Bioresource Technology 337 (2021) 125468

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Efficient removal of various textile dyes from wastewater by novel

thermo-halotolerant laccase
Elaheh Motamedi a, Kaveh Kavousi b, Seyedeh Fatemeh Sadeghian Motahar c,
Mohammad Reza Ghaffari c, Atefeh Sheykh Abdollahzadeh Mamaghani c,
Ghasem Hosseini Salekdeh c, d, Shohreh Ariaeenejad c, *
a
Department of Nanotechnology, Agricultural Biotechnology Research Institute of Iran (ABRII), Agricultural Research Education and Extension Organization (AREEO),
Karaj, Iran
b
Laboratory of Complex Biological Systems and Bioinformatics (CBB), Department of Bioinformatics, Institute of Biochemistry and Biophysics (IBB), University of
Tehran, Tehran, Iran
c
Department of Systems and Synthetic Biology, Agricultural Biotechnology Research Institute of Iran (ABRII), Agricultural Research Education and Extension
Organization (AREEO), Karaj, Iran
d
Department of Molecular Sciences, Macquarie University, Sydney 2109, NSW Australia

H I G H L I G H T S G R A P H I C A L A B S T R A C T

• A novel thermostable/halotolerant Per­

siLac2 screened from tannery
wastewater.
• The enzyme was highly active and sta­
ble in a wide temperature and pH
ranges.
• The PersiLac2 decolorized azo, anthra­
quinone, and triphenylmethane dyes
rapidly.
• The PersiLac2 is used for detoxification
of dyes used in the textile industry.

A R T I C L E I N F O A B S T R A C T

Keywords: A novel thermostable/halotolerant metagenome-derived laccase (PersiLac2) from tannery wastewater was pu­
Metagenome rified to remove textile dyes in this study. The enzyme was highly active over a wide temperature and pH range
Thermostable laccase and maintained 73.35% of its initial activity after 30 ​ days, at 50 ◦ C. The effect of various metal and organic-
Halotolerant
solvent tolerance on PersiLac2 showed, retaining ​ greater than ​ 53% activity at 800 ​ mM of metal ions,
Decolorization
Detoxification
52.12% activity at 6 ​ M NaCl, and ​ greater than ​ 44.09% activity at 20% organic solvents. PersiLac2 manifested
effective removal of eight different textile dyes from azo, anthraquinone, and triphenylmethane families. It
decolorized 500 ​ mg/L of Alizarin yellow, Carmine, Congo red and Bromothymol blue with 99.74–55.85% ef­
ficiency after 15 ​ min, at 50 ◦ C, without mediator. This enzyme could practically remove dyes from a real textile
effluent and it displayed significant detoxification in rice seed germination tests. In conclusion, PersiLac2 could
be useful in future for decolorization/detoxification of wastewater.

* Corresponding author.
E-mail addresses: sh.ariaee@abrii.ac.ir, iaee@gmail.com (S. Ariaeenejad).

https://doi.org/10.1016/j.biortech.2021.125468
Received 1 May 2021; Received in revised form 20 June 2021; Accepted 24 June 2021
Available online 26 June 2021
0960-8524/© 2021 Published by Elsevier Ltd.
E. Motamedi et al.
1. Introduction
Synthetic dyes are a critical part of various industries, such as textile,
paper, plastic, printing, and leather that possess severe toxic effects on
the environment. These hazardous chemicals are highly persistent,
which lead to water pollution, change the ecosystem balance and have a
severe impact on the animal, plant, and human health (Ariaeenejad
et al., 2021; Rahimi et al., 2020). Azo dyes are considered as the largest
class of synthetic dyes used in textile manufacturing which around
10–15% of them are lost through dyeing process (Sarkar et al., 2017).
Triphenylmethane and anthraquinone dyes are other groups of synthetic
dyes that cause severe environmental pollution problems by releasing
large amounts of potentially toxic compounds (Navas et al., 2020).
Removing hazardous contaminants before discharge to the environment
is a challenging problem and a recent global priority. Therefore,
developing a low-cost and eco-friendly way of dealing with textile
dyeing waste has gained popularity (Ariaeenejad et al., 2021). In this
respect, laccase enzymes have attracted increasing attention for dye
detoxification and degradation (Chmelová and Ondrejovič, 2016; Du
et al., 2020; Iark et al., 2019; Mehandia et al., 2020; Si et al., 2013; Yang
et al., 2020).
Laccases (benezenediol: oxygen oxidoreductase, EC 1.10.3.2) belong
to the family of multicopper oxidases that broadly spread in bacteria,
plants, and fungi (Mate and Alcalde, 2017). These enzymes are best
known for their ability to act on a broad range of substrates and degrade
persistent environmental pollutants. Laccases can oxidize a variety of
phenolic and non-phenolic compounds by reducing the molecular oxy­
gen to water (Guan et al., 2018). They are beneficial enzymes employed
in multipurpose applications from bio-cells and bio-sensors to biore­
mediation, dye decolorization, food, and paper industries (Mate and
Alcalde, 2017). There have been many reports of laccase for effective
biodegradation and detoxification of synthetic dyes up to now (Du et al.,
2020; Song et al., 2017; Zhang et al., 2012). The wastewater from the
dying process usually contains high concentrations of metal ions, salts,
organic solvents and involves high temperatures and neutral or alkaline
pHs, limiting the activity of most laccases (Santhanam et al., 2011).
Thus, looking for robust laccases that can tolerate these extreme con­
ditions is an essential issue for industrial dye decolorization.
Several approaches have been applied to identify the novel laccases
for various industrial purposes, especially dye decolorization. However,
a traditional method for producing novel laccases is using culturable
microorganisms that include microorganism cultivation, production,
purification, and studying the characteristics of the enzyme (Liu et al.,
2019). Due to the poor cultivability of the vast number of microorgan­
isms and the high cost of this approach, it is not desirable to produce
laccases on a large scale (Liu et al., 2019). Therefore, metagenomics
have proven to overcome the limitations of culture-dependent methods
and led to identifying novel laccases capable of degrading pollutant and
used for bioremediation (Ufarté et al., 2015). Up until now, various
laccases have been successfully mined from soil, marine, and plant
sludge metagenome (Ausec et al., 2017; Zhong et al., 2013). Based on
the rapid developments in advanced sequencing techniques, the multi-
stage screening pipeline coupled with the bioinformatic tools showed
the strong power for the discovery of diverse and novel improved en­
zymes from the considerable diversity of unculturable microbes for a
wide range of applications such as biorefinery, lignocellulose-based and,
food industries in the recent years (Ariaeenejad et al., 2020b, 2020c;
Motahar et al., 2020; Motamedi et al., 2021)
This study aimed to introduce a novel thermostable laccase from
tannery wastewater metagenomic data along with its potent application
in decolorization of various dyes from effluents. The enzyme was first
characterized to find its optimum temperature and pH, then its storage
stability under optimum working conditions was evaluated. This novel
laccase enzyme showed high resistance to different concentrated metal
ions, organic solvents, and common inhibitors. Furthermore, the appli­
cation of PersiLac2 for removing three major classes of dyes (azo, tri-
2
Bioresource Technology 337 (2021) 125468
phenylmethane, and anthraquinone) and its detoxification effect on
germination of the rice grain in the presence of these three dye groups
were confirmed.
2. Materials and methods
2.1. Dyes and chemicals
The various dyes used in this study were from Merck Co. (Table 1).
The mediators including ABTS (2,2-azino-bis-(3-ethylbenzothiazoline-6-
́
sulfonic acid)), HBT (hydroxybenzotriazole), and Syringaldazine were
Sigma-Aldrich products. The metal ions, dithiothreitol (DTT), sodium
dodecyl sulfate (SDS), sodium azide (NaN3), ethylenediaminetetraacetic
acid (EDTA), acetone, acetonitrile, iso-propanol, ethanol, ethylene gly­
col, iso-butanol, methanol, glycerol and dimethyl sulfoxide (DMSO)
were purchased from Sigma-Aldrich. The Luria-Bertani medium (LB
broth), T4 DNA ligase (Thermo Fisher Scientific), Kanamycin (Duchfa),
Isopropyl β-D-1-thiogalactopyranoside (IPTG), NdeI and HindIII restric­
tion enzyme (Thermo Fisher Scientific), Gel Extraction kit (Thermo
scientific, US), Ni-NTA Fast Start Kit (Qiagen, Hilden, Germany) were
used for the cloning, expression and purification of the laccase enzyme
(PersiLac2) in the Agricultural Biotechnology Research Institute of Iran
(ABRII). The real effluent sample from a textile factory was kindly
provided by Harir Semnan Dyeing & Printing Co., Semnan, Iran. The
components of real industrial effluent containing some typical salts and
surfactants found in wastewater was provided in Supplementary
Information.
2.2. In- silico identification of the laccase sequence
The MeTarEnz (metagenomic targeted enzyme miner, accessible at
https://cbb.ut.ac.ir/MeTarEnz), as an enzyme prediction and identifi­
cation tool, was exploited to screen and identify appropriate meta­
genomic laccase sequences from the environmental metagenomic data
extracted from tannery wastewater (NCBI BioProject ID:
PRJNA640737).
MeTarEnz facilitates the process of targeted enzyme mining from
high-throughput sequencing data. It is capable to identify enzymes with
desired characteristics, based on the patterns that extracts from a
database of enzymes with known and desired characteristics (Shahraki
et al., 2020a, Shahraki et al., 2020b).
For the present study, this database was created by the gene se­
quences of experimentally validated thermophile laccases enzymes with
EC 1.10.3.2 collected from the NCBI. The predicted metagenomic lac­
cases were further studied by the NCBI CDD (Marchler-bauer et al.,
2017). The 3D model of the confirmed enzymes were built by the Phyre2
(Kelley et al., 2015) for their structural compatibility with laccase
domain.
2.3. Cloning, expression, and purification of the laccase genes
To acquire the laccase gene, metagenomic DNA templates from the
tannery wastewater, were used for a polymerase chain reaction (PCR).
The comlete coding sequence of PersiLac2 was amplified by polymerase
chain reaction using a forward primer (5′ TAATAGCA­
TATGATGGCCTCCCAGGGC − 3′ with NdeI restriction site and reverse
primers (5′ - TAATAGAAGCTTTCATGTGATGCATGGATTC − 3′ ) with
HindIII restriction site. The PCR protocol was conducted as follows: one
cycle at 95 ◦ C for 5 ​ min, 35 cycles of 94 ◦ C for 40 ​ s, 48 ◦ C for 30 ​ s, 72 ◦ C
for 1 ​ min and then a cycle of 72 ◦ C for 5 ​ min. The resulting 1134 ​ bp
PCR product was detected on 1% (w/v) agarose gel, and the specific
DNA fragment was eluted and purified using the Gel Extraction kit
(Thermo scientific, US). Purified DNA fragments were cloned and
digested into the pET28a. For expression of the recombinant protein, the
recombinant construct was transformed into competent E. coli Rosetta
(DE3) bacteria and then cultivated at LB medium supplemented with
E. Motamedi et al. Bioresource Technology 337 (2021) 125468

shaking (180 ​ rpm) until the absorbance at 600 ​ nm reached approxi­
mately 0.6. Then, 0.1 ​ mM isopropyl-β-D-thiogalactopyranoside (IPTG)
was added in the presence of CuSO4 to a final concentration 0.5 ​ mM for
18 ​ h at 19 ◦ C, followed by centrifugation at 4000 ​ rpm for 5 ​ min.
The cell pellet was resuspended in lysis buffer (50 ​ mM NaH2PO4,
300 ​ mM NaCl, 10 ​ mM imidazole; pH 8) containing 1 ​ mg/mL Lyso­
zyme, followed by 30 ​ min on ice. Bacterial debris was removed by
centrifugation of the resulting cell lysate at 12,000 ​ × ​ g for 30 ​ min at
4 ◦ C. The supernatant was loaded on the His60 Ni super flow resin
(Takara) column balanced by the lysis buffer for purification. Using
wash buffer (50 ​ mM NaH2PO4, 300 ​ mM NaCl, 20 ​ mM imidazole; pH 8)
the column was washed multiple times. By adding elution buffer
(50 ​ mM NaH2PO4, 300 ​ mM NaCl, 250 ​ mM imidazole; pH 8) the
enzyme was collected, and its concentration was measured by the
Bradford method. The enzyme’s single band was evaluated by sodium
dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE).

Table 1
Dye decolorization capacity of purified PersiLac2 in the present and absence of mediators.
Dye λmax (nm) Treatment Dye decolorization (%) Chemical structure

Alizarin Yellow 360 PersiLac2 99.5±0.2

PersiLac2 ​ + ​ ABTS 63.5±0.6
PersiLac2 ​ + ​ HBT 96.1±0.7
PersiLac2 ​ + ​ Syringaldazine 95.8±0.7

Congo red 490 PersiLac2 100.0±0.1

PersiLac2 ​ + ​ ABTS 99.5±0.2
PersiLac2 ​ + ​ HBT 99.9±0.1
PersiLac2 ​ + ​ Syringaldazine 99.9±0.1

Carmine 520 PersiLac2 100.0±0.1

PersiLac2 ​ + ​ ABTS 92.2±0.8
PersiLac2 ​ + ​ HBT 78.1±0.7
PersiLac2 ​ + ​ Syringaldazine 93.2±0.7

Brilliant green 630 PersiLac2 11.7±0.5

PersiLac2 ​ + ​ ABTS 68.3±0.5
PersiLac2 ​ + ​ HBT 27.3±0.6
PersiLac2 ​ + ​ Syringaldazine 6.8±0.5

Crystal violet 590 PersiLac2 40.5±0.5

PersiLac2 ​ + ​ ABTS 100.0±0.1
PersiLac2 ​ + ​ HBT 41.1±0.8
PersiLac2 ​ + ​ Syringaldazine 42.2±0.6

Methyl green 630 PersiLac2 4.5±0.4

PersiLac2 ​ + ​ ABTS 23.5±0.7
PersiLac2 ​ + ​ HBT 2.2±0.8
PersiLac2 ​ + ​ Syringaldazine 1.7±0.7

Bromophenol blue 590 PersiLac2 87.4±0.6

PersiLac2 ​ + ​ ABTS 95.2±0.8
PersiLac2 ​ + ​ HBT 81.6±0.7
PersiLac2 ​ + ​ Syringaldazine 84.0±0.5

Bromothymol blue 440 PersiLac2 100.0±0.8

PersiLac2 ​ + ​ ABTS 98.9±0.7
PersiLac2 ​ + ​ HBT 98.9±0.2
PersiLac2 ​ + ​ Syringaldazine 95.0±0.4

3
E. Motamedi et al.
2.4. Assay for laccase activity
The activity of the laccase was spectrophotometrically determined
by measuring the oxidation of ABTS (Ɛ420 nm ​ = ​ 36,000 ​ M− 1 cm− 1), at
420 ​ nm (Wang et al., 2018). For this purpose, the enzyme was mixed
with ABTS (2 ​ mM), and incubated at pH 5 and 50 ◦ C, for 30 ​ min. One
unit of the laccase activity was defined as the amount of enzyme
required to oxidize 1 ​ μM of ABTS per minute under the standard assay
conditions. The protein concentration of the enzyme was estimated ac­
cording to the Bradford assay (Bradford, 1976).
2.5. Influence of temperature, pH changes and storage on activity
The influence of temperature was studied within a range of 20–90 ◦ C,
at constant pH of 5. The effect of pH values was investigated in a pH
range from 3 to 9 using glycine-HCL, sodium citrate, potassium phos­
phate and carbonate-bicarbonate (50 ​ mM) buffers, at 50 ◦ C. The ABTS
was used as substrate for both experiments. The relative laccase activity
was measured using the optimal temperature and pH as 100%.
The storage stability of enzyme was studied by incubating the Per­
siLac2 at 50 ◦ C, for 30 ​ days. The enzymatic activity was measured in
2 ​ days intervals compared with the laccase activity before incubation
(100%).
2.6. Kinetic property of purified laccase
For measuring the kinetic properties of the PersiLac2, a Line­
weaver–Burk plot was made from a series of ABTS concentration ranging
from 0.1 to 4 ​ mM. The Km, Kcat and Kcat/Km of the enzyme were then
evaluated.
2.7. Laccase activity amidst metal ions, detergents and organic solvents
For this experiment, the metal ions including K+, Ni2+, Mg2+, Ca2+,
Mn , Fe2+, Cu2+, Zn2+, Li2+, Al3+ in concentration ranging from 10 to
2+
800 ​ mM, various concentration of inhibitors including EDTA (50 and
25 ​ mM), SDS (25 and 10 ​ mM), DTT (50 and 25 ​ mM) and NaN3 (10 and
0.5 ​ mM) and organic solvents including acetone, ethanol, methanol,
ethylene glycol, acetonitrile, iso-propanol, iso-butanol, glycerol and
DMSO in final concentration of 5 to 50% v/v were prepared. The enzyme
was incubated with each chemical for 30 ​ min at room temperature.
Eventually, for the activity assay, the reaction was conducted at pH 5
and 50 ◦ C. Enzyme without the added compound was taken as control
and its activity was considered 100%. The relative laccase activity was
measured compared to the control. The concentration of trace metals, in
the real effluent sample were analyzed using inductively coupled
plasma-optical emission spectrometry (ICP-OES, SPECTRO ARCOS).
Analysis of anions in the real effluent sample have been done using ion
chromatography (IC; Knauer, CDD-10AVP, column: PRP-X110S
(150 ​ mm ​ × ​ 4.1, 7 ​ µm)).
2.8. Effect of high concentration halide
The halotolerance test of the PersiLac2 was investigated using the
NaCl as halide donor. The enzyme was incubated with 1 to 6 ​ M NaCl for
30 ​ min, at room temperature. The enzymatic activity was measured
corresponding to the laccase activity in the absence of NaCl as 100%.
2.9. Decolorization of dyes by PersiLac2
To analyzing the decolorization ability of the PersiLac2, eight com­
mon dyes in the textile industry were used (Table 1), and three media­
tors including ABTS, HBT and Syringaldazine were assayed. The
reaction mixtures were composed of the dye solution (50 ​ mg/L),
mediator (2 ​ mM) and purified laccase (0.3 U/mL) in phosphate buffer
pH 5. The experiment was carried out in the presence or absence of each
4
Bioresource Technology 337 (2021) 125468
mediator followed by the incubation at 50 ◦ C, for 30 ​ min. The control
samples without the enzyme were run in parallel. The concentration
change of each dye was measured spectrophotometrically between 400
and 800 ​ nm. In each case, the percent of dye decolorization was
measured at the maximum absorption wavelength (λmax) of dyes based
on the below formula (Si et al., 2013):
Ab0 − Abt
Decolorization% = × 100
Ab0
where Ab0 is the initial absorbance of dye at time zero and Abt is the dye
solution absorbance at any given time.
To analyze the effect of dye concentration on decolorization of
various dyes by the PersiLac2, the treatment with highest percentage of
decolorization obtained from the previous experiment was assayed for
each dye. For Alizarin Yellow, Carmine, Congo red and Bromothymol
blue various concentrations of dyes from 100 to 500 ​ mg/L were incu­
bated with laccase (0.3 U/mL) for 15 and 30 ​ min at 50 ◦ C, respectively.
The same condition was assayed for the Brilliant green, Methyl green,
Crystal violet and Bromophenol blue in the presence of ABTS (2 ​ mM).
The dye decolorization was calculated based on the described equation.
2.10. Phytotoxicity seed germination studies
Phytotoxicity assay was performed on germination using dyes
(500 ​ mg/L) after biological transfer. In the experiment, rice (Oryza
sativa), a seed of ordinary agricultural products from the grass family,
was used. Seeds of Oryza sativa (10 each) were seeded in petri plates
(5 ​ cm diameter) containing 5 ​ mL of dye solutions and decolorized dye
solutions with enzyme separately. For the control sample, petri plates
made with sterile distilled water were used for seeds germination. The
adjusted phytotoxicity was evaluated for 6 ​ days and percentage
germination (%) of seeds treated with dye and decolorized dye solutions
by enzyme was calculated after comparing with control (Jadhav et al.,
2010).
3. Results and discussion
3.1. Screening and identification of novel PersiLac2
It was expected that the bacterial metagenome of the tannery
wastewater encoded for the novel and special laccases with the high
activity in harsh conditions. By employing the MeTarEnz, CDD, and
Phyre2 tools, the final laccase candidate was selected and named
PersiLac2.
Analysis of the predicted enzyme from metagenome versus
conserved domains using the PSSM models in the CDD, revealed its high
similarity with laccase superfamily members (Ariaeenejad et al., 2020a).
By 3D modeling of PersiLac2 using Phyre2, its high structural similarity
to known laccase enzymes with confidence score 100% was confirmed.
3.2. Cloning, expression, and purification of the laccase genes
The metagenomic DNA from the tannery wastewater with degen­
erate primers and over-expressed under the control of the T7 promoter
of pET-28a vector, the sequences of PersiLac2 fragments were amplified.
The recombinant enzyme was purified as the N-terminus His-tagged
protein and checked by SDS-PAGE and nucleotide sequence of Persi­
Lac2 was submitted to Gen bank Database with submission ID: 2456260.
3.3. Influence of temperature, pH changes and storage on activity
As illustrated in Fig. 1, the PersiLac2 showed its optimal temperature
and pH at 50 ◦ C and pH 5, respectively. The enzyme was active over a
wide range of temperatures and retained more than half of its maximum
activity at a temperature range of 20 to 90 ◦ C. When the enzyme was
E. Motamedi et al. Bioresource Technology 337 (2021) 125468

Fig. 1. Effect of (a) temperature and (b) pH changes on the activity of the purified PersiLac2, and (c) storage stability of the enzyme for 30 ​ days.

incubated at high temperatures such as 70, 80 and 90 ◦ C, most of in a wide range of pH and temperature, the PersiLac2 is not only a po­
oxidizing activity maintained and the results showed the 74%, 68% and tential biocatalyst in the biological treatment of textile dyes but also as a
54% laccase activities, respectively (Fig. 1a). The thermotolerant laccase suitable candidate in lignin-based industries, biofuel cells, pulp
from metagenomic data with similar temperature optima (50 ◦ C) bleaching, paper, detergent and also in the area of dye decolorization.
showed less than 40% activity at 70 ◦ C (Ausec et al., 2017). Moreover,
the laccase activity of the PersiLac2 at 90 ◦ C was higher than the laccase
3.4. Kinetic property of purified laccase
from Cerrena unicolor and Oudemansiella canarii which showed less than
20% activity toward ABTS and were used for decolorization of synthetic
The kinetic analysis of the PersiLac2 showed that the enzymatic re­
dyes (Iark et al., 2019; Wang et al., 2017). According to this, the Per­
actions were follow Michaelis-Menten kinetics. Based on the results, the
siLac2 remained more activity at 90 ◦ C than a highly thermostable
Km, Kcat and Kcat/Km of the purified laccase were 325.66±0.58μ ​ mol,
laccase such as Geobacillus sp with less than 30% activity under the same
1427.15±1.45 1/s and 4.38±0.82 1/μmol.s when the laccase incubated
condition (Rai et al., 2019).
with a series concentration of ABTS. The Kcat and Kcat/Km of the Persi­
The PersiLac2 showed high activity when incubated at broad range
Lac2 was much more than the alkaline laccase and a high salt and
of pH (Fig. 1b). The purified laccase retained more than 50% of its
thermo-tolerance laccase from soil metagenome when the ABTS was
maximal laccase activity at pH ranging from 3 to 10. It was notable that
used as substrate (Ausec et al., 2017; Ye et al., 2010). In another study a
unlike the acidic behavior of the PersiLac2, the enzyme could retain 65%
metagenome-derived laccase with potential application in textile dye
and 55% of its activity after incubation at pH 8 and 9, respectively. The
decolorization stated the Kcat and Kcat/Km of 0.036 1/s and 0.00044 1/
pH of textile industrial effluents is mostly near to alkaline (Jahmeer­
μmol.s toward ABTS which were much lower than these values for
bacus et al., 2004) which indicated the potential applications of the
PersiLac2. Additionally, the Kcat and Kcat/Km of the PersiLac2 were
PersiLac2 for wastewater treatment. The PersiLac2 activity was higher
higher than a thermostable, organic solvents and salt tolerant laccase
than that of other reported laccases over a wide pH range. For instance,
from marine metagenomic library with high decolorization activity
the acidic laccase from Pleurotus ostreatus which was used for degrada­
which demonstrated Kcat and Kcat/Km of 34.39 1/s and 0.161/μmol.s
tion of industrial toxic compounds, showed less than 10% activity at pH
when the ABTS was used as substrate (Yang et al., 2018). In contrast, the
7 to 8 (Liu et al., 2021). Recent study on the alkaline thermostable
Km of the PersiLac2 was lower than the all-mentioned laccases from
metagenome-derived laccase showed 0% laccase activity at pH 7
metagenomic data that revealed the high affinity of enzyme toward
(Xiaoet al., 2021).
ABTS.
The storage stability of the PersiLac2 was investigated after 30 ​ days
of storage at 50 ◦ C (Fig. 1c). The purified laccase showed 95.27% of its
maximum activity after two days of storage. This amount was decreased 3.5. Laccase activity amidst metal ions, detergents, organic solvents and
to the 73.35% after 30 ​ days of storage. high halide concentration
Due to the results of long-term stability in high temperature, activity
The observed data from Fig. 2 representer the strong tolerance of

5
E. Motamedi et al.
Fig. 2. Activity of the PersiLac2 in the presence of different metal ions at the concentration of 10 to 800 ​ mM. The enzymatic activity in the absence of each metal ion
was set as 100%.
PersiLac2 to low and high concentrations of various tested metal ions. It
was found that the addition of all the metal ions enhanced the laccase
activity at low concentration and then the dose dependent inhibitory
was observed in the presence of all the assayed metal ions except Cu2+.
The enzymatic activity was enhanced gradually as the concentration of
Cu2+ increased. The phenomenon observed in the current study was in
accordance with previous metal tolerant laccases (Mehandia et al.,
2020; Sondhi et al., 2014). It was reported that presence of some metal
ions such as Cu2+ increased the laccase activity probably due to the
filling of type II copper binding sites of enzyme with this ion (Lu et al.,
2013). Presence of Fe2+ inhibited the laccase activity to 84% and 53% at
600 and 800 ​ mM, respectively. Likewise, the activity of laccase showed
slight decrease after addition of the Mg2+ at 600 and 800 ​ mM and
showed 91% and 86% activities, respectively.
Activity of the PersiLac2 in the presence of metal ions was signifi­
cantly higher than the reported laccases that mostly used for dye
decolorization (Supplementary Information). Most of the laccases lost
their activity at high concentration of metal ions. In contrast, the Per­
siLac2 showed high activity even at high concentration of salts. These
results indicated the strong tolerance of the PersiLac2 toward different
metal ions which reflected the ability of the enzyme for different in­
dustrial processes.
Another remarkable property of the PersiLac2 was its activity toward
6
Bioresource Technology 337 (2021) 125468
the known enzyme inhibitors such as EDTA, SDS, DTT and sodium azide
(Fig. 3a). The metal chelating EDTA negatively influenced the metal­
loenzymes. The PersiLac2 showed high resistance to this inhibitor and
the results indicated 2.88% inhibition after treatment with 25 ​ mM of
EDTA which reached to the 8.93% inhibition at 50 ​ mM. The laccase was
resistant to the DTT and this thiol compound showed sight inhibitory
effect on the laccase activity at 25 ​ mM concentration (36.88%).
Moreover, increasing the DTT concentration inhibited the laccase ac­
tivity to 56.55% at 50 ​ mM. When the sodium azide existed in the re­
action system at low concentration (0.5 ​ mM), the PersiLac2 activity
inhibited to 36.31% which increased to 40.92% at the concentration of
10 ​ mM. This may be due to the binding of NaN3 to the copper sites of the
enzyme that inhibited the laccase activity as a result of electron trans­
port disruption (Dwivedi et al., 2011). The SDS is a detergent with
denaturing effect that showed 15.78% and 57.89% inhibition at the
concentration of 10 and 25 ​ mM, respectively. Compared with other
known laccases, the PersiLac2 showed high activity toward the strong
inhibitors including SDS, EDTA, DTT and NaN3 even at high concen­
tration (Supplementary Information).
Laccases with stability in high salt contaminated conditions are
essential for bioremediation of textile dyes due to the high concentra­
tions of salts, especially NaCl in the textile wastewaters. In this regard,
the activity of the PersiLac2 in the presence of NaCl at high
E. Motamedi et al. Bioresource Technology 337 (2021) 125468

Fig. 3. (a) Inhibitory effect of different laccase inhibitors on the PersiLac2 activity. (b) Activity of the PersiLac2 at high concentration of NaCl. The laccase activity in
the absence of NaCl was set as 100%.

concentration from 1 to 6 ​ M was examined and the results were pre­
sented in the Fig. 3b. The purified laccase showed 121.21% and
152.12% activities in the presence of 1 and 2 ​ M NaCl, respectively. The
laccase activity was decreased as the salt concentration increased from 3
to 6 ​ M. The enzyme could retain 52.12% of its activity at the highest
concentration of NaCl (6 ​ M). These results were strongly higher than
the halotolerant laccase from Chaetomium sp with less than 20% activity
at 3 ​ M NaCl (Eugenio et al., 2017). A thermostable laccase from Alca­
ligenes faecalis that used for the decolorization of industrial dyes showed
56.76% activity after addition of 1 ​ M NaCl (Mehandia et al., 2020).
Another study stated 77.84% laccase activity in the presence of 1 ​ M
NaCl for the thermostable laccase with application in decolorization of
dyes (Qiao et al., 2017).
Laccase enzymes that remain active even at high concentration of

Fig. 4. Activity of the PersiLac2 in the presence of different organic solvents at the concentration of 5 to 50% v/v. The enzymatic activity in the absence of each
organic solvent was set as 100%.

7
E. Motamedi et al. Bioresource Technology 337 (2021) 125468

organic solvents appear to be quite attractive for various applications Table 2

such as bioremediation and textile industry. Based on the results, the Ability of PersiLacaase2 for decolorization of various concentration of dyes.
PersiLac2 was stable in the presence of commonly used organic solvents Dye Dye concentration Dye Removal (%) Dye Removal (%)
and retained more than 50% of its activity in the presence of acetone, (mg/L) after 15 ​ min after 30 ​ min
acetonitrile, isopropanol, ethanol and DMSO at the concentration of Alizarin Yellow 100 91.9±0.4 97.6±0.7
50% v/v (Fig. 4). The enzyme was also stable in the presence of ethylene 200 89.9±0.7 94.3±0.6
glycol, iso-butanol, methanol and glycerol and showed the most sensi­ 300 73.2±0.5 88.5±0.6
tivity to iso-butanol. The negative effect of the organic solvents can 400 70.7±0.7 83.5±0.9
500 66.7±0.8 79.2±0.6
related to the interaction of laccase with organic solvent and changes in
Carmine 100 92.2±0.9 97.0±0.5
the active site and structure of the enzyme (Rodakiewicz-nowak and 200 83.4±0.8 96.7±0.3
Jarosz-wilkołazka, 2007). The PersiLac2 showed high resistance to the 300 70.8±0.8 94.3±0.7
organic solvents when compared with reported laccases (Supplementary 400 64.4±0.5 92.9±0.4
Information). Most of the known laccases are instable at the concen­ 500 57.6±0.8 90.9±0.7
tration above 10% v/v of organic solvents. In contrast, the PersiLac2 Brilliant green 100 45.4±0.4 67.9±0.4
200 35.8±0.5 62.5±0.3
could maintain most of its activity even at high concentration of organic
300 3.5±0.5 12.7±0.2
solvents. 400 2.0±0.6 3.9±0.1
The PersiLac2 tolerance to the common inhibitors, organic-solvent 500 2.0±0.5 4.9±0.2
tolerate presenting in the industrial effluents is of great interest for in­ Congo red 100 99.8±0.1 100.0±0.1
dustrial treatments such as decolorization of synthetic dyes, lignin sol­ 200 99.8±0.2 100.0±0.1
ubilization, and environmental pollution. 300 99.8±0.1 99.9±0.1
400 99.8±0.2 99.7±0.7
500 99.7±0.3 99.6±0.3
3.6. Decolorization of dyes by the PersiLac2 Crystal violet 100 90.1±0.8 99.7±0.2
200 88.1±0.6 95.3±0.5
Synthetic dyes associated with various industries specially textile 300 72.9±0.5 86.8±0.7
and leather. Azo, anthraquinone and triphenylmethane are three largest 400 45.9±0.6 72.5±0.3
500 25.8±0.3 67.7±0.2
classes of dyes that use widely in this industry. Due to the complex
Methyl green 100 7.5±0.9 15.3±0.4
structure of these dyes, they are recognized to be nonbiodegradable and
200 0.0±0.1 9.1±0.6
leading to serious health problems for human and animals. Using the 300 0.0±0.1 0.0±0.1
enzyme-based decolorization is quite effective, eco-friendly and cost- 400 0.0±0.3 0.0±0.3
competitive way for degradation of these toxic dyes. 500 0.0±0.3 0.0±0.4
In the current study, decolorization of the eight common dyes with Bromophenol 100 84.1±0.6 90.4±0.9
different structures including azo, anthraquinone and triphenylmethane blue 200 69.8±0.5 88.3±0.6
300 57.0±0.6 87.1±0.7
by the novel PersiLac2 were studied. As illustrated in the Table 1, the
400 38.9±0.7 86.6±0.4
purified laccase could decolorize all kinds of dyes. The azo dyes are 500 37.2±0.4 82.9±0.6
highly stable and have one or more azo groups (-N ​ = ​ N-) in their Bromothymol 100 87.6±0.9 98.9±0.1
chemical structures. This class of dyes are used largely in textile industry blue 200 84.9±0.1 99.3±0.4
that more than 70% of them used for coloring the products (Senthivelan 300 60.7±0.6 99.5±0.3
400 63.6±0.8 99.5±0.2
et al., 2016). Application of PersiLac2 resulted in the highest decolor­
500 55.8±0.7 99.5±0.1
ization of Alizarin Yellow and Congo red up to 99.54% and 100%
without using of mediators. Also, the enzyme possessed the decolor­
ization of 98.15% after 30 ​ min toward anthraquinone dye, Carmine in presence of 500 ​ mg/L Alizarin Yellow, Carmine, Congo red, Crystal
the absence of mediators (Table 1). Triphenylmethane are other group violet, Bromophenol blue and Bromothymol blue after 30 ​ min. Brilliant
of dyes that mostly being used in the textile industry and dyeing pro­ green and Methyl green represented resistance to decolorization and
cesses. Such dyes are serious environmental problem in the recent de­ showed a negligible color removal at high concentration after 30 ​ min
cades and cause severe toxicity (Mishra and Maiti, 2018). The PersiLac2 (Table 2). This could be because of the dye toxicity and metabolites that
was used for decolorization of Crystal violet, Brilliant green, Methyl produced during decolorization by the enzyme at high concentration
green, Bromothymol blue and Bromophenol blue which are all triphe­ (Ghobadi Nejad et al., 2019). These results are undoubtedly consider­
nylmethane dyes. The highest decolorization of these dyes were able as decolorization of dyes generally carry out in the presence of
observed in the absence of ABTS, except Bromothymol blue, which mediators and required much longer periods of incubation than 30 ​ min.
showed 100% conversion without using mediators (Table 1). Based on Compared to present study, laccases from previous reports showed less
the results, the ability of the laccase was higher in the absence of me­ percentage of decolorization for azo, anthraquinone and triphenyl­
diators for all dyes except Bromophenol blue, Crystal violet, Brilliant methane in much longer time (Supplementary Information). Also, most
green and Methyl green which showed the higher decolorization in the of the reported laccases demonstrated less than 50% decolorization of
presence of ABTS. There has been reported that some laccases are not known azo dye (Congo red) and triphenylmethane dye (Crystal violet) in
influenced by mediators which is advantageous for industrial applica­ low concentration of dye solution and longer reaction time than the
tions (Asadi et al., 2020). Mediators release the unstable radical which PersiLac2.
are mostly toxic for the environment and have high cost. However, it is The metagenome-derived PersiLac2 was a thermostable laccase with
well established that mediators increase the activity of laccase and are considerably high detergent and organic-solvent stabilities and showed
essential for most of the dye decolorization systems. that it could be a potential and cost-effective alternative for industrial
Further, the PersiLac2 was used for decolorizing different concen­ decolorization of various dyes. Moreover, the reliability of PersiLac2 for
trations of dyes ranging from 100 to 500 ​ mg/L, after 15 and 30 ​ min removal of dyes in a real sample (collected from the effluents of a textile
(Table 2). As expected, the highest decolorization was obtained by the factory) were evaluated. The components of the real sample effluent
lowest concentration of dyes (100 ​ mg/L). A continuous decrease in dye were provided in Supplementary Information.
removal was observed as the concentration was increased to 500 ​ mg/L. Because PersiLac2 was able to decolorize this real sample in less than
The PersiLac2 was an effective decomposer toward most of the dyes and 2 ​ min, we added other dyes to the real sample to demonstrate its
showed considerably high decolorization rates of 67–99% in the

8
E. Motamedi et al.
enzyme ability.
Two dye samples were prepared using real effluent: 1) A real sample
contained four dyes of Alizarin, Carmine, Congo Red and Bromothymol
Blue (each dye concentration was 50 ​ mg/L); 2) another sample con­
tained five dyes of Alizarin, Carmine, Congo Red, bromothymol blue
plus Crystal violet with the same concentration as the first sample. Both
samples were then treated with this laccase enzyme. UV–Vis analysis
before and after treatment of the samples showed the practical use of
PersiLac2 in removal of dyes from two samples (Supplementary Infor­
mation). Dye removal percentages (calculated using areas below the
adsorption curves) were found to be 84 and 87%, even after 5 ​ min of
treatment for textile effluents in two real samples, respectively, which
confirmed the practical application of PersiLac2 for wastewater
treatment.
Laccases with fast decolorizing ability towards a number of dyes are
attractive for industrial scale. The PersiLac2 showed unparalleled
decolorization of reactive dyes, which confirmed its suitability for
further industrial application in dye removal. However, further studies
need to be conducted in the future regarding the cost-effectiveness of
PersiLac2 use and its dye decolorization mechanism of action.
3.7. Phytotoxicity seed germination test
The dyes released in the environment cause harsh effect on the
plants. According to the literature, there is a lot of evidence that high
concentrations of dyes can negatively affect the germination percentage
in different seeds and significantly reduce the germination percentage
(Si et al., 2013; Gao et al., 2020). Plant toxicity test was based on
measuring the effect of selected dye from the above-mentioned groups
on the germination percentage of rice seeds (Oryza sativa), as the model
plant. The phytotoxicity of dyes was estimated by measuring the ability
of the untreated dye and treated dye with laccase to germinate rice seeds
after 6 ​ days. The results showed that the three selected dyes Bromo­
thymol blue, Crystal violet, Alizarin, Carmine with 500 ​ mg/L concen­
tration, were considered toxic and inhibited rice seed germination, but
Carmine had less effect on germination than other dyes (Supplementary
Information). In addition, regarding the toxicity of Bromothymol blue,
Crystal violet, and Alizarin, the germination percentage of rice seeds in
laccase-treated dye was significantly higher than untreated dyes. In
carmine dye, the germination percentage of rice seeds in laccase-treated
dye was close to those of water-treated seedlings and the samples had a
significant germination percentage in both treated and untreated cases.
Therefore, phytotoxicity studies have shown that PersiLac2 can be used
to detoxify various dyes used in the textile industrial effluents. Further
studies can be conducted about the mechanism of thermo-halotolerant
PersiLac2 on reducing the toxicity of dyes in textile wastewater.
4. Conclusion
This study introduced a novel thermostable and halo-tolerant laccase
enzyme that showed resistance against metal ions, surfactants and could
effectively and practically be utilized for dye removal from wastewater.
The enzyme was highly active and stable under various harsh conditions
and was also able to decolorize a high concentration of azo, anthra­
quinone, and triphenylmethane dyes in a short time without need to
addition of redox mediators. Moreover, effective decolorization of the
real textile effluent and a remarkable reduction in toxicity were found
due to the laccase action. The superior properties of PersiLac2 made this
enzyme a potential candidate for decolorization of various textile dyes
from wastewater in a cost-effective and eco-friendly way.
CRediT authorship contribution statement
Elaheh Motamedi: Methodology, Investigation, Writing - original
draft. Kaveh Kavousi: Writing - review & editing. Seyedeh Fatemeh
Sadeghian Motahar: Investigation, Writing - original draft.
9
Bioresource Technology 337 (2021) 125468
Mohammad Reza Ghaffari: Formal analysis, Software, Data curation.
Atefeh Sheykh Abdollahzadeh Mamaghani: Investigation, Method­
ology, Writing - original draft. Ghasem Hosseini Salekdeh: Resources.
Shohreh Ariaeenejad: Conceptualization, Methodology, Supervision,
Investigation, Writing - original draft.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgement
This research was supported by a grant from Agricultural Biotech­
nology Research Institute of Iran (ABRII) and Iran National Science
Foundation (INSF) (funding reference number 99016942). The authors
gratefully acknowledge the help of HARIR SEMNAN DYEING &
PRINTING CO., especially Mr. A. Sarsharzadeh, and Mr. A. A. Khakbaz
from the administrative board.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.biortech.2021.125468.
References
Ariaeenejad, S., Lanjanian, H., Motamedi, E., Kavousi, K., Moosavi-Movahedi, A.A.,
Hosseini Salekdeh, G., 2020a. The Stabilizing mechanism of immobilized
metagenomic xylanases on bio-based hydrogels to improve utilization performance:
computational and functional perspectives. Bioconjug. Chem. 31 (9), 2158–2171.
https://doi.org/10.1021/acs.bioconjchem.0c0036110.1021/acs.
bioconjchem.0c00361.s001.
Ariaeenejad, S., Motamedi, E., Hosseini Salekdeh, G., 2021. Application of the
immobilized enzyme on magnetic graphene oxide nano-carrier as a versatile bi-
functional tool for efficient removal of dye from water. Bioresour. Technol. 319,
124228. https://doi.org/10.1016/j.biortech.2020.124228.
Ariaeenejad, S., Nooshi-nedamani, S., Rahban, M., Kavousi, K., 2020b. A novel high
glucose-tolerant β -glucosidase : targeted computational approach for metagenomic
screening. Front. Bioeng. Biotechnol. 8, 1–14. https://doi.org/10.3389/
fbioe.2020.00813.
Ariaeenejad, S., Sheykh, A., Mamaghani, A., Maleki, M., Kavousi, K., Shahraki, M.F.,
Salekdeh, G.H., 2020c. A novel high performance in-silico screened metagenome-
derived alkali- thermostable endo- β -1, 4-glucanase for lignocellulosic biomass
hydrolysis in the harsh conditions. BMC Biotechnol. 20, 1–13. https://doi.org/
10.1186/s12896-020-00647-6.
Asadi, E., Makhdoumi, A., Asoodeh, A., 2020. Laccase mediator system obtained from a
marine spore exhibits decolorization potential in harsh environmental conditions.
Ecotoxicol. Environ. Saf. 191, 110184. https://doi.org/10.1016/j.
ecoenv.2020.110184.
Ausec, L., Berini, F., Casciello, C., Cretoiu, M.S., van Elsas, J.D., Marinelli, F., Mandic-
Mulec, I., 2017. The first acidobacterial laccase-like multicopper oxidase revealed by
metagenomics shows high salt and thermo-tolerance. Appl. Microbiol. Biotechnol.
101 (15), 6261–6276. https://doi.org/10.1007/s00253-017-8345-y.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.
72 (1-2), 248–254. https://doi.org/10.1016/0003-2697(76)90527-3.
Chmelová, D., Ondrejovič, M., 2016. Purification and characterization of extracellular
laccase produced by Ceriporiopsis subvermispora and decolorization of
triphenylmethane dyes. J. Basic Microbiol. 56 (11), 1173–1182. https://doi.org/
10.1002/jobm.v56.1110.1002/jobm.201600152.
Du, Y., Ma, H., Huang, L., Pan, Y.u., Huang, J., Liu, Y., 2020. Electrochemical
characteristics of the decolorization of three dyes by laccase mediator system (LMS)
with synthetic and natural mediators. Chemosphere 239, 124779. https://doi.org/
10.1016/j.chemosphere.2019.124779.
Dwivedi, U.N., Singh, P., Pandey, V.P., Kumar, A., 2011. Structure–function relationship
among bacterial, fungal and plant laccases. J. Mol. Catal. B Enzym. 68 (2), 117–128.
https://doi.org/10.1016/j.molcatb.2010.11.002.
Eugenio, L. De, Ghariani, B., Louati, I., 2017. A halotolerant laccase from Chaetomium
strain isolated from desert soil and its ability for dye decolourization. 3 Biotech. 7,
329. https://doi.org/10.1007/s13205-017-0973-5.
Foroozandeh Shahraki, M., Ariaeenejad, S., Fallah Atanaki, F., Zolfaghari, B.,
Koshiba, T., Kavousi, K., Salekdeh, G.H., 2020a. MCIC: automated identification of
cellulases from metagenomic data and characterization based on temperature and
pH dependence. Front. Microbiol. 11, 1–10. https://doi.org/10.3389/
fmicb.2020.567863.
E. Motamedi et al.
Gao, T., Qin, D., Zuo, S., Peng, Y., Xu, J., Yu, B., Song, H., Dong, J., 2020. Decolorization
and detoxification of triphenylmethane dyes by isolated endophytic fungus,
Bjerkandera adusta SWUSI4 under non-nutritive conditions. Bioresour. Bioprocess. 7,
53. https://doi.org/10.1186/s40643-020-00340-8.
Ghobadi Nejad, Z., Borghei, S.M., Yaghmaei, S., 2019. Biodegradation of synthetic dye
using partially purified and characterized laccase and its proposed mechanism. Int.
J. Environ. Sci. Technol. 16 (12), 7805–7816. https://doi.org/10.1007/s13762-019-
02226-5.
Guan, Z.-B., Luo, Q., Wang, H.-R., Chen, Y.u., Liao, X.-R., 2018. Bacterial laccases:
promising biological green tools for industrial applications. Cell. Mol. Life Sci. 75
(19), 3569–3592. https://doi.org/10.1007/s00018-018-2883-z.
Iark, D., Buzzo, A.J.D.R., Garcia, J.A.A., Côrrea, V.G., Helm, C.V., Corrêa, R.C.G.,
Peralta, R.A., Peralta Muniz Moreira, R.d.F., Bracht, A., Peralta, R.M., 2019.
Enzymatic degradation and detoxification of azo dye Congo red by a new laccase
from Oudemansiella canarii. Bioresour. Technol. 289, 121655. https://doi.org/
10.1016/j.biortech.2019.121655.
Jadhav, J.P., Phugare, S.S., Dhanve, R.S., Jadhav, S.B., 2010. Rapid biodegradation and
decolorization of direct orange 39 (Orange TGLL) by an isolated bacterium
Pseudomonas aeruginosa strain BCH. Biodegradation. 21 (3), 453–463. https://doi.
org/10.1007/s10532-009-9315-6.
Jahmeerbacus, M.I., Kistamah, N., Ramgulam, R.B., 2004, Fuzzy control of dyebath pH
in exhaust dyeing. Color. 120, 51-55. Technol, https://doi.org/10.1111/j.1478-
4408.2004.tb00206.x.
Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N., Sternberg, M.J.E., 2015. The Phyre2
web portal for protein modeling, prediction and analysis. Nat. Protoc. 10 (6),
845–858. https://doi.org/10.1038/nprot.2015.053.
Liu, X., Deng, W., Yang, Y., 2021. Characterization of a novel laccase LAC-Yang1 from
white-rot fungus Pleurotus ostreatus Strain Yang1 with a strong ability to degrade and
detoxify chlorophenols. Molecules 26, 473. https://doi.org/10.3390/
molecules26020473.
Liu, Y.i., Luo, G., Ngo, H.H., Guo, W., Zhang, S., 2020. Advances in thermostable laccase
and its current application in lignin-first biorefinery: a review. Bioresour. Technol.
298, 122511. https://doi.org/10.1016/j.biortech.2019.122511.
Lu, L., Zeng, G., Fan, C., Ren, X., Wang, C., Zhao, Q., Zhang, J., Chen, M., Chen, A.,
Jiang, M., 2013. Characterization of a laccase-like multicopper oxidase from newly
isolated Streptomyces sp. C1 in agricultural waste compost and enzymatic
decolorization of azo. Biochem. Eng. J. dyes.72, 70–76. https://doi.org/10.1016/j.
bej.2013.01.004.
Marchler-Bauer, A., Bo, Y.u., Han, L., He, J., Lanczycki, C.J., Lu, S., Chitsaz, F.,
Derbyshire, M.K., Geer, R.C., Gonzales, N.R., Gwadz, M., Hurwitz, D.I., Lu, F.u.,
Marchler, G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D.,
Zheng, C., Geer, L.Y., Bryant, S.H., 2017. CDD/SPARCLE: Functional classification of
proteins via subfamily domain architectures. Nucleic Acids Res. 45 (D1),
D200–D203. https://doi.org/10.1093/nar/gkw1129.
Mate, D.M., Alcalde, M., 2017. Laccase: a multi-purpose biocatalyst at the forefront of
biotechnology. Microb. Biotechnol. 10 (6), 1457–1467. https://doi.org/10.1111/
mbt2.2017.10.issue-610.1111/1751-7915.12422.
Mehandia, S., Sharma, S.C., Arya, S.K., 2020. Isolation and characterization of an alkali
and thermostable laccase from a novel Alcaligenes faecalis and its application in
decolorization of synthetic dyes. Biotechnol. Reports. 25, e00413. https://doi.org/
10.1016/j.btre.2019.e00413.
Mishra, S., Maiti, A., 2018. The efficacy of bacterial species to decolourise reactive azo,
anthroquinone and triphenylmethane dyes from wastewater: a review. Environ. Sci.
Pollut. Res. 25 (9), 8286–8314. https://doi.org/10.1007/s11356-018-1273-2.
Motahar, S.F.S., Khatibi, A., Salami, M., Ariaeenejad, S., Emam-Djomeh, Z., Nedaei, H.,
Kavousi, K., Sheykhabdolahzadeh Mamaghani, A., Salekdeh, G.H., 2020. A novel
metagenome-derived thermostable and poultry feed compatible α-amylase with
enhanced biodegradation properties. Int. J. Biol. Macromol. 164, 2124–2133.
https://doi.org/10.1016/j.ijbiomac.2020.08.064.
Motamedi, E., Sadeghian Motahar, S.F., Maleki, M., Kavousi, K., Ariaeenejad, S.,
Moosavi-Movahedi, A.A., Hosseini Salekdeh, G., 2021. Upgrading the enzymatic
hydrolysis of lignocellulosic biomass by immobilization of metagenome-derived
novel halotolerant cellulase on the carboxymethyl cellulose-based hydrogel.
Cellulose. 28 (6), 3485–3503. https://doi.org/10.1007/s10570-021-03727-8.
Navas, L.E., Carballo, R., Levin, L., Berretta, M.F., 2020. Fast decolorization of azo dyes
in alkaline solutions by a thermostable metal-tolerant bacterial laccase and proposed
degradation pathways. Extremophiles. 24 (5), 705–719. https://doi.org/10.1007/
s00792-020-01186-w.
Qiao, W., Chu, J., Ding, S., Song, X., Yu, L., 2017. Toxic / Hazardous Substances and
Environmental Engineering Characterization of a thermo-alkali-stable laccase from
Bacillus subtilis cjp3 and its application in dyes decolorization. J. Environ. Sci. Heal.
Part A. 52 (8), 710–717. https://doi.org/10.1080/10934529.2017.1301747.
Rahimi, M., Moghadas, S., Motamedi, E., Nasiri, J., Reza, M., Sabokdast, M., 2020.
Proficient dye removal from water using biogenic silver nanoparticles prepared
through solid-state synthetic route. Heliyon. 6, e04730 https://doi.org/10.1016/j.
heliyon.2020.e04730.
10
Bioresource Technology 337 (2021) 125468
Rai, R., Bibra, M., Chadha, B.S., Sani, R.K., 2019. Enhanced hydrolysis of lignocellulosic
biomass with doping of a highly thermostable recombinant laccase. Int. J. Biol.
Macromol. 137, 232–237. https://doi.org/10.1016/j.ijbiomac.2019.06.221.
Rodakiewicz-Nowak, J., Jarosz-Wilkołazka, A., 2007. Catalytic activity of Cerrena
unicolor laccase in aqueous solutions of water-miscible organic solvents —.
Experimental and numerical description. 44 (2), 53–59. https://doi.org/10.1016/j.
molcatb.2006.08.005.
Santhanam, N., Vivanco, J.M., Decker, S.R., Reardon, K.F., 2011. Expression of
industrially relevant laccases: prokaryotic style. Trends Biotechnol. 29 (10),
480–489. https://doi.org/10.1016/j.tibtech.2011.04.005.
Sarkar, S., Banerjee, A., Halder, U., Biswas, R., Bandopadhyay, R., 2017. Degradation of
synthetic Azo dyes of textile industry: a sustainable approach using microbial
enzymes. Water Conserv. Sci. Eng. 2 (4), 121–131. https://doi.org/10.1007/s41101-
017-0031-5.
Senthivelan, T., Kanagaraj, J., Panda, R.C., 2016. Recent trends in fungal laccase for
various industrial applications: An eco-friendly approach - a review. Biotechnol.
Bioprocess Eng. 21 (1), 19–38. https://doi.org/10.1007/s12257-015-0278-7.
Foroozandeh Shahraki, M., Farhadyar, K., Kavousi, K., Azarabad, M.H., Boroomand, A.,
Ariaeenejad, S., Hosseini Salekdeh, G., 2021. A generalized machine-learning aided
method for targeted identification of industrial enzymes from metagenome: a
xylanase temperature dependence case study. Biotechnol. Bioeng. 118 (2), 759–769.
https://doi.org/10.1002/bit.v118.210.1002/bit.27608.
Si, J., Peng, F., Cui, B., 2013. Purification, biochemical characterization and dye
decolorization capacity of an alkali-resistant and metal-tolerant laccase from
Trametes pubescens. Bioresour. Technol. 128, 49–57. https://doi.org/10.1016/j.
biortech.2012.10.085.
Sondhi, S., Sharma, P., Saini, S., Puri, N., Gupta, N., Duhalt, R.V., 2014. Purification and
characterization of an extracellular, thermo-alkali- stable, metal tolerant laccase
from Bacillus tequilensis SN4. PLoS One 9 (5), e96951. https://doi.org/10.1371/
journal.pone.009695110.1371/journal.pone.0096951.g00110.1371/journal.
pone.0096951.g00210.1371/journal.pone.0096951.g00310.1371/journal.
pone.0096951.g00410.1371/journal.pone.0096951.g00510.1371/journal.
pone.0096951.t00110.1371/journal.pone.0096951.t00210.1371/journal.
pone.0096951.t00310.1371/journal.pone.0096951.t00410.1371/journal.
pone.0096951.t00510.1371/journal.pone.0096951.t00610.1371/journal.
pone.0096951.s00110.1371/journal.pone.0096951.s002.
Song, L., Shao, Y., Ning, S., Tan, L., 2017. Performance of a newly isolated salt-tolerant
yeast strain Pichia occidentalis G1 for degrading and detoxifying azo dyes. Bioresour.
Technol. 233, 21–29. https://doi.org/10.1016/j.biortech.2017.02.065.
Ufarté, L., Laville, É., Duquesne, S., Potocki-Veronese, G., 2015. Metagenomics for the
discovery of pollutant degrading enzymes. Biotechnol. Adv. 33 (8), 1845–1854.
https://doi.org/10.1016/j.biotechadv.2015.10.009.
Wang, S.N., Chen, Q.J., Zhu, M.J., Xue, F.Y., Li, W.C., Zhao, T.J., Li, G.D., Zhang, G.Q.,
2018. An extracellular yellow laccase from white rot fungus Trametes sp. F1635 and
its mediator systems for dye decolorization. Biochimie. 148, 46–54. https://doi.org/
10.1016/j.biochi.2018.02.015.
Wang, S.S., Ning, Y.J., Wang, S.N., Zhang, J., Zhang, G.Q., Chen, Q.J., 2017. Purification,
characterization, and cloning of an extracellular laccase with potent dye
decolorizing ability from white rot fungus Cerrena unicolor GSM-01. Int. J. Biol.
Macromol. 95, 920–927. https://doi.org/10.1016/j.ijbiomac.2016.10.079.
Yang, Q., Zhang, M., Zhang, M., Wang, C., Liu, Y., Fan, X., Li, H., 2018. Characterization
of a novel, cold-adapted, and thermostable laccase-like enzyme with high tolerance
for organic solvents and salt and potent dye decolorization ability, derived from a
marine metagenomic library. Front. Microbiol. 9, 1–9. https://doi.org/10.3389/
fmicb.2018.02998.
Yang, X., Wu, Y., Zhang, Y., Yang, E., Qu, Y., Xu, H., Chen, Y., Irbis, C., Yan, J., 2020.
A thermo-active laccase isoenzyme from Trametes trogii and its potential for dye
decolorization at high temperature. Front. Microbiol. 11, 241. https://doi.org/
10.3389/fmicb.2020.00241.
Ye, M., Li, G., Liang, W.Q., Liu, Y.H., 2010. Molecular cloning and characterization of a
novel metagenome-derived multicopper oxidase with alkaline laccase activity and
highly soluble expression. Appl Microbiol Biotechnol. 87 (3), 1023–1031. https://
doi.org/10.1007/s00253-010-2507-5.
Xiao, Y., Li, J., Wu, P., Ning, N.a., Li, J., Shen, Y., Huang, Q., Ni, J., 2021. An alkaline
thermostable laccase from termite gut associated strain of Bacillus stratosphericus. Int.
J. Biol. Macromol. 179, 270–278.
Zhang, C., Diao, H., Lu, F., Bie, X., Wang, Y., Lu, Z., 2012. Degradation of
triphenylmethane dyes using a temperature and pH stable spore laccase from a novel
strain of Bacillus vallismortis. Bioresour. Technol. 126, 80–86. https://doi.org/
10.1016/j.biortech.2012.09.055.
Zhong, K., Lin, Z.-T., Zheng, X.-L., Jiang, G.-B., Fang, Y.-S., Mao, X.-Y., Liao, Z.-W., 2013.
Starch derivative-based superabsorbent with integration of water-retaining and
controlled-release fertilizers. Carbohydr. Polym. 92 (2), 1367–1376. https://doi.org/
10.1016/j.carbpol.2012.10.030.