Article

Cite This: Chem. Res. Toxicol. 2019, 32, 986−994 pubs.acs.org/crt

Effects of Silver Nanoparticle Exposure to the Testicular Antioxidant

System during the Prepubertal Rat Stage
Ingra Monique Duarte Lopes,† Isabela Medeiros de Oliveira,† Paula Bargi-Souza,‡,§
Mônica Degraf Cavallin,† Christiane Schineider Machado Kolc,§ Najeh Maissar Khalil,†
Sueli Peŕ cio Quinaí a,∥ Marco Aurelio Romano,† and Renata Marino Romano*,†
†
Laboratory of Reproductive Toxicology and Pharmaceutical Nanotechnology Laboratory, Department of Pharmacy and
∥
Laboratory of Trace and Instrumentation Analysis Group, Department of Chemistry, State University of Centro-Oeste
(UNICENTRO), Rua Simeão Camargo Varela de Sa, 03, 85040-080 Parana, Brazil
‡
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of São Paulo (USP), Av. Prof. Lineu Prestes,
1524, 05508-000 São Paulo, Brazil
Downloaded via UNIV FED DE SANTA MARIA on August 9, 2021 at 17:27:07 (UTC).

§
Department of Physiology and Biophysics, Institute of Biological Sciences, Federal University of Minas Gerais, Avenida Presidente
Antônio Carlos, 6627, 31270-901 Minas Gerais, Brazil

ABSTRACT: Humans and environments are constantly exposed to a wide range of commercial products containing silver
nanoparticles (AgNPs) in their composition. The hypothalamic-pituitary-testicular (HP-testicular) axis is sensitive to low doses
of AgNPs with repercussions in sperm functionality. The oxidative stress may be related to the pathogenesis of sperm alterations
because Ag+ ions are released from AgNPs in the corporal fluids. This study aimed to investigate the effects of AgNP exposure
in the antioxidant defense system. For this, the transcript expression and the activity of catalase (CAT), superoxide dismutase
(SOD), glutathione peroxidase (GPX), and glutathione reductase (GSR) enzymes were evaluated in the testis of rats exposed
during the prepubertal period to increasing doses of AgNPs (1.875, 3.75, 7.5, or 15 μg of AgNPs/kg). The higher dose of
AgNPs (15 μg/kg) investigated promoted increases in the activity of CAT, GPX, and GSR enzymes and in the expression of
Gpx4 var1 transcript. The exposure to 7.5 μg/kg of AgNP increased the Gpx4 var1 mRNA expression. In the group that
received 3.75 μg of AgNP/kg, the expression of Sod1, Gpx4 var2, and Gsr transcripts was decreased while the Gpx4 var1 mRNA
expression was augmented. The lower dose of AgNPs tested (1.875 μg/kg) increased the expression of Cat and Gpx4 var1
transcripts. Thus, AgNP alters the expression and activity of the antioxidant enzymes in a nonmonotonic dose−response curve
and directly or indirectly modulates the events related to spermatogenesis process.

■ INTRODUCTION
Among the nanomaterials, silver is commonly used in
nanoenabled products in the commercial market as water
filters, paints, toys, cosmetics, deodorants, toothbrushes,
clothes, plastics, detergents, disinfectants and biosensors.1,2
The silver nanoparticles (AgNPs) present a variable size (1 to
100 nm) and unique physical and chemical proprieties3 (shape,
catalytic and antimicrobial activity,4 and high electrical and
thermal conductivity5) that are useful in several fields of
science and technology.6,7 AgNPs are applied as coatings of
surgical instruments, prostheses, catheters, and bandages to
prevent bacterial infection, 8 incorporated into clothes
manufacturing as antiodor, antimicrobial, and antihumidity
agents in the textile area,9 and used during the assembly of
food packaging to preserve it from fungal contamination in the
food industry.10
Thus, humans and the environment are constantly exposed
to a wide range of commercial products containing residues of
AgNPs. AgNP release was observed from the use of
commercial AgNP-impregnated toothbrushes11 as well as
from infant products (plush toys, baby blankets, and sippy
cups).12 Despite the potential risk being considered minimal
for infants,13 the relevance of human exposure to low doses of
AgNP is a controversial issue because it may be released from
several products.14−19 Therefore, it is relevant to study possible
toxic effects of low doses of AgNPs after oral exposure.
Received: September 30, 2018
Published: April 1, 2019

© 2019 American Chemical Society 986 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology
The lrepubertal period is highly sensitive to the action of
chemical substances, which is why this period is chosen to
evaluate the action of endocrine-disrupting chemicals
(EDC).20 Puberty is initiated by a differential modulation of
GnRN neuron activity: before puberty, their activity is
predominantly inhibitory, while after puberty, it is mainly
excitatory.21 Prior to puberty, a pulsatile release of gonado-
tropin-releasing hormone (GnRH) is increased and stimula-
tory events lead to the release of lutropin (LH) and follitropin
(FSH) from the pituitary.21,22 The pulse frequency of GnRH
controls the differential expression of LH and FSH subunit
genes by the gonadotrophs.23,24 In the testis, LH stimulates the
synthesis of testosterone by binding to the luteinizing
hormone/choriogonadotropin receptor (LHCGR) in the
plasma membrane of Leydig cells.25 Spermatogenesis events
take place in the Sertoli cells and are mainly influenced by the
action of FSH, which binds to the follicle-stimulating hormone
receptor (FSHR) located at the plasma membrane of Sertoli
cells to perform its action.25 Besides Leydig and Sertoli cells,
the testis presents a large number of germ cells, and during
spermatogenesis the spermatogonial stem cells are differ-
entiated to spermatozoa.26
Our previous studies conducted on prepubertal male rats
showed that the hypothalamic-pituitary-testicular (HP-testicu-
lar) axis is highly sensitive to AgNPs.27 The reduction of sperm
production and integrity, the impairment of plasma and
acrosomal membranes, the decrease in mitochondrial activity,
and alterations on reproductive behavioral28 as well as the
deregulation of the HP-testicular axis were observed in rats
exposed to different doses of AgNPs during the prepubertal
period.29 The sperm alterations observed in these studies27−29
may be related to an imbalance between the generation and
removal of reactive oxygen species (ROS) in the testicular
environment.30
The FSH modulates gene expression, activates several
signaling pathways, and induces the secretion of many peptides
in Sertoli cells involved in the development of the proper
environment for the spermatozoa.31 For example, the cAMP
response element binding protein (CREB) is an important
transducer of FSH signals, and this family of transcription
factors is recognized to induce gene expression in response to a
number of signaling pathways induced by ROS over-
expression.31 Thus, the ROS formed during oxidative
phosphorylation in the Sertoli cells can act by stimulating
CREB, but its excess may also impair the functioning of the cell
and consequently and the efficiency of spermatogenesis.31 The
plasma membrane of spermatozoa has an elevated content of
polyunsaturated fatty acids (PUFA), making the spermatozoa
highly susceptible to oxidative damage by lipid peroxidation
(LPO).32 Besides, the high rates of cell division during the
spermatogenesis process contribute to the overexpression of
reactive oxygen species (ROS),30 which may impair the
functioning of the Sertoli cells and consequently the efficiency
of spermatogenesis.31 In contrast, the testes present a complex
antioxidant system that comprises vitamins, minerals, and
nonenzymatic and enzymatic defenses. The catalase (CAT),
superoxide dismutase (SOD), glutathione peroxidase (GPX),
and glutathione reductase (GSR) enzymes are associated with
the antioxidant process. SOD synthesizes H2O2 from O2− and
H+, and H2O2 is metabolized to H2O by CAT or in a greater
proportion by GPX. The GSR enzyme converts the reduced
form of glutathione (GSH) in oxidized glutathione (GSSG) in
987
Article
an NADPH-dependent way, maintaining the balance in the
GSH/GSSG ratio.31,33,34
The ROS generation induced by AgNP may be an important
mechanism of toxicity.35 Thus, the sperm alterations observed
in prepubertal rats exposed to low doses of AgNPs could be
related to an imbalance between the generation and removal of
reactive oxygen species (ROS) in the testicular environment.30
In this sense, considering the possibility of oral ingestion of
AgNPs released from commercial products,14−19 the bio-
accumulation of AgNPs in the testis,36−38 and the higher
susceptibility in the prepubertal period to the action of
EDCs,29 the present study aims to evaluate the consequences
of AgNP exposure to the testicular antioxidant defense system
by the evaluation of CAT, SOD, GPX, and GSR mRNA
expression and their enzymatic activity in animals exposed to
low doses of AgNPs during the prepubertal period.
■
EXPERIMENTAL PROCEDURES
Experimental Design. All procedures were performed in
accordance with the Conselho Nacional de Controle de Exper-
imentação Animal (CONCEA) and were approved by the
Universidade Estadual do Centro-Oeste Ethical Committee for
Animal Research (protocol 013/2015). The experimental design
was based on the prepubertal protocol from the Endocrine Disrupting
Screening and Testing Advisory Committee (EDSTAC) and includes
the evaluation of endocrine-disrupting chemical (EDC) effects in
prepubertal and puberty.20 Forty newly weaned male Wistar rats
(Rattus norvegicus var. albinus) were obtained from 20 pregnant
female rats that had been monitored from the 17th day of pregnancy
to determine the exact day of birth. On postnatal day 4 (PND4), the
10 litters were culled to 8 pups (4 males/4 females) per female and
kept at this size until weaning (PND21). On PND23, the male
offspring were divided into five groups containing eight animals each
and received either 0 (control), 1.875, 3.750, 7.500, or 15 μg of
AgNP/kg of body weight (BW) from PND23 to PND60 every other
day in a volume of 0.25 mL/100 g of BW by gavage in watery
suspension. (The control group received only water.) The doses used
in this study were the same as Cavallin et al.29 in which the lowest
observable adverse effect level (LOAEL) for sperm parameters was
1.875 μg/kg.
During all experiments, the animals were kept in groups of four,
housed in polypropylene cages (43 × 43 × 20 cm3) with a 5 cm layer
of wood shavings, fed commercial feed (Nuvilab CR- 1, Quimtia, PR,
Brazil), and allowed water ad libitum, under a 12:12 h/h dark/light
cycle in a temperature-controlled room (23 ± 1 °C).
Characterization of AgNPs. A solution containing silver
nanoparticles in a dispersion (60 nm particle size, 0.02 mg/mL in
aqueous buffer) was purchased from Sigma-Aldrich (catalog number
730815, Sigma-Aldrich Co., Seelze, Germany), and the dilution in
water was performed just before its use. The nanoparticle stability in a
watery suspension was analyzed by the mean particle size and
polydispersity index (PDI) by dynamic light scattering (DSL) (BIC
90 plus, Brookhaven Instruments Corp., USA) at a scattering angle of
90° and a temperature of 25 °C. The estimated particle diameter was
79.5 ± 11 nm, and the PDI was 0.575 ± 118.29
Tissue Collection. The animals were subjected to deep anesthesia
with ketamine and xylazine and euthanized by decapitation.
Afterward, the testis was immediately excised, frozen in liquid
nitrogen, pulverized in liquid nitrogen, and maintained at −80 °C
until further analysis of RT-qPCR, enzyme activity, and electro-
thermal atomic absorption spectrometry.
Reverse Transcription Followed by Real-Time Quantitative
PCR (RT-qPCR). Fifty milligrams of the pulverized testis was used for
total RNA extraction using Trizol reagent (Life Technologies,
Carlsbad, CA, USA). The total RNA concentration was measured
with a nanospectrophotometer (Kasvi, Brazil), and 2.5 μg was
transcript reversed by the GoScript reverse transcription system
(Promega, Madison, WI, USA) using oligo(dTs) according to the
DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology
Table 1. Primers Used for RT-qPCR Analyses
gene
Sod1
(superoxide dismutase 1)
Cat
(catalase)
Gpx4Var1
(glutathione peroxidase 4, transcript variant 1)
Gpx4Var2
(glutathione peroxidase 4, transcript variant 2)
Gsr
(glutathione-disulfide reductase)
Rpl19
(ribosomal protein L19)
a
F, forward; R, reverse.
manufacturer’s instructions. The catalase (Cat), superoxide dismutase
1 (Sod1), glutathione-disulfide reductase (Gsr), glutathione perox-
idase 4 variants 1 (Gpx4var1), and 2 (Gpx4var2) mRNA contents
were evaluated in testis, and the results obtained for each target gene
per sample were normalized with the mRNA expression of ribosomal
protein L19 (Rpl19), a housekeeping gene. The primer sequences and
the GenBank access number of target genes are shown in Table 1.
The product of reverse transcription (RT) was diluted according to
the efficiency curve for each gene investigated. Real-time PCR (RT-
qPCR) was performed in a 10 μL mix reaction volume containing the
product of RT, 2 μM primers [except for Gpx4var1 (1.6 μM) and Gsr
(1 μM)], 0.5 μM ROX dye, and 5 μL of Platinum SYBR Green qPCR
SuperMix-UDG (Life Technologies, Carlsbad, CA, USA). Amplifica-
tion was performed with the resources of an Applied Biosystems
StepOnePlus Real-Time PCR System (Applied Biosystems, Singa-
pore) and consisted of the following cycle conditions: 50 °C (2 min),
95 °C (2 min), and 40 cycles of 95 °C (15 s) and 60 °C (30 s). At the
end of the reaction, a melting curve was generated and analyzed to
confirm the specificity of the amplification. The average cycle
threshold (Ct) was automatically determined using StepOne
Software, v2.3 (Applied Biosystems), and quantification was
performed by the 2−ΔΔCt method, as described previously.39
Antioxidant Enzyme Activity in the Testis. Twenty-five
milligrams of pulverized testis was homogenized in 250 μL of 0.5
mM Tris-HCl at pH 7.4 and centrifuged at 590g for 10 min at 4 °C.
The supernatant was collected, and the total protein content was
estimated by the Bradford method.40 The supernatant was then used
in the enzymatic assays to determine the activities of superoxide
dismutase (SOD), glutathione peroxidase (GPX), glutathione
reductase (GSR), and catalase (CAT). These assays were performed
using the SpectraMax 190 Microplate Reader (Molecular Devices,
USA).
The SOD activity was estimated according to the degree of
formazan inhibition in the presence of xanthine and xanthine oxidase
and detected by spectrophotometry.41 Analyses were performed
following the manufacturing instructions for the RANSOD Kit
(Randox Laboratories Limited, Crumlin, Northern Ireland), and the
absorbance at 505 nm was measured. The SOD activity data was
obtained for each sample by the absorbance/protein concentration
ratio, and the results were expressed as units of SOD per microgram
of protein (U of SOD × μg of Ptn−1).
The GPX activity was measured using the RANSEL Kit as
previously described42 (Randox Laboratories Limited, Crumlin,
Northern Ireland). GPX catalyzes the GSH oxidation to GSSG in
the presence of cumene hydroperoxide. Reductions in absorbance
were measured at 340 nm. The GPX activity data was obtained for
each sample by the absorbance/protein concentration ratio, and the
results were expressed as units of GPX per liter per microgram of
protein (U of GPX × L−1 × μg of Ptn−1).
The GSR activity was measured following the manufacturer’s
instructions for the GLUTATHIONE REDUCTASE Kit (GLUT
Article
GenBank primer sequences (5′-3′)a
NM_017050.1 F:GGGGACAATACACAAGGCTGT
R:CATGCCTCTCTTCATCCGCT
NM_012520.2 F: TTCTTGTTCAGCGACCGAGG
R:GATGCCCTGGTCAGTCTTGTA
NM_017165.2 F:GCCGTCTGAGCCGCTTATT
R: ACGCAACCCCTGTACTTATCCA
NM_001039849.2 F: ACCTTCCCCAGACCAGCAAC
R: ACGCAACCCCTGTACTTATCCA
NM_053906.2 F: ACTTCTCACCCCAGTTGCG
R: CCACGGTAGGGATGTTGTCA
NM_031103.1 F: AATGAAACCAACGAAATCG
R: TCAGGCCATCTTTGATCAGCT
RED, Randox Laboratories Limited, Crumlin, Northern Ireland).
GSR catalyzes the GSSG reduction and the NADPH oxidation to
NADP+.43 The absorbance was measured at 340 nm. For each sample,
the absorbance value was divided by the protein concentration. The
results were expressed as units of GSR per liter per microgram of
protein (U of GSR × L−1 × μg of Ptn−1).
The catalase activity was measured by the H2O2 decay at 30 °C via
spectrophotometry at 240 nm, according to the method described.44
Briefly, 10 μL of protein lysate was added to 500 μL of H2O2 (20 mM,
pH 7.0) at 30 °C, and the absorbance was measured at 60 s in quartz
cuvetttes using a V-630 Bio UV−vis spectrophotometer (JASCO,
USA). The results were expressed by the change in absorbance (initial
minus final) per second per microgram of protein (ΔAbs × s−1× μg of
Ptn−1).
Electrothermal Atomic Absorption Spectrometry. The rat
testicle samples were prepared from acid digestion using concentrated
HNO3 as previously described.45 The determination of AgNP was
carried out with electrothermal atomic absorption equipment (model
AA 240Z) from Varian (Agilent) with Zeeman background correction
and a graphite tube atomizer (GT 120) linked to an autosampler
(PSD 120). The analysis was performed using one hollow cathode
lamp operating at 328.1 nm with a current of 4 mA and a slit width of
0.5 nm. Argon as an inert gas and pyrolytic graphite-coated graphite
tubes with longitudinal heating were used.
Statistical Analysis. The variables in question were first
submitted to Kolmogorov−Smirnov tests for normality and the
Bartlett test for homoscedasticity. The parameters were analyzed by
an ANOVA test followed by the post hoc Tukey HSD (honest
significance difference) test. The Pearson correlation coefficient (r)
was used to measure the linear correlation between the two variables:
mRNA expression and enzymatic activity. The linear correlation
ranges from −1 to 1 and was classified as strong (|r > 0.7|), moderate
(|0.5 < r < 0.7|), or weak (|0.3 < r < 0.5|). When |0 < r < 0.3|, there is
no linear correlation between the variables. All analysis was performed
with Statistica 7.0 (Statsoft Inc., Tulsa, OK, USA). Statistical
differences were considered to be significant when the value of P
was lower than 0.05. The values were expressed as means and the
standard error of the mean (±SEM).
■
RESULTS
Superoxide Dismutase. The expression of the Sod1
transcript was reduced in the animals that received 3.750 μg of
AgNP/kg of BW compared to the control and 1.875 μg of
AgNP/kg of BW groups. The SOD activity was not statically
altered by AgNP exposure. A weak linear correlation between
SOD transcript expression and activity according to the
Pearson correlation coefficient analysis (r = 0.36; P = 0.025)
was observed (Figure 1A−C).
Glutathione Peroxidase. The Gpx4 var1 mRNA content
was increased in all groups treated with AgNP compared to
988 DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology
Figure 1. Superoxide dismutase (A) mRNA relative expression, (B)
enzyme activity, and (C) correlation between mRNA and enzyme
activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500, or 15 μg
of AgNPs/kg of BW during the prepubertal period. Data are expressed
as the mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/
group; a and b differ, P < 0.05. Pearson correlation coefficient (r) =
0.36; P = 0.025. Sod1, Superoxide dismutase 1; SOD, superoxide
dismutase; Ptn, protein.
control animals, while the expression of the Gpx4 var2
transcript was reduced in the group that received 3.750 μg of
AgNP/kg of BW in comparison to all others groups (Figure
2A,B). The GPX activity was increased only in the group that
received 15 μg of AgNP/kg of BW compared to all other
groups (Figure 2C). There was no statistical significance (P >
0.05) in the Pearson correlation coefficient analysis for the
comparisons between Gpx4 var. 1 or Gpx4 var. 2 and GPX
activity (data not shown).
Glutathione Reductase. The Gsr mRNA content was
reduced in the group that received 3.750 μg of AgNP/kg of
BW in comparison to the control and 1.875 μg of AgNP/kg of
BW (Figure 3A). The GSR activity was reduced in the group
that received 3.750 μg of AgNP/kg of BW compared to 1.875
and 15 μg of AgNP/kg of BW groups and increased in the
989
Article
Figure 2. Glutathione peroxidase 4 mRNA relative expression (A)
transcript variant 1, (B) transcript variant e, and (C) enzyme activity
in male Wistar rats exposed to 0, 1.875, 3.750, 7.500, or 15 μg of
AgNPs/kg of BW during the prepubertal period. Data are expressed as
mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/group; a
and b differ, P < 0.05. Gpx4var1, Glutathione peroxidase 4 transcript
variant 1; Gpx4var2, glutathione peroxidase 4 transcript variant 2;
GPX, glutathione peroxidase; Ptn, protein.
group that received 15 μg of AgNP/kg of BW in comparison to
the control and 3.750 and 7.500 μg of AgNP/kg of BW (Figure
3B). The Pearson correlation coefficient (r) between GSR
transcript expression and activity was 0.49 (P = 0.002) (Figure
3C).
Catalase. The expression of the Cat transcript was
increased in the group that received 1.875 μg of AgNP/kg of
BW compared to the control and 15 μg of AgNP/kg of BW
groups (Figure 4A). The CAT activity was increased in the
group that received 15 μg of AgNP/kg of BW in comparison to
control and 3.750 μg of AgNP/kg of BW groups (Figure 4B).
The Pearson correlation coefficient (r) between CAT
transcript expression and activity was 0.37 (P = 0.02) (Figure
4C).
DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

Figure 3. Glutathione reductase (A) mRNA relative expression, (B)

enzyme activity, and (C) correlation between mRNA and enzyme
activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500, or 15 μg
of AgNPs/kg of BW during the prepubertal period. Data are expressed
as the mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/
group; a, b and g, h differ, P < 0.05. Pearson correlation coefficient (r)
= 0.39; P = 0.002. Gsr, Glutathione reductase; GSR, glutathione
reductase; Ptn, protein.
Quantification of AgNP in the Testis. AgNP was
detected in the testis of rats treated with doses higher than
3.750 μg/kg of BW. The amount of AgNP (ng/g of testis)
detected is shown in Table 2.
Figure 4. Catalase (A) mRNA relative expression, (B) enzyme
activity, and (C) correlation between mRNA and enzyme activity in
male Wistar rats exposed to 0, 0, 1.875, 3.750, 7.500, or 15 μg of
AgNPs/kg of BW during the prepubertal period. Data are expressed as
the mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/
group; a and b differ, P < 0.05. Pearson correlation coefficient (r) =
0.37; P = 0.02. Cat, Catalase; CAT, catalase; Abs, absorbance; Ptn,
protein.
Table 2. Quantification of AgNP in the Testis

■
dose AgNP (μg/kg BW) detected AgNP (ng/g testis)
0.000 <detection limit
DISCUSSION 1.875 <detection limit
The puberty period is marked by changes in hypothalamic 3.750 2.110 ± 1.30
function. Before puberty, the tonus controlling the GnRH 7.500 3.288 ± 0.80
neuron activity is predominantly inhibitory, and during 15.000 5.450 ± 0.07
puberty, the change to excitatory tonus is associated with the
increase in the pulsatile GnRH release and secretion of
pituitary gonadotrophins, LH and FSH, which in turn trigger The puberty period is sensitive to the action of AgNPs,27−29
their actions in testicular cells and initiate the process of and the induction of oxidative stress is also a factor related to
spermatogenesis.21,22 The spermatogenesis process involves the toxicity of AgNPs.48−50 Indeed, it has been shown that the
the intense production of ROS,31,46 and several fertility levels of AgNPs remain elevated in the testis several weeks
problems are associated with failures in ROS removal.30,32,47 after the end of exposure,36−38 demonstrating a particular
990 DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology
susceptibly of gonadal tissue to AgNP actions. Corroborating
these findings, a range from 2.11 to 5.45 ng of AgNPs was
detected per gram of testis of animals treated with 3.750−
15.000 μg of AgNP/kg of BW. The objective of this study was
to evaluate whether the exposure to low doses of AgNPs
during the prepubertal phase alters the expression and activity
of the enzymes catalase (CAT), superoxide dismutase (SOD),
glutathione peroxidase (GPX), and glutathione reductase
(GSR) in the testes of rats, which could explain the
impairment previously observed in the spermatogenesis
induced by AgNPs.
AgNP altered the expression and activity of enzymes related
to the testicular antioxidant system without following a classic
dose−response pattern. The catalase transcript showed the
maximum alteration in the group treated with the lower dose
of AgNP (1.875 μg/kg), while the GSR activity was reduced in
animals treated with 3.750 μg of AgNP/kg and increased in the
group that received 15 μg of AgNP/kg. In a dose−response
curve, the effects observed at the point where the signal of the
slopes are inverted (negative to positive and vice versa) are
classified as a nonmonotonic dose−response curve and are
related to the occupation kinetics and receptor saturation.51
This pattern of response for certain chemical compounds
observed in the experimental model hinders the establishment
of important toxicological parameters such as LOAEL (lowest
observed adverse effect level) and NOAEL (no observed
adverse effect level, a higher dose that does not result in a toxic
effect).51−55
The testes are highly dependent on oxygen for the
spermatogenesis process and very susceptible to the ROS
toxic effects.56 The plasma membrane of spermatozoa has an
elevated content of polyunsaturated fatty acids (PUFA) that
are involved with the events associated with the fertilization
process. However, the high levels of PUFA cause the
spermatozoa to be highly susceptible to oxidative damage by
lipid peroxidation (LPO).32 In human spermatozoa, the
superoxide radical (O2−.) is the predominant ROS57 and
comes mainly from the mitochondrial electron transport
chain.56 O2−. is a potent initiator of the LPO cascade which
can lead to membrane rupture and loss of sperm function.58 In
this study, all groups showed alterations in the expression and/
or activity of antioxidant enzymes investigated; however,
considering that lower doses of AgNP (3.750 and 1.875 μg/
kg) do not alter the sperm functionality,29 we assume that the
generation and removal dynamics of ROS is modulated only by
the higher doses of AgNPs.
The excess in testicular ROS is one of the main factors in the
induction of germ cell apoptosis.46 The testes present an
efficient antioxidant enzyme system and also high concen-
trations of antioxidants such as reduced glutathione (GSH),
ascorbic acid, and vitamin E,31,57,59 which protect the germ
cells from DNA damage.60,61 The first enzyme involved in the
protection against oxidative damage is SOD, which catalyzes
the reaction between O2−. and H+ to produce O2 and H2O2.62
SOD activity is stimulated by the increase in the oxygen
pressure62 and inhibited by elevated H2O2 concentra-
tion.63H2O2 is then metabolized by CAT or, to a greater
extent, by GPX. GSR is a NADPH-dependent enzyme
responsible for reducing GSH to oxidized glutathione
(GSSG) while maintaining the GSH/GSSG ratio.31,33,34
Although the activity of CAT, GPX, and GSR enzymes was
increased in the group treated with 15 μg of AgNP/kg, these
alterations were not sufficient to prevent mitochondrial
991
Article
damage in the midpiece of spermatozoa and the loss of
capacity to produces energy needed for flagellum movement29
impairing the movement of the sperm through the female
genital tract.64
It is possible to assume that 15 μg of AgNP/kg directly
triggers a toxic effect on sperm mitochondria and the plasma
membrane, as observed in cultured neuronal cells.65 In these
cells, AgNPs alters the electron transport chain in the
mitochondrial membrane and its permeability and protein
composition, reducing the mitochondrial function.65 In this
study, treatment with 15 μg of AgNP/kg also increased the
Gpx4 var1 transcript expression. The translation of variant 1 of
Gpx4 results in the long form of GPX, also known as
phospholipid hydroperoxide glutathione peroxidase (phGPx),
which has an affinity for mitochondria.66 Thus, in addition to
the positive effect on GPX enzyme activity, AgNP also
increases the transcription of the gene that codifies the
glutathione peroxidase enzyme. All of these data together
indicate that the physiological mechanisms triggered in the
testicular cells are not sufficient to prevent the oxidative
damage induced by AgNP (at 15 μg/kg).
The group treated with 7.500 μg of AgNP/kg presented only
an increase in the Gpx4 var1 expression, without alterations in
the GPX activity, despite the reduced mitochondrial activity of
the sperm.29 Previously, we showed that AgNP, in this
intermediate dose, increases the serum estradiol concentra-
tion.29 The exogenous administration of estradiol stimulates
the testicular LPO and reduces the SOD and CAT activities,67
which in turn could alter the generation and removal of ROS.
Thus, AgNP (at 7.500 μg/kg) would be exerting an indirect
effect on the testicular antioxidant system. Interestingly, GPX
was the only enzyme that did not present a correlation
between the transcript content and enzymatic activity. In fact,
Gpx4 var1 encodes the gene for phGPx, and besides its action
as an antioxidant enzyme during spermatogenesis, phGPx was
described as a structural protein in the mature spermatozoa,
constituting about 50% of the midpiece and being enzymati-
cally inactive under this condition.68 This functional change is
synchronized with the relocation of phGPx from the matrix to
the intermembrane space of mitochondria during spermato-
genesis.69
The groups that received the lowest doses of AgNP did not
show spermatic functional changes,29 indicating that the fine
modulation of the antioxidant system was sufficient to
maintain the integrity of the spermatozoa membrane. The
treatment with 3.750 μg of AgNP/kg reduced the Sod1, Gpx4
var2, and Gsr expression and the GSR activity, while the
expression of Gpx4 var1 was increased. The group that
received 1.875 μg of AgNP/kg showed an increase in the
mRNA content of Cat and Gpx4 var1. Gpx4 var1, as previously
mentioned, has two important roles: (a) acting as an
antioxidant enzyme and (b) being a structural protein of the
mitochondria in the midpiece of sperm. Thus, the increase in
Gpx4 var1 mRNA expression may influence the antioxidant
defense system as well as the mitochondrial composition in the
midpiece of the sperm. Gpx4 var2 encodes specific sperm
nuclei glutathione peroxidase (snGPx), which is related to the
chromatin condensation in the final stages of spermatogenesis
by cross-linked protamine thiols.70 In this sense, the reduction
of Gpx4 var2 transcription could impair the DNA integrity in
the chromatin, which in turn could increase the vulnerability of
the offspring to xenobiotic agents, thus affecting its health.71
DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology
The methods applied in these studies were not able to evaluate
whether the AgNPs induced changes in the chromatin.
In this study, we have used low doses of AgNP in an attempt
to compare to the unintentional ingestion of AgNPs residues
released from commercial products. Recent studies have used
very high doses of AgNPs to assess the possible effects on the
antioxidant system, and the results were variable. A single
intraperitoneal dose of 5000 μg of AgNP/kg (2666-fold >
1875) administered to rats reduced the SOD, CAT, and GPX
activities in testis72 and liver,73 while higher doses (100 000
and 200 000 μg of AgNP/kg/90 days, 53 333- and 106 666-
fold > 1875, respectively) increased the SOD and CAT
activities in the liver of rats.74 However, the SOD, CAT, and
GPX activities were not altered in the serum of male Wistar
rats exposed to 5000 or 10 000 μg of AgNP/kg/28 days.75
■
CONCLUSIONS
Exposure to low doses of AgNPs during the prepubertal phase
alters the expression and the activity of catalase, superoxide
dismutase, glutathione peroxidase, and glutathione reductase
enzymes in the testes of rats, directly or indirectly affecting the
events related to the spermatogenesis process. The response to
different AgNP doses did not fit a classic dose−response
pattern, characterizing a nonmonotonic dose−response curve.
■
AUTHOR INFORMATION
Corresponding Author
*Phone: 55 42 36298184. E-mail: renataromano20@gmail.
com.
ORCID
Paula Bargi-Souza: 0000-0001-7746-0636
Funding
This study was supported by Capes (Coordenação de
Aperfeiç o amento de Pessoal de Nivel Superior,
23038.009865/2013-32). I.M.D.L. was the recipient of a
scholarship from Fundaçaõ Araucária.
Notes
The authors declare no competing financial interest.
■
REFERENCES
(1) Vance, M. E., Kuiken, T., Vejerano, E. P., McGinnis, S. P.,
Hochella, M. F., Jr., Rejeski, D., and Hull, M. S. (2015)
Nanotechnology in the real world: Redeveloping the nanomaterial
consumer products inventory. Beilstein J. Nanotechnol. 6, 1769−1780.
(2) WWICS, W. W. I. C. f. S. Project on Emerging Nanotechnologies:
Nanotechnology, 2018, https://www.wilsoncenter.org/publication-
series/project-emerging-nanotechnologies.
(3) Wei, L., Lu, J., Xu, H., Patel, A., Chen, Z.-S., and Chen, G.
(2015) Silver nanoparticles: synthesis, properties, and therapeutic
applications. Drug Discovery Today 20, 595−601.
(4) Xu, R., Wang, D., Zhang, J., and Li, Y. (2006) Shape-dependent
catalytic activity of silver nanoparticles for the oxidation of styrene.
Chem. - Asian J. 1, 888−893.
(5) Alshehri, A. H., Jakubowska, M., Mlozniak, A., Horaczek, M.,
Rudka, D., Free, C., and Carey, J. D. (2012) Enhanced electrical
conductivity of silver nanoparticles for high frequency electronic
applications. ACS Appl. Mater. Interfaces 4, 7007−7010.
(6) Tran, Q. H., et al. (2013) Silver nanoparticles: synthesis,
properties, toxicology, applications and perspectives. Adv. Nat. Sci.:
Nanosci. Nanotechnol. 4, 033001.
(7) Keat, C. L., Aziz, A., Eid, A. M., and Elmarzugi, N. A. (2015)
Biosynthesis of nanoparticles and silver nanoparticles. Bioresources and
Bioprocessing 2, 47.
992
Article
(8) Shenava, A., Sharma, S., Shetty, V., and Shenoy, S. (2015) Silver
nanoparticles: A boon in clinical medicine. Journal of Oral Research
and Review 7, 35−38.
(9) Velmurugan, P., Lee, S. M., Cho, M., Park, J. H., Seo, S. K.,
Myung, H., Bang, K. S., and Oh, B. T. (2014) Antibacterial activity of
silver nanoparticle-coated fabric and leather against odor and skin
infection causing bacteria. Appl. Microbiol. Biotechnol. 98, 8179−8189.
(10) Kumari, A., and Yadav, S. K. (2014) Nanotechnology in agri-
food sector. Crit. Rev. Food Sci. Nutr. 54, 975−984.
(11) Mackevica, A., Olsson, M. E., and Hansen, S. F. (2017) The
release of silver nanoparticles from commercial toothbrushes. J.
Hazard. Mater. 322 (Part A), 270−275.
(12) Quadros, M. E., Pierson, R., Tulve, N. S., Willis, R., Rogers, K.,
Thomas, T. A., and Marr, L. C. (2013) Release of Silver from
Nanotechnology-Based Consumer Products for Children. Environ. Sci.
Technol. 47, 8894−8901.
(13) Pang, C., Hristozov, D., Zabeo, A., Pizzol, L., Tsang, M. P.,
Sayre, P., and Marcomini, A. (2017) Probabilistic approach for
assessing infants’ health risks due to ingestion of nanoscale silver
released from consumer products. Environ. Int. 99, 199−207.
(14) Benn, T., Cavanagh, B., Hristovski, K., Posner, J. D., and
Westerhoff, P. (2010) The release of nanosilver from consumer
products used in the home. J. Environ. Qual. 39, 1875−1882.
(15) Benn, T. M., and Westerhoff, P. (2008) Nanoparticle silver
released into water from commercially available sock fabrics. Environ.
Sci. Technol. 42, 4133−4139.
(16) Echegoyen, Y., and Nerin, C. (2013) Nanoparticle release from
nano-silver antimicrobial food containers. Food Chem. Toxicol. 62,
16−22.
(17) Farkas, J., Peter, H., Christian, P., Gallego Urrea, J. A.,
Hassellov, M., Tuoriniemi, J., Gustafsson, S., Olsson, E., Hylland, K.,
and Thomas, K. V. (2011) Characterization of the effluent from a
nanosilver producing washing machine. Environ. Int. 37, 1057−1062.
(18) Rigo, C., Roman, M., Munivrana, I., Vindigni, V., Azzena, B.,
Barbante, C., and Cairns, W. R. (2012) Characterization and
evaluation of silver release from four different dressings used in
burns care. Burns: journal of the International Society for Burn Injuries
38, 1131−1142.
(19) Tulve, N. S., Stefaniak, A. B., Vance, M. E., Rogers, K., Mwilu,
S., LeBouf, R. F., Schwegler-Berry, D., Willis, R., Thomas, T. A., and
Marr, L. C. (2015) Characterization of silver nanoparticles in selected
consumer products and its relevance for predicting children’s
potential exposures. Int. J. Hyg. Environ. Health 218, 345−357.
(20) Stoker, T. E., Parks, L. G., Gray, L. E., and Cooper, R. L. (2000)
Endocrine-disrupting chemicals: prepubertal exposures and effects on
sexual maturation and thyroid function in the male rat. A focus on the
EDSTAC recommendations. Endocrine Disrupter Screening and
Testing Advisory Committee. Crit. Rev. Toxicol. 30, 197−252.
(21) Abreu, A. P., and Kaiser, U. B. (2016) Pubertal development
and regulation. Lancet Diabetes Endocrinol. 4, 254−264.
(22) Prevot, V. (2015) Chapter 30 - Puberty in Mice and Rats. In
Knobil and Neill’s Physiology of Reproduction (Plant, T. M., and
Zeleznik, A. J., Eds.) , 4th ed., pp 1395−1439, Academic Press, San
Diego.
(23) Kaiser, U. B., Jakubowiak, A., Steinberger, A., and Chin, W. W.
(1997) Differential Effects of Gonadotropin-Releasing Hormone
(GnRH) Pulse Frequency on Gonadotropin Subunit and GnRH
Receptor Messenger Ribonucleic Acid Levels in Vitro 1. Endocrinology
138, 1224−1231.
(24) Nagirnaja, L., Rull, K., Uusküla, L., Hallast, P., Grigorova, M.,
and Laan, M. (2010) Genomics and genetics of gonadotropin beta-
subunit genes: unique FSHB and duplicated LHB/CGB loci. Mol.
Cell. Endocrinol. 329, 4−16.
(25) O’Donnell, L., Meachem, S. J., Stanton, P. G., and McLachlan,
R. I. (2006) Chapter 21 - Endocrine Regulation of Spermatogenesis.
In Knobil and Neill’s Physiology of Reproduction (Neill, J. D., Plant, T.
M., Pfaff, D. W., Challis, J. R. G., de Kretser, D. M., Richards, J. S., and
Wassarman, P. M., Eds.) 3rd ed., pp 1017−1069, Academic Press, St.
Louis.
DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology
(26) Valli, H., Phillips, B. T., Orwig, K. E., Gassei, K., and Nagano,
M. C. (2015) Chapter 15 - Spermatogonial Stem Cells and
Spermatogenesis, Knobil and Neill’s Physiology of Reproduction 4th
ed., pp 595−635, Academic Press, San Diego.
(27) Sleiman, H. K., Romano, R. M., Oliveira, C. A., and Romano,
M. A. (2013) Effects of prepubertal exposure to silver nanoparticles
on reproductive parameters in adult male Wistar rats. J. Toxicol.
Environ. Health, Part A 76, 1023−1032.
(28) Mathias, F. T., Romano, R. M., Kizys, M. M., Kasamatsu, T.,
Giannocco, G., Chiamolera, M. I., Dias-da-Silva, M. R., and Romano,
M. A. (2015) Daily exposure to silver nanoparticles during
prepubertal development decreases adult sperm and reproductive
parameters. Nanotoxicology 9, 64−70.
(29) Cavallin, M. D., Wilk, R., Oliveira, I. M., Cardoso, N. C. S.,
Khalil, N. M., Oliveira, C. A., Romano, M. A., and Romano, R. M.
(2018) The hypothalamic-pituitary-testicular axis and the testicular
function are modulated after silver nanoparticle exposure. Toxicol. Res.
7, 102−116.
(30) Aitken, R. J., Gibb, Z., Baker, M. A., Drevet, J., and
Gharagozloo, P. (2016) Causes and consequences of oxidative stress
in spermatozoa. Reprod., Fertil. Dev. 28, 1−10.
(31) Guerriero, G., Trocchia, S., Abdel-Gawad, F. K., and Ciarcia, G.
(2014) Roles of reactive oxygen species in the spermatogenesis
regulation. Front Endocrinol. 5, 56.
(32) Aitken, R. J. (2017) Reactive oxygen species as mediators of
sperm capacitation and pathological damage. Mol. Reprod. Dev. 84,
1039−1052.
(33) Bauche, F., Fouchard, M. H., and Jegou, B. (1994) Antioxidant
system in rat testicular cells. FEBS Lett. 349, 392−396.
(34) Wong, W. Y., Thomas, C. M., Merkus, J. M., Zielhuis, G. A.,
and Steegers-Theunissen, R. P. (2000) Male factor subfertility:
possible causes and the impact of nutritional factors. Fertil. Steril. 73,
435−442.
(35) McShan, D., Ray, P. C., and Yu, H. (2014) Molecular toxicity
mechanism of nanosilver. Journal of food and drug analysis 22, 116−
127.
(36) van der Zande, M., Vandebriel, R. J., Van Doren, E., Kramer, E.,
Herrera Rivera, Z., Serrano-Rojero, C. S., Gremmer, E. R., Mast, J.,
Peters, R. J. B., Hollman, P. C. H., Hendriksen, P. J. M., Marvin, H. J.
P., Peijnenburg, A. A. C. M., and Bouwmeester, H. (2012)
Distribution, Elimination, and Toxicity of Silver Nanoparticles and
Silver Ions in Rats after 28-Day Oral Exposure. ACS Nano 6, 7427−
7442.
(37) Bachler, G., von Goetz, N., and Hungerbühler, K. (2013) A
physiologically based pharmacokinetic model for ionic silver and silver
nanoparticles. Int. J. Nanomed. 8, 3365−3382.
(38) Kim, Y. S., Kim, J. S., Cho, H. S., Rha, D. S., Kim, J. M., Park, J.
D., Choi, B. S., Lim, R., Chang, H. K., Chung, Y. H., Kwon, I. H.,
Jeong, J., Han, B. S., and Yu, I. J. (2008) Twenty-eight-day oral
toxicity, genotoxicity, and gender-related tissue distribution of silver
nanoparticles in Sprague-Dawley rats. Inhalation Toxicol. 20, 575−
583.
(39) Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative
gene expression data using real-time quantitative PCR and the 2(-
Delta Delta C(T)) Method. Methods 25, 402−408.
(40) Bradford, M. M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal. Biochem. 72, 248−254.
(41) Beauchamp, C., and Fridovich, I. (1971) Superoxide dismutase:
Improved assays and an assay applicable to acrylamide gels. Anal.
Biochem. 44, 276−287.
(42) Paglia, D. E., and Valentine, W. N. (1967) Studies on the
quantitative and qualitative characterization of erythrocyte glutathione
peroxidase. J. Lab. Clin. Med. 70, 158−169.
(43) Kaneko, T., Iuchi, Y., Kobayashi, T., Fujii, T., Saito, H.,
Kurachi, H., and Fujii, J. (2002) The expression of glutathione
reductase in the male reproductive system of rats supports the
enzymatic basis of glutathione function in spermatogenesis. Eur. J.
Biochem. 269, 1570−1578.
993
Article
(44) Aebi, H. (1984) Catalase in vitro. In Methods in Enzymology,
Vol. 13, pp 121−126, Academic Press.
(45) Butik, M., Kelte Filho, I., Peres, J. A., and Quinaia, S. P. (2018)
Comparison between Alkaline Solubilization Methods and Acid
Digestion of Animal Tissue for Determination of Metals by Flame
Atomic Absorption Spectrometry. Revista Virtual Quim. 10, 1039−
1055.
(46) Xu, Y.-R., Dong, H.-S., and Yang, W.-X. (2016) Regulators in
the apoptotic pathway during spermatogenesis: Killers or guards?
Gene 582, 97−111.
(47) Aitken, R. J., Smith, T. B., Jobling, M. S., Baker, M. A., and De
Iuliis, G. N. (2014) Oxidative stress and male reproductive health.
Asian J. Androl. 16, 31−38.
(48) Foldbjerg, R., Jiang, X., Miclaus, T., Chen, C., Autrup, H., and
Beer, C. (2015) Silver nanoparticles − wolves in sheep’s clothing?
Toxicol. Res. 4, 563−575.
(49) Kim, S., Choi, J. E., Choi, J., Chung, K. H., Park, K., Yi, J., and
Ryu, D. Y. (2009) Oxidative stress-dependent toxicity of silver
nanoparticles in human hepatoma cells. Toxicol. In Vitro 23, 1076−
1084.
(50) Zhang, W., Xiao, B., and Fang, T. (2018) Chemical
transformation of silver nanoparticles in aquatic environments:
Mechanism, morphology and toxicity. Chemosphere 191, 324−334.
(51) Vandenberg, L. N. Non-Monotonic Dose Responses in Studies
of Endocrine Disrupting Chemicals: Bisphenol a as a Case Study.
Dose-Response 2014, 12, DOI: 10.2203/dose-response.13-020.Van-
denberg.
(52) Diamanti-Kandarakis, E., Bourguignon, J. P., Giudice, L. C.,
Hauser, R., Prins, G. S., Soto, A. M., Zoeller, R. T., and Gore, A. C.
(2009) Endocrine-disrupting chemicals: an Endocrine Society
scientific statement. Endocr. Rev. 30, 293−342.
(53) Welshons, W. V., Thayer, K. A., Judy, B. M., Taylor, J. A.,
Curran, E. M., and Vom Saal, F. S. (2003) Large effects from small
exposures. I. Mechanisms for endocrine-disrupting chemicals with
estrogenic activity. Environ. Health Perspect. 111, 994−1006.
(54) Schug, T. T., Janesick, A., Blumberg, B., and Heindel, J. J.
(2011) Endocrine disrupting chemicals and disease susceptibility. J.
Steroid Biochem. Mol. Biol. 127, 204−215.
(55) Weiss, B. (2011) ENDOCRINE DISRUPTORS AS A
THREAT TO NEUROLOGICAL FUNCTION. J. Neurol. Sci. 305,
11−21.
(56) Aitken, R. J., and Roman, S. D. (2008) Antioxidant systems and
oxidative stress in the testes. Oxid. Med. Cell. Longevity 1, 15−24.
(57) Henkel, R. R. (2011) Leukocytes and oxidative stress: dilemma
for sperm function and male fertility. Asian J. Androl. 13, 43−52.
(58) Agarwal, A., Virk, G., Ong, C., and du Plessis, S. S. (2014)
Effect of oxidative stress on male reproduction. World J. Men’s Health
32, 1−17.
(59) Saalu, L. C. (2010) The incriminating role of reactive oxygen
species in idiopathic male infertility: an evidence based evaluation.
Pak. J. Biol. Sci. 13, 413−422.
(60) Kasahara, E., Sato, E. F., Miyoshi, M., Konaka, R., Hiramoto, K.,
Sasaki, J., Tokuda, M., Nakano, Y., and Inoue, M. (2002) Role of
oxidative stress in germ cell apoptosis induced by di(2-ethylhexyl)-
phthalate. Biochem. J. 365, 849−856.
(61) Sanocka, D., and Kurpisz, M. (2004) Reactive oxygen species
and sperm cells. Reprod. Biol. Endocrinol. 2, 12.
(62) Fridovich, I. (1978) The biology of oxygen radicals. Science 201,
875.
(63) Bray, R. C., Cockle, S. A., Fielden, E. M., Roberts, P. B., Rotilio,
G., and Calabrese, L. (1974) Reduction and inactivation of superoxide
dismutase by hydrogen peroxide. Biochem. J. 139, 43−48.
(64) Amaral, A., Lourenco, B., Marques, M., and Ramalho-Santos, J.
(2013) Mitochondria functionality and sperm quality. Reproduction
(Bristol, U. K.) 146, R163−174.
(65) Ma, W., Jing, L., Valladares, A., Mehta, S. L., Wang, Z., Li, P. A.,
and Bang, J. J. (2015) Silver nanoparticle exposure induced
mitochondrial stress, caspase-3 activation and cell death: amelioration
by sodium selenite. Int. J. Biol. Sci. 11, 860−867.
DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

(66) Arai, M., Imai, H., Koumura, T., Yoshida, M., Emoto, K.,
Umeda, M., Chiba, N., and Nakagawa, Y. (1999) Mitochondrial
phospholipid hydroperoxide glutathione peroxidase plays a major role
in preventing oxidative injury to cells. J. Biol. Chem. 274, 4924−4933.
(67) Chaki, S. P., Misro, M. M., Gautam, D. K., Kaushik, M., Ghosh,
D., and Chainy, G. B. (2006) Estradiol treatment induces testicular
oxidative stress and germ cell apoptosis in rats. Apoptosis 11, 1427−
1437.
(68) Ursini, F., Heim, S., Kiess, M., Maiorino, M., Roveri, A.,
Wissing, J., and Flohe, L. (1999) Dual function of the selenoprotein
PHGPx during sperm maturation. Science 285, 1393−1396.
(69) Haraguchi, C. M., Mabuchi, T., Hirata, S., Shoda, T., Yamada,
A. T., Hoshi, K., and Yokota, S. (2003) Spatiotemporal changes of
levels of a moonlighting protein, phospholipid hydroperoxide
glutathione peroxidase, in subcellular compartments during spermato-
genesis in the rat testis. Biol. Reprod. 69, 885−895.
(70) Pfeifer, H., Conrad, M., Roethlein, D., Kyriakopoulos, A.,
Brielmeier, M., Bornkamm, G. W., and Behne, D. (2001)
Identification of a specific sperm nuclei selenoenzyme necessary for
protamine thiol cross-linking during sperm maturation. FASEB J. 15,
1236−1238.
(71) Aitken, R. J. (2018) Not every sperm is sacred; a perspective on
male infertility. Mol. Hum. Reprod. 24, 287−298.
(72) Ansar, S., Abudawood, M., Hamed, S. S., and Aleem, M. M.
(2017) Sodium Selenite Protects Against Silver Nanoparticle-Induced
Testicular Toxicity and Inflammation. Biol. Trace Elem. Res. 175,
161−168.
(73) Ansar, S., Alshehri, S. M., Abudawood, M., Hamed, S. S., and
Ahamad, T. (2017) Antioxidant and hepatoprotective role of
selenium against silver nanoparticles. Int. J. Nanomed. 12, 7789−7797.
(74) Blanco, J., Tomas-Hernandez, S., Garcia, T., Mulero, M.,
Gomez, M., Domingo, J. L., and Sanchez, D. J. (2018) Oral exposure
to silver nanoparticles increases oxidative stress markers in the liver of
male rats and deregulates the insulin signalling pathway and p53 and
cleaved caspase 3 protein expression. Food Chem. Toxicol. 115, 398−
404.
(75) Nakkala, J. R., Mata, R., Raja, K., Khub Chandra, V., and Sadras,
S. R. (2018) Green synthesized silver nanoparticles: Catalytic dye
degradation, in vitro anticancer activity and in vivo toxicity in rats.
Mater. Sci. Eng., C 91, 372−381.

994 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994