Plant Physiology and Biochemistry 107 (2016) 301e309

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Research article

Short-term UV-B radiation affects photosynthetic performance and

antioxidant gene expression in highbush blueberry leaves
Claudio Inostroza-Blancheteau a, b, *, Patricio Acevedo c, d, Rodrigo Loyola e,
Patricio Arce-Johnson e, Miren Alberdi f, g, Marjorie Reyes-Díaz f, g
a
Núcleo de Investigacio
n en Produccio

n Alimentaría (NIPA-UCT), Facultad de Recursos Naturales, Universidad Cato
lica de Temuco, P.O. Box 56-D, Temuco,
Chile
b
Escuela de Agronomía, Facultad de Recursos Naturales, Universidad Cato
lica de Temuco, P.O. Box 56-D, Temuco, Chile
c
Departamento de Ciencias Físicas, Facultad de Ingeniería y Ciencias, Universidad de La Frontera, P.O. Box 54-D, Temuco, Chile
d
Center for Optics and Photonics, Universidad de Concepcio
n, Casilla 4012, Concepcio
n, Chile
e
Departamento de Gen
etica Molecular y Microbiología, Facultad de Ciencias Biolo
gicas, Pontificia Universidad Cato

lica de Chile, P.O. Box 114-D, Santiago,
Chile
f
Departamento de Ciencias Químicas y Recursos Naturales, Facultad de Ingeniería y Ciencias, Universidad de La Frontera, P.O. Box 54-D, Temuco, Chile
g
Center of Plant, Soil Interaction and Natural Resources Biotechnology, Scientific and Technological Bioresource Nucleus (BIOREN), Universidad de La
Frontera, P.O. Box 54-D, Temuco, Chile

a r t i c l e i n f o a b s t r a c t

Article history: The impact of increased artificial UV-B radiation on photosynthetic performance, antioxidant and SOD
Received 10 March 2016 activities and molecular antioxidant metabolism responses in leaves of two highbush blueberry (Vacci-
Received in revised form nium corymbosum L. cv. Brigitta and Bluegold) genotypes was studied. Plants were grown in a solid
10 June 2016
substrate and exposed to 0, 0.07, 0.12 and 0.19 W m
2 of biologically-effective UV-B irradiance for 0
Accepted 14 June 2016
e72 h. Our findings show that net photosynthesis (Pn) decreased significantly in Bluegold, accompanied
Available online 16 June 2016
by a reduction in the effective quantum yield (ФPSII) and electron transport rate (ETR), especially at the
highest UV-B irradiation. On the other hand, Brigitta showed a better photosynthetic performance, as
Keywords:
UV-B radiation
well as a clear increment in the antioxidant activity response that could be associated with increased
Highbush blueberry superoxide dismutase activity (SOD) in the early hours of induced UV-B stress in all treatments. At the
Photochemical parameters molecular level, the expression of the three antioxidant genes evaluated in both genotypes had a similar
Radical scavenging activity tendency. However, ascorbate peroxidase (APX) expression was significantly increased (6-fold) in Bluegold
Antioxidant gene expression compared to Brigitta. Thus, the reduction of Pn concomitant with a lower photochemical performance
and a reduced response of antioxidant metabolism suggest that the Bluegold genotype is more sensitive
to UV-B radiation, while Brigitta appears to tolerate better moderate UV-B irradiance in a short-term
experiment.
© 2016 Elsevier Masson SAS. All rights reserved.

1. Introduction
Ozone (O3) is the main agent absorbing UV-B radiation in the
Earth’s atmosphere (Russell et al., 1996; Nowack et al., 2016), but
the indiscriminate use of anthropogenic pollutants such as chlo-
rofluorocarbon compounds (CFCs) and other antagonists, which
possess high stability, volatility and affinity with ozone, are causing
a depletion of the protective ozone layer. Due to this depletion, an
increase in ultraviolet-B radiation (UV-B; 280e315 nm) at the
* Corresponding author. P.O.Box 56-D, Temuco, Chile.
E-mail address: claudio.inostroza@uct.cl (C. Inostroza-Blancheteau).
Earth’s surface has been provoked. This has several implications
due to the potential damage and consequences for sustainable crop
production and natural plant ecosystems (Bjorn, 1996; Wargent
and Jordan, 2013). UV-B radiation can affect negatively the photo-
synthetic machinery, leading to the loss in integrity of the thylakoid
membranes, photosystem II (PSII) damage, a decrease in CO2
assimilation and oxygen evolution, among other effects (Hollo
sy,
2002; Kakani et al., 2003; Swarna et al., 2012; Rojas-Lillo et al.,
2014). Consequently, plant growth and development are negatively
affected (Wargent and Jordan, 2013). Likewise, a decrease in leaves
thickness in two deciduous species of Vaccinium (V. myrtillus and V.
uliginosum) under enhanced UV-B radiation have been reported
(Johanson et al., 19953). Recent studies in Vaccinium corymbosum L.

http://dx.doi.org/10.1016/j.plaphy.2016.06.019
0981-9428/© 2016 Elsevier Masson SAS. All rights reserved.
302 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309
showed that leaf thickness was reduced and a disorganization in
different cell layers exhibited by the sensitive cultivar under UV-B
exposition (Inostroza-Blancheteau et al., 2014). At the molecular
level, UV-B radiation damages nucleic acids, lipids and proteins,
and modifies the gene expression of some antioxidant enzymes in
plant species (Ries et al., 2000; Hollo
sy, 2002; Cantarello et al.,
2005). In this way, studies performed in Arabidopsis thaliana and
Nicotiana tabacum indicated that elevated UV-B radiation increased
the DNA recombination due to a strong induction of photolyase and
Rad51 gene expression (Ries et al., 2000). Under UV-B exposition,
Cantarello et al. (2005) reported an increase the expression levels of
peroxidase (POX), catalase (CAT) and phenylalanine ammonia lyase
(PAL) in Cucumis sativus plants. However, susceptibility to UV-B
radiation depends on a complex network of interactions in pro-
tection, damage, repair and transcriptional regulation, where the
plant responses depend on the intensity, dosage, time, genotype
and environmental factors (Kataria et al., 2014). In this sense, in
recent years, the identification of a specific UV-B photoreceptor UV
RESISTANCE LOCUS 8 (UVR8) in Arabidopsis thaliana has allowed
advances in the comprehension of this complex interplay. UVR8
mediates physiological responses such as inhibition of hypocotyl
growth and accumulation of UV-B absorbing compounds like
flavonol glycosides (Tilbrook et al., 2013) and molecular responses
like signaling pathways through the interaction with Constitutively
Photomorphogenic1 (COP1) a E3 ubiquitin ligase (Rizzini et al.,
2011; Heijde and Ulm, 2012). At the physiological level, excess
UV-B radiation decrease the photochemical efficiency (effective
quantum yield and electron transport rate) and net photosynthesis,
leading to a decrease in growth and crop productivity as reported in
Vigna ugniculata, Glycine max and Oryza sativa (Surabhi et al., 2009;
Feng et al., 2003; Wang et al., 2015). In Lactuca sativa seedlings, UV-
B reduces the processes of photosynthesis including CO2 assimila-
tion (Pn), stomatal conductance (gs) and transpiration rate (E)
(Basahi et al., 2014). UV-B radiation induces an enhancement of
reactive oxygen species (ROS), provoking oxidative stress at cellular
levels (Nawkar et al., 2013). In fact, the increase of hydrogen
peroxide (H2O2) is detected simultaneously with the inhibition of
photosynthesis by UV-B stress (Fujibe et al., 2004). Nonetheless,
plants subjected to different biotic and abiotic stresses develop
sophisticated antioxidant defense systems that include the pro-
duction of secondary metabolites and enzymes that protect against
oxidative damage (Cantarello et al., 2005; Agrawal and Mishra,
2009). The enzymatic system includes superoxide dismutase
(SOD, E.C.1.15.11) and ascorbate peroxidase (APX, E.C.1.11.1.11),
whose activities are increased in Glycine max in response to
oxidative stress (Xu et al., 2008). In addition, secondary metabolites
can protect the plant against oxidative damage by absorbing UV-B
(Burchard et al., 2000; Kolb et al., 2001). Studies performed in
Indigofera tinctora plants subjected to UV-B radiation showed an
increase of UV-absorbing compounds and activities of antioxidant
enzymes diminished oxidative damage in this species (Ravindran
et al., 2010). In this way, gene expression is also altered when
other plants are exposed to UV-B radiation (Brosche
and Strid,
2003). Several studies have described that UV-B stress increases
the gene expression levels of PHENYLALANINE LYASE (PAL),
ANTHOCYANIDIN SYNTHASE (ANS), PEROXIDASE (POX), CATALASE
(CAT) and some transcription factors such as MYBs, among others
(Ryan et al., 2002; Cantarello et al., 2005; Zoratti et al., 2014).
Nevertheless, little is known at molecular level about the tran-
scriptional regulation of these genes and their relationship with the
antioxidant metabolism in woody plant species in response to UV-B
radiation.
The aim of this work was to assess the impact of UV-B radiation
on photosynthetic performance (Pn, Fv/Fm, ФPSII, ETR and NPQ),
antioxidant and SOD activities and molecular responses (gene
expression analysis) in highbush blueberry genotypes (Vaccinium
corymbosum L.) in order to understand and establish resistance
strategies to UV-B radiation in this species.
2. Materials and methods
2.1. Plant material and growth conditions
We used two genotypes of highbush blueberry (cv. Brigitta and
Bluegold) that are widely cultivated in southern Chile. For this
study, we selected one-year-old plants of these genotypes grown in
a 3 L pot and solid substrate (1 oat straw: 1 shell sawdust: 1 pine
needles) under greenhouse conditions. These plants were provided
by the “San Luis” farm located in Lautaro, Araucanía region, Chile
(38 290 S, 72 230 W; 244 m above sea level). The plants were
maintained in a University greenhouse with similar controlled
conditions of 25/20  C (day/night), photoperiod of 16/8 h (light/
dark), 80% relative humidity and a photosynthetic active radiation
of around 500 mmol m
2 s
1 at midday, for two weeks. Then, the
plants were subjected to UV-B treatments and fully developed
leaves were used for all determinations.
2.2. UV-B radiation experiments
The experiment had a completely randomized design with 2
genotypes, 4 treatments and 5 biological replicates plants. The
genotypes were treated as follows: without UV-B radiation (
UV-B
control) or with a maximum of 0.07, 0.12 and 0.19 W m
2 of
biologically-effective UV-B irradiation for 0, 6, 24, 48 and 72 h. The
UV-B values of treatments represented biologically effective UV-B
radiation according to the generalized curve described by
Caldwell (1968). UV-B radiation (280e315 nm) was provided by
special UV-B lamps (Q-Panel 313, 40 W, Cleveland, OH, USA). With
the objective of preventing UV-C radiation, these lamps were
wrapped with pre-solarized 0.08 mm thick cellulose diacetate film
(Cadillac Plastic, Pensauken, NJ) and placed at a distance of 40 cm
from the top of the plants. The supplemental UV emitted by the Q-
panel tubes, and filtered through cellulose diacetate filter, consisted
of 77% UV-B and 23% UV-A. Thus, it is possible to ensure that the UV
radiation used mainly corresponds to biologically effective UV-B.
For simulating a daily course of UV-B radiation of the summer
season in southern Chile (38 460 S), plants were exposed from 9:00
to 20:00 h, with a maximum peak of irradiance at midday (Dura
n
et al., 2004; Huovinen et al., 2006). The lamps were set up with
timers (model Temp-24 H, Santiago, Chile). For each of the above
mentioned treatments, the lights of these lamps were left on,
increasing proportionally until reaching the maximum of UV-B
radiation. Then, the lights of the lamps were decreased propor-
tionally, until being completely turned off. In the greenhouse, the
photosynthetic photon flux density was around 500 mmol photons
m
2s
1 at midday, provided by metal halide lamps (400 W, Phillips,
Eindhoven, The Netherlands). The calculations for intensity, dura-
tion and UV-B irradiance were measured using two portable
spectroradiometers (Licor, 1800, Lincoln, NE, USA and BLUE-Wave,
StellarNet Inc., Florida, USA).
2.3. Net photosynthesis
Net photosynthesis (Pn) was determined between 9:00 to 10:00
in leaves from the second to the third shoot node. We used a
portable CO2 infrared gas analyzer (Licor LR6400, Lincoln, NE, USA)
equipped with a cuvette and a light source. This equipment controls
the light (300 mmol m
2 s
1), temperature (20  C), humidity and
CO2 concentration. External air with CO2 was used, obtaining a
concentration of 360 ppm, with a flow rate of 200 mL min
1 and
 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309
80% external relative humidity.
2.4. Chlorophyll a fluorescence parameters of PSII
Leaf chlorophyll a fluorescence from the second to the third
shoot node (similar to Pn) was determined using a portable pulse-
amplitude modulated fluorimeter (FMS 2; Hansatech Instruments,
Norfolk, UK) with the purpose of determining in vivo the photo-
chemical efficiency of PSII as described by Reyes-Díaz et al. (2009).
Maximum quantum yield (Fv/Fm), effective quantum yield (ФPSII),
and electron transport rate (ETR) were estimated according to
Genty et al. (1989), whereas nonphotochemical quenching (NPQ)
was estimated as described by Maxwell and Johnson (2000).
2.5. Radical scavenging activity
The radical scavenging activity (RSA) of leaves was performed
using the method of free radical 2.2-diphenyl-1-picrylhydrazyl
(DPPH) according to Chinnici et al. (2004), with some modifica-
tions. DPPH methods are widely used to evaluate antioxidant ac-
tivity in plants, due to its rapid, accurate, simple, and cheap assay
for measuring the ability of different compounds to act as free
radical scavengers or hydrogen donors (Prior et al., 2005). The
absorbance of this assay was measured at 515 nm in a spectro-
photometer (Thermo Scientific Spectronic Genesys 10 UVeVis
Scanning, Madison, WI, USA) using Trolox (Sigma Aldrich, St Louis,
MO, USA) as the standard.
2.6. Superoxide dismutase activity (SOD)
Samples were homogenized in 50 mM potassium phosphate
buffer (K2HPO4eKH2PO4, pH 7.0), using a mortar and pestle. Then,
the homogenate was centrifuged at 11000 g at 4  C for 15 min. The
supernatant was used as a crude enzyme extract. SOD activity (EC.
1.15.1.1) was assayed by measuring the inhibition of the photo-
chemical reduction of nitroblue tetrazolium (NBT) at 560 nm
(Donahue et al., 1997). One SOD unit was defined as the amount of
enzyme corresponding to 50% inhibition of NBT reduction. The
protein concentration was measured spectrophotometrically using
the method described by Bradford (1976), using bovine serum al-
bumin as a standard, and SOD activity was expressed on a per
protein basis.
2.7. Isolation of total RNA, and synthesis of cDNA
Total RNA was isolated from 300 mg of blueberry leaves, using
the method described for woody plants by Inostroza-Blancheteau
et al. (2011a). To eliminate any contamination with genomic DNA,
total RNA was treated with RNase-free DNase I (Invitrogen) and the
concentrations were measured spectrophotometrically using
ScanDrop (Thermo Scientific, Varioskan, Flash Multimode Reader,
Wilmington, USA). The purity of the total RNA was determined
using the A260/280 and A260/230 ratios given by the ScanDrop
software. Quality was tested visually by gel electrophoresis of de-
natured RNAs. Finally, the concentration was adjusted to 1.5 mg for
synthesis of the first strand of cDNA using 200 units of Superscript
II reverse transcriptase (Invitrogen) and 1 mL oligo-dT25 (700 ng).
2.8. Real-time quantitative PCR (RT-qPCR) analysis
RT-qPCR analysis of the antioxidant genes of V. corymbosum (Vc)
GLUTHATIONE S-TRANSFERASE (VcGST), ASCORBATE PEROXIDASE
(VcAPX) and ALDEHYDE DEHYDROGENASE (VcALDH) (Table 1), was
carried out using a Stratagene Mx 3000 pTM Real-Time PCR System
(Stratagene/Agilent, Santa Clara, CA, USA). The total reaction (25 mL)
303
contained 12.5 mL SYBR® Premix Ex Taq (TaKaRa, Shiga, Japan),
0.4 mL forward-specific primer, 0.4 mL reverse-specific primer and
2 mL cDNA template. DNA amplification was conducted using the
following thermocycling programme: 95  C for 10 min followed by
40 cycles at 95  C for 30 s, 58  C for 30 s and 72  C for 30 s. GLYC-
ERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (VcG3PDH) or MET-
ALLOTHIONEIN (VcMET) were used as reference genes as previously
described (Naik et al., 2007; Zifkin et al., 2012). The list of the
specific and reference genes and their respective primer pairs are
shown in Table 1. Furthermore, dissociation curves were generated
for each reaction to ensure specific amplification. Threshold values
(Ct), which represent the PCR cycle at which the fluorescence ex-
ceeds the threshold, were generated using the RQ Study software.
Ct values were employed to quantify relative gene expression using
the comparative 2
DDCt method described by Livak and Schmittgen
(2001).
2.9. Statistical analysis
For data analyses, the reported values correspond to the average
of three biological replicates for each genotype, time and treatment.
All data passed the normality and equal variance tests according to
the Kolmogorov-Smirnov test. Data were subjected to three- or
two-way analyses of variance (ANOVA). Means were compared
using Tukey’s Test at 95% confidence (p  0.05). All analyses were
performed with Sigma Stat 2.0 software (SPSS, Chicago, IL, USA).
3. Results
3.1. Photosynthetic performance in highbush blueberry under UV-B
radiation
Net photosynthesis (Pn) was differential between treatments
and genotypes exposed to UV-B radiation (Fig. 1). Bluegold showed
a severe reduction in almost all UV-B treatments, as only during the
first 6 h of the lowest UV-B exposure was Pn maintained, before
dropping dramatically, as observed at earlier timepoints with
higher UV-B irradiation. On the other hand, in Brigitta a significant
decrease was observed only at the highest UV-B irradiation
(0.19 W m
2). In the treatments at 0.07 W m
2, Pn was practically
maintained in Brigitta, while at 0.12 W m
2 a slight decrease was
observed, which converges with the control treatment by the end
of the experiment (Fig. 1).
The chlorophyll a fluorescence parameters indicated that Fv/Fm
did not change significantly (p > 0.05) under any of the UV-B ra-
diation treatments in both genotypes, compared with the control
plants (Table 2). The effective quantum yield of PSII (ФPSII) and
electron transport rate (ETR), showed a significant decrease
(p < 0.05) among times in both genotypes compared to the control
for each treatment. However, in Bluegold, a significant decrease
was observed at all times at the highest UV-B irradiance. On the
other hand, the non-photochemical quenching (NPQ) increased in
both genotypes, mainly at higher UV-B intensities (Table 2).
3.2. Effects of UV-B radiation on radical scavenging activity in
highbush blueberry
UV-B radiation increased the radical scavenging activity (RSA) in
both genotypes (Fig. 2). Brigitta increased significantly its RSA with
all UV-B treatments through the time compared to the control. A
statistically significant increase from the 6 and 48 h was observed
in Brigitta at 0.07 and 0.12 W m
2, while in Bluegold this increase
was exhibited only at lower UV-B exposure (Fig. 2). Interestingly,
the highest increment of RSA was observed in Bluegold at 72 h of
UV-B exposure at 0.19 W m
2 (Fig. 2).
304 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309

Table 1
Gene-specific primers used for gene expression analysis in highbush blueberry by RT-qPCR.

Gene Primers Sequence (50 /30 ) Reference

VcALDH Forward AGGCTCCAAAGGCTTCTACATCCA Inostroza-Blancheteau et al., 2011b

Reverse ACCGGGCCGAAGATTTCATCTTGT
VcAPX Forward CCACCATTCCCATACTTCTTC This work
Reverse CCCTTCTCACTGATCCTGTCT
VcGST Forward GAGGAAGTTGGGTCCATGAAAAT Inostroza-Blancheteau et al., 2011b
Reverse CGGCGGTAACTTGTC CTTGA
VcG3PDH Forward GGTTATCAATGATAGGTTTGGCA Zifkin et al., 2012
Reverse CAGTCCTTGCTTGATGGACC
VcMET Forward ACCCTGACATGAGCTTCTCG Naik et al., 2007
Reverse ACCCAAATCTCTGCTTGCTG

3.3. Effects of UV-B radiation on superoxide dismutase activity

A differential behavior was observed in SOD activity between

genotypes, mainly in the two higher UV-B treatments (Fig. 3). At
0.07 and 0.12 W m
2 a significant increase in activity in Brigitta
until 24 h of UV-B exposure was observed, followed by a steep
decline. Likewise, at the highest UV-B treatment, only until 6 h of
exposure was an increase in SOD activity found, before falling to-
wards the end of the experiment (Fig. 3). In the case of Bluegold, a
marked increment in SOD activity was observed at 6 h in the
highest UV-B irradiance compared to the control, activity which
then fell until 72 h (Fig 3). On the other hand, at 0.07 W m
2, higher
SOD activity was detected at 24 and 72 h of UV-B exposure in
Bluegold, whilst at 0.12 W m
2, a rise was observed only at 72 h
(Fig. 3).

3.4. Gene expression analysis of antioxidant metabolism in

highbush blueberry leaves subjected to UV-B exposure

We analyzed the transcriptional regulation of several antioxi-

dant metabolism genes exposed to different UV-B irradiance in
highbush blueberry leaves. The expression of VcGST, VcAPX and
VcALDH were studied using quantitative RT-PCR assays. The genes
encoding for VcALDH and VcGST were induced in both genotypes
mainly between 24 and 48 h of UV-B treatment compared to the
control. Nonetheless, this induction was a significant increment
compared to the control in all treatments at 48 h. Moreover, VcGST
showed higher expression levels at 0.12 W m2 at 24 and 48 h of UV-
B exposure in both genotypes, whereas in Bluegold this induction
was more marked at 24 h of UV-B stress. On the other hand, in
general the expression of VcAPX is observed after 6 h in both ge-
notypes mainly at the highest UV-B irradiance. In Bluegold, with
the exception at 24 h, a strong induction in the three UV-B treat-
ments that was more notable than in Brigitta (p  0.05) was
observed (Fig. 4).

4. Discussion

In our study, the short-term exposure of highbush blueberry to

UV-B radiation differentially affected photosynthetic performance
between genotypes (Fig. 1; Table 2). In several studies, it has been
reported that the photosynthetic apparatus is a key target for UV-B
radiation (He et al., 1993; Keiller et al., 2003; Tevini, 2004). In this
sense, Pn was significantly affected in Bluegold at all UV-B treat-
ments (p  0.05), which could negatively-impact the productivity
of this genotype because it has been reported that photosynthesis is
directly-linked to biomass production and plant yield (Kataria et al.,
2014). Similar results are reported by Rojas-Lillo et al. (2014), who
showed, in a combined experiment (UV-B and Mn) at longer term,
that UV-B radiation severely affects Pn and relative root growth of
highbush blueberry. In addition, in several species such as Triticum
Fig. 1. Net photosynthesis (Pn) of two highbush blueberry genotypes exposed for 72 h
to different biologically-effective UV-B irradiation (
UV-B or Control; þUV-B
0.07 W m
2; 0.12 W m
2 and 0.19 W m
2). (a) Brigitta cultivar and (b) Bluegold
cultivar. The values represent averages of three replicates ± s.e. Asterisks show dif-
ferences between the same treatment and the same genotype (p  0.05), compared to
the control, according to the Tukey test.
aestivum (Yuan et al., 1998), Vigna radiata (Agrawal et al., 2006), and
Glycine max (Liu et al., 2013), a reduction of growth by enhanced
UV-B radiation has been described. Our findings displayed that in
Bluegold, a significant decrease of Pn was observed in all UV-B
treatments, whereas in Brigitta, a decrease in Pn occurred only at
the highest UV-B irradiation. This suggests that Brigitta exhibits a
 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309 305

Table 2
Effect of UV-B radiation on maximum quantum yield (Fv/Fm), effective quantum yield (ФPSII), electron transport rate (ETR) and non-photochemical quenching (NPQ) in two
highbush blueberry genotypes. The values represent averages of ten measurements ± s.e. Different capital letters indicate significant differences (p  0.05) between treatments
at the same timepoint (72 h). Different lowercase letters indicate differences (p  0.05) between genotypes within the same treatment of UV-B. Asterisks (*) indicates dif-
ferences (p  0.05) between cultivars at the same UV-B treatments and timepoint.

Genotypes Photochemical parameters Time (h) Treatments UV-B radiation

0.07 W m
2 0.12 W m
2 0.19 W m
2

Brigitta Fv/Fm Control 0.84 ± 0.01Aa 0.83 ± 0.01Aa 0.84 ± 0.01Aa

6 0.84 ± 0.01Aa 0.83 ± 0.01Aa 0.84 ± 0.00Aa
24 0.85 ± 0.01Aa 0.83 ± 0.01Aa 0.85 ± 0.02Aa
48 0.86 ± 0.01Aa 0.82 ± 0.02Aa 0.85 ± 0.01Aa
72 0.84 ± 0.01Aa 0.84 ± 0.01Aa 0.85 ± 0.01Aa
ФPSII Control 0.42 ± 0.03Aa 0.43 ± 0.02Aa 0.41 ± 0.02Aa
6 0.31 ± 0.01Ab 0.32 ± 0.01Ab* 0.30 ± 0.04Ab*
24 0.31 ± 0.01Ab 0.34 ± 0.03Ab* 0.31 ± 0.03Ab*
48 0.31 ± 0.03Ab 0.32 ± 0.02Ab 0.31 ± 0.04Ab*
72 0.31 ± 0.05Ab 0.32 ± 0.05Ab 0.31 ± 0.03Ab*
ETR Control 53.4 ± 3.79Aa 53.9 ± 2.97Aa 52.0 ± 2.76Aa
6 39.3 ± 1.82Ab 40.3 ± 1.71Ab* 37.5 ± 4.54Ab*
24 39.3 ± 1.78Ab 42.8 ± 3.57Ab* 38.5 ± 3.48Ab*
48 38.9 ± 4.08Ab 40.8 ± 3.14Ab* 39.5 ± 4.54Ab*
72 39.2 ± 6.43Ab 39.8 ± 5.98Ab 38.5 ± 4.36Ab*
NPQ Control 2.10 ± 0.27Ab 2.15 ± 0.16Aa 2.14 ± 0.21Ab
6 3.06 ± 0.07Aa 2.48 ± 0.29Ba 3.00 ± 0.11Aa
24 3.06 ± 0.20Aa 2.47 ± 0.25Ba 3.03 ± 0.46Aa
48 3.03 ± 0.19Aa 2.37 ± 0.13Ba 3.03 ± 0.14Aa
72 3.00 ± 0.07Aa 2.32 ± 0.26Ba 3.02 ± 0.13Aa
Bluegold Fv/Fm Control 0.85 ± 0.00Aa 0.84 ± 0.01Aa 0.83 ± 0.01Aa
6 0.83 ± 0.02Aa 0.83 ± 0.01Aa 0.84 ± 0.02Aa
24 0.83 ± 0.01Aa 0.84 ± 0.22Aa 0.82 ± 0.01Aa
48 0.84 ± 0.03Aa 0.85 ± 0.01Aa 0.84 ± 0.01Aa
72 0.85 ± 0.03Aa 0.86 ± 0.03Aa 0.84 ± 0.02Aa
ФPSII Control 0.44 ± 0.03Aa 0.41 ± 0.02Aa 0.41 ± 0.03Aa
6 0.26 ± 0.03Ab 0.20 ± 0.03Ab 0.23 ± 0.01Ab
24 0.27 ± 0.02Ab 0.24 ± 0.03Ab 0.22 ± 0.02Ab
48 0.28 ± 0.04Ab 0.27 ± 0.02Ab 0.23 ± 0.02Ab
72 0.30 ± 0.05Ab 0.27 ± 0.02Ab 0.23 ± 0.02Bb
ETR Control 55.2 ± 3.95Aa 50.0 ± 2.78Aa 52.2 ± 3.46Aa
6 33.3 ± 3.63Ab 25.0 ± 3.24Ab 29.0 ± 1.81Ab
24 33.8 ± 2.56Ab 30.3 ± 3.78Ab 28.3 ± 2.13Ab
48 35.4 ± 5.32Ab 34.3 ± 2.49Ab 28.9 ± 2.35Ab
72 38.1 ± 6.20Ab 34.3 ± 5.46Ab 29.6 ± 2.46Ab
NPQ Control 2.30 ± 0.27Aa 2.31 ± 0.28Ab 2.27 ± 0.23Ab
6 2.19 ± 0.05Ba 3.17 ± 0.18Aa 3.12 ± 0.20Aa
24 2.09 ± 0.08Ba 3.06 ± 0.17Aa 3.05 ± 0.13Aa
48 2.08 ± 0.14Ba 3.03 ± 0.24Aa 3.01 ± 0.20Aa
72 2.11 ± 0.11Ba 3.07 ± 0.14Aa 3.03 ± 0.18Aa

better performance for CO2 assimilation under the lower UV-B
irradiation (Fig. 1). Our results showed also that the photochem-
ical parameters were more severely affected in Bluegold than in
Brigitta at the highest UV-B treatment, especially in the effective
quantum yield (ФPSII) (Table 2). Although in both genotypes a
decrease in ФPSII was found, this decrease was more significant in
Bluegold, which suggest that this genotype is more UV-B-sensitive
than Brigitta. Bearing in mind that ФPSII measures the quantity of
light that is absorbed by chlorophyll associated with PSII used in
photochemistry (Maxwell and Johnson, 2000), we could suggest
that Brigitta has a higher photochemical efficiency than Bluegold.
Furthermore, the maximum quantum yield of PSII (Fv/Fm) in both
genotypes was close to 0.84 (normal values for healthy leaves,
Bjo€ rkman and Demmig, 1987) and did not vary during the period of
UV-B exposure (Table 2). In this sense, despite the Fv/Fm was not
affected by UV-B radiation; we observed a severe decrease in the Pn
especially in Bluegold in all treatments. These results agree with
those of Tsonev et al. (2003) and Chen et al. (2005) for Phaseolus
vulgaris and Citrus reshni, respectively, whereby a decrease in Pn
occurs without changes in Fv/Fm. In fact, others authors have re-
ported that the fluorescence parameters are not necessarily asso-
ciated with the Pn (Goh et al., 1999). The diminished rate of CO2
fixation could be due to competing processes such as
photorespiration and the Mehler reaction (Asada, 2006). Moreover,
the electron transport rate (ETR) and non-photochemical quench-
ing (NPQ) were affected in both genotypes, although Bluegold
suffers a more significant fall in the ETR in the higher UV-B treat-
ments. This could indicate that in a long-term assay, these pa-
rameters may be more affected in this genotype. Our results on the
reduction of ETR and increased NPQ agree with reports in several
plant species (Gururani et al., 2015), and could be a strategy to
prevent photooxidation under different stress conditions.
Additionally, numerous reports have documented that UV-B
provokes an increase in cellular levels of ROS, leading to oxidative
damage enhancing the stress in all plant systems (Blokhina et al.,
2003). Nonetheless, plant cells have developed different strate-
gies such as enzymatic and non-enzymatic defense systems in or-
der to mitigate oxidative stress (Foyer et al., 1994). In our study,
both enzymatic and non-enzymatic antioxidant systems were
evaluated. Brigitta increased RSA at practically all times and UV-B
treatments. On the other hand, high SOD activity was observed
during the first hours of UV-B treatment in this genotype (Fig. 3).
However, in Bluegold this behavior was only observed at the
highest UV-B irradiation. In this sense, both RSA and SOD activity
increased in all treatments at early hours in Brigitta genotype.
These responses could lead to an efficient strategy of protection of
306 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309
Fig. 2. Radical scavenging activity (RSA) in leaves of two highbush blueberry geno-
types exposed for 72 h to different biologically-effective UV-B irradiation (
UV-B or
Control; þUV-B 0.07 W m
2; 0.12 W m
2 and 0.19 W m
2). (a) Brigitta cultivar and (b)
Bluegold cultivar. The values represent averages of three replicates ± s.e. Different
capital letters indicate differences (p  0.05) between UV-B treatments at the same
timepoint for the same genotype. Different lowercase show differences between
timepoint for the same treatment and genotype (p  0.05).
photosynthetic performance in the Brigitta genotype exposed to
UV-B. On the contrary, a reduced RSA and SOD activity was
observed at 0.12 W m
2 in Bluegold until 48 h of UV-B irradiation,
increasing significantly (p  0.05) only at the end of the experi-
ment. In addition, a high activity of SOD is widely recognized as the
first protection mechanism against ROS at cellular levels (Alscher
et al., 2002). Thus, the results obtained for Brigitta genotype sug-
gest that the SOD enzyme and RSA might mitigate the potential
damage provoked by UV-B exposure. Several reports have shown
that UV light enhances antioxidant enzyme activity such as SOD,
ascorbate peroxidase (APX), glutathione reductase (GR) and
guaiacol peroxidase (GPx) assayed in the leaves of Gossypium hir-
situm L. (Dehariya et al., 2011; Kataria et al., 2012). For this reason,
we speculate that increased UV-B irradiation induces more ROS,
triggering the synthesis of SOD and other antioxidant enzymes, as
well as non-enzymatic antioxidant compounds to maintain meta-
bolic stability in highbush blueberry plants, especially in the Bri-
gitta genotype. This assumption agrees with reported by Wang
et al. (2015), where indicated that enhanced UV-B radiation could
trigger de novo SOD synthesis and other antioxidant enzymes,
maintaining the metabolic stability of Oryza sativa plants. Gener-
ally, when plants are exposed to enhanced UV-B radiation, an in-
crease in soluble phenolic contents could protect photosynthetic
Fig. 3. Superoxide dismutase activity (SOD) in leaves of two highbush blueberry ge-
notypes exposed for 72 h to different biologically-effective UV-B irradiation (
UV-B or
Control; þUV-B 0.07 W m
2; 0.12 W m
2 and 0.19 W m
2). The values represent av-
erages of three replicates ± s.e. Asterisks show differences between the same treat-
ment and the same genotype (p  0.05), compared to the control, according to the
Tukey test.
performance against UV-B radiation, increasing the tolerance of
plants to this stress (Gitz et al., 2004). In our work, Brigitta showed
a better photosynthetic performance in comparison to Bluegold
due to a more efficient antioxidant system, which would mitigate
the damage caused by ROS in this genotype. In highbush blueberry,
the expression levels of ALDH, APX and GST were differentially
enhanced by UV-B treatment over time. These genes have been
associated with the antioxidant response in A. thaliana and Cra-
terostigma plantagineum subjected to different environmental
stresses such as: Cu2þ, NaCl, Cd2þ, oxidative stress, desiccation and
UV-B (Sunkar et al., 2003; Hideg et al., 2013). With respect to ALDH,
our findings revealed an up-regulation in its expression after 24 h
of UV-B exposure in both genotypes. However, the maximum peak
in the expression in all treatments was recorded in Brigitta. In plant
cells, ALDH expression helps abrogate oxidative stress and imparts
resistance against UV-B radiation (Yin et al., 2010). Likewise, APX
expression was significantly increased mainly at the highest UV-B
treatment in both genotypes. Nonetheless, in Bluegold this incre-
ment was around 6-fold more than in Brigitta, which was not
associated with UV-B resistance of this genotype. The expression of
GST was only significantly-induced in the 0.12 W m
2 treatment
after 24 h of exposure to UV-B, decreasing afterwards. In this sense,
 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309 307

Fig. 4. Effect of UV-B radiation on the expression of antioxidant genes of aldehyde dehydrogenase (ALDH), ascorbate peroxidase (APX) and glutathione S-transferase (GST) in leaves of
two highbush blueberry genotypes. Three independent biological replicates were performed. All data were normalized to VcG3PDH and VcMET expression levels. Asterisks show
differences between the same treatment and the same genotype (p  0.05), compared to the control according to the Tukey test.

it is known that one of the main consequences of UV-B radiation in
plants is the generation of ROS (Nawkar et al., 2013). This is a signal
for the expression of a set of genes, which include antioxidant
enzymes such as SOD, APX, GST, among others (Agrawal et al.,
2009). For example, in transgenic plants overexpressing GLUTA-
TIONE REDUCTASE (GR) was found an increased resistance to cad-
mium and UV-B stress. It is reported that GST and GR have great
potential for use in genetic engineering for resistance to multiple
stresses in plants (Le Martret et al., 2011). In this context, it has been
reported that in cell suspension cultures of Petroselinum crispum,
GSH and P. crispum GLUTHATIONE S-TRANSFERASE 1 (PcGST1) are
involved in a signal cascade induced by UV light to promote chal-
cone syntase (CHS) expression (Loyall et al., 2000). Also, PcGST1 is
rapidly and transiently induced by UV-B. This early induction
agrees with our results in blueberry plants where GST expression
was induced at the beginning of the experiment under UV-B radi-
ation (Fig. 4). Besides, the transient accumulation of PcGST1 tran-
scripts does not require intact de novo protein biosynthesis and is
stimulated by specific wavelengths that later induce the expression
of CHALCONE SYNTHASE (Loyall et al., 2000). Currently, considerable
evidence exists for altered expression of glutathione-related genes
across a range of UV treatments and exposure times.
In summary, increased UV-B irradiation cause significant
changes in physiological and antioxidant activities of highbush
blueberry as well as differential gene expression. The severe Pn
decreases in Bluegold were accompanied by a reduction in the ФPSII
and ETR, especially at the highest UV-B irradiation. This genotype
seems to show more sensitivity to UV-B radiation. On the other
hand, Brigitta showed a better photosynthetic performance and a
clear increment in the antioxidant activity response, which could be
associated with increased SOD activity in the early hours of the
exposure to UV-B stress in all treatments, suggesting a higher UV-B
resistance than Bluegold. Surprisingly, at the molecular level, the
expression of the three antioxidant genes evaluated in the leaves
was similar in both genotypes, with the exception of the expression
of APX that was significantly higher in Bluegold than in Brigitta.
However, APX expression in Bluegold was not reflected in a higher
UV-B resistant in relation with the other parameters evaluated.
Furthermore, the induction of the expression of APX was not
directly related to the UV-B resistance in highbush blueberry leaves.
Author’s contribution
CI-B, MR-D, MA designed and coordinated the experiment. CI-B
308 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309
formulated the manuscript and CI-B, MR-D, MA and PA-J revised
and corrected it. CI-B and MR-D carried out the physiological and
biochemical analyzes. PA contributed with measurements of UV-B
irradiance. RL performed the RT-qPCR analysis. CI-B and RL per-
formed statistical analysis.
Acknowledgements
This work was supported by the FONDECYT-POSTDOCTORAL
project N 3120248 and FONDECYT Nº1120917, CONICYT, Chile. We
thank Michael Handford, Universidad de Chile, for proof-reading
the manuscript.
References
Agrawal, S.B., Mishra, S., 2009. Effects of supplemental ultraviolet-B and cadmium
on growth, antioxidant and yield of Pisum sativus L. Ecotoxicol. Environ. Saf. 72,
610e618.
Agrawal, S.B., Rathore, D., Singh, A., 2006. Combined effects of enhanced ultraviolet-
B radiation and mineral nutrients on growth, biomass accumulation and yield
characteristics of two cultivars of Vigna radiata L. J. Environ. Biol. 27, 55e60.
Agrawal, S.B., Singh, S., Agrawal, M., 2009. Ultraviolet-B induced changes in gene
expression and antioxidants in plants. In: Jacquot, Jean-Pierre (Ed.), Adv. Bot.
Res., vol. 52, pp. 47e86.
Alscher, R.G., Erturk, N., Heath, L.S., 2002. Role of superoxide dismutases (SODs) in
controlling oxidative stress in plants. J. Exp. Bot. 53, 1331e1341.
Asada, K., 2006. Production and scavenging of reactive oxygen species in chloro-
plasts and their functions. Plant Physiol. 141, 391e396.
Basahi, J.M., Ismail, I.M., Hassan, I.A., 2014. Effects of enhanced UV-B radiation and
drought stress on photosynthetic performance of lettuce (Lactuca sativa L.
Romaine) plants. Ann. Res. Rev. Biol. 4, 1739e1756.
€ rkman, O., Demmig, B., 1987. Photon yield of O2 evolution and chlorophyll
Bjo
fluorescence characteristics at 77K among vascular plants of diverse origins.
Planta 170, 489e504.
Bjorn, L.O., 1996. Effects of ozone depletion and increased UV-B on terrestrial
ecosystems. Int. J. Environ. Stud. 51, 217e243.
Blokhina, O., Virolainen, E., Fagerstedt, K.V., 2003. Antioxidants, oxidative damage
and oxygen deprivation stress: a review. Ann. Bot. 91, 179e194.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein dye binding. Anal.
Biochem. 72, 248e254.
Brosche
, M., Strid, Å., 2003. Molecular events following perception of ultraviolet-B
radiation by plants. Physiol. Plant 117, 1e10.
Burchard, P., Bilger, W., Weissenbock, G., 2000. Contribution of hydroxycinnametes
and flavonoids to epidermal shielding of UV-A and UV-B radiation in devel-
oping rye primary leaves as assessed by ultraviolet-induced chlorophyll fluo-
rescence measurements. Plant Cell Environ. 23, 1373e1380.
Caldwell, M., 1968. Solar ultraviolet radiation as an ecological factor for alpine
plants. Ecol. Monogr. 38, 243e268.
Cantarello, C., Volpe, V., Azzolin, C., Bertea, C., 2005. Modulation of enzyme activ-
ities and expression of genes rekated to primary and secondary metabolism in
response to UV-B stress in cucumber (Cucumis sativus L.). J. Plant Interac. 1,
151e161.
Chen, L.S., Qi, Y.P., Liu, X.H., 2005. Effects of aluminum on light energy utilization
and photoprotective systems in citrus leaves. Ann. Bot. 96, 35e41.
Chinnici, F., Bendini, A.A., Gaiani, A., Riponi, C., 2004. Radical scavenging activities of
peels and pulps from cv. Golden delicious apples as related to their phenolic
composition. J. Agr. Food Chem. 52, 4684e4689.
Dehariya, P., Kataria, S., Pandey, G.P., Guruprasad, K.N., 2011. Assessment of impact
of solar UV components on growth and antioxidant enzyme activity in cotton
plant. Physiol. Mol. Biol. Plants 17, 223e229.
Donahue, J.L., Okpodu, C.M., Cramer, C.L., Grabau, E.A., Alscher, R.G., 1997. Responses
of antioxidants to paraquat in pea leaves. Relationships to resistance. Plant
Physiol. 113, 249e257.
Dur
an, P., Acevedo, P., Garrido, E., 2004. Un modelo de radiacio
n UV desde medidas
espectroradiome
tricas. Charlas de Física, Publicaciones del Departamento de
Física N 18. Universidad de Tarapaca, Arica, Chile, pp. 33e38.
Feng, H., An, L., Chen, T., Qiang, W., Xu, S., Zhang, M., Wang, X., Cheng, G., 2003. The
effect of enhanced ultraviolet B on growth, photosynthesis and stable carbon
isotope composition (d13C) of two soybean cultivars (Glycine max) under field
conditions. Environ. Exp. Bot. 49, 1e8.
Foyer, C.H., Lelandis, M., Kunert, K.J., 1994. Photooxidative stress in plants. Physiol.
Plant 92, 696e717.
Fujibe, T., Saji, H., Arakawa, K., Yabe, N., Takeuchi, Y., Yamamoto, K.T., 2004. A methyl
violagen-resistant mutant of Arabidopsis, which is allelic to ozone-sensitive
rcd1, is tolerant to supplemental Ultraviolet-B irradiation. Plant Physiol. 134,
275e285.
Genty, B., Briantais, J.M., Baker, N.R., 1989. The relationship between the quantum
yield of photosynthetic electron transport and quenching of chlorophyll fluo-
rescence. Biochim. Biophys. Acta 990, 87e92.
Gitz, D.C., Gitz, L.L., McClure, J.W., Huerta, A.J., 2004. Effects of a PAL inhibitor on
phenolic accumulation and UV-B tolerance in Spirodela intermedia (Koch.).
J. Exp. Bot. 398, 919e927.
Goh, C.H., Schreiber, U., Hedrich, R., 1999. New approach of monitoring changes in
chlorophyll a fluorescence of single guard cells and protoplasts in response to
physiological stimuli. Plant Cell Environ. 22, 1057e1070.
Gururani, M.A., Venkatesh, J., Ganesan, M., Strasser, R.J., Han, Y., Kim, J.I., Lee, H.Y.,
Song, P.S., 2015. In vivo assessment of cold tolerance through chlorophyll-a
fluorescence in transgenic zoysiagrass expressing mutant phytochrome A.
PLoS ONE 10, e0127200.
He, J., Huang, L.K., Chow, W.S., Whitecross, M.I., Anderson, J.M., 1993. Effects of
supplemental ultraviolet-B radiation on rice and pea plants. Aust. J. Plant
Physiol. 20, 129e142.
Heijde, M., Ulm, R., 2012. UV-B photoreceptor-mediated signalling in plants. Trends
Plant Sci. 17, 230e237.
Hideg, E., Jansen, M.A., Strid, A., 2013. UV-B exposure, ROS, and stress: inseparable
companions or loosely linked associates? Trends Plant Sci. 18, 107e115.
Hollo
sy, F., 2002. Effects of ultraviolet radiation on plant cells. Micron 33, 179e197.
Huovinen, P., Go
mez, I., Lovengreen, C., 2006. A five-year study of solar ultraviolet
radiation in Southern Chile (39 S): potential impact on physiology of coastal
marine algae? Photochem. Photobiol. 82, 515e522.
Inostroza-Blancheteau, C., Aquea, F., Reyes-Díaz, M., Alberdi, M., Arce-Johnson, P.,
2011a. Identification of aluminum-regulated genes by cDNA-AFLP analysis of
roots in two contrasting genotypes of highbush blueberry (Vaccinium cor-
ymbosum L. Mol. Biotechnol. 49, 32e41.
Inostroza-Blancheteau, C., Reyes-Díaz, M., Aquea, F., Nunes-Nesi, A., Alberdi, M.,
Arce-Johnson, P., 2011b. Biochemical and molecular changes in response to
aluminium-stress in highbush blueberry (Vaccinium corymbosum L.). Plant
Physiol. Biochem. 49, 1005e1012.
Inostroza-Blancheteau, C., Reyes-Díaz, M., Arellano, A., Latsague, M., Acevedo, P.,
Loyola, R., Arce-Johnson, P., Alberdi, M., 2014. Effects of UV-B radiation on
anatomical characteristics phenolic compounds and gene expression of the
phenylpropanoid pathway in highbush blueberry leaves. Plant Physiol. Bio-
chem. 85, 85e95.
Johanson, U., Gehrke, C., Bjo € rn, L.O., Callaghan, T.V., 1995. The effects of enhanced
UV-B radiation on the growth of dwarf shrubs in a subarctic heathland. Funct.
Ecol. 9, 713e719.
Kakani, V.G., Reddy, K.R., Zhao, D., Sailaja, K., 2003. Field crop responses to
ultraviolet-B radiation, a review. Agric. For. Meteorol. 120, 191e218.
Kataria, S., Dehariya, P., Guruprasad, K.N., Pandey, G.P., 2012. Effect of exclusion of
ambient solar UV-A/B components on growth and antioxidant response of
cotton (Gossypium hirsutum l.). Acta Biol. Crac. Ser. Bot. 54, 47e53.
Kataria, S., Jajoo, A., Guruprasad, K.N., 2014. Impact of increasing Ultraviolet-B (UV-
B) radiation on photosynthetic processes. J. Photochem. Photobiol. B 137,
55e66.
Keiller, D.R., Mackerness, S.A.H., Holmes, M.G., 2003. The action of a range of sup-
plementary ultraviolet (UV) wavelengths on photosynthesis in Brassica napus L.
in the natural environment, effects on PSII, CO2 assimilation and level of
chloroplast proteins. Photosynth. Res. 75, 139e150.
Kolb, C.A., Kaser, M.A., Kopeck, J., Zotz, G., Riederer, M., Pfundel, E.E., 2001. Effects of
natural intensities of visible and ultraviolet radiation on epidermal ultraviolet
screening and photosynthesis in grape leaves. Plant Physiol. 127, 863e875.
Le Martret, B., Poage, M., Shiel, K., Nugent, G.D., Dix, P.J., 2011. Tobacco chloroplast
transformants expressing genes encoding dehydroascorbate reductase, gluta-
thione reductase, and glutathione-S-transferase, exhibit altered anti-oxidant
metabolism and improved abiotic stress tolerance. Plant Biotechnol. J. 9,
661e673.
Liu, B., Liu, X.B., Li, Y.S., Herbert, S.J., 2013. Effects of enhanced UV-B radiation on
seed growth characteristics and yield components in soybean. Field Crops Res.
154, 158e163.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2
DDCT method. Methods 25, 402e408.
Loyall, L., Uchida, K., Braun, S., Furuya, M., Frohnmeyer, H., 2000. Glutathione and a
UV light-induced glutathione S-transferase are involved in signaling to chal-
cone synthase in cell cultures. Plant Cell 12, 1939e1950.
Maxwell, K., Johnson, G.N., 2000. Chlorophyll fluorescence practical guide. J. Expt.
Bot. 51, 659e668.
Naik, D., Dhanaraj, A.L., Arora, R., Rowland, L.J., 2007. Identification of genes asso-
ciated with cold acclimation in blueberry (Vaccinium corymbosum L.) using a
subtractive hybridization approach. Plant Sci. 173, 213e222.
Nawkar, G.M., Maibam, P., Park, J.H., Sahi, V.P., Lee, S.Y., Kang, C.H., 2013. UV-induced
cell death in plants. Int. J. Mol. Sci. 14, 1608e1628.
Nowack, P.J., Abraham, N.L., Braesicke, P., Pyle, J.A., 2016. Stratospheric ozone
changes under solar geoengineering: implications for UV exposure and air
quality. Atmos. Chem. Phys. 16, 4191e4203.
Prior, R.I., Wu, X., Schaich, K., 2005. Standardized methods for the determination of
antioxidant capacity and phenolics in foods and dietary supplements. J. Agric.
Food Chem. 53, 4290e4302.
Ravindran, K.C., Indrajith, A., Pratheesh, P.V., Sanjiviraja, K., Balakrishnan, V., 2010.
Effects of ultraviolet-B radiation on biochemical and antioxidant defence sys-
tems in Indigofera tinctoria L. seedling. Int. J. Eng. Sci. Tech. 2, 226e232.
Reyes-Díaz, M., Alberdi, M., Mora, M.L., 2009. Short-term aluminum stress differ-
entially affects the photochemical efficiency of photosystem II in highbush
blueberry genotypes. J. Am. Soc. Hortic. Sci. 134, 14e21.
Ries, G., Heller, W., Puchta, H., Sandermann, H., Seidlitz, H.K., Hohn, B., 2000.
 C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 107 (2016) 301e309
Elevated UV-B radiation reduces genome stability in plants. Nature 406,
98e101.
Rizzini, L., Favory, J.J., Cloix, C., Faggionato, D., O’Hara, A., Kaiserli, E., Baumeister, R.,
Scha€fer, E., Nagy, F., Jenkins, G.I., Ulm, R., 2011. Perception of UV-B by the Ara-
bidopsis UVR8 protein. Science 332, 103e106.
Rojas-Lillo, Y., Alberdi, M., Acevedo, P., Inostroza-Blancheteau, C., Rengel, Z.,
Mora, M.L., Reyes-Díaz, M., 2014. Manganese toxicity and UV-B radiation
differentially influence the physiology and biochemistry of highbush blueberry
(Vaccinium corymbosum L.) cultivars. Funct. Plant Biol. 41, 156e167.
Russell, J.M., Luo, M.Z., Cicerone, R.J., Deaver, L.E., 1996. Satellite conformation of the
dominance of chloroflurocarbons in the global stratospheric chlorine budget.
Nature 379, 526e529.
Ryan, K.G., Swinny, E.E., Markham, K.R., Winefield, C., 2002. Flavonoid gene
expression and UV photoprotection in transgenic and mutant Petunia leaves.
Phytochemistry 59, 23e32.
Sunkar, R., Bartels, D., Kirch, H., 2003. Overexpression of a stress-inducible aldehyde
dehydrogenase gene from Arabidopsis thaliana in transgenic plants improves
stress tolerance. Plant J. 35, 452e464.
Surabhi, G., Reddy, K., Singh, S., 2009. Photosynthesis, fluorescence, shoot biomass
and seed weight responses of three cowpea (Vigna unguiculata [L.] Walp) cul-
tivars with contrasting sensitivity to UV-B radiation. Environ. Exp. Bot. 66,
160e171.
Swarna, K., Bhanumathi, G., Murthy, S.D.S., 2012. Studies on the UV-B radiation
induced oxidative damage in thylakoid photofunctions and analysis of the role
of antioxidant enzymes in maize primary leaves. Bioscan 7, 609e610.
Tevini, M., 2004. Plant responses to ultraviolet radiation stress. In:
Papageorgiou, G.C., Govindjee (Eds.), Chlorophyll-a Fluorescence, A Signature of
Photosynthesis, Advances in Photosynthesis and Respiration, vol. 19. Springer,
Dordrecht, The Netherlands, pp. 605e621.
309
Tilbrook, K., Arongaus, A.B., Binkert, M., Heijde, M., Yin, R., Ulm, R., 2013. The UVR8
UV-B Photoreceptor, Perception, Signaling and Response. The Arabidopsis Book.
http://dx.doi.org/10.1199/tab.0164.
Tsonev, T., Velikova, V., Georgieva, K., Hyde, P.F., Jones, H.G., 2003. Low temperature
enhances photosynthetic down-regulation in French bean (Phaseolus vulgaris
L.) plants. Ann. Bot. 91, 343e352.
Wang, Y., Yu, G., Li, K., Wu, M., Ma, J., Xu, J., Chen, G., 2015. Responses of photo-
synthetic properties and antioxidant enzymes in high-yield rice flag leaves to
supplemental UV-B radiation during senescence stage. Environ. Sci. Pollut. Res.
22, 4695e4705.
Wargent, J.J., Jordan, B.R., 2013. From ozone depletion to agriculture, understanding
the role of UV radiation in sustainable crop production. New Phytol. 197,
1058e1076.
Xu, C., Natarajan, S., Sullivan, J., 2008. Impact of solar ultraviolet-B radiation on the
antioxudant defense system in soybean lines differing in flavonoid content.
Environ. Exp. Bot. 63, 39e48.
Yin, L., Mano, J., Wang, S., Tsuji, W., Tanaka, K., 2010. The involvement of lipid
peroxide-derived aldehydes in aluminum toxicity of tobacco roots. Plant
Physiol. 152, 1406e1417.
Yuan, L., Ming, Y., Xunling, W., 1998. Effects of enhanced ultraviolet-B radiation on
crop structure, growth and yield components of spring wheat under field
conditions. Field Crops Res. 57, 253e263.
Zifkin, M., Jin, A., Ozga, J.A., Zaharia, L.I., Schernthaner, J.P., Gesell, A., Abrams, S.R.,
Kennedy, J.A., Constabel, C.P., 2012. Gene expression and metabolite profiling of
developing highbush blueberry fruit indicates transcriptional regulation of
flavonoid metabolism and activation of abscisic acid metabolism. Plant Physiol.
158, 200e224.
Zoratti, L., Karppinen, K., Luengo-Escobar, A., Ha €ggman, H., Jaakola, L., 2014. Light-
controlled flavonoid biosynthesis in fruits. Front. Plant Sci. 5, 534.