A Detailed Lesson Plan in

Science 10
(GENETIC MUTATION)

Prepared By:
CYRIL BAUA CAUILAN
Pre-Service Teacher

Checked By:
Mrs. Catherine Balubal
Cooperating Teacher
I. Objectives:
At the end of the lesson the learners should be able to:
A.) examine different types of mutations;
B.) observe possible effects of mutations, and;
C.) manage issues pertaining to persons suffering from mutation

II. Subject Matter:

A. Topic: HEREDITY: INHERITANCE and VARIATION
B. Sub-Topic: GENETICMUTATION
C. Reference: Science – Grade 10, Support Material for Independent
Learning Engagement (SMILE)
Quarter 3 – Module 4: PROTEINS and GENETIC
MUTATION, Science 10 Learners Material Unit 3

D. Materials: Powerpoint, Pictures, Learning Module

E. Teaching Strategy: Constructivist, Collaborative, Spiral Progression
Approach, Developmentally Appropriate,
Responsive and Relevant
F. Time Allotment: 60 minutes

III. Learning Procedure

Teachers Activity Student Activity
Preliminary Activities
• Prayer (call a student)
• Greetings
• Classroom Management
• Attendance

Before we start, Diomar can you Place ourselves in the Lord's

presence. In the name of the father,
please lead the prayer.
the son, and the Holy Spirit, amen.
God, thank you for such a beautiful
day. In our online lesson, please
guide us. Please share your blessings
and love with us. Give us the
strength we need to succeed in our
online class. Through Jesus Christ,
this is our prayer. Amen...
Good morning class
Good morning, sir
Please be reminded and observe
always our classroom management

For your attendance I will just

download it through the google
attendance tracker.
Excellent! You've got an excellent
attendance record.

Did I give an assignment last

meeting? Yes sir

Okay let’s answer those questions.

Gene1:
TACTTGTTTACATAACTTTGAATT
AUGAACAAAUGUAUUGAAACUUAA
Step 1. Transcribe the DNA to mRNA
AUG-AAC-AAA-UGU-AUU-GAA-ACU-
Step 2. Draw lines to separate the
UAA
mRNA into codons (3 bases).
Start Codon (Methionine)-Asparagine-
Step 3. Using the newly made mRNA,
Lysine-Cysteine-Isoleucine-Glutamic
translate it into its corresponding
Acid-Threonine-Stop Codon
protein fragment. Refer to Figure 1
(The Genetic Code Table). Don't forget
to look for the start and stop codon.

Very good class that you were able to

master how to transcribe DNA into
RNA and translate RNA into proteins

Recalling Activity
Sir We discussed about the central
What was our lesson last meeting? dogma.

We also discussed about the protein

What else class? synthesis sir

It is the process of making proteins

What is protein synthesis? which involves transcription and
translation
Very good class that you can still
remember our topic last discussion
though we did not meet last week due
to your Intramurals

Motivation

Class, before we start to our lesson

for today, let’s have a short
motivation first.
(Students will raise their hands) or
Who among the class are funs of they will answer Yes
watching movies?

Okay, that’s good, because our

activity for today is related to movies.
So, let us call our game as “GUESS
WHO”.

So, I have here a picture of movies

and I want you to identify and guess
who is in the picture. Yes sir

Are you ready? (Showing some

pictures) Teenage Ninja Turtles Sir

Its Hulk sir

Very Good.
How about this one?

X-Men sir

Excellent how this last picture?

They all possessed superpowers sir.

(Answers may vary)

Okay, based
on your observation class what do Yes sir
you think is the similarities of the
characters in the movies?

Yes, very good! They have a special (Answers may vary) Some may say
ability because they are different from Yes some may say No
normal human beings, right?

Now, the question is, are they real?

Or do they really exist?

Presentation
A.) examine different types of
Before we formally start our new mutations;
discussion this morning, let us check
first our objectives. B.) observe possible effects of
mutations, and;
Who ca read the first one?
C.) manage issues pertaining to
persons suffering from mutation
How about the next one?
How about the last one?

Thank you, class. These objectives

will guide us as we go through with
our discussion.

Lesson Proper
Mutation is the process in which the
So, we have identified four
change in the base sequence of DNA
superheroes that all gained some sort
that may affect only one gene, or they
of special abilities is from the process
may affect whole chromosomes.
what we called mutation.

Who can give the definition of

mutation?

Very Good Sir the gene mutation is a permanent

change in the DNA sequence that
There are two types of mutation, the makes up a gene.
gene mutation and the chromosomal
mutation. Sir in DNA is cytosine-guanine and
adenine-thymine while in RNA is
What is gene mutation? cytosine-guanine and adenine-uracil.

Do you still remember class those

base pairs of our DNA and RNA? And
what those?
It is a change in one or a few
Yes, very good! So, under gene nucleotides. It includes substitution,
mutation class, there are two types: deletion and insertions.
point mutation and frameshift
mutation. In substitution it occurs when the
nucleotide is replaced with different
So, what is Point Mutation? nucleotide in the DNA sequence.

In deletion is the removal of a

nucleotide from the DNA sequence.
So, who can differentiate
substitution, Deletion and Insertion? While in insertion is the addition of a
nucleotide to the DNA sequence.

So, to illustrate the idea of these

mutations. Let’s take a look in this
figure.
Normal DNA THE DOG BIT THE
 CAT
Substitutio THE DOG BIT TEE
n CAT
Insertion THE DOG BIT THE
CAR T
Deletion THE DO_ BIT THE Shifts the reading frame of the
CAT genetic message so that the protein
may not be able to perform its
Now let us proceed to second type of function. It also includes insertion
gene mutation which is the and deletion.
Frameshift Mutation.

What is Frameshift Mutation?

So, to illustrate the idea of these

mutations. Let’s take a look in this
figure.
Normal DNA THE DOG BIT THE
CAT

Insertion THE DOC GBI TTH

ECA T
Deletion TED OGB ITT HEC
AT

There is significance of mutation.

Most are neutral, some are harmful,
but some are beneficial. None sir

But in some cases, mutation can

caused by mutagens in a form of
medicines, chemicals, radiation,
extremes of temperature, during DNA
replication, and even viral infection. It occurs at the chromosome level
that maybe caused by parts of
Do you have any clarification before chromosomes breaking off or
we proceed in our next subtopic? rejoining incorrectly.

Okay, so the second type of mutation

is the chromosomal mutation.

What is Chromosomal Mutation?

There are also kinds of chromosomal

The learners will be going to watch
mutation: translocation, deletion and
the video
insertion. So let’s have a figure to
visualize what will happen. In translocation the chromosome
swap one or more gene(s) with
Please watch this video and take note
another chromosome
of these following questions

What is Translocation, Deletion and

Insertion?
What is translocation?

One or more gene(s) are removed

from one chromosome and inserted
into another chromosome.

How about the Insertion?

The single chromosome mutation

involving the loss of one or more
gene(s) from the parent chromosome.

And how about the deletion?

None sir

Sir some will have a genetic disorder.

Do you have any questions or

clarifications class?

If that’s so, what do you think class

will be the possible effects when No sir
mutation occurs?

Yes, very good! The gain or loss of

chromosome material can lead to a
variety of genetic disorders. Let us
focus our examples in human.

Are you familiar with Karyotype

class?

If that’s so, karyotype are the

homologous pairs of chromosomes
are identified and arranged in order
by size, with the exception of the sex
chromosomes; these appear as
shown in Figure.
So, I have here some examples of
genetic disorders that cause
chromosomal mutation specifically
genetic syndromes.
a. “Cri du chat” is caused by the
deletion of part of the short arm of
chromosome 5. Infants with this
condition often have a high-pitched cry
that sounds like that of a cat.

b. Down’s syndrome is usually caused

by an extra copy of chromosome
21(trisomy 21).

c. Edward’s syndrome, which is the 1. Deletion

second most common trisomy after 2. Translocation
Down’s syndrome, is a trisomy of 3. Duplication
chromosome 18. 4. Down Syndrome

d. Jacobsen syndrome is also called

terminal 11q deletion disorder.

e. Klinefelter’s syndrome (XXY).

f. Turner’s syndrome (X instead of XX

or XY).

Application

Identify what mutation is depicted in

the picture

1. 2.

4.

Mutation is the process in which the

change in the base sequence of DNA
3. that may affect only one gene, or they
may affect whole chromosomes.

The two types of mutation are the

gene mutation and chromosomal
mutation.
Generalization
Based on what we have discussed,
what is Mutation again?
Sir under gene mutation is the point
mutation and frameshift mutation.
Sir under chromosomal mutation is
caused by parts of chromosomes
breaking off or rejoining incorrectly.

What are the two types of mutation?

And what are the two types of gene None sir.

mutation?

What is chromosomal mutation?

Very good, you seem you understood

our lesson.

Do you have any clarifications or

questions?

If that so, once again thank you for

joining this online class and for your
active participation. God bless and
stay safe.

IV. Evaluation
In ½ sheet of paper, answer the following questions: (10pts.)
1. If you have a family member with Down syndrome, what will you do?
2. Base on the causes of mutation, how can you prevent your DNA from
mutation?

V. Assignment
For your assignment, search the following:
1. Fossils
2. Evidence from Fossil records
3. Geological Time Scale