing potential
high-risk areas of tuberculosis disease in Malaysia. MATEC Web Conf. 266:02007
Abdul Rasam, AR, Shariff NM, Dony JF, Othman F (2019c) Spatial and statistics for profiling risk
factors of diseases: a case study of tuberculosis in Malaysia. IOP Conf Ser: Earth Environ Sci
385(2019):012037. https://doi.org/10.1088/1755-1315/385/1/012037
Bazlan MJ, Ghazali R, Abdul Rasam AR, Aziz NFA (2014) Development of integrated infectious
disease information system (IDIS): geospatial-based components for malaria information system
(GeoMIS) In: 2014 IEEE 5th control and system graduate research colloquium, Shah Alam, pp
75–79. https://doi.org/10.1109/icsgrc.2014.6908699
Boulos MN, Honda K (2006) Web GIS in practice IV: publishing your health maps and connecting
to remote WMS sources using the open source UMN mapserver and DM solutions maplab. Int J
Health Geogr 5:1–7. https://doi.org/10.1186/1476-072X-5-6
Douglas JV, Bianco S, Edlund S, Engelhardt T, Filter M, Günther T, Hu K, Nixon EJ, Sevilla NL,
Swaid A, Kaufman JH (2019) STEM: an open source tool for disease modeling 4. https://doi.
org/10.1089/hs.2019.0018
Evans B, Sabel CE (2012) Open-source web-based geographical information system for health
exposure assessment. Int J Health Geogr 11:2. https://doi.org/10.1186/1476-072X-11-2
Fisher RP, Myers BA (2011) Free and simple GIS as appropriate for health mapping in a low
resource setting: a case study in eastern Indonesia. Int J Health Geogr 10(15). https://doi.org/10.
1186/1476-072x-10-15
Goswami ND, Hecker EJ, Vickery C, Ahearn MA, Cox GM, Holland DP, Stout JE (2012)
Geographic information system-based screening for TB, HIV, and syphilis (GIS-THIS): a
cross-sectional study. PLoS ONE 7(10):1–8. https://doi.org/10.1371/journal.pone.0046029
Iyawoo K (2004) Tuberculosis in Malaysia: problems and prospect of treatment and control.
Tuberculosis 84(1–2):4–7. https://doi.org/10.1016/j.tube.2003.08.014
Jamaluddin AS, Abdul Rasam AR, Khalid N, Halim MA (2018) Exploring open source GIS for drug
mapping and analysis in Malaysia. In: IEEE 8th international conference on system engineering
and technology (ICSET), Bandung, pp91–96. https://doi.org/10.1109/icsengt.2018.8606360
Koroleva EV, Nikitin YY (2014) Principles of geographic information sysyem. J Multivar Analysis.
https://doi.org/10.1016/j.jmva.2014.02.00
Li R, Cheng S, Luo C, Rutherford S, Cao J, Xu Q, Li X (2014) Epidemiological characteris-
tics and spatial-temporal clusters of mumps in shandong province, China, 2005-2014. Sci Rep
7(March):1–10. https://doi.org/10.1038/srep46328
Mohd Noor AM, Abdul Rasam AR, Ahmad N (2011) Ghazali R MyGeoHealth: GIS-based cholera
transmission risk system in Sabah, Malaysia. In: IEEE 7th international colloquium on signal
processing and its applications, Penang, pp 474–479. https://doi.org/10.1109/cspa.2011.5759925
Munch Z, Van Lill SWP, Booysen CN, Zietsman HL, Enarson DA, Beyers N (2003) Tuberculosis
transmission patterns in a high-incidence area: a spatial analysis. Int J Tuberc Lung Dis 7(3):271–
277. https://doi.org/10.1016/S2214-109X(15)00100-X
Neteler M, Bowman MH, Landa M, Metz M (2012) GRASS GIS: a multi-purpose open source
GIS. Environ Model Softw 31:124–130. https://doi.org/10.1016/j.envsoft.2011.11.014
Nissapatorn V, Lim YAL, Jamaiah I, Chin HM, Ilyana MZ, Nonaziah MZ, Hasifah AS (2003)
Tuberculosis in Malaysia: a continuing surge. Southeast Asian J Trop Med Public Health 297:231–
239
Ramsey P, Street SD (2006) The State of Open Source GIS. Source 250:1–30
Rasam ARA, Mohd Shariff N, Dony JF, Maheswaran P (2017) Mapping risk areas of tuberculosis
using knowledge-driven GIS model in Shah Alam. Malays Pertanika J Soc Sci HumIties 2:135–
144
Rasam ARA, Shariff NM, Dony JF (2016) Identifying high-risk populations of tuberculosis using
environmental factors and GIS based multi-criteria decision-making method. Int Arch Pho-
togramm, Remote Sens Spat Inf Sci; Gottingen XLII-4/W1:9–13. https://doi.org/10.5194/isprs-
archives-xlii-4-w1-9-2016
Razak A (2016) Pattern of tuberculosis in Malaysia, 1. http://aar2017.com/abs/D2/BODY-
IMAGING/1. SB 01 Hj Abdul Razak.pdf. Last accessed 6 June 2018
Shariff NM, Abdul Rasam AR, Dony JF, Misni A (2018) Socio-environmental factors and
tuberculosis: an exploratory spatial analysis in peninsular Malaysia. Int J Eng & Technol
7(3.11):187–192
Smith CM, Hayward AC (2016) DotMapper: an open source tool for creating interactive disease
point maps. BMC Infect Dis 16:145. https://doi.org/10.1186/s12879-016-1475-5
Srivastava K, Kant S, Verma A (2015) Role of environmental factors in transmission of tuberculosis.
Dyn Hum Health 20152(4):1–12
WHO: Tuberculosis (TB) (2018). http://www.who.int/tb/en/. last accessed 2018/6/6
Chapter 44
E-Mosque Tourism: Discovering
Mosques via Geodigital Mapping
in Kuala Lumpur, Malaysia
Nurin Syarafina Mohd Hasmizi, Abdul Rauf Abdul Rasam

and Noraain Mohamed Saraf
Abstract The mosque represents the heart of Muslim religion and community.
Mosque plays an important role in bringing the Muslim communities together. As
the technology is developing, the function of the mosque is also getting wider. A
proposed electronic or e-mosque does not only act as the place for the religious
purposes, but the beautiful and the modern architecture has turned it into one of the
knowledge and tourism attractions in Malaysia. Despites the importance of the role of
mosque in Malaysia, the recording and providing geoinformation about the mosques
are still lacking. Therefore, the aim of this paper is to develop a GeoWeb system and
GeoMobile application or e-mosque exploration in Kuala Lumpur. The methodology
involved in developing the system is spatial data collection of mosques data in Kuala
Lumpur, data processing, system development, system implementation, and testing.
After conducting user requirement, majority of the respondents strongly agreed that
the proposed system and applications of discovering mosques in Kuala Lumpur need
to be developed completely. The system built has more information on the mosques
such as the location can help the user to get the direction of the mosque. Besides, the
system also has the important geoinformation such as the activities of the mosques
which can help the user to get updated on the activities of the mosque. The respon-
dents corresponded with the overall functions proposed in the system, but the other
significant digital elements such as virtual reality (VR) and augmented reality (AR)
could be further integrated with the developed system or apps.
Keywords E-Mosques tourism · GeoWeb-based system · GeoMobile

applications · GIS · Geodigital
N. S. Mohd Hasmizi · A. R. Abdul Rasam (B) · N. Mohamed Saraf

Centre of Studies for Surveying Science and Geomatics, Faculty of Architecture Planning and
Surveying, Universiti Teknologi MARA, 40450 Shah Alam, Selangor, Malaysia
N. S. Mohd Hasmizi
e-mail: nurin.syarafina@yahoo.com
N. Mohamed Saraf

508 N. S. Mohd Hasmizi et al.
44.1 Introduction
The institution of mosque has been playing the main role in establishing, developing,
and flourishing the Muslim communities since the beginning of Islam (Utaberta et al.
2015). The word of mosque is originated from the word “Mesjid”. It is the sacred place
where people go there to prostrate god. In terms of community, it is the place where
the Muslims meet at least five times a day to worship the one God. Mosque represents
the heart of Muslim religion and community. Even in the past years, mosque had
become one of the biggest institutions in Islamic world. Some of the functions of
mosque in the past including as a learning school, a court, and a political forum where
citizens discussed their problems with the khalifa (Rabah 2002). It shows that the
mosque is playing an important role in bringing the Muslim communities together.
As the technology is developing, the function of the mosque is also getting wider.
The mosque does not only act as the place for the religious purposes, but the beau-
tiful and the modern architecture has turned it into one of the tourism attractions
in Malaysia. Being the capital city of Malaysia, Kuala Lumpur has become one of
the famous tourism spots among the foreigners and even the local from other states.
Having majority of Muslims community, mosque is one of the dominant Islamic land-
marks in Kuala Lumpur. Despites the importance of the role of mosque in Malaysia,
the recording, providing, and exposing information about the mosques are still lack-
ing. Most of the information provided regarding the mosque are mostly done in a
hardcopy way which make it less easy and less interesting for the information to
be delivered to the user. Thus, the role of technology is needed in providing the
information of the mosque in an easier, faster, and practical way.
Today, the maps are available in digital form such as on computer and mobile
phones. Technologies advances nowadays are changing the way maps are created
and displayed such as digital and web-based multimedia cartography that are bring-
ing maps outside the mainstream flow by giving a new life to archive data such as
old paper maps and photographs (Dieudonne and Anita 2009; Santoso et al. 2016).
There are also several websites showing some information about the mosques. Each
of the website has a different focus, but all the websites are still lacking the detailed
information about the mosque that could be beneficial for both the Muslims and
tourists. Therefore, this innovation is intended to build apps and website of multi-
media cartography (e-Mosque) consisting of the map of mosque in Kuala Lumpur
completed with other geospatial information.
44.2 A Review on Geovisualistion in Mosque Tourism
44.2.1 Mosque and Tourism
A mosque is a place of worship for Muslims. There are strict and detailed require-
ments in Sunni jurisprudence for a place of worship to be considered a mosque, with
44 E-Mosque Tourism: Discovering Mosques via … 509
places that do not meet these requirements regarded as musallas. There are stringent
restrictions on the uses of the area formally demarcated as the mosque and in the
Islamic Shariah, after an area is formally designated as a mosque, it remains so until
the last day. Many mosques have elaborate domes, minarets, and prayer halls, in
varying styles of architecture. Mosques originated on the Arabian Peninsula but are
now found in all inhabited continents.
Since the beginning of Islam, the institution of mosque has been playing the main
role in establishing, developing, and flourishing the Muslim communities. In terms of
community, it is the place where the Muslims meet at least five times a day to worship
the one God. The mosque represents the heart of Muslim religion and community.
Even in the past years, mosque had become one of the biggest institutions in Islamic
world. Some of the function of mosque in the past including as a learning school, a
court, and a political forum where citizens discussed their problems with the khalifa
(Rabah 2002). It shows that the mosque is playing an important role in bringing the
Muslim communities together.
As the technology is developing, the function of the mosque is also getting wider.
The mosque does not only act as the place for the religious purposes, but the beau-
tiful and the modern architecture has turned it into one of the tourism attractions in
Malaysia (Aziz et al. 2016). The architecture of mosque is shaped most strongly by
the regional traditions of the time and place where it was built. As a result, style,
layout, and decoration can vary greatly. Nevertheless, because of the common func-
tion of the mosque as a place of architectural features appear in mosques all over the
world. Some bigger mosques are even used as law courts for the few problems of the
Muslims today. The Prophet used mosques as a means of Da’wah (calling people to
Islam), and some people still do it today.
In addition, there are many rooms in the mosque that people rent to use for things
like meetings and deliberations or like birth, marriage functions, charity events, and
parties. Mosques are very important to Muslims because it brings people together and
helps to spread the word of God around, In Malaysia, after 50 years of Independence,
it has become a developing Islamic country, and the functions of the mosque are also
broader than previously, such as academic institution, social welfare centre, Islamic
tourism, and others.
44.2.2 Geovisualisation and Electronic Mosque Tourism
In general, geovisualization deals with a set of techniques supporting the analysis

of geospatial data using interactive spatial visualization such as GIS, remote sens-
ing, cartography, and other mapping applications. Geographic Information System
(GIS) is the computer system that can capture, storing, checking, integrating, manip-
ulating, analyzing, and displaying data related to positions on Earth’s surface. By
relating seemingly unrelated data, GIS can help individuals and organizations better
understand spatial patterns and relationships.
GIS applications include both hardware and software systems. These applications
may include cartographic data, photographic data, digital data, or data in spread-
sheets. Cartographic data are already in map form, may include such information as
the location of rivers, roads, hills, and valleys. Cartographic data may include survey
data, mapping information which can be directly entered through a GIS tool. Photo-
graphic interpretation is a major part of GIS. Photo interpretation involves analyzing
aerial photographs and assessing the features that appear. GIS technologies allow all
these different types of information, no matter their source or original format, to be
overlaid on top of one another on a single map. GIS uses location as the key index
variable to relate these seemingly unrelated data.
GIS is an important technology in multimedia cartography that is the collection
of geographical information in a manner that allows presentation through various
display interfaces (Stopper et al. 2012). Multimedia cartography is based on tradi-
tional cartography and is its further development. Cartography benefited a lot from
the development and the ideas of multimedia system (Moreira 2009) and it contin-
uously does. Multimedia cartography derived from the need to intuitively present
geographical information on computer screens. In contrast to traditional cartogra-
phy, a multimedia map combines various media and may feature interactivity. The
implementation of interactivity in a multimedia map is important as it allows the user
to actively manipulate the map. Multimedia information system in tourism can easily
attract more attention from tourists (Gundogdu et al. 2016), boost regular updates
of Web links (Sawyer 2008), and used for decision-making purposes (Moufa and
Muller 2002).
An electronic mosque (e-Mosque) is generally referred to an application of infor-
mation technology and system in displaying attributes of mosque such as prayer
times, mosque activities, and Qibla direction. In this study, besides the information,
geovisualization such as multimedia cartography is also displayed to analyze the
related geoinformation of the mosques. Multimedia cartography has been applied to
a lot of applications. Each of the applications illustrates the rich media components
that Multimedia Cartography offers users on geospatial information.
ArcGIS Online and Android applications are currently applied to develop the
mapping system such as electronic city, building, and any space information system.
ArcGIS Online is a cloud-based mapping and analysis solution. It is used to make
maps, analyze data, and to share and collaborate. Boulos and Honda (2006) said
that this application can improve time response, and understandability compared to
conventional map distribution.
Android is the name of the mobile operating system (OS) possessed by American
organization named as Google. It most generally comes introduced on an assortment
of cell phones or smartphone and tablets from a large group of producers offering
users access to Google’s own services like Search, YouTube, Maps, Gmail, and that’s
just the beginning. This implies user can undoubtedly search for data on the web,
watch recordings video, scan for headings, and compose messages or email on their
telephone, pretty much as you would on their computers. Android is presently the
world’s most generally utilized cell phone stage and is utilized by a wide range of
telephone makers.
The combination of GIS, mobile apps, and mapping is beneficial for society
development (Bazlan and Abdul Rasam 2012; Abdul Rasam et al. 2018; Halim et al.
2018; Zain Rashid and Abdul Rasam 2019) especially in Islamic tourism applications
(Aziz et al. 2016; Shyti and Kushi 2012; Jovanović and Njeguš 2008; Abdul Rasam
et al. 2013a). Islamic tourism in Malaysia is significantly developing since the country
has the different assets for Islamic hotpots to display their religion and culture like
mosque, museums, and university (Aziz et al. 2016; Abdul Rasam et al. 2013b).
44.3 Data and Methods
Figure 44.1 shows the general methodology or general steps on how to acquire the aim
and objective of this project. The general workflow of this project can be interpreted
as general steps which need to be followed so that the project can run successfully.
Need assessment is the process of creating system prerequisites that are gener-
ally created by reporting the courses in which an association utilizes data. It is the
evaluation of existing systems and their capabilities to perform future processing
need. Need assessment is an initial phase in executing a project which can help to
identify what is expected from the project. It can also help to identify the potential
problems of projects. For this project, 10 questions had been made to collect the user
requirement and their view about the existing mosque web. The application will be
executed based on the users’ views.
The planning phase in a project is a crucial phase where it is used to make a selec-
tion of the required research area and selection of software and hardware. Planning
phase is very important since it involves creating a set of plan which acts as a guide
throughout the execution and closure phases of the project. For this project, the study
area selected is Kuala Lumpur, the capital state of Malaysia. Over 8 million people
live within the greater KL area. It has many interesting attractions such as Merdeka
Web
Need assessment Planning Data CollecƟon Data Processing implementaƟon
and TesƟng
Fig. 44.1 Methodology of e-mosque in Kuala Lumpur

Square, Chinatown, and Petronas Twin Towers. Kuala Lumpur is chosen as the study
area for this project because Kuala Lumpur is one of the states in Malaysia which
has a lot of famous and beautiful mosque. ArcGIS Desktop 10.3, ArcGIS Online,
and App studio for ArcGIS are the main tools used in this study.
Data collection is the process of gathering and measuring information on vari-
ables of interest, in an established systematic fashion that enables one to answer the
stated research outcome. In this project, the primary data is collected by visiting
the mosques in Kuala Lumpur. Secondary data collection refers to the data collec-
tion from existing sources such as maps, chart, and documents. The secondary data
collected for this project is collected from the website in Google. One of the web-
sites used for collecting the data in this project is the website called www.mymasjid.
net.my/masjid/location/3/wilayah-persekutuan/18/kuala-lumpur. Some of the data
collected from the web is the address of the mosques in Kuala Lumpur.
During design phase, the system was created to follow the requirement identified
during need assessment. The requirements identified in the need assessment phase
are transformed in a system design document that accurately describes the design of
the system. The main steps applied in this study are database creation, data editing
in ArcMap, web map application, and data sharing in ArcGIS Online. Last stage is
system testing and implementation which is to ensure that the application produced
can be used and run properly without any problem. Any report made regarding to
the web application will be published on the server and the application. This step
is important in order to detect any error or lack of the application. Any error that
occurred must be improved before it can be used by public.
44.4 Development and Functions of E-Mosque in Kuala

Lumpur
The aim of this product is to build a web system and mobile application of mosque
(e-Mosque) for enhancing the information through platform of mapping for mosques
in Kuala Lumpur.
44.4.1 Constructive Feedbacks from the Users
There are 50 respondents from variety of ages and sexes who gave their responses
on this product’s survey. Figure 44.2 found that most respondents (51.2%) were
unsatisfied with the existing system and application on the market. This may be
caused by the lack of information provided in the existing system or application on the
Internet. Meanwhile, there are about 98% of the respondents strongly agree and agree
that it is necessary to develop a web-based system or mobile application for helping
the public to get more information about the mosques because it will help them to get
Fig. 44.2 Satisfaction of

respondents of the current
system
Fig. 44.3 The need of

developing proposed web
system
useful information regarding to the mosques they wanted to visit in Kuala Lumpur
(Fig. 44.3). Therefore, the respondents were suggested on the information that they
prefer in the system for exploring the mosques in Kuala Lumpur. The information
includes address, activities, facilities, and map location of those mosques.
44.4.2 Practical Functions of the Web System and Mobile

Applications of E-Mosque Tourism
This web-based system was developed so that the public can easily access the infor-
mation of mosques in Kuala Lumpur such as the location, types, and activities of
several main mosques in Kuala Lumpur as shown in Fig. 44.4. This website allows
the users to get know the activities available for the mosque which will then help
them in decision-making. This website is also can be used not only by the local, but
Fig. 44.4 Menus and functions in e-mosque tourism
also by the tourist. It is a product that can be linked with the web system that had
been developed from ArcGIS Online.
Overall, the function of this user-friendly mobile application consists of main
page, main map of the study area object button, base map widget, draw a path widget,
search widget, and map navigation control. For example, in object button, users can
obtain the attribute or the information of the features or object button available on
the application such as the mosques, Islamic Department of Wilayah Persekutuan,
and the Islamic Cemetery in Kuala Lumpur. Users can get to know the information
such as the activities available for each of the mosques depicted. Besides this, other
information such as the addresses, type, and the coordinate for locating the mosque
can also be obtained in the system. These attributes are also available for the other
features depicted on the map as shown in Fig. 44.5. This creative map is not only
displaying the main information of the mosques but also providing a graphic and
cognitive cartography on the current and future activities of the mosques.
44.4.3 Testing the GeoWeb-Based System and GeoMobile

of E-Mosque Applications
There are 10 selected respondents from variety of ages and sexes who gave their
responses on this product’s survey. Figure 44.6 found out that 80% of the respondents
were satisfied with the proposed system. While another 11% percent were natural
and other 1% is not really satisfied with the system. The next question asked was on
the satisfaction with the information provided in the system. 80% of the respondent
Fig. 44.5 A cartographic mapping of e-mosque tourism in Kuala Lumpur
Fig. 44.6 Satisfaction on the functions of the proposed system
were satisfied with the information provided from the systems. Another 13% of the
respondent were only feeling neutral and other 2% were unsatisfied. Interestingly,
95% of the respondents agreed that the system can be easily understood after using
it practically.
44.5 Conclusion
The GeoWeb-based system and apps of e-mosque were developed aiming at

exploratory geovisualizing mosques in Kuala Lumpur. The respondents strongly
agree that it is necessary to develop a GeoWeb-based system or GeoMobile applica-
tion for helping the publics to get detailed geoinformation or geodiscoveries about the
mosques. The geoinformation include address, activities, facilities, and map location
of those mosques and others. Since the respondents also strongly agree to depict all
the suggested geoinformation inside the proposed system and mobile application,
this prototype apps are reliable and practical to be applied by local users on the sites
for the local mosque and tourism activities.
References
Aziz MA, Ibrahim MJ, Kassim PS, Abdullah A (2016) Issues and potential of mosque as a spiritual
tourism destination in Malaysia. In: Proceedings of ISER 22nd international conference, Hong
Kong
Abdul Rasam AR, Hanif FA, Samad AM, Hadi RA (2013) Spatial information management system
for building energy consumption. In: IEEE 3rd international conference on system engineering
and technology. Shah Alam, pp 295–299. https://doi.org/10.1109/icsengt.2013.6650188
Abdul Rasam AR, Mazlan AS, Wan Rodi WN (2013) GIS-based muslim cemetery information
system. In: 2013 IEEE business engineering and industrial applications colloquium (BEIAC).
Langkawi, pp 364–368. https://doi.org/10.1109/beiac.2013.6560149
Abdul Rasam AR, Azlin AH, Saraf NM (2018) Mobile apps and web gis-based accessible health
and social care system for people with disabilities. In: 2018 IEEE 8th international conference
on system engineering and technology (ICSET). Bandung, pp 85–90. https://doi.org/10.1109/
icsengt.2018.8606358
Bazlan MJ, Abdul Rasam AR (2012) Development of geographical based library information system
(GeoLIS). In: IEEE control and system graduate research colloquium. Shah Alam, Selangor, pp
248–252. https://doi.org/10.1109/ICSGRC.2012.6287170
Boulos MNK, Honda K (2006) Web GIS in practice IV: publishing your health maps and connecting
to remote WMS sources using the Open Source UMN MapServer and DM Solutions MapLab.
Int J Health Geograph 5(6)
Dieudonne M, Anita M (2009) Web-Based multimedia cartography applied to the historical evo-
lution of Iqaluit. Nunavut. https://www.isprs.org/proceedings/XXXIV/part4/pdfpapers/501.pdf.
Last accessed 15 July 2019
Gundogdu LB, Unel FB, Yalpir S (2016) The impact of multimedia geographic information system
in tourism
Halim MA, Saraf NM, Hashim NI, Abdul Rasam AR, Idris AN, Saad NM (2018) Discovering new
tourist attractions through social media data: a case study in Sabah Malaysia. In: 2018 IEEE 8th
international conference on system engineering and technology (ICSET). Bandung, pp 157–161.
https://doi.org/10.1109/icsengt.2018.8606373
Jovanović V, Njeguš A (2008) The application of GIS and its components in tourism. Yugoslav J
Oper Res 18(2):261–272. https://doi.org/10.2298/YUJOR0802261J
Moreira SAR (2009) Multimedia cartography as language in language in the geog-
raphy teaching. https://icaci.org/files/documents/ICC_proceedings/ICC2009/html/nonref/15_2.
pdf. Last accessed 15 July 2019
Moufa D, Muller A (2002) Web-based multimedia cartography applied to the historical evolu-
tion of Iqaluit, Nuvanut. In: Symposium on geospatial theory, Ottawa. https://www.isprs.org/
proceedings/XXXIV/part4/pdfpapers/501.pdf. Last accessed 15 July 2019
Rabah S (2002) A review on mosque architecture. https://muslimheritage.com/uploads/the-mosque-
275.pdf. Last accessed 15 July 2019
Santoso MI, Arham Z, Khudzaeva E (2016) Design of a web-based geographic information systems
spatial for distribution of historic site. In: 4th international conference on cyber and IT service
management. Bandung, pp 1–5. https://doi.org/10.1109/citsm.2016.7577514
Stopper R, Sieber R, Schnabel O (2012) Introduction to multimedia cartography
Sawyer C (2008) Web cartography for World Heritage cities: a survey and evaluation. Int Perspect
Maps Internet. https://doi.org/10.1007/978-3-540-72029-4_22
Shyti B, Kushi E (2012) The impact of GIS application in the tourism development of Elbasan
region. Roman Econ J 45:189–209
Utaberta N, Asif N, Rasdi MT, Yunos MY, Ismail NA, Ismail S (2015) The concept of mosque based
on islamic philosophy: a review based on early Islamic texts and practices of early generation of
the Muslims
Zain Rashid AH, Abdul Rasam AR (2019) Online mapping and GIS mobile healthcare sys-
tems for intensifying low-and-middle-income community accessibility. In: IOP Conference on
Series: Earth Environmental Science, vol 385. p 012038. https://doi.org/10.1088/1755-1315/385/
1/012038
Chapter 45
Sustainable Palm Oil Production
Through Optimizing of Planted Area
Wan Nurshazelin Wan Shahidan and Nor Atikah Nadzri
Abstract Malaysia, the world’s second largest producer of palm oil, urgently needs
to increase its palm oil productivity to the highest possible level, as well as boost
the Malaysian economy to the global market. Increasing productivity will lead to
a more sustainable palm oil industry. Maximum productivity of palm oil depends
on the land used for planting. One of the agencies involved in palm oil plantation
is Malaysia Federal Land Consolidation and Rehabilitation (FELCRA). FELCRA
Seberang Perak is the main contributor of palm oil to FELCRA and owns four planted
areas. However, these plantations have not optimized the production of palm oil. An
extension of the palm oil planted area is required for optimum production in order to
meet the current and future demand for palm oil. This study has two specific goals
and applied the Goal Programming model to optimize FELCRA Seberang Perak’s
palm oil plantation areas. The results show that the goal of optimizing planting areas
has been achieved successfully. The optimization of the palm oil plantation area at
an optimum level can, therefore, help to improve the production of palm oil in order
to support the sustainable growth of productivity.
Keywords Optimization · Planted area · Palm oil · Production · Goal

programming model · Sustainable
45.1 Introduction
Palm oil, which is one of the most significant contributors to Malaysia’s economy
in general and to the agricultural industry especially, is now the second largest pro-
duction in Malaysia after Indonesia. It is estimated that Indonesia and Malaysia will
lead palm oil production in 2020. Palm oil not only benefits as a food source, but
has recently emerged as a sustainable source of biofuels. Sustainability of palm oil
W. N. Wan Shahidan (B) · N. A. Nadzri

Faculty of Computer & Mathematical Sciences, Universiti Teknologi MARA, Perlis Branch,
N. A. Nadzri
e-mail: nuratikahnadzrii@gmail.com
520 W. N. Wan Shahidan
has become a critical issue. The demand for global palm oil is rising due to the rise
in these issues. Malaysia is obliged to look at increasing its productivity in order to
meet the increased demand to serve the need for global growth.
Appropriate measures to increase palm oil production should be planned and
implemented in order to remain competitive and ensure agricultural sustainability.
One of the measures that can be taken is the expansion of the plantation area. Higher
productivity can be achieved with the current size of the palm oil planted area (Parveez
et al. 2019). Malaysia has recently suffered from low production due to its limited
planted area. The available plantation areas across Malaysia need to be fully utilized
to increase palm oil production. Unproductive palm trees should be replaced by
planting new crops, and this should be done urgently to increase productivity and to
sustain the future of palm oil. The effort to optimize the unused plantation areas in
addition to generating national income can also provide employment opportunities
and promote domestic palm oil consumption (Nik Hashim et al. 2014).
Linear programming is the simplest optimization technique that attempts to solve
maximizing or minimizing single objective function with linear constraints. However,
most agricultural problems have multiple objectives, such as maximizing crop pro-
duction, land allocation, maximizing overall profits, minimizing labor costs, water
requirements, machine utilization, and others that conflict simultaneously. Thus,
goal programming is a precise method used to solve multiple objective optimization
problem. The modeling approach of goal programming does not attempt to maximize
or minimizes the objective function directly as in the case of linear programming.
Instead, goal programming focuses on minimizing the differences between the goals
set and the actual results to be achieved in accordance with the assigned priorities
(Chowdary and Slomp 2002). Three types of goal programming, which are goal
programming with multiple objectives of equal importance, goal programming with
a weighted goal, and goal programming with priority-level goals of ranking. In this
study, a priority-level model of goal programming was proposed.
Goal programming approach has been widely used in the agriculture industry to
optimize production. According Hassan et al. (2013) the proposed goal programming
method was used to optimize the planting area and the production of rubber. The
weights were assigned on the basis of the percentage of rubber production per area in
each country. As a result, the production of rubber was also increased by increasing
the area for rubber plantation. In 2017, Jeyavanan et al. (2016) conducted a study
to optimize the yield of chili and string bean using multiple goal programming
approaches. Their study claimed that the optimization method could have optimized
crop yields for different levels of fertilizer and spacing under both intercropping and
monocropping systems.
Study by Satkhed et al. (2018) seeks the goal programming model for the culti-
vation of wheat crops by considering multiple goal programming. Their study has
successfully met their goals of maximizing crop production, minimizing labor costs,
minimizing chemical fertilizers, maximizing the use of organic fertilizers, and min-
imizing production costs. In 2017, Gamage (2017) carried out research on optimal
land use. Land is of good quality when it has potential for the well-being of the sur-
rounding area. Research was conducted in Sri Lanka and the goal programming was
45 Sustainable Palm Oil Production Through Optimizing … 521
used to solve land-related problems. In the study, the researcher established three
objectives based on the priority of seeking the maximum solution in the land area.
This research implemented a goal programming model with a ranking goal with a
priority-level approach. Two objectives were accomplished, which were to optimize
the overall palm oil plantation area and boost palm oil output. One of the Malaysian
agencies responsible for the production of palm oil, the Federal Land Consolidation
and Rehabilitation (FELCRA). Since Perak has a large palm oil plantation area,
FELCRA Seberang Perak is chosen to optimize its planted area for this study. Four
areas are planted in FELCRA Seberang Perak (FSP), consisting of FSP 10 and 11,
FSP 12, FSP 13, and FSP 14 and 15. It is reported that 4318 ha of land were planted
with palm oil in 2017, producing 169,769 tonnes of palm oil. The department claimed
that palm oil production decreased in 2017 compared to the previous year’s total palm
oil production of 178,258 tonnes. As a result, the expansion of palm oil plantation is
expected to help increase the overall production of palm oil. The QM for Windows
software is used to execute the proposed goal programming model.
45.2 Methodology
Two stages were involved in this study. Data were collected in the first stage, includ-
ing the palm tree plantation area, the number of palm trees, and the production of
palm fruit for four planted areas. In the second stage, a goal programming model is
developed and solved using QM for Windows software.
45.2.1 Data Collection Method
Data were collected from the Department of FELCRA Seberang Perak in 2017.
Total planted area used and corresponding total production of palm oil are shown in
Table 45.1. According to the table below, 1821 ha of palm oil plantation area needed
to be optimized to increase palm oil production.
Table 45.1 Planted area and production in FELCRA Seberang Perak

Area FSP 10 & 11 FSP 12 FSP 13 FSP 14 and 15 Total
Planted area used (ha) 794 1,044 868 1,612 4,318
Planted area unused 523 298 267 733 1,821
(ha)
Production (tonne) 32,857 33,232 34,558 69,122 169,769
45.2.2 The Development of Goal Programming (GP) Model
Minimize

n
d+ −
i + di (45.1)
i
Subject to

n
aij xj + d+ −
i + di = bi (45.2)
j=1
Such that
xj + d+ −
i , di ≥ 0, (45.3)
where d− +
i is the amount by which goal i is underachieved, di is the amount by which
goal i is overachieved, xj (j = 1, 2,…n) are the variables in the goal equation, b are
the targets or goals and aij are the coefficient of the variable.
Priority-level target rankings applied to the proposed goal programming model.
The model started with setting the desired goals and assigning the priority order,
developing the requirement of constraints, defining the variable of deviation accord-
ing to goals and finally forming the objective function that exists to the variable of
deviation.
Goals. Two objectives have been set to be achieved. The first goal is to optimize
planted areas (hectares) for four planted areas in FELCRA Seberang Perak. Currently,
FELCRA Seberang Perak has used 4318 ha and the area left to plant palm oil is 1812
ha. Palm oil production is expected to increase in the future due to an increase in
the total planted area of palm oil, which is why the objective of this study is to
use the plantation area left in FELCRA Seberang Perak. The goal equation for total
plantation can be expressed as

n
x − d+ −
i + di = TA, (45.4)
i
where TA is targeted the total planted area to be achieved by all four planted areas.
The second goal is to maximize the production of palm oil for each plantation
area by increasing the production of palm oil to 254635.5 tonnes. As the expansion
of the total planted area of palm oil to be produced is expected to have contributed
to the increase in FELCRA Seberang Perak’s palm oil production. Accordingly, the
targeted of this study was that the production of palm oil could be up to 50% from
the previous year. The goal equation for the production of palm oil can be expressed
as
Table 45.2 Target planted area and production

Area FSP 10 & 11 FSP 12 FSP 13 FSP 14 & 15 Total
Planted area used (ha) 794 1,044 868 1,612 4,318
Target planted area 1,317 1,342 1,135 2,345 6,139
Production (tonne) 32,857 33,232 34,558 69,122 169,769
Production per area (tonne/ha) 41.38 31.83 39.81 42.88 155.9
Target production 49285.5 49,848 51,837 103,683 254653.5
Table 45.3 Goals with

Goals Priority
priority levels
Plantation area P1
Production on palm oil P2

n
qi xi − d+ −
i + di = TP, (45.5)
i
where q is production per area (hectare/tonne) for each area and TP is the total target
production of palm oil.
From Table 45.1, the data needed for the purpose of setting the goals have been
prepared in Table 45.2. The total production of palm oil is expected to increase as the
plantation area increases. Palm oil production for proposed goal programming shall
be allocated on the basis of production of palm oil per area for each planted area.
Ranking goals with priority levels. The goals were listed in order of significance.
The first goal of programming will be the most significant one than the others.
Priorities are allocated to each variable of the deviation. Therefore, a set of priorities
will only be achieved once the highest priority goal has been set. All of the goals
will only be achieved once the priority 1 goal has been achieved. Table 45.3 shows
the goals to be used in this study along with their priorities.
Deviation variable. There are two deviational variables which are overachieve-
ment of goal (d+ ) and underachievement of goal (d− ). The overachievement for two
goals is not important for the goal programming model for this study, as this GP
model only needs to minimize the underachievement of the objective function. Thus,
d1+ and d2+ will therefore be omitted from the objective function.
Constraint requirement. In order to meet the planted area for each area, the
constraints required each planted area to be greater than the current planted area for
each area. The equation can be expressed as follows:
xi ≥ Ai (45.6)
where A is the current planted area for each planted area.

In order to meet the production of palm oil for each planted area, each planted
area must be more than equal to the amount of targeted palm fruit production per
area (hectare/tonne) for each area. The equation can be expressed as
qi xi ≥ Pi (45.7)
where q is production per area and P is refer to target production area.

Objective function. The objective of the goal programming model is to optimize
all goals and limitations. The objective function is designed to minimize the sum of the
goal deviations in order to minimize the costs associated with the underachievement
goal and the overachievement goal. The general form of goal programming function
corresponding to the priority ranking (P) goals considered, the new objective function
for this study is as follows:

Minimize Z = Pi d+ −
i + di (45.8)
i
Decision variable. All decision variables xi refer to the palm oil planted area in
hectare, where the index i refer to four planted areas in FELCRA Seberang Perak
FSP 10, FSP 11 and 12, FSP 13, and FSP 14 and 15.
Final form. In view of the final goal programming model, palm oil optimization
is obtained as follows:
Minimize = P1 d− −
1 + P1 d2 (45.9)
Subject to
x1 + x2 + x3 + x4 + d+ −
1 − d1 = 6,319 (45.10)
Total planted area
41.38x1 + 31.83x2 + 39.81x3 + 42.88x4 + d+ −

2 − d2 = 254653.5 (45.11)
Total production per area
x1 ≥ 794 (45.12)
x2 ≥ 1,044 (45.13)
x3 ≥ 868 (45.14)
x4 ≥ 1,612 (45.15)
Planted area for each area
41.38x1 ≥ 49285.5 (45.16)

31.83x2 ≥ 49,848 (45.17)
39.81x3 ≥ 51,837 (45.18)
42.88x4 ≥ 103,683 (45.19)
Production for each area
x1 , x 2 , x 3 , x4 , d + − + −
1 , d1 , d2 , d2 ≥ 0,
where
x1 FSP 10 and 11
x2 FSP 12
x3 FSP 13
x4 FSP 14 and 15
P1 priority level for first goal
P2 priority level for second goal
d−1 underachievement of total planted area
d+1 overachievement of total planted area
d_2 underachievement of total planted area
d+2 overachievement of total planted area
This goal programming model formulated with QM for Windows 5.3 software has
been addressed. The summary of the priority achievement is shown in Table 45.4.
From the table, the first and second goals of the model are successfully achieved,
indicating the zero value of the non-achievement obtained from QM for Windows
results.
Table 45.5 shows that the first priority goal of optimizing the planted area for
four planted areas in FELCRA Seberang Perak is achieved. The underachievement
(d− ) with value 0 shows that there is no decrement in the planted area. The value
of overachievement (d+ ) shows that each planted area is suggested to increase their
planted area by their corresponding d+ . These results show that the planted area
can be optimized but depending on the availability of the planted area left for each
planted area in FELCRA Seberang Perak.
Table 45.4 Summary

Goals Priority Non-achievement Summary
priority achievement
Plantation area P1 0 Achieved
Production on P2 0 Achieved
palm oil
Table 45.5 Planted area analysis from the deviation

Area Planted areas Achieved palm Overachievement Underachievement
2017 (ha) oil planted area (d+ ) (d− )
(ha)
FSP 10 and 794 1191.05 397.05 0
11
FSP 12 1044 1566.07 522.07 0
FSP 13 868 1302.11 434.11 0
FSP 14 and 1612 2417.98 805.98 0
15
Table 45.6 Production analysis from the deviation

Area Production 2017 Achieved Overachievement Underachievement
(ha) production (ha) (d+ ) (d− )
FSP 10 and 32857 49285.5 0 0
11
FSP 12 33232 49848 0 0
FSP 13 34558 51837 0 0
FSP 14 and 69122 103683 0.01 0
15
Table 45.6 shows the analysis of the production of palm oil for each planted area.
The results show 0 underachievement values for FSP 10 & 11, FSP 12, and FSP 13,
which means that the target for maximizing palm oil production has been achieved
and is fully utilized. However, the target production for FSP 14 & 15 shows an
overachievement of 0.01. This suggested that the production of FSP 14 & 15 would
have exceeded the target of 0.01 tonnes.
It was found, based on the above findings, that the first objective can be achieved
followed by the second objective. This means that the area planted is the main factor
in maximizing palm oil production. Table 45.7 shows the results of the analysis of
goals. The finding recommended that the total planted area exceeds the target value
of 6319 ha by 158.21 ha. It shows that the available planted area of 1821 ha can
be optimized. For the production palm oil, 0 values for d+ and d− mean target is
fully utilized and achieved to increasing up production palm oil to 50% from 2017.
It can be concluded that the total production of palm oil is expected to increase as
the plantation area is optimized.
Table 45.7 Goals analysis from the deviation

Goals Target Overachievement (d+ ) Underachievement (d− )
Planted area 6319 158.21 0
Production palm oil 254653.5 0 0
Table 45.8 Comparative analysis for target and achieved results

Area Planted areas Available Target to Achieved palm
2017 (ha) planted area (ha) Optimize (ha) oil planted area
(ha)
FSP 10 and 11 794 523 1317 1191.05
FSP 12 1044 298 1342 1566.07
FSP 13 868 267 1135 1302.11
FSP 14 and 15 1612 733 2345 2417.98
Total 4318 1821 6319 6477.21
Table 45.8 provides a comparative analysis between the 2017 planted area target
for each planted region in FELCRA Seberang Perak and the proposed planted area.
For FSP 10 & 11 area, the target area planted to be optimized is up to 1317 ha, but
the QM for Windows results suggest that only 1191.05 ha are allowed to increase
the planted area. The target for FSP 12, FSP 13 and FSP 14 &15 area is up to 1342
ha, 1135 ha and 2345 ha, respectively, but the QM for Windows suggested the area
had exceeded the target set. The findings indicate that these three planted areas can
optimize all available planted areas remaining to maximize palm oil output.
45.4 Conclusion
In preparing Malaysia for a sustainable agriculture industry for future production

research, a goal programming approach has been approved as a good technique and
useful for the problem of agricultural plantation land and can be implemented in other
palm oil plantation area in Malaysia. This study presents the goal programming model
to achieve two objective goals. The model applied ranking targets with a priority-
level method. The first goal was to optimize the plantation area and the second goal
was to increase the production of palm oil in FELCRA Seberang Perak. The finding
shows that, when the first priority for the goal is achieved, the other goals will also
be achieved, which means that the first priority must be achieved at first. Priority
has been successfully achieved in sequence. The results obtained confirmed that the
total production of palm oil can be increased as the plantation area is optimized. This
study can be further expanded by considering other factors that could contribute
to the production of palm oil in Malaysia, such as the price of palm oil, labor,
machine, and fertilizer. Productivity is maintained the current and future demands
are urgently necessary without damaging sustainability in the environment. So it is
a matter of urgent necessity and a step forward to identify strategies for sustainable
palm oil production. In conclusion, the technique for optimization can be a solution
or a strategy for improving palm oil production in Malaysia. Although sustainable
development of oil palm agriculture means maximizing its socio-economic benefits,
it should not undermine the sustainability of the environment.
References
Chowdary BV, Slomp J (2002) Production planning under dynamic product environment: a multiple-
objective goal programming approach. Research report, University of Groningen
Gamage A (2017) Application of goal programming approach on finding and optimal land allocation
for five other field crops in Anuradharapura district. An Int J (ORAJ) 4(2)
Hassan N, Hamzah HMM, Zain MMS (2013) A goal programming approach for rubber production
in Malaysia. Am-Eurasian J Sustain Agric 7(2):50–53
Jeyavanan S, Slyambalappitiya SB, Jeyavanan K (2016) Application of goal programming on yield
optimization of selected agricultural crops. Int J Innov Res Sci Eng Technol 6(7)
Nik Hashim NM, Hashim NMH, Abu F (2014) Optimizing vacant land for crop production using
linear programming. J Bus Soc Dev 2(1):1–13
Parveez GKA, Kho LK, Hill C, Teh YA, Kushairi A (2019) Sustainable palm oil cultivation in
Malaysia-are peatlands a sustainable choice. J Palm Environ Health 10:13–18
Satkhed A, Vatsala GA, Ghanashyam KJ (2018) A new approach to optimize the production of crop
using compost from solid waste. Int J Adv Sci Eng Technol 6(1)
Chapter 46
Agent-Based Encryption for Password
Management Application
Nurul Hidayah Ahmad Zukri, Nor Aimuni Md Rashid,

Norkhushaini Awang and Zuhri Arafah Zulkifli
Abstract As the technology evolves, people tend to have many online accounts that
need password for authentication in order to access a particular account or infor-
mation. However, the way of keeping the password will expose account users to
vulnerable threats such as hacking if the password is not protected appropriately. It
is important to address the issue of violation of information privacy in order to pro-
mote peaceful and inclusive societies for sustainable development. Thus, Password
Management Application (PMA) is developed in order to help users to manage and
keep their passwords of different accounts safely. Password Management Applica-
tion (PMA) applied an Advance Encryption Standard (AES) algorithm for securing
user’s data that keep with the agent. The AES is chosen based on the researches and
analysis conducted. Agile framework is used in completing this project. The Func-
tionality Test technique was applied to test the usability of the application. It was
done by a qualified tester and was proven to be the solution for users to manage their
passwords more efficiently. This application can help users to manage and keep their
passwords of different accounts safely. The only limitation is that the application is
only available for users of Android application devices. It is recommended that the
Password Management Application should be given more access to social media or
websites and different algorithms can be used to protect passwords.
Keywords Encryption · Password management · Security
N. H. A. Zukri (B)
Faculty of Computer & Mathematical Sciences, UiTM Arau, 02600 Arau, Perlis, Malaysia
e-mail: hidayahzukri@tmsk.uitm.edu.my
N. A. M. Rashid · Z. A. Zulkifli
Faculty of Computer & Mathematical Sciences, UiTM (Melaka) Kampus Jasin, Merlimau,
Melaka, Malaysia
e-mail: aimuni5294@melaka.uitm.edu.my
Z. A. Zulkifli
e-mail: zuhrizulkifli@melaka.uitm.edu.my
N. Awang
Faculty of Computer & Mathematical Sciences, UiTM Shah Alam, Shah Alam, Selangor,
Malaysia
e-mail: shaini@tmsk.uitm.edu.my

530 N. H. A. Zukri et al.
46.1 Introduction
There are many password security issues such as phishing attacks and malware. Gajek
et al. (2009) used a secure compartment which functions as a proxy to help in user
authentication as password protection. For instance, TruWallet and TruWalletM use
different techniques to secure the authentication proxy by storing the users’ creden-
tials and submits them to a remote server. The main disadvantage of these schemes
is the architectural change of the platform. In addition, it is challenging to isolate
the browser and user interface due to the Virtualization-Based Password Protection
against Malware in Untrusted OSs 203 enormous code size. In contrast, Cheng and
Ding (2012) proposed the use of trusted mobile device for users to delegate their cre-
dentials to perform a task. Cheng and Ding (2012) presented a virtualization-based
password input protection system composed of a novel user-hypervisor interaction
channel, a keyboard stroke interception mechanism, and a hypervisor-based SSL
client. However, the application needs to have a plug-in in order to split the SSL
operations.
Notwithstanding the above, it is proposed for software agent to facilitate the
encryption of password. Software agents will execute the encryption as instructed
without user’s intervention. AES algorithm is adopted due to its ability of with-
standing brute force attacks. Software agents are also called as the crypto agent for
this project with the aim to preserve the confidentiality and integrity of the data for
sustainable development.
In this paper, agent-based encryption is proposed for password management appli-
cation. The next section of this paper introduces the password management sys-
tem, JADE development framework, and software agent. Section three of this paper
describes the main features of JADE and in particular, the architecture of the agent
platform, the communication subsystem, and the agent execution flowchart. Finally,
section four of this paper discusses the implementation of agent-based encryption for
password management application and its interoperability with other agent platforms
as well as the new features which can be added in future. The last discussion focuses
on conclusion and direction of future works.
46.2.1 Password System Management
Passwords are used for many reasons such as to protect data, systems, and networks.
Passwords are used to authenticate users, protect files and other stored informa-
tion. User authentication is the process of checking account user’s permission and
to grant right to user for accessing resources. There are three types of authentica-
tion, namely, knowledge-based authentication, physical-based authentication, and
biometric-based authentication (Al-Hussain and Al-Rassan 2010).
46 Agent-Based Encryption for Password Management Application 531
This research will discuss on knowledge-based authentication with encryption in

securing the data. When applying One Time Password (OTP), administrator has to
consider the security of the data in the database and transaction is conducted. There
are different types of passwords, namely, personal identification number (PIN) and
passphrase. PINs are rarely used as the only form of authentication for access of IT
system due to its less complexity. On the other hand, passphrase is another type of
password which is relatively longer and more complex. When choosing which type
of password authentication to be used in a system, administrator has to consider the
complexity and security of the data. Park et al. (2004) said that in order to increase the
security of a system, the process of encryption and decryption is crucial during and
after the transaction. However, when embedding a security component into a system,
a developer should also focus on the usability and deployability of the system.
Organizations need to protect the confidentiality, integrity, and availability of
passwords so that all authorized users can use secured passwords to protect their
confidential data. Chen et al. (2012) found that a simple password authentication
system is a one-way authentication system and can serve for a multi-users system to
authenticate legitimate users who can log into the system and access the resources.
They also stated that in a simple password authentication system, the session key
will get exchanged and distributed between server and users.
46.2.2 Password Security Issues and Threat
Threats for authentication procedures and data confidentiality come from different
types of intervention to the process. The major threat of authentication is from human
factor, where user forget his or her authentication key (Jeslet et al. 2010), loss or
damage of authentication key. This happens due to mistakes and carelessness of the
users which can affect the reliability of the authentication system.
There are also threats that come from mobile technical problem. For example,
the software or device used contains vulnerability or corruption that can affect the
authentication process (Sujithra and Padmavathi 2012). Other vulnerabilities such
as Viruses and Trojan can also cause interruption to the process. Apart from threats
caused by the software problem, sometimes hardware can also be a factor of threat
to authentication process such as hardware attacks.
Scarfone and Souppaya (2009) classified threats to password into groups such
as threats that take advantage of weak passwords and password hashes like pass-
word guessing and cracking; threats that replace passwords; and threats that involve
attackers of reusing compromised passwords. According to Kajal (2013), attack-
ers commonly crack password through three ways, namely, password capturing,
password guessing, and capturing and social engineering.
Fig. 46.1 Static agent system architecture (Source Omalley et al. 2000)
46.2.3 Static Agent
A static agent is unable to move from its source of origin to a different environment.
It is unable to adapt itself to other variety of host environments (Lin 2007). A static
agent stays on a host and can create mobile agents in order to interact with other
static or mobile agents. It shares information with mobile agents as mobile agents
do not have the same knowledge as their counterparts. Figure 46.1 below shows an
example of static agent system architecture.
46.2.4 Agent Development Environment
Java Agent Development Framework (JADE) is a software framework that fully

implemented the Java language. It simplifies the development of multi-agent system
through a middleware that complies with the FIPA specifications and a set of graphical
tools that support the debugging and deployment phases (Kravari et al. 2015).
46.2.5 Agent Platform
An agent platform offers physical infrastructure of which agents can be organized

including machines, operating systems, agent support software, Foundation for Intel-
ligent Physical Agents (FIPA) agent management components, namely, Directory
Facilitator (DF), Agent Management System (AMS) and Message Transport Service
(MTS) and agents.
There are several examples of agent platform such as Agent Factory, Agent
Builder, Agent Scape, AGLOBE, Any Logic, Cormas, Cougaar, CybelePro, EMER-
ALD, GAMA, INGENIAS Development Kit, JACK, JADE, Jadex, JAMES II, JAS,
Jason, JIAC, MaDKit, MASON, NetLogo, Repast, SeSAm, and Swarm (Bellifemine
et al. 2001).
46.2.6 JADE SDK
According to Bellifemine et al. (2008), JADE is an open-source middleware for multi-

agent system development. JADE architecture is rooted in peer-to-peer ideas and
communication patterns. It can also be referred as “hybrid peer-to-peer” architecture
due to the peep-to-peer communication among entities and yet peer discovery is
centralized (Ughetti et al. 2008).
There are two kinds of software components in JADE component model, namely,
agents and services. JADE agents share resources and services such as threads
scheduling and messaging support when accomplished in a run-time environment. It
shows autonomy and communicating through asynchronous message passing. Mean-
while, services are non-autonomous components. It can run on single node or cooper-
atively on multiple nodes. It also includes operations that can be triggered by agents
(Ughetti et al. 2008).
JADE platform is collected from agent containers that can be spread over the
network. The JAVA processes that offer the JADE run-time and all the services
needed for hosting and executing agents is an agent that lives in the containers.
The main container which represents the “hybrid part” of the peer-to-peer JADE
architecture and provides service discovery capabilities. Figure 46.2 shows the main
architectural elements of a JADE platform.
In November 2007, Open Handset Alliance has released JADE SDK which pro-
vides an open platform with Linux-based OS and JAVA-based language (http://jade.
tilab.com/doc/tutorials/JADE_ANDROID_Guide.pdf).
Fig. 46.2 JADE main architectural elements (Source Cheng and Ding 2012)
46.3 Methodology
This project proposed to implement the AES Encryption algorithm for storing data
in the database. The AES Encryption process contains the round-functions such
substitute bytes, shift rows, mix column, and add round key (Liang et al. 2010). The
round-functions apply to the decryption process are in inverse steps. The process is
looping 10 rounds, as the first 9 rounds it will pass through all four (4) functions,
and the last round the mix column will not be carried out.
46.3.1 AES Algorithm
AES encryption function is used to encrypt information that is needed to be secured as

shown in Fig. 46.3. It happens in a background process during the saving of new memo
created by user. Cipher class provides access to implementation of cryptographic
ciphers for encryption and decryption. Once the method is called, the data will be
encrypted to base 64 format by using AES algorithm.
Figure 46.4 shows the encrypted username and password stored in database.
The code in Fig. 46.5 is used to decrypt all data encrypted in the database. The
decryption process happens during the process of editing memo whereby user can
Fig. 46.3 Encryption

algorithm
Fig. 46.4 Database for note
Fig. 46.5 Decryption

algorithm
view the username and password saved earlier. The decrypt mode is used to initialize
cipher to decryption mode. Decode method will decrypt the data in string value.
46.3.2 Flowchart Diagram
Figure 46.6 below shows the cryptography agent flowchart of the system.
In this process, if the system chooses encryption process, it calls the application
agent and then the plain text is passed to the crypto agent. Once the encryption process
is completed, the ciphertext is passed to the application agent, and it is stored in the
database.
When the system chooses decryption process, the application agent reads the data
from the database. The ciphertext is then passed to the crypto agent for decryption
process. Once the decryption process is completed, the plain text is passed to appli-
cation agent to display the data on the application. In short, the decryption process
is a vice versa of the encryption process.
46.3.3 Network Diagram
Figure 46.7 shows the network diagram of Password Management Application that
requires the network coverage. When user creates a new memo in the application, the
AES algorithm will generate a secret key for encryption purposes. Then the encrypted
data of username and password is saved in the online database. The process of
decryption happens when a user retrieves the information from database. The secret
key is used to decrypt the information.
Yes No
Fig. 46.6 Cryptography agent flowchart

Fig. 46.7 Network diagram
46.4 Findings
The focus of this project is to develop an application that keeps the password and
implements the encryption algorithm. The functionality testing was conducted to ver-
ify the functionality of the application which performs according to the specification
that has planned from earlier project development process.
The process of testing is done by using Android device pre-installed with the
application. The testing was carried out by three lecturers of Computer Sciences.
The test case which listed down all the modules in the application and the Android
device was given to the experts.
The expert checked and confirmed that the Password Management Application
was working correctly and it received positive comments from the experts.
46.4.1 JADE Agent Environment Setup
Table 46.1 shows the results of the JADE Agent Environment Setup Module testing.
This module covers the testing of the set up of the JADE Agent environment. The
test encompasses two main steps, namely, compiling the crypto agent and running
the crypto agent. The results concluded that the JADE environment was successfully
set up without errors.
Crypto Agent is one of the agents developed by this project. This agent is devel-
oped on the Java Agent Development Environment (JADE) platform. In order to
compile and run this agent, JADE platform has to install the Java Virtual Machine
(JVM).
Figure 46.8 shows the command to compile and run the agent on JADE platform
by using command prompt. Number one is the command for compiling the Crypto
Agent whereas number two is to run it on the JADE platform.
538
Table 46.1 JADE agent environment setup module

JADE agent environment setup
# Test description Steps Expected result Actual result
1 Compile crypto agent Open command prompt > > type “javac -classpath Compile crypto agent without error
lib\jade.jar;lib\commons-codec\commons-codec-1.10.jar -d
PASS
classes src\cryptoagent\cryptoagent.java” FAIL
2 Run crypto agent Open command prompt > > type “java -cp Run crypto agent without error and JADE Remote Agent
lib\jade.jar;lib\commons-codec\commons-codec-1.10.jar;classes Management GUI open PASS
jade.Boot -gui -agents CryptoAgent:cryptoagent” FAIL
N. H. A. Zukri et al.
Fig. 46.8 Compile and run crypto
Table 46.2 Crypto agent function module

Crypto agent function
# Test description Steps Expected result Actual result
1 Crypto agent encrypts Check command Crypto agent
PASS
account details prompt screen for successfully encrypts
successful message account details using
FAIL
AES encryption and
sends object reply to
client agent
2 Client agent receives Client agent PASS
encrypted object successfully encrypted FAIL
account object without
errors
3 Crypto agent decrypts Check command Crypto agent
PASS
account details prompt screen for successfully decrypt
successful message account details and
FAIL
sends object reply to
client agent
46.4.2 Crypto Agent Function
Table 46.2 shows the third module of functionality testing which covers the Crypto
Agent function. This module tests the encryption and decryption functions that
Crypto agent performs in this project. As shown in Table 46.2 below, all of the
functions were successfully performed without any errors.
46.5 Conclusions
The project provides an alternative solution for users to manage their passwords more
efficiently. This application can help users to manage and keep their passwords of
different accounts securely.
The secure part is implemented in the application by using an Advance Encryption

Standard (AES) algorithm. In this application, the encryption process happens during
the process of saving the memo created by the user before entering the database. Other
feature which is also included in the application is the password strength checker. The
password strength checker helps the users to check their strength of their passwords.
This application is well constructed and it is able to satisfy the needs of the end users.
However, there are still some other additional features which can be added to the
application in future.
References
Al-Hussain A, Al-Rassan I (2010) A biometric-based authentication system for web services mobile
user. In: Proceedings of the 8th international conference on advances in mobile computing and
multimedia—MoMM ’10. pp 447–452. http://doi.org/10.1145/1971519.1971596
Bellifemine F, Caire G, Poggi A, Rimassa G (2008) JADE: a software framework for developing
multi-agent applications Lessons learned. Inf Softw Technol 50:10–21. https://doi.org/10.1016/
j.infsof.2007.10.008
Bellifemine F, Poggi A, Rimassa G (2001) Developing multi-agent systems with a FIPA-
compliant agent framework software. Pract Exper 31:103–128. https://doi.org/10.1002/1097-
024X(200102)31:2%3c103:AID-SPE358%3e3.0.CO;2-O
Chen BL, Kuo WC, Wuu LC (2012) Robust smart-card-based remote user password authentication
scheme. Int J Commun Syst 27(2):377–389. http://dx.doi.org/10.1002/dac.2368
Cheng Y, Ding X (2012) Virtualization based password protection against malware in untrusted
operating systems. In: International conference on trust and trustworthy computing. Springer,
Berlin Heidelberg, pp 201–218
Gajek S, Löhr H, Sadeghi AR, Winandy M (2009) TruWallet: trustworthy and migratable wallet-
based web authentication. In: Proceedings of the 2009 ACM workshop on Scalable trusted
computing. ACM, New York, pp 19–28
Gotta D, Trucco T, Ughetti M, Semeria S, Cuce C, Porcino AM, JADE android add-on guide. http://
jade.tilab.com/doc/tutorials/JADE_ANDROID_Guide.pdf
Jeslet DS, Sivaraman G, Uma M, Thangadurai K, Punithavalli M (2010) Survey on awareness and
security issues in password management strategies. IJCSNS 10(4):19–23
Kajal A (2013) Secure password Selection method. Int J Adv Res Comput Commun Eng 2(7):2613–
2615
Kravari K, Bassiliades N (2015) A survey of agent platforms. J Artif Soc Soc Simul 18(1):11.
https://doi.org/10.18564/jasss.2661
Liang S, Liu J, Zhang R, Wang C (2010) A modified AES algorithm for the platform of Smart-
phone. In: Proceedings—international conference on computational aspects of social networks,
CASoN’10. pp 749–752. http://doi.org/10.1109/CASoN.2010.172
Lin H (2007) Architectural design of multi-agent systems: technologies and techniques, 1st edn.
IGI Global, New York
Omalley SA, Self AL, Deloach SA (2000) Comparing performance of static versus mobile multia-
gent systems. In: National aerospace and electronics conference (NAECON) Dayton. http://doi.
org/10.21236/ada451595
Park DJ, Kim K, Lee PJ (2004) Public key encryption with conjunctive field keyword search. In
Proceedings of the WISA. Lecture notes in computer science, vol 3325. Springer, Wuhan, China,
pp 73–86
Scarfone K, Souppaya M (2009) Guide to enterprise password management (Draft), US Department
of Commerce, NIST, Special Publication 800-118
Sujithra M, Padmavathi G (2012) Next generation biometric security system: an approach for
mobile device security. In: Proceedings of the second international conference on computational
science, engineering and information technology—CCSEIT ’12. pp 377–381. http://doi.org/10.
1145/2393216.2393280
Ughetti M, Trucco T, Gotta D (2008) Development of agent-based, peer-to-peer mobile applications
on ANDROID with JADE. In: Proceedings of the second international conference on mobile
ubiquitous computing systems services and technologies. pp 287–294
Chapter 47
A Single Objective Fuzzy Linear
Programming for Optimizing Hand
Socks Production
Wan Nurshazelin Wan Shahidan , Nurul Ain Rusydiah Mohd Rodzi

and Siti Nor Nadrah Muhamad
Abstract There are a lot of production companies in this world. Each production
company has their own product that they produce. However, there are two or more
companies that produce the same product such as hand sock. Each company has its
own design of hand socks that they produce and sell according to customer pref-
erence. Again, satisfying all the customer’s demands can sometimes be confusing.
The problem is that the production company always has the difficulty of identifying
or estimating the optimum demand for its product in order to meet the customer’s
demand and obtain the maximum profit at the same time as overcoming the problems
of overproduction. Thus, in this paper, a single objective fuzzy linear programming
model was proposed to optimize the production of hand socks with a view to max-
imizing profits. The study was conducted in Selangor by collecting secondary data
from a small textile company (Q Nisa Journey Enterprise) producing hand socks for
2018. The proposed fuzzy linear programming developed in accordance with the
Zimmerman method, which includes a fuzzy objective function and fuzzy inequali-
ties in the model. The proposed model was resolved using Excel Solver to obtain an
optimal solution. The results obtained vary depending on the value of the auxiliary
variable being tested. The result of the study showed that when the value of Basic,
3 Ruffles, and Alhambra hand socks were 20372, 188032, and 1536, the highest
profit that can be earned by Q Nisa Journey Enterprise was RM 1836863.68 with
an auxiliary variable of 0.0. This study concludes that the determination of optimal
production of hand socks can be made through the use of the optimization techniques
called fuzzy linear programming with both fuzziness in a single objective function
and constraints that can prepare the company to be sustainable in both industrially
and the environmentally.
W. N. Wan Shahidan (B) · N. A. R. Mohd Rodzi · S. N. N. Muhamad

Faculty of Computer & Mathematical Sciences, Universiti Teknologi MARA, Perlis Branch,
N. A. R. Mohd Rodzi
e-mail: nainr96@gmail.com
S. N. N. Muhamad
e-mail: nadrahmuhamad@uitm.edu.my

544 W. N. Wan Shahidan et al.
Keywords Fuzzy linear programming · Single objective · Optimization ·

Production · Maximum profit
47.1 Introduction
One of the largest industries in the world is the production company or other name
manufacturing company. However, the same product is produced by many compa-
nies. The higher the number of production companies that produce the same product,
the more competitive the market will be. One of the production companies that are
very competitive with each other is the hand socks production companies. Each com-
pany has its own design of the hand socks that they produce. Yet it is so difficult to
meet all the demands of the customers. Hence, every production company must have
its own production plan to achieve their objective. It is an advantage to have an appli-
cable and well-being production planning in a competitive situation. Consequently,
each production company must have its own production plan in order to achieve its
objective. It is advantageous to have an effective and well-being production planning
in a competitive situation (Denkena et al. 2019).
There are different types of hand socks that have been produced. Nowadays, in
order to be well marketed in the industries and competitive with others, the company
must be innovative and creative in designing hand socks to meet the needs of its
customers. However, it has recently been difficult for the company to identify or
estimate the optimum demand for its product. Based on the previous sales record,
there is no increase in profit and sales, as there are hand socks that are produced
at a high price, but only a few are sold. This situation has led to problems with
overproduction. Overproduction may lead to textile waste being dumped in landfills
contributing to the pollution of the environment in the world.
The industry is crucial to tackle the problem of overproduction first when it comes
to making the textile industry more sustainable. Thus, not only will the environment
end up being harmed, if this condition remains unmonitored and unresolved, the
company will be more unprofitable due to the failure to determine the optimum
quantity of hand socks to be produced. Therefore, the environment will not only be
affected when this condition remains unmonitored and remains unresolved, because
the optimal quantity of hand socks is not established, it will be even less profitable.
The present study is designed to produce a model that uses a fuzzy linear program-
ming method to obtain the optimal solution for the manufacturing of hand socks to
maximize the profit and avoid overestimating future sales at the same time. Data for
2018 have been collected and analyzed with Excel Solver.
47 A Single Objective Fuzzy Linear Programming for Optimizing … 545
47.2 Methodology
47.2.1 Fuzzy Linear Programming Model Development
Fuzzy. Lofti A. Zadeh was the one who introduced the fuzzy set theory in 1965.
Uncertainty in fuzzy is usually associated with human decision-making and the
natural environment, as both are bound to change and cannot be controlled. Study by
Werro (2015) stated that in this theory human subjectivity, such as human judgement,
assessment, and decisions and inaccuracy was taken into account. Hence, there is the
development of the mathematical concept of a set of fuzzy sets dealing with natural
language that are familiar with biasness and uncertainty (Werro 2015; Satheeshkumar
and Nandhini 2017). Instead of quantitative variables, fuzzy set theory uses linguistic
variables to represent the imprecise concept, as linguistic terms better represent
decision-makers experience and subjective viewpoints in a more intuitive and natural
language (Chaudhuri and De 2011).
Meanwhile, the proposition in fuzzy logic is either true or false (Satheeshkumar
and Nandhini 2017). Fuzzy logic was also introduced by Zadeh in 1965, who claimed
that there are so many sets in our surroundings in this world that there is no separate
boundary. In study from Werro (2015) fuzzy logic main idea is to express the inac-
curacy of human thinking in proper mathematical tools. Fuzzy logic propositions
could be either true or false and perhaps partially true and partially false. Thus, the
degree of truth is from zero to one, as it is an element that can have two memberships
in different sets (Guney et al. 2016).
Linear programming. Linear programming is an effective way to minimize
costs and to meet any type of conditions or maximize the achievement of objec-
tives (Abdullah and Abidin 2014). For years, linear programming is known as one
of the instruments in decision-making and one of the techniques often employed in
operational research (Abdullah and Abidin 2014; Repnik 2016). Linear program-
ming is an objective function, as the problem constraints are linear. However, the
values of the coefficients involved in the real-world problem are not always known
to decision-makers, and the uncertainty of the coefficients may not be a probabilistic
type (Abdullah and Abidin 2014).
Basic linear programming problem consists of single objective function and
constrains equation has been formulated as
Maximize Cx
Subject to
(Ax)i ≤ bi (47.1)
xi ≥ 0
i = 1, 2, . . . ..n
In which A ∈ m×n is the matrix of coefficients of constraints, B ∈ m is the right-

hand sides of problem, C ∈ n is a coefficients of an objective function while C ∈ n
is an alternative set.
Fuzzy linear programming. In 1973, Zimmermann’s fuzzy set theory was tuned
to linear programming problems. In order to address the uncertainty of the decision
problem, a fuzzy set theory modeled on linear programming, which is a fuzzy linear
programming (FLP), may be the ideal approach (Guney et al. 2016). Certain coef-
ficients which may be influenced by other parameters or which cannot be precisely
evaluated, and only the qualitative factors which arise in classical LP problems, may
not be clear. Fuzzy linear programming is just an addition to the classical linear
programming that used fuzzy variables to deal with elusive coefficients. Then, the
fuzzy linear programming problem is considered to be
Maximize Z = CT x
Subject to
(47.2)
Ax ≤ b
x≥0
Zimmermann Method. This study applied fuzzy linear programming model

adapted from Guney et al. (2016) which is the Zimmermann method. According to
the Zimmermann method, the following steps may be summarized.
Step 1: Forming inequality relations.
According to Zimmermann (Lee and Wen 1996) pointed out that where inequality
is a symmetrical model, one of the constraints of objective function can be formed
CT xi ≥ b0
(Ax)i ≤ bi
(47.3)
xi ≥ 0
i = 1, 2, . . . ..n
Based on the Eq. 47.3, the inequality is then converted to the matrix form in which
becomes Eq. 47.5 can be expressed as follows:
CT xi ≥ b0 (47.4)

−C −b0
B= b= (47.5)
Ai bi
Then adopted from Lee and Wen (1996) the right-hand side, b can be violated
by increasing some value as “be as small as possible or equal” is the meaning of
inequalities of constraint. The membership function represents the degree of violation
can be expressed below where d is matrix of permissible violation.
⎧ ⎫
⎪
⎨ 0 if Cx ≤ b0 − d0 ⎪ ⎬
μ0 (x) = 1 − b0 −Cx if b 0 − d0 ≤ Cx ≤ b0 (47.6)
⎪
⎩
d 0 ⎪
⎭
1 if (Ax)i ≤ b0
⎧ ⎫
⎪
⎨ 0 if (Axi ) ≥ bi + di ⎪ ⎬
μ1 (x) = 1 − Axdi −b i
if b i ≤ (Ax) ≤ b i + d i (47.7)
⎪
⎩ i i
⎪
⎭
1 if (Ax)i ≤ bi
Step 2: Introducing auxiliary variable (λ).
From Eqs. 47.6 and 47.7, the problem is then transformed by the introduction of
an auxiliary variable λ and becomes the following linear programming equation that
can be expressed as
Max λ
Subject to
μ0 (x) ≥ λ (47.8)
μi (x) ≥ λ
λ ∈ [0, 1]
Then, the membership function of the fuzzy objective function and the fuzzy
coefficient equation was adapted to Eq. 47.8 and the equation is as follows:
Max λ
Subject to
1 − b0 −Cx
d0
≥ λ.
(Ax)i −bi (47.9)
1 − di ≥ λ, ∀i
λ ∈ [0, 1]
x≥0
Finally, the fuzzy linear programming model used for this study is simplified as
the following model:
Max λ
Subject to
C T x − λd0 ≥ b0 + d0
(47.10)
(Ax)i − λdi ≥ bi + di , ∀i
λ ∈ [0, 1]
x≥0
Table 47.1 Actual data for three hand socks for 2018
Category Hand socks Total
Basic 3 Ruffles Alhambra
Price (RM) 15 15 15
Production cost 5.8 6.3 6.17
(RM)
No. hand socks produced 15,795 223,388 3138 242,321
(units)
No. hand socks sold 15,522 143,263 1171 159,956
(units)
47.2.2 Data Collection Method
In order to obtain optimal production, three designs of hand socks were chosen for
this study. These three hand socks are chosen on the basis of products that make
the company more profitable. Data were collected for the year 2018. Company was
complained that according to the production they made, they do not gain profit. Hand
socks production was exceeded when they sold only for 155,956 hand socks. The
summarized data set used for this study is shown in Table 47.1.
To structure a fuzzy linear programming model later, constraints value needs to
set up. Expected demand (per year) and expected profit were determined by the
company itself. For the expected demand and expected profit, the company decides
to increase the previous demand value of each type of hand socks and previous profit
by 25%. This study found that the value of the expected demand and the expected
profit are uncertain.
In study by Chalkidis et al. (2006) it is noted that there are no rules in international
literature for the determination of the tolerance value. The decision-maker can adjust
the fuzzy limitation tolerance values according to their preferences (Herath and
Samarathunga 2015). Therefore, for this study, the tolerance value for both demand
and profit are determined by the company to be 5% of the respective expected value.
Tolerance value is a value that can be tolerated by a company if the expected value
is not achieved. Table 47.2 shows the value of the constraint on the calculation.
47.2.3 Complete Fuzzy Linear Programming Model
The information in Table 47.2 has been entered in Eq. (47.10) with the aim of
obtaining an optimum production of hand socks and the maximum profit earned by
the company. The complete single objective fuzzy linear programming model was
structured as
Table 47.2 Constraints values for linear programming model

Variable names Basic 3 Ruffles Alhambra (X3 )
(X1) (X2 )
Unit profits (RM) 9.2 8.7 8.83
Expected demands per year (units) 19402.50 179078.75 1463.75
Tolerance per demands per year (units) 970.125 8953.9375 73.1875
Expected profit (RM) 1749413.038
Tolerance for profit (RM) 87470.6519
Yearly production capacity 242,321
Max λ
(47.11)
Subject to
9.2x1 + 8.7x2 + 8.83x3 − 87470.6519λ ≥ 1661942.386
x1 + 970.125λ ≤ 20372.625
x2 + 8953.9375λ ≤ 188032.6875
x3 + 73.1875λ ≤ 1536.9375
x1 + x2 + x3 ≤ 242, 321
λ ∈ [0, 1]
x1 , x2 , x3 ≥ 0
∀x1 , x2 , x3 ∈ Z +
In a fuzzy linear programming, auxiliary variable, λ is used to obtain an optimal

solution of the hand socks production. This λ tested for several sets using an Excel
solver.
The fuzzy linear programming model was resolved using the Excel solver. The model
was tested for a number of sets of auxiliary variables between 0 and 1. Table 47.3
shows the results obtained with the value of the auxiliary variable being respected.
As can be seen from Table 47.3, the highest auxiliary variable tested was 0.99 as
the Excel solver could only provide a solution if the auxiliary variable value below
1.0 was tested. The table above shows that the profit and the number of productions
of hand socks are vary depending on the value of the auxiliary variable. Results show
that the optimal production of hand socks is 20,372 units of x1, 188,032 units for x2
and 1536 units for x3 with a maximum profit of hand socks is RM 1836863.68 with
an auxiliary variable λ value of 0.0.
Table 47.4 also presents a comparison of the number of hand socks produced
between 2018 and the optimal value for hand sock produced by solver. Based on
the table above, the optimal number of hand socks for Basic should be 20,372 units
Table 47.3 The results of solution

λ Basic (X1) 3 Ruffles (X2 ) Alhambra (X3 ) Profit (Z)
0.0 20,372 188,032 1536 1836863.68
0.1 20,275 187,137 1529 1828122.97
0.3 20,081 185,346 1514 1810624.02
0.5 19,887 183,555 1500 1793133.90
0.7 19,693 181,764 1485 1775634.95
0.8 19,596 180,869 1478 1766894.24
0.9 19,499 179,974 1471 1758815.53
0.99 19,412 179,168 1464 1750279.12
Table 47.4 Analysis of result comparison

Variable Production Sold in 2018 Expected Tolerance Solver Result
2018 (optimal)
Basic 15795 15522 19402.50 970.125 20372
(X1 )
3 Ruffles 223388 143263 179078.75 8953.9375 188032
(X2 )
Alhambra 3138 1171 1463.75 73.1875 1536
(X3 )
Profit 2116498.14 1399530.43 1749413.038 87470.6519 1836863.68
(Z)
produced by the company, which increased from 15,795 units for 2018. However, in
contrast to Basic, the number of hand socks produced for 3 Ruffles and Alhambra
decreased from 223,388 and 3,138 units to 188,032 and 1,536 units, respectively.
Even the number of hand socks produced by the solver is lower than production in
2018 but generates a maximum profit for the company, which is RM 1836863.68
compared to RM 1399530.43, based on the number of hand socks sold in 2018. This
can be concluded that fuzzy linear programming can estimate the optimum amount
of hand sock production that gives the company profitability.
47.4 Conclusions
This study implements a fuzzy linear programming to estimate the optimal production
of hand socks in order to maximize total profits. Three hand socks have been chosen
as these products are demanding by the customer. Zimmermann’s method has been
used in comparison to others since a fuzzy linear model of programming has both
objective function and constraints. The issue was modeled as single fuzzy linear
programming with the data for 2018 and was solved using Excel Solver. According
to Zimmermann, the expected and tolerance value of profit and demand for hand socks
is determined by the user’s uncertainty. Since the expected and tolerance values are
determined by the user to be uncertain, this study has established a 25% increase in
the expected demand and profit and a 5% increase in both the tolerance value.
A variety of auxiliary variables have been entered in a fuzzy linear programming
model and resolved by Excel Solver. This study successfully tested the maximum
value of auxiliary variable from 0.0 to 0.99. The results show that the higher auxiliary
variable lowers the profit earned. However, this result is contradicted by the previous
study which determines the maximum profit of meat production by (Abdullah and
Abidin 2014) found that the higher the auxiliary variable, the higher the profit. This is
due to the fact that all the coefficients in their study are fuzzy with applied alpha-cuts
to examine profit, whereas this study was only observed on objective function and the
constraints were fuzzy. Although it has been shown that fuzzy linear programming
has been successfully used to obtain an optimum solution for the production of
hand socks and produced maximum profits, it also helps to optimize unpredictable
demand and minimize overproduction, while at the same time reducing revenues and
increasing sustainability in both the textile industry and environmental.
Various other membership functions, such as the trapezoidal membership func-
tion, can be considered in the future. Different types of fuzzy linear programming
need to be concentrated, for example, objective function is set to be fuzzy, or right
side is fuzzy, or right side and coefficients are fuzzy, or all objectives are fuzzy.
References
Abdullah L, Abidin NH (2014) A fuzzy linear programming in optimizing meat production. Int J
Eng Technol 6(1):436–444
Chalkidis I, Tzimopoulos CD, Evangelides CY, Annopoulos S (2006) Management of an Aquifer,
(May 2014)
Chaudhuri A, De K (2011) Fuzzy multi-objective linear programming for traveling salesman
problem. Afr J Math Comput Sci Res 4(2):64–70
Denkena B, Dittrich M-A, Wilmsmeier S (2019) Automated production data feedback for adap-
tive work planning and production control. Procedia Manuf 28:18–23. https://doi.org/10.1016/j.
promfg.2018.12.004
Guney B, Teke C, Tas M (2016) Fuzzy linear programming approach for determining the production
amounts in food industry. Int J Mech Prod Eng 4(1):132–135
Herath HMIU, Samarathunga DM (2015) Multi-objective fuzzy linear programming in agricultural
production planning 4:(10)
Lee C, Wen C (1996) River Assim Capacit Anal Fuzzy Linear Program 79:191–201
Repnik M (2016) The application of fuzzy linear programming methods in energy planning. J
Enerhy Technol 9(4):35–42
Satheeshkumar B, Nandhini R (2017) An optimum solution for the fuzzy linear programming
problem. Int J Pure Appl Math 117(13):91–98
Werro N (2015) Fuzzy classification of Online customers. In: Fuzzy classification of online
customers, pp 7–27. https://doi.org/10.1007/978-3-319-15970-6
Chapter 48
GeoPark Management and GIS:
Geospatial Tree Information Inventory
System
Hanisah Othman, Abdul Rauf Abdul Rasam and Norajlin Jaini
Abstract Planning vegetation in urban area is a complex task but it can be enhanced
by utilizing computerized tree inventory and Geographic Information Systems (GIS).
Using a GIS or geospatial approach, the tree inventories can be used to effectively
manage tree datasets, to avoid project budget cutback, to improve the efficiency of an
existing program, and to educate and provide information to the public. This paper
covers three objectives which are to identify the user requirement for the proposed
systems, to design and develop the proposed systems and to test the capability of
the proposed systems performance. ArcGIS and Microsoft Visual Basic are main
software operated in this study. ArcGIS was used to store, manipulate, analyze and
communicate between user and datasets. While the Microsoft Visual Basic was used
to create the interface and menus of the system. The result has shown that the local
authority is need the proposed system to manage its tree inventory in the park. This
system also allows to reduce the maintenance cost. This geospatial-based system
could be implemented by the whole local authority in Malaysia especially for urban
planners, engineers, landscape architects, and urban foresters.
Keywords Tree landscape · GeoPark · GIS · Tree · Inventory system
48.1 Introduction
Open space is defined in Town and Country Planning Act 1976 as land laid out as a
public garden, or used for the purpose of public recreations, or land which is a disused
burial ground. However, open space is covered water area such as rivers, canals, lakes,
H. Othman · A. R. Abdul Rasam (B) · N. Jaini

Faculty of Architecture Planning and Surveying, Universiti Teknologi MARA, Shah Alam,
Selangor, Malaysia
H. Othman
e-mail: hanisahothman89@gmail.com
N. Jaini
e-mail: norajlin@uitm.edu.my

554 H. Othman et al.
and reservoirs which offer important opportunities for sports and recreations and can
also act as a visual amenity.
In order to manage an urban forest, it is vital to know and understand the
resource. It is the structure of the urban forest that provides the basis for its func-
tions (McPherson et al. 1997), and subsequently its value as a resource. It has been
stressed that inventories are an important components in the management of urban
forest (Smiley and Baker 1988; Keller and Konijnendijk 2012) and urban tree inven-
tory would, therefore, be the first step in planning and managing the urban forest for
priorities functions and values (Cumming et al. 2008; Jim 2008) The management
of any resource needs to begin with an inventory of that resource (Miller 1997).
In general, forest inventory and diversity assessments are essential to understand
the tree population structure and diversity status of forests and to provide information
for biodiversity recovery planning. Unfortunately, majority of forests in developing
countries lack inventory data. Consequently, the tree population structure and diver-
sity status of these forests are often insufficient for management (Mark 2013). In
the context of the study area located in Shah Alam, the local authority in 2014
does not have update inventory of tree on the park. Majlis Bandaraya Shah Alam
(MBSA) or Shah Alam Municipal Council just has the proposed data of the tree
before construction of the park.
The MBSA just has that basic data which comprised of scientific name, family
name, and common name of the trees. Furthermore, the inventory of the tree will
help in planning the resources of the place. Without the inventory the activities of
upgrading, improvement, management, interpretive cannot be done (James 1999).
The collection of the data will be increased cost, waste time, and energy. If the
authority has their own system that store the inventory, the activities that need the
inventory can be done without problems. The work will be finished faster without
wasting the energy, time, and resource.
This research addresses the issue of majority of forests or public park in developing
countries are lack in data inventory. At the end of the research is providing tree
inventory systems for maintaining and managing the tree inventory in the park. Tree
inventory is a listing and description of the tree and planting sites. It can be simple,
partial, or complete depending on its purpose. Sometimes it can be handwritten,
typed or computerized, but the computerized inventories are the best in the long run.
The tree inventories permit better hazard reduction, budgeting, and work planning.
The need to manage trees in urban setting has become an essential part of urban
forestry. Computer tree inventories and Geographic Information Systems (GIS) are
presently being used to help urban foresters better manage this valuable resource.
Tree inventories can also be easily incorporated into a GIS to achieve a more
thorough analysis. Besides that, the maintenance of the tree requires careful attention
by proper management for integration of uses (Abu Bakar 2002). Maintaining the
park will ensure the quality for public use to the local community and neighborhood.
Using GIS as tools may help in managing systems as well as increasing the ease of
park management process. These systems can replace the conventional method to
smart management where computerized and systematic approach of database system
will accelerate the tree assessment (Isa et al. 2012). The potential users can be used
48 GeoPark Management and GIS … 555
this proposed system for planning and designing the park, estimating the cost of
maintenance process before outsourcing the maintenance to contractor and for in
interpretive activities and management plan.
48.2 Review on Geospatial Technology for Tree Inventory

Management
48.2.1 Park and Tree Management
Parks and open space are valued for a variety of reasons—aesthetics, active and pas-
sive recreational opportunities, restorative attributes, historic significance, cultural
events, environmental benefits, ecological benefits, educational purposes, added eco-
nomic value, and the opportunity to socialize and congregate with others. In short,
society values parks for a multiplicity of reasons, each as unique as the individual
user. For example, in aesthetical aspect, trees, flowers, and other green vegetation
offer beauty and welcome contrast to the built environment. Benches, fountains,
sculpture, and other built features can further enhance the beauty of urban open
spaces.
Tree also can become hazardous to others. Hazard tree has the big potential to
fail and injure or damage a target such as building, utility lines, car and the lastly
people surrounding. Tree in the urban area is more stressful physical environment
than those trees found in the forest. The tree has much greater chance of being close
to valuables targets, but it fails due to the stressful conditions. There are several signs
of potential problems of hazard tree that can be defined. Seven several categories of
defects tree are decayed wood, cracks, root problems, weak branch unions, cankers,
poor tree architecture and dead tree, top or branches (Pokorny 1992).
48.2.2 Geospatial Technology in Inventory Tree System
The inventory consists of collection of data regarding tree that has been planting in the
park. The tree inventories are used to review the current state of the urban forest. The
information that can be acquired from an inventory is valuable in program planning
and subsequent management. Tree inventory can improve the response to public
inquiry regarding the tree. While the public calls the municipal, they can directly
investigate the inventory that they have (James 1999).
Tree inventory can be also used to determine the need for management program.
Tree needs to have proper maintenance to avoid hazardous conditions. The negligence
regarding tree will give the big impact in a lawsuit. The municipal is the agency that
easily to be lawsuit if the problem regarding tree is happened to the community. The
municipal is needed to pay the cost of medical, lawyer and another contingency. The
collecting inventory tree can help achieve a long-term management plan.
The other application is to efficiently dispatch work crews and to help the interest
of the community involved in the preservation and manages of the tree. Previous
studies have shown (Table 48.1) that data collection in inventory can be identified
and measured in a tree inventory that will be helpful on managing specific urban
forest tree in a system such as species, size, tree locations, site characteristics, tree
conditions, maintenance need, and action recommendation (James 1999).
A GIS is a technological tool for comprehending geography and making intelli-
gent decisions of spatial issues (Misni et al. 2017; Abdul Rasam et al. 2011, 2013;
Mohamad et al. 2013) especially in tree and park management (Khalid et al. 2018).
For example, GIS organizes geospatial data of tree so that a person reading a map can
select data necessary for a specific task in park and garden management. Specifically,
a GIS allows user to conduct task such as digitizing tree location from the satellite
image, creating selecting attribute in the database systems for geographic analysis
of the level of risk, data editing, and compilation data management and visualization
(Isa et al. 2012).
In the context of tree landscape planning, it supports sustainable development
by creating planning prerequisites that will enable future generations to live in an
ecological intact environment. It breeds to a full-coverage strategy with the aim
of maintaining landscape and nature as well as supports sustainable development
by creating planning prerequisites that will enable future generations to live in an
ecological intact environment. Contrary to the design approach (McHarg 1969), it has
been developed to an institutionalized planning system based on analytical processes
(Raumer and Stokman 2011). Objectives will be derived from scientifically based
analysis and normative democratically legitimized goals (Riedel and Lange 2001;
Jessel and Tobias 2002; Von Haaren 2004).
48.3 Research Methodology
This part covers the whole process to accomplish the research. A systematic flow
of methodology is the key to success for this research. The development of systems
for inventory of tree consists of several stages which identify need assessment, data
collections, geoprocessing and digitizing, database development and systems inte-
gration, system development, testing and applications. This study is based on general
and conceptual methodology that is shown in Fig. 48.1.
48.3.1 Selection of Study Area
Identification of the study area is very important step in a study relate to the avail-
ability of data, preparation of procedures required, and the possible outcomes of the
Table 48.1 The attribute table of previous research
Written Attribute that recommended by the author
UConn Tree height and Tree species Condition Maintenance need Planting Site Special
(2006) diameter • Scientific name • Hazard • Pruning spaces—Record characteristics characteristics
• Fertilizing spaces that could • Power line • History
support a tree • Root system • record size
• Soil • Special scenic
characteristic value
48 GeoPark Management and GIS …
James Size Species Tree conditions Maintenance need Tree locations Site characteristic Action
(1999) • diameter at breast • scientific name • Alive or dead • types of pinning: • Coordinate • Site class or recommendation
• height, height • common mine • Considered • small tree training • Number of land use • Planting
• crown spread • family name hazardous • dead wood nearest utility • space • Watering
• Excellent good, fair, removal pole dimensions • Fertilizing
poor, dead/dying • hanging branch • Tag number • ground cover • Mulching
• Foliage color removal • paved walkway • Spraying
• Life expectancy • elevating lower • Soil • Trimming
limb, • Removal
• sanitation pruning • Repair of
which removes pavement
diseased or insect
infested limbs
Size Species factor Condition factor Location value
Size Species Condition range Special management Location
557
Fig. 48.1 A flowchart of general methodology
Table 48.2 Spatial data collected from variable of sources

No Map Format Organization
1. Topology map Hardcopy Jabatan Ukur dan Pemetaan Malaysia
2. Land use map Hardcopy Jabatan Perancang Bandar, MBSA
3. Proposed map of park Hardcopy Jabatan Taman dan Rekreasi, MBSA
4. Google map Softcopy Google earth
study. In this stage of the work included an in-depth study on the study, namely,
Taman Tasik, Sect. 7, Shah Alam.
48.3.2 Data Collection
Data is the most precious element in GIS components. This study used spatial data
and non-spatial data. Spatial data acquisition in this study was shown in Table 48.2.
The primary data obtained from GPS observation for location of the tree in the park,
meanwhile the secondary data such as topology map, AutoCAD map, and proposed
map were collected from Google Earth Map and others.
48.3.3 Geoprocessing and User Requirements
The data processing involved in this stage of work is creating a personal Geodatabase
in ArcCatalog, establishing the control point on the base map, registering the base
map, and digitizing the base map that has rectified coordinate systems. Then, the main
reason for conducting a needs assessment in this study is to inform an organizational
decision about what to do in relation to a given situation. There are a few ways for
carrying out need assessment which is interview, questionnaire, and observation.
These methods were carried out with staff of MBSA within 2013–2014. The Delphi
survey method is a research method involving the use of questionnaire or interview
schedule. It was given the research participation that is usually expert in their field,
to seek their options or views on the area of interest.
The questionnaire is separated into three sections. The first section is personal pro-
file, second is current systems, and the lastly is proposed system. The person profiles
are identifying the scope of work, positions, period experience, and others. Further-
more, the second section was describing the current system that implementing on the
agency, rating of current systems and their opinion regarding GIS to implementing
on the agency. The lastly section is about proposed systems for tree inventory using
GIS. The main in this section is about component that they need in the proposed
system and the attribute that installed on the systems.
48.3.4 System Design and Testing
On this stage, the design of the interface was implemented by using visual basic
Microsoft. The process involved in the system design are in the process of conceptual
design logical design and physical design. This process applies to realize the system
performance. The software used is Visual Studio Microsoft. The system has the final
stage which is testing the system. The developed system was tested by the MBSA
because they are the users who have been interviewed and they are the persons who
can use the systems.
48.4 Result and Discussion
48.4.1 User Requirement Based on Questionnaire
Understanding the user requirement was importance to make sure the product that was
created based on their requirement and they need the systems to handling the problem
and help in decision making. The result from the pre-test was 0.975 for 31 items,
showing the suitability and reliability of the instrument that use in the questionnaire.
To understanding the user requirement the questionnaire was distributed among staff
of MBSA via email as shown in Fig. 48.2. The highest percentage which is 44% comes
from design the landscape and maintenance the park. The other administrative and
other was 6%. It shows the people that answer the questionnaire are related with the
inventory field. This is shown that they are involving in tree care and maintenance.
In terms of the feedbacks of the respondents on the currents systems, revealing that
86% of respondent are still using semi digital, while 14% of the are using manually
Fig. 48.2 The pie chart of scope of work of the respondents
Fig. 48.3 Component GIS that needed in the proposed system
record and surprisingly there are no respondents (0%) using digital method. The
respondent is able to use the technology, but maybe some of obstacle to them to use
the technology such the GIS due to lack of human expertise (people), problem in
data and instrument availability. Therefore, this study proposes the applications of
GIS in managing tree inventory system.
As expected earlier, 100% of the respondent agrees to implement the GIS into
their agency. It is because the uses of technology nowadays are increased rather those
5 years ago. The respondents also agreed that there are some important features that
need to be included in the proposed system as shown in Fig. 48.3. This figure shows
that the 100% agree the mapping was implementing the proposed system follow by
3D with 60% and navigator 45% and the lastly Analysis with 30%.it show the most
needed component into proposed systems was Mapping and 3D which is they are
more than 50%.
48.4.2 Development of Database for the Proposed Systems
This section explains the database of the proposed systems. The commonly system
design consists of conceptual design, logical design, and physical design. Figure 48.4
shows entity–relationship diagram for tree inventory database. The entity for this
diagram is Taman Tasik Seksyen 7, Landuse, Tree and proposed map. Every entity has
interrelationship for each other. Logical design is defined as the process of detailing
which element solves and how they interrelate with each other. This design does
Fig. 48.4 Entity relationship diagram of Taman Rekreasi seksyen 7
not provide technical implementation details and thus is prior to making specific
technology decisions. In logically design, the high-level data model of conceptual
design is change into database information system (DBMS) data model (Rob and
Coronel 2007).
Basically, the logical design follows the database format as ArcView. In Arc
View, every data is being kept in different layers which is called entity. Figure 48.5
shows the Logical Design of Tree Inventory database, the physical design described
the movement of the data and the data that used and implemented on the systems.
The challenger is to design the conversion between the independent logical model
and dependent physical model. Meanwhile, Fig. 48.6 shows the physical model of
i-TREE INV of the proposed system.
The proposed system was developed after the design process was finished. To
develop the system has 2 phases involved in the research which are Phase 1: Data
Preparation and Phase 2: Design the Graphical User Interface. Data preparation is
main task in Phase 1, involving data acquisition and process to integrate attribute and
spatial data. The process of data acquisition occurs when the base map of Shah Alam
is on the Google Earth. Phase 2 is to design the Graphical User Interface (GUI). For
creating the systems, the software used was Microsoft Visual Basic 6.0 and Adobe
Photoshop 5.
Before creating GUI of the system, the planning process should clearly be under-
stood. It is important to know the workflow from one form to another form. Firstly,
plan the flow on the piece of paper. Then review the flow of plan with supervisor.
Then, write down the properties and element that involved in the form. After that, this
is the most important on using the software or making the systems know the basic
Fig. 48.5 Logical designs of tree inventory system
Fig. 48.6 The physical model of proposed system

code to implementing the systems using Microsoft Visual Basic 6.0. The designing
process was used adobe Photoshop 5. Next is the system inventory system is created
based on used requirement. Before this the local authority does not have the proper
database for storing the data. They are using semi-manual method. The existing sys-
tem has a many lacking regarding the storing. The data is difficult to find. Figure 48.7
illustrates the system architecture for the proposed systems.
This system has some interfaces and specific features (see Fig. 48.8). The first
windows appear in the system is Home windows. On this window the admin needs
to choose the place of park and they need to Sign in the systems. The Sign in systems
is importance as a security factor to avoid from occurring data problems. For the
next form (2), the user will be introduced with option interface windows. In these
windows, user is an able to click the buttons Home, Database, Map, and Animations.
The windows also provide the button of Help, Exit and Introduce. The button Home
is able to connect the user to the introduction, contact us and location of park.
The button Database will move to next which is Database Display. The display of
data is able to show all the stored data. The data stored are connected with Microsoft
Fig. 48.7 Structural architecture for the proposed system

Fig. 48.8 Some interfaces and specific features in the proposed system
Access. The window is able to delete or remove the data. The Data Display Windows
before click button show data. Besides that, the report can be printed as management
use on the site. The report can be printing for the external use.
On the right side as shown in Fig. 48.9, the data display windows two button which
is Home and Update. The button Home is for to go back the option window, while
the Update is for Update date windows. The window containing the species, size,
maintenance need, special characteristic, action recommended site characteristic,
and the tag number of tree and other. The window able to help the user update all the
data after collecting or receiving the new data for the park manager regarding add or
remove of the tree on the park.
From the update data window, the user is able to connect the ArcGIS without
close the windows. The Option Windows shows the button Map, the button map was
link to Map windows. The Map window has File, View, Edit, and Layer toolbar of
the map display (see Fig. 48.9). The last form or window is animation of the park.
The window that consists of home button, play, next, and stop button. Regarding
to the user requirement the user is needed the animation to know the real situation
of the park. By watching the animation planning of the design will be more easily
because the user can identify the space of planting the tree and others.
Fig. 48.9 Updating map and animation function in the proposed system
48.4.3 Testing and Evaluation of the Proposed System
System testing and evaluation were needed to ensure the systems can be used by the
user and related agencies (such as Majlis Bandaraya Shah Alam). Respondents A
and B from MBSA evaluated the features and functions of proposed system by using
likert scale based on level of consideration 1. would not consider, 2. Might or might
not consider, and 3. consider.
i. Give attribute information of the tree, e.g., Scientific name, Common name, and
Family name
ii. Visualize the location of tree.
iii. Provide hardcopy for the fieldwork activities.
Both of respondents have given their comments and suggestions for this proposed
system. Respondent A was said the system is the best solution to handle the problem
on the agency regarding tree inventory. As we know, the MBSA was handling more
than 10 parks. The proposed system can help the agency. The respondent B was
said the system can help on reducing the time, energy, and money. They agency can
search the data without referring the other source. The proposed system comprised a
helpful GIS element and technology t that can be implementing on future prospects
in the study area.
48.5 Conclusion
This paper has demonstrated the capabilities of GIS and information technology
to develop a spatial information system for park and amenity management in the
Majlis Bandaraya Shah Alam (MBSA), Selangor. By implementing the GIS in this
department, it will improve the current status of management of the tree and park
inventory system. The agency can have a better visualization regarding tree element
to maintain the inventories of tree. The system also offers special functions in the
system such as updating the database, mapping, data management, and visualization.
The system was tested by the staff of the MBSA to make sure the developed system
is based on requirement of the user. The agency also agreed to the implementation
of the GIS in the department application. The user thinks by using the proposed
system, it will help them in solving the lack data regarding the tree inventory and
the system help in managing the natural resource properly in cost effective way. The
respondents suggest a few requests for the system enhancement or improvement.
They hope the completed system can show some spatial analyses to manage the tree
inventory properly and interactively. The system can be also accessed by users by
using the web GIS in promoting the public park to local and international people.
References
Abu Bakar J (2002) A design guide for public parks in Malaysia. University Technology Malaysia,
Skudai, Johor
Abdul Rasam AR, Mohd Noor AM, Ahmad N, Ghazali R (2011) MyGeoHealth: GIS-based cholera
transmission risk system in Sabah, Malaysia. In: 2011 IEEE 7th international colloquium on signal
processing and its applications, Penang, pp 474–479. https://doi.org/10.1109/cspa.2011.5759925
Abdul Rasam AR, Hanif FA, Samad AM, Hadi RA (2013) Spatial information management
system for building energy consumption. In: 2013 IEEE 3rd international conference on sys-
tem engineering and technology, Shah Alam, pp 295–299. https://doi.org/10.1109/icsengt.2013.
6650188
Cumming AB, Twardus DB, Nowak DJ (2008) Urban forest health monitoring: large scale
assessments in the United States. Arboric Urban For 34:341–346
Isa MM, Othman N, Ghazali R (2012) GIS in management of landscape trees: determining, monitor-
ing and implementing safety measures on potentially hazardous trees. In: IEEE 8th international
colloquium on signal processing and its applications (CSPA)
James PW (1999) Tree inventories and GIS in urban forestry. Master Thesis, Faculty of the Virginia
Polytechnic Institute and State University
Jessel B, Tobias K (2002) Ökologisch orientierte Planung, Verlag Eugen Ulmer, Stuttgart
Jim CY (2008) Multi-purpose census methodology to assess urban forest structure in Hong Kong.
Arboric Urban For 34:366–378
Keller, Konijnendijk (2012) A comparative analysis of municipal urban tree inventories. Arboric
Urban For 38(1):24–30
Khalid N, Hamid JRA, Latif ZA, Abdul Rasam AR, Saraf NM (2018) Mapping the 3D distribution
of Shorea tree species based upon information extracted from worldview-2 and LiDAR data.
In: 2018 IEEE 8th international conference on system engineering and technology (ICSET),
Bandung, pp 128–132. https://doi.org/10.1109/icsengt.2018.8606359
Mark A (2013) Tree population inventory, diversity and degradation analysis of a tropical dry
deciduous forest in Afram Plains, Ghana. For Ecol Manag 295:145–154. https://doi.org/10.1016/
j.foreco.2013.01.023
McHarg IL (1969) Design with nature. Doubleday & Company, Garden City, NY
McPherson EG, Nowak D, Heisler G, Grimmond S, Souch C, Grant R, Rowntree R (1997) Quanti-
fying urban forest structure function, and value: the Chicago urban forest climate project. Urban
Ecosyst 1:49–61
Miller RW (1997) Urban forestry: planning and managing urban greenspaces, 2nd edn. Prentice
Hall, Upper Saddle River, New Jersey, USA
Misni A, Abdul Rasam AR, Buyadi SNA (2017) Spatial analysis of habitat conservation for horn-
bills: a case study of Royal Belum-Temengor forest complex in Perak State Park, Malaysia
Pertanika. J Soc Sci Hum 25(S):11–20
Mohamad AN, Masrek MN, Abdul Rasam AR (2013) A bibliometric analysis on scientific produc-
tion of geographical information system (GIS) in web of science. In: 2013 international conference
of information and communication technology (ICoICT), Bandung, pp 264–268. IEEE. https://
doi.org/10.1109/icoict.2013.6574584
Pokorny JD (1992) Urban tree risk management, A community guide to program design and
implementation. USDA Forest Service Northeastern Area State and Private Forestry
Raumer HGSV, Stokman A (2011) GeoDesign-approximations of a catchphrase. Heidelberg, Berlin,
p 364
Riedel W, Lange H (2001) Landschaftsplanung, Spektrum Akademischer Verlag
Rob P, Coronel C (2007) Database systems: design, implementation, and management, 8th edn.
Course Technology Ptr, Boston
Smiley ET, Baker FA (1988) Options in street tree inventories. J Aboric 14(2):36–42
University of Connecticut (Uconn) (2006) The Tree Inventory. http://www.ctforestry.uconn.edu/
TreeInventory.html
Von Haaren C (2004) Landschaftsplanung, vol 528. Eugen Ulmer Verlag, Stuttgart
Author Index
A F
Abd. Aziz, Khairul Naim, 13, 285 Fauzi, Fazlina, 473
Abdullah, Shafinas, 79 Fauzi, Shukor Sanim Mohd, 377
Abdul Rasam, Abdul Rauf, 507
Abdul Wahab, Nor Mazlina, 147, 435, 447
Ahmad Nasir, Nor Atikah Husna, 123 G
Ahmad, Norhanani, 23, 137 Ghazali, Noriati Roseni binti, 37
Ahmad Zaghlul, Nureen Shahirah, 123 Gining, Ray Adderley JM, 377
Ahmad, Zuliahani, 435
Al-Bakri, Nurdamia Yasmin Mustaffa, 285
Ali, Ab Malik Marwan, 465 H
Alias, Nurul Zawani, 65, 79 Halim, Iman Hazwam Abd, 377
Ali, Nik Kamarullah Ya, 307 Halim, Nur Atiqah, 389
Anthonysamy, Shameen Izwan, 13 Hamdan, Ruhil Hayati, 215, 473
Awang, Norkhushaini, 529 Hamid, Juazer Rizal Abdul, 335
Azewan, Muhammad Dinie Haqim, 495 Hamzah, Siti Salbiah, 111
Aziz, Rosmawati Abdul, 297 Hanah, Iqmal Che, 487
Azlan, Nur Azrin, 87 Hanif, Fatin Amirah, 49
Azman, Mohd Azhar, 421 Hasan, Sharizal Bin, 65, 193
Azman Shah, Norzatul Bazamah, 351 Hashim, Nor Hafida, 411
Azmi, Amirul Ikram, 23 Hassan, Siti Sumaiyah Syahida, 227
Hayati, Adilin Mohd Abd Majid, 237
B
Bakar, Mohd Nazari Abu, 465 I
Bohari, Sharifah Norashikin, 23, 319 Ibrahim, Farah Izati, 147
Ibrahim, Norfiza, 181
Ibrahim, Nur Fairuz Wahida, 487
Idris, Mohd Fazril Izhar Mohd, 399
D
Idris, Saiyidatul Adidah, 259
Dahalan, Nurol Huda, 389
Imran, Nik Farhanim, 87, 411
Daud, Norfataha Mohd, 307
Ismail, Mithalina Zulaikha, 147
Ismail, Muhammad Hazim Firdaus, 181
Ismail, Nismahasyirah Alang, 203
E Ismail, Sharifah Nafisah Syed, 487
Eri, Zeti Darleena, 111 Ismail, Wan Izhan Nawawi Wan, 465
in Science and Technology, https://doi.org/10.1007/978-981-15-3434-8
570 Author Index
J Muhd Sidek, Muhd Norhasri, 411

Jaini, Norajlin, 553 Mustafa, Mohd Syamaizar, 435, 447
Jamaluddin, Muhammad Nabil Fikri, 377
Jamaludin, Mohd Hafiz, 215
Junik, Jesmond Joel, 79 N
Nadzri, Nor Atikah, 519
Nasir, Nor Atikah Husna Ahmad, 227, 249,
K 455
Kadir, Evizal Abdul, 97 Nasirun, Noraini, 49
Kamal, Mohd Lias, 65, 79, 193, 487 Nazir, Khuzaimah, 147
Kamarolzaman, Khairun Najwa, 361 Noordin, Noraini, 259
Kamaruddin, Salsabila, 307 Noor, Raja Nor Husna Raja Mohd, 389
Kamaruddin, Sharir Aizat, 13, 285 Nugraha, Idham, 49
Kamarudin, Nur Khairani, 351
Karim, Muhamad Amin Naim Ab, 1
O
Kawi, Roejhan Md, 455
Osman, Aznoora, 181
Khalid, Nafisah, 361
Osman, Mohd Nizam, 1, 37
Osman, Nafisah, 465
Othman, Ainon Nisa, 361
L
Othman, Farhana, 203
Latif, Zulkiflee Abd, 319
Othman, Hanisah, 553
Lothfy, Fairuzdzah Ahmad, 307
R
M Radzi, Nor Azira Mohd, 97
Maghribi, Mushahadah, 1 Rahim, Nur Syafiqah, 155, 455
Majid, Noor Aishatun, 147, 447, 487 Rahman, Wahida Abdul, 487
Malik, Siti Norfahana Abdul, 377 Rajeswari, Raju, 237
Mamauod, Siti Nur Liyana, 487 Ramle, Rashidah, 351
Masdar, Non Daina, 65, 79, 193 Ramli, Azliana, 465
Masdar, Nur Wajihah, 455 Ramli, Norizan Binti, 65
Mat Zin, Ain Auzureen, 215 Ramli, Rohayu, 123
Md Hanafiah, Mohammad Azri, 435 Rasam, Abdul Rauf Abdul, 23, 335, 361,
Md Saad, Nurhafiza, 335 495, 553
Mohamad Nor, Md Rasul, 411 Rashid, Nor Aimuni Md, 529
Mohamad Sakdun, Noor Syafeekha, 87, 411 Razak, Nur Illani Abdul, 227
Mohamed, Maizan, 473 Razak, Tajul Rosli, 377
Mohamed Saraf, Noraain, 335, 507 Razali, Zainab, 155, 249, 455
Mohammed, Abdul Hapes, 377 Romeli, Che Ahmad Redzuan Che, 23
Mohd Abd Majid, Hayati Adilin, 111 Roslani, Muhammad Akmal, 13, 285
Mohd Azham, Mohd Afiq, 411 Roslan, Nurul Syazwina, 155
Mohd Bahrin, Ummu Fatihah, 111 Roslan, Robiatul Adawiyah Binti, 193
Mohd Haider, Haidib, 351 Rosli, Nurul Miza, 249
Mohd Hasmizi, Nurin Syarafina, 507 Roslly, Nurul Atikah Liana, 249
Mohd Radzi, Intan Nur Suhaida, 319 Rosseli, Siti Rahimah, 411
Mohd Rodzi, Nurul Ain Rusydiah, 543 Ruslan, Rafiza, 351
Mohd Shahabudin, Marina, 147
Mohd Shaipul Amini, Shafeera, 447
Mohd Shukair, Muhammad Khairil Asyraf, S
335 Saad, Nurhafiza Md, 167, 361
Mohd Zaki, Nurul Ain, 319 Sa’aid, Nur Amira Mohd, 167
Mokhtar, Ernieza Suhana, 49 Sabri, Jasni, 215
Muhamad Azlan, Hafizah, 87, 411 Sallehuddin, Nur Syahirah Mohamad, 167
Muhamad, Siti Nor Nadrah, 399, 543 Samsuddin, Noor Zuhairah, 137
Author Index 571
Samsudin, Dalina, 435 W

Sani, Noor Faezah Mohd, 487 Wahab, Nadia Abdul, 181
Saraf, Noraain Mohamed, 361 Wahab, Nor Mazlina Abdul, 487
Sarip, Muhamad Naiman, 447 Wahab, Nurul Izzati Husna, 399
Sedek, Khairul Anwar, 1, 37 Wan Mohd Zaki, Wan Nur Azliena, 49
Seman, Azmi Abu, 181 Wan Shahidan, Wan Nurshazelin, 519, 543
Sepeai, Suhaila, 465
Shaari, Siti Shahirah, 79
Shahidan, Wan Nurshazelin Wan, 399 Y
Yunus, Juzailah Nur, 389
Sharifah, Nurulhikmah Syed Yasin, 237
Yusof, Rizana, 421
Siti, Salbiah Hamzah, 237
Yusuf, Muhammad Fakhrul, 351
Sukri, Nurhidayah Mat, 137
Suratman, Mohd Nazip, 319
Syed Ismail, Sharifah Nafisah, 147, 435, 447 Z
Syed Ismail, Syarifah Nursyimi Azlina, 297 Zabri, Muhammad Tholhah, 97
Syed Soffian, Sharifah Sakinah, 297 Zahari, Nur Zaida, 271
Syed Yasin, Sharifah Nurulhikmah, 111 Zainal, Mohd Zainee, 319
Zaini, Siti Zawani Ahmad, 421
Zain, Nur Zaid Md, 1
Zainolabdin, Shaidatul Najwa, 285
T Zainol, Zamzila Erdawati, 13
Tahiruddin, Nordiana Suhada Mohmad, 297 Zaki, Nurul Ain Mohd, 23
Taib, Abidah Mat, 97 Zeti, Darleena Eri, 237
Talib, Noorfatekah, 167, 335 Zohir, Nur Syazwana Akmal Mohd, 285
Tammy, Nor Janna, 389 Zukri, Nurul Hidayah Ahmad, 529
Tan, Li Peng, 215, 473 Zulkifli, Mohd Azhar, 155
Tuah, Piakong Mohd, 271 Zulkifli, Zuhri Arafah, 529

Charting The Sustainable Future of Asean in Science and Technolo 2020

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Charting The Sustainable Future of Asean in Science and Technolo 2020

Uploaded by

Copyright:

Available Formats

Nurul Zawani Alias

Rizana Yusof Editors

Charting the Sustainable

ISBN 978-981-15-3433-1 ISBN 978-981-15-3434-8 (eBook)

1 Hearing Assistive Technology: Sign Language Translation

8 Tensile Strength of Polyester Composite Filled

17 Determination of Antioxidant from Ubi Gadong Tubers

26 Antibacterial and Insect-Repellent Activities of Cananga odorata

33 The Investigation on the Implementation of Industrialised

41 Detection of Integron and Antibiotic Resistance Genes

Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 569

Mohd Nizam Osman , Khairul Anwar Sedek, Nur Zaid Md Zain,

M. N. Osman (B) · K. A. Sedek · N. Z. M. Zain · M. A. N. A. Karim

© Springer Nature Singapore Pte Ltd. 2020 1

Keywords Hearing assistive technology · Hearing-impaired · Sign language ·

1.2.1 Developing the System Architecture for Sign Language

Fig. 1.1 System architecture of sign language translation application

1.2.2 Model Used for the Development of Sign Language

Fig. 1.2 The waterfall model phases

User choose the

True Convert into

Fig. 1.3 The flow of the application

used for pattern matching, a database of predefined gestures of each performed at a

Table 1.1 Range of mean

1.3 Results and Discussion

1.3.1 Interfaces of the Sign Language Translation

1.3.2 User Acceptance Test

Fig. 1.4 Interface of the application in a main interface and b button

required to answer a set of questionnaires, which consist of thirteen (13) questions

Table 1.2 The user acceptance test results

Table 1.2 (continued)

gesture. Furthermore, the most advantageous of being supported by this application

Khairul Naim Abd.Aziz, Shameen Izwan Anthonysamy,

K. N. Abd.Aziz (B) · S. I. Anthonysamy · Z. E. Zainol · M. A. Roslani · S. A. Kamaruddin

© Springer Nature Singapore Pte Ltd. 2020 13

Fuzzy Inference System

Fish Freshness Defuzzification

Table 2.1 The eye sensory

Table 2.2 Eye changes for

2.4 Conclusion and Recommendations

Sharifah Norashikin Bohari, Che Ahmad Redzuan Che Romeli,

S. N. Bohari (B) · C. A. R. C. Romeli · A. I. Azmi · N. A. M. Zaki

© Springer Nature Singapore Pte Ltd. 2020 23

Keywords UAV · DEM · Flow accumulation · Soil fertility

3.2 Material and Method

3.2.1 Study Area

3.2.2 Slope from UAV Image

Fig. 3.1 Location of study area

3.2.3 Ground Control Point

3.2.4 Soil Sampling

3.2.5 Rainfall Data

3.2.6 Flow Accumulation

3.2.7 Relationship Between Slope with Soil pH, K, Salinity

3.3 Analysis and Discussion

3.3.1 Average Slope at Study Area

3.3.2 Flow Accumulation of Study Area

Fig. 3.3 a Slope of harumanis mango, b average slope at soil samples

Fig. 3.4 Flow accumulation

3.3.3 Soil Nutrient, Soil pH, Potassium and Soil Salinity

Fig. 3.5 a Soil texture content, b soil pH

Fig. 3.6 a Potassium, b soil salinity

3.3.4 Relationship of Different Slope Towards Soil Nutrient,

Fig. 3.7 Relationship between three slopes with soil pH