See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/283296189

A pharmacological and phytochemical study of medicinal plants used in Mexican

folk medicine

Article  in  Indian Journal of Traditional Knowledge · October 2015

CITATIONS READS

17 663

9 authors, including:

jose alberto Mendoza Rayn Clarenc Aarland

Autonomous University of Mexico City University of Guadalajara
63 PUBLICATIONS   264 CITATIONS    13 PUBLICATIONS   59 CITATIONS   

SEE PROFILE SEE PROFILE

Juan Manuel Villa-Hernández Fernando Díaz de León-Sánchez

Universidad del Mar (Mexico) Metropolitan Autonomous University
13 PUBLICATIONS   100 CITATIONS    36 PUBLICATIONS   204 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Natural products chemistry View project

EVALUACIÓN DEL POTENCIAL FARMACOLÓGICO DE LOS EXTRACTOS METANÓLICOS DE CÁSCARAS DE FRUTAS TROPICALES: Annona squamosa L. (SARAMUYO), Annona
reticulata L. (ANONA), Chrysophyllum cainito L. (CAIMITO) Y Melicoccus bijugatus Jacq. (HUAYA) View project

All content following this page was uploaded by jose alberto Mendoza on 28 October 2015.

The user has requested enhancement of the downloaded file.

Indian Journal of Traditional Knowledge
Vol. 14(4), October 2015, pp. 550-557

A pharmacological and phytochemical study of medicinal plants used in

Mexican folk medicine
Rayn Clarenc Aarland1, Susana Peralta-Gómez2, Cesar Morales Sanchéz2, Francisco Parra-Bustamante2, Juan Manuel
Villa-Hernández1, Fernando Díaz de León-Sánchez1, Laura J Pérez-Flores1, Fernando Rivera-Cabrera1 &
José Alberto Mendoza-Espinoza2*
1
Laboratorio de Fisiología, Bioquímica y Biología Molecular de Plantas, Universidad Autónoma Metropolitana-Iztapalapa,
2
Colegio de Ciencias y Humanidades, Universidad Autónoma de la Ciudad de México.
*E-mail: amendozaespinoza@gmail.com
Received 13 October 2014, revised 26 February 2015
Sonora market is one of the most important places in Latin America for management of traditional medicine due to the
convergence of knowledge from several different indigenous communities. For this reason we decided to apply the
standardization methodology proposed by the World Health Organization (WHO) and adapted by our research group to a total
of ten plants used in the Sonora market, because of their referred antioxidant properties. A fragment of 18S rDNA of four of
these plants was registered in GenBank database 2014 (http://www.ncbi.nlm.nih.gov/genbank/). Quantitative analysis showed
that the E. angustifolia® commercial extract (Maryel Natura Gold) contains higher levels of total flavonoids than the extracts of
the plants used in the Sonora market. However, chlorogenic acid was found in Castela erecta Turpin ssp “chaparro amargo”,
Larrea tridentata (Sessé & Moc. ex DC.) Coville “gobernadora”, Opuntia ficus-indica (L.) Mill. “Raíz de nopal”, Tecoma
stans “tronadora”, and Ibervillea sonorae (S. Watson) Greene “Wereke”, but not in the E. angustifolia® extract. Antioxidant
activity was higher in the E. angustifolia® extract compared to the extracts of evaluated plants. This information will serve as
basis for progress in the recovery, standardization, pharmacological characterization and application of medicinal plants used in
Mexican traditional medicine.

Keywords: Pharmacological characterization, Mexico, Folk medicine, E. angustifolia DC., Antioxidant activity,
Molecular identification
IPC Int. Cl.8: A61K 36/00, C09K 15/00, G06F 19/10, C07C 7/13, C01B 37/00, C01B 39/00

In order to meet their basic needs, man has always had
a close relationship with plants. Folk or indigenous
medicine is the result of this relationship1 and still
plays an important role in continents like Africa, Asia
and America. The World Health Organization (WHO)
has paid attention to the success achieved by Eastern
countries like China, where incorporation of medicinal
plants into official medicine resulted in their clinical
assessment. In the last four years, the Food and Drug
Administration (FDA) has approved three treatments
based on herbal mixtures (antiallergic, anticancer,
antipsoriatic)2; this fact could change the current view
of traditional medicine in the world. In order to
approve treatments based on medicinal plants, the
establishment of protocols that allow the
standardization of the process is required. This
standardization consists of two main stages; in the first,
safety and identity of the product must be guaranteed.
In the second, chemical content of the extract must be

*Corresponding author
guaranteed in order to achieve the desired
pharmacological effect. To do so, it is necessary to
measure some parameters of their chemical
composition such as the presence of major chemical
groups through qualitative analysis combined with the
quantification of some secondary metabolites.
Determination of metabolite fingerprints by using
various analytical techniques such as HPLC, UV-Vis
spectrum, GC-MS analysis, among others, is also part
of the standardization process3. Finally, it is necessary
to perform some in vitro or in vivo pharmacological
essays.
Mexico is one of the five mega diverse countries of
the world given that about 50% of the 22,000 vascular
plant species are endemic4, and similarly to other
countries, the use of native and incorporated medicinal
plants is a common alternative to conventional
medicine in some rural communities. Markets are the
most common sites for obtaining these plants.
However, their clinical use has not resulted in the
development of scientific methodologies; for this
 AARLAND et al.: PHARMACOLOGICAL & PHYTOCHEMICAL STUDY OF MEDICINAL PLANTS USED BY MEXICAN FOLK
reason, they cannot be incorporated into official
medicine5. In this context, the objective of the present
work was to apply the methodology to standardize
medicinal plants to ten of the most used medicinal
plants in the Sonora Market in order to contribute to
the knowledge of Mexican medicinal plants.
Methodology
Biological material
Medicinal plants were selected by ethnobotanical
study. In this study, the common name for each plant
was obtained and then, scientific names were searched
for in the catalogue of common and scientific names of
Mexican plants as a first approach, and corroborated
with the taxonomic classification of Mexican plants by
Calderon and Rezdowski (2005)6. These studies were
conducted by the taxonomist Susana Peralta of the
Plantel Casa Libertad Herbarium. A commercial
extract of Echinacea angustifolia manufactured by
Maryel Natural Gold, Mérida, Yucatán, México, was
obtained from a local merchandiser.
DNA isolation and 18S gene amplification
Total DNA was isolated from 50 mg of dry leaf
from each plant using Axy Prep Multisource Genomic
DNA Miniprep kit (Axygen Biosciences®, CA, USA).
DNA was resuspended in 100 µL of DEPC-treated
water. DNA purity was determined by
A260nm/A280nm ratio and its concentration was
quantified using a Nanodrop 2000 (Thermo Scientific,
Wilmington, DE. USA). Integrity of all samples was
verified by gel electrophoresis using 100 ng. For
amplifying 18S gene, the following primers were used:
Fwd: 5’–GTGGCCTAAACGGCCATAGTCCCTC- 3’
and Rv: 5’ –GGAAACTTACCAGGTCCAGAGAT
AG- 3’ based on the published maize sequences
(Accession number AF168884)7. The amplicon was
purified with the Wizard® SV Gel kit and the PCR
Clean-Up System (Promega, Madison, USA) and
sequenced by the Sanger method (Applied Biosystems
ABI, Hitachi 3130XL Prism Genetic Analyzer,
Mariland, USA).
Preparation of extracts
For obtaining the extracts, biological material (200 g)
was dried and macerated starting with hexane (1000
mL). After a week of maceration, the solvent was
recovered by filtering and it was concentrated under
reduced pressure to obtain the solid extract. The
filtered parts of the plant were macerated once again
with ethyl acetate (1000 mL) and afterwards with
methanol (1000 mL) using the same process described
551
for hexane. Samples were refrigerated at 4ºC until their
further analysis8.
Qualitative analyses
Determination of alkaloids
An aliquot of 0.1 mL of each extract was applied on
silica gel 60F254 plates (3 x 5 cm). Plates were eluted
with chloroform-methanol 95:5 v/v and revealed with
the Dragendorff reagent. Formation of red-brown spots
indicates the presence of alkaloids8.
Detection of tannins
The extracts obtained (2 mg) were dissolved in 10
mL of distilled water. The solution was divided into 3
test tubes and treated with: a gelatin solution 1% (w/v)
in test tube number 1; a gelatin- salt reagent (1 gm of
gelatin and 10 gm of NaCl dissolved in 100 mL of
distilled water) in test tube number 2; saline solution
(NaCl 10% (w/v)) in test tube number 3. The
appearance of a white precipitate in test tubes number 1
& 2 and the absence of such precipitate in test tube
number 3 indicate the presence of tannins8.
Determination of saponins
The extracts obtained (2 mg) were placed in a tube
containing 10 mL of distilled water and then, incubated
in a water bath at 80 °C during 30 min. Afterwards, the
tube was allowed to cool, stirred vigorously and left to
stand for 15 to 20 minutes8. The presence and level of
saponins was assessed by measuring the height of the
foam formed.
Determination of free anthracene derivatives
Silica gel plates 60F254 of 3x5 cm were cut and an
aliquot (0.1 mL) of each extract was applied. Plates were
eluted with the same solvents used for alkaloids
determination. Yellow or red fluorescent spots under
UV-light indicate the presence of free anthracene
derivatives8.
Determination of volatile coumarins
The extracts obtained (2 mg) were added to 10 mL
of distilled water were covered with filter paper
moistened in a caustic soda solution (1gm in 15mL)
and heated until boiling point. After 5 minutes, the
filter paper was removed from the tube, dried and
exposed to UV-light. Blue fluorescence indicates the
presence of volatile coumarins8.
Quantitative analyses
Total phenolic compounds
Total phenolic compounds were measured as
described by Singlenton and Rossi (1965)9 using a
552 INDIAN J TRADIT KNOWLE, VOL 4, NO. 4, OCTOBER 2015
spectrophotometer (6705 UV/VIS JENWAY). Gallic
acid was used as standard.
Total flavonoids
Total flavonoids were measured by the chloride
aluminum method as described by Chang et al.
(2002)10 using a spectrophotometer (6705 UV/VIS
JENWAY). Quercetin was used as standard.
Caffeic and chlorogenic acid determination
Caffeic and Chlorogenic acid determinations were
performed according to Pellati et al. (2011)11 with
slight modifications. An HPLC Agilent 1200 series
system consisting of a degasser, a quaternary pump,
an autosampler, a thermostatted column compartment,
and a UV detector was used for the determinations. A
µBondapakTM C18 (3.9 x 300 mm, W00671T018 serial
number) column was used for the analyses; the
column temperature was set at 30 ºC. The mobile
phase consisted of (A) 0.1% (v/v) acetic acid in H2O
and (B) acetonitrile. The gradient elution was as
follows: initial, 15% B; 0-10 min, from 15 to 30% B;
10-18 min, from 30 to 65% B; 18-25 min, from 65 to
80% B; 25- 30 min from 80 to 90% B, 30- 35 min,
linear gradient B. The post-running time was 3 min at
a 1 mL min-1 flow rate. Sample injection volume was
20 µL. The DAD acquisition range was 250-350 nm
and peak integration was performed at 320 nm.
Pharmacological analysis
Analysis of toxicity using Artemia salina bioassay
Toxicity activity was measured using the A. salina
bioassay described by Meyer et al. in 1982 and
adjusted by our investigation group8.
Antioxidant activity measured using DPPH
Antioxidant activity was determined by
diphenylpicrylhydrazyl (DPPH) assay described by
Brand-Williams et al. in 199512 using a
spectrophotometer JENWAY 6705 UV/VIS. Trolox
was used as positive control (See, S1).
Antioxidant activity measured using ABTS+
Antioxidant capacity was measured according to
the method described by Rivero-Pérez et al. in 200713
using a spectrophotometer JENWAY 6705 UV/VIS.
Trolox was used as positive control (See, S1).
UV/Vis Spectrum
The solid extract (10 mg) was dissolved in 5 mL
methanol and then the solution was filtered. Spectra
were obtained using a spectrophotometer (6705
UV/VIS JENWAY) within an acquisition range from
190 to 1100 nm.
Results and discussion
The Sonora Market is one of the most important
places in Mexico City for selling and buying
medicinal plants, this market has sales of about 160
tons per month. There, the traditional knowledge of
several indigenous communities of the Mexican
Valley converges. Sonora Market was officially
named in 1974 when this center of popular commerce
took its current structure, made up of 10,262 m2
distributed in two areas. In the first area, there are 11
aisles where ceramic, handcrafted decorative and
herbal items, as well as Mexican toys, alebrijes
(alebrijes are colored Mexican folk art sculptures of
imaginary creatures) and seasonal items for any social
event, animals and pet accessories can be found. The
second area houses stalls selling saint images, herbs
and medicinal plants. Regarding herbalism, plants
availability in the market stalls depend on the demand
for the product, as well as its natural availability in its
native environment.
As a result of the ethnobotanical and bibliographic
study a total of 10 plants used in the Sonora Market for
its referred antioxidant properties for curing and
preventing several illnesses were selected (Table 1); it
is important to mention that these plants are among the
most bought by consumers for several ailments. Once
the plants were obtained in the market, they were
identified as described in the section of materials and
methods and a literature review was conducted to know
the pharmacological properties reported in PubMed
(http://www.ncbi.nlm.nih.gov/pubmed) for these
plants. From the 10 selected plants, 5: Cecropia
obtusifolia Bertol., Bryophyllum pinnatum (Lam.)
Oken, Opuntia indica, Tecoma stans (L.) Juss. ex
Kunth and Ibervillea sonorae (S. Watson) Greene have
been mentioned for their hypoglycemic properties,
while Larrea tridentata (Sessé & Moc. ex DC.)
Coville, Castela erecta Turpin ssp., Guazuma ulmifolia
Lam., and Frangula purshiana Cooper syn Rhamnus
purshiana DC. have been associated with other
pharmacological properties as shown in Table 1. No
pharmacological studies were found for Swietenia
humilis Zucc.; however, there are some ethnobotanical
studies reported in the Digital Library of
Mexican Traditional Medicine developed by the
National Autonomous University of México
(seewww.medicinaltradicionalmexicana.unam.mx) and
in the Sonora Market (Table 1). This makes Swietenia
 AARLAND et al.: PHARMACOLOGICAL & PHYTOCHEMICAL STUDY OF MEDICINAL PLANTS USED BY MEXICAN FOLK 553

humilis Zucc. an interesting candidate for studying its
antibiotic properties that have been empirically
reported, but not pharmacologically validated.
In addition, a conserved region of the 18S
ribosomal gene from each of the ten selected plants
was amplified and sequenced as previously described
in materials and methods (Table 2). The alignment of
the obtained sequences to sequences previously
reported allows having a molecular reference for
identification of the analyzed biological material.
However, the selected plants are not registered in the
GenBank database (http://www.ncbi.nlm.nih.gov/
genbank/). The conserved fragment of 18S of 4 of the
10 plants studied, were registered by our group in
GenBank with the following accession numbers:
Cáscara Sagrada (Frangula purshiana Cooper syn.
Rhamnus purshiana DC., KJ937009), Guarumbo
(Cecropia obtusifolia Bertol., KJ937006), Guazima
(Guazuma ulmifolia Lam., KJ937008), and Wereke
(Ibervillea sonorae (S. Watson) Greene, KJ937007)
the others are shown in Table 2.
Qualitative and toxicity analyses were performed in
the extracts obtained using the three solvents: hexane,
ethyl acetate and methanol. In contrast, quantitative
and pharmacological analyses were determined only
in the methanolic extract, since this is the most similar
to the Echinacea angustifolia DC. hydroalcoholic
extract used for comparison. Also, the plants selected

Table 1Bibliographic review and empirical uses of plants used in the Sonora Market
a. Common name Chemical and pharmacological properties as Empirical uses in the Sonora Market and
b. Scientific name documented in Pubmed (revised in 2014). information contained in the Digital Library of
Mexican Traditional Medicine developed by
National Autonomous University of México
(UNAM).
a. Cáscara sagrada Aflatoxins and glycosides have been assessed15. Recommended for treating diabetes. It is
b. Frangula purshiana Cooper Anti-hepatoma16 and laxative17 properties have been recommended for treating habitual constipation and
syn. Rhamnus purshiana DC. validated. hemorrhoids. Also used for treating indigestion.
a. Chaparro amargo Toxicity studies on extracts of this plant have been Useful in the treatment of dysentery and chronic
b. Castela erecta Turpin ssp. performed17. diarrhea. It is a strong antioxidant that helps to
prevent cellular disorders like cancer.
a. Gobernadora Toxicity and studies of its antioxidant properties Most commonly used to treat kidney stones. It is
b. Larrea tridentata have been performed18. It is also known for its also used to relieve pain from rheumatism. It has
(Sessé & Moc. ex DC.) Coville diuretic properties. been also reported for treating anemia, diabetes,
headache, cough, ulcer, blood pressure and foot
infections.
a. Guarumbo Chlorogenic acid has been extracted19. Treatment Used to treat asthma, hepatic diseases, rheumatism,
b. Cecropia obtusifolia Bertol. for diabetes20. obesity, heart diseases, nervousness, fever, body
aches and dropsy.
a. Guazima Antidiabetic effects20. Used to gastrointestinal disorders, abdominal pain,
b. Guazuma ulmifolia Lam. stomach pain, liver disease, digestive ailments and
gallstones.
a. Prodigiosa Anti-inflammatory, antidiabetic and Mostly employed for treating gallstones. Used to
b. Brickellia cavanillesii (Cass.) antimicrobial activities have been assessed21. treat heart diseases and malaria. Also used to treat
A. Gray (Cass.) A. Gray scabies, swollen stomach and intestinal infections.
a. Raíz de nopal It has been used for weight control because of its Used to treat hyperglycemia, cholesterol, obesity,
b. Opuntia ficus-indica (L.) Mill. high fiber content and to control diabetes22. digestive problems, colitis and diverticulitis. Local
prescription at the Sonora Market.
a. Semilla de zopilote No pharmacological studies were found. Used to alleviate various hair diseases;
b. Swietenia humilis Zucc. recommended against urinary tract infections,
vomiting, malaria and swollen spleen. Also used to
treat chest pain, cough, cancer, amebiasis and for its
anthelmintic properties.
a. Tronadora Antimicrobial studies have been performed. Used as treatment for various digestive ailments.
b. Tecoma stans (L.) Juss. It has also shown antiglycemic properties23. Also mentioned as an appetite stimulant and for
ex Kunth toothaches.
a. Wereke Hypoglycemic effects have been reported24. Used for rheumatism and to treat wounds difficult
b. Ibervillea sonorae to heal. It is also used by people who eat a lot of
(S. Watson) Greene sugar and slim fast.
a. Echinacea angustifolia Used to prevent respiratory tract infections, to treat common cold and to enhance the immune system25.
b. Echinacea angustifolia DC.
554 INDIAN J TRADIT KNOWLE, VOL 4, NO. 4, OCTOBER 2015

Table 2Common names, 18S rDNA partial sequence (in capital letters) of Mexican plants used in traditional medicine
Chaparro amargo:
ACGCCCCCCCCGGGGGGGGGGTGAAAAAGGAAGAGCCCCCCCCCCCCCCCCCTCCCCCCGCGCGGCGCCCTTTTT
Gobernadora:
GGTCAATCAGCTCTTCTGATCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGA
ACGAGAC CTCAGCCTGCTAACTAGCTATGCGGAGGCATCCCTTCGCAGCTAGCTTCTTAGAGGGACTATGGCCGTTTAGGCCACA
Prodigiosa:
GGAATTCGAACAGCAAAACTCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTG
GTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTATGTGGAGGTATCCCTCCATGGCCAGCTTCTTAGAGGG
ACTATGGCCGTTTAGGCCAC
Raíz de nopal:
AATGCGACACTCGAGCTCTTCATGATCTATGGGTGGTGGTGCAATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGTGTTA
ATTCCGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTACGCGGAGGCATCCCTCCGCGGCCAGCTTCTTAGAGGGACTA
TGGCCGTTTAGGCCACCA
Semilla de zopilote:
TTTCTTCCTTCCTGGTCTTAGCTCTTTTCATGATTTCTATGGGTGGTGGTGCAATGGCCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTT
AATAACCAGTTAAACGAACGAGACCTCAGCCTGCTAACTAGCTACGCGGAGGATACCCTCCGCGGCCAGCTTCTTAGAGGGACTATGG
CCGTTTAGGCCAC
Tronadora:
TCTTCCGCCGGGGGGGGGAAAGAGGGGGGGGAACTTTTTTTTTTTCTTCCTCCCCCCCCCGGCCCCCCTCGCCCCCCCCCT
Table 3Evaluation of the presence of major chemical groups
Hexane (C6H14) Ethyl acetate (C4H8O2) Methanol (CH3OH)
Common name A B C D E A B C D E A B C D E
Cáscara sagrada ++ - - - ++ ++ + - - + - - + - +
Chaparro amargo ++ ++ - - + +++ ++ - - + + - - - ++
Gobernadora + - ++ - ++ ++ - - - ++ ++ - - - +++
Guarumbo +++ - - - - +++ - - - - + - + - +
Guazima +++ - - - ++ +++ - + - - + - - - +
Prodigiosa ++ - - - ++ +++ - - - +++ +++ - ++ - +
Raíz de nopal - ++ + - - - + ++ - - - ++
Semilla de zopilote - - - - + - +++ - - + ++ - - - ++
Tronadora ++ - - - - ++ ++ - - ++ ++ - - - ++
Wereke - - ++ - ++ - - - - ++ - - +++ - ++
(A) Anthraquinones, (B) tannins; (C) saponins; (D) coumarins; (E) alkaloids. Qualitative scale: - No presence was observed. Presence: + low, ++
moderate, +++ high. Methods used as formerly described.

for the study are used as aqueous infusion for its
therapeutic application.
Qualitative preliminary tests were carried out in the
plants selected in the Sonora Market to determine the
presence of different chemical groups shown in Table
3. Alkaloids, anthraquinones, tannis, saponins and
coumarins are among the chemical groups associated
to the therapeutic principles evaluated in each of the
extracts. This qualitative evaluation represents an
initial characterization. Since, it is a qualitative study
we cannot obtain an absolute value for comparing to
other plant species; however, it is possible to compare
the plants used in the study among them. Results
show that ‘prodigiosa’ ethyl acetate extract and
‘gobernadora’ methanolic extract contained the
highest content of alkaloids; regarding saponins,
hexane and ethyl acetate extracts of ‘wereke’ showed
the highest levels. Coumarins were not detected in
any of the analyzed species.
Chemical groups of interest such as caffeic acid,
chlorogenic acid, total phenols, and total flavonoids.
Caffeic and chlorogenic acids are compounds with
pharmacological properties related to antioxidant
protection. Since, these compounds are reported in
many plants with antioxidant properties, they represent
a good chemical marker. It is important to mention that
E. angustifolia was chosen as control because there are
several studies that report high contents of these
compounds in this plant and therefore, it represents a
parameter for comparison to the plants used in Mexican
traditional medicine. Content of these compounds is
reported in Table 4. Caffeic acid was detected in
Rhamnus purshiana “Cáscara sagrada”, Opuntia ficus
“raíz de nopal” and Ibervillea sonorae “Wereke”,
showing Cáscara sagrada much lower concentrations
than the E. angustifolia® extract. Regarding
chlorogenic acid, which was not detected in
the Echinacea extract, we found concentrations of 32.3,
 AARLAND et al.: PHARMACOLOGICAL & PHYTOCHEMICAL STUDY OF MEDICINAL PLANTS USED BY MEXICAN FOLK 555

Table 4Phytochemical quantitative analyses and pharmacological assay

Caffeic Chlorogenic Total Total Antioxidant Antioxidant Toxicity assay
acida acida phenolsb flavonoidsc capacity (DPPH)d Capacity (ABTS)d Artemia salinae
Cáscara sagrada 0.022 n.d. 1133 ± 41 9.56 ± 0.08 0.28±0.05 0.09 ± 0.002 1535
Chaparro amargo n.d. 32.3 154 ± 17 6.77 ± 0.53 0.16±0.01 n.d. 1551
Gobernadora n.d. 21.4 476 ± 11 0.88 ± 0.05 0.06±0.01 0.04 ± 0.002 1592
Guarumbo n.d. n.d. 146 ± 14 0.63 ± 0.03 0.08± 0.002 0.12 ± 0.002 276
Guazima n.d. n.d. 58 ± 7 2.87 ± 0.59 0.05 ± 0.003 0.01 ± 0.001 300
Prodigiosa n.d. n.d. 708 ± 29 0.31 ± 0.02 0.05± 0.006 0.06 ± 0.001 254
Raíz de nopal 0.804 90.4 537 ± 31 0.19 ± 0.02 0.70± 0.04 0.11 ± 0.005 260
Semilla de zopilote n.d. n.d. 1040 ± 57 0.80 ± 0.02 0.31 ± 0.04 0.003 ± 0.0002 1529
Tronadora n.d. 34.6 411 ± 10 5.76 ± 0.47 0.03±0.002 0.06 ± 0.004 1550
Wereke 0.559 15.7 747 ± 42 5.41 ± 0.43 n.d 0.004 ± 0 1536
Echinacea angustifolia®. 0.368 n.d. 826 ± 11 15.70 ± 0.13 44.55±2.98 76.22 ± 3.81 1535

Only methanol extracts were analyzed

Expressed as: (a) ppm, (b) gallic acid milliequivalents/g dry weight, (c) quercetin milliequivalents/g dry weight, (d) trolox millimolar
equivalents/ gm dry weight, (e) toxicity was expressed as lethal dose fifty DL50 (ppm, mg/mL). n.d = not detected

21.4, 90.4, 34.6 and 15.7 ppm per gm of dry weight in

the Mexican plants Castela erecta ssp “Chaparro
amargo”, Larrea tridentata “Gobernadora”, Opuntia
ficus “raíz de nopal”, Tecoma stans “Tronadora” and
Ibervillea sonorae “Wereke”, respectively (S2). In
regards to total phenolic compounds and total flavonoids
content, Rhamnus purshiana “Cáscara sagrada” and
Semilla de zopilote showed a high content of total
phenolic compounds (for statistical differences in the
flavonoids and phenols content between plants see
supporting information). Even though total phenols in
these Mexican species were higher than in the
E. angustifolia® extract, the Echinacea extract showed a
stronger antioxidant activity, regarding the Mexican
plants, we did not find statistical differences between
groups (See supporting information S3). Echinacea
angustifolia® had the highest concentration of total
flavonoids evaluated as milliequivalents of quercetin per
gram of dry weight. We observed poor correlations
between total phenolic compounds vs the antioxidant
capacity and a better correlation between total flavonoid
content and antioxidant capacity. The use of a wider range
of plants is recommended in order to come to a better
conclusion regarding the correlations. See supporting
information S4-S7. There was a strong correlation
(R2= 0.9998) between DPPH vs ABTS+, however, when
we eliminated the value of Echinacea angustifolia® we
Fig. 1UV absorption spectrum
obtained a bad correlation. These results suggest that for
this correlation analysis it is necessary to have The HPLC method has been used to obtain the
intermediate values (S8). It is important to mention that fingerprint profiles14 in this case we decided to use
neither the extracts obtained from the Mexican plants nor ultraviolet-visible (UV-VIS) absorption spectrum
the Echinacea angustifolia® extract were active against because this method is more versatile and can be used
nauplii of Artemia salina, considering that values higher as an extra chemical control. (UV-VIS) Spectra of the
than 200 ppm of the crude extract are considered as toxic. ten Mexican plants are shown in Fig. 1.
556 INDIAN J TRADIT KNOWLE, VOL 4, NO. 4, OCTOBER 2015
Conclusion
This work presents the analysis of 10 plants used in
the Sonora Market; 5 of them have been previously
studied for their antiglycemic properties and the other 5
selected species have been related to diverse
pharmacological properties. It is noteworthy that
Swietenia humilis Zucc. “Semilla de zopilote” has
extensive medicinal uses, as ethno botanical data
indicate, but there are no pharmacological studies that
validate them and therefore, it becomes an interesting
species to study in order to find its active compounds
or to develop the standardization process to obtain an
herbal medicine. In the present study, it was shown that
Swietenia humilis “Semilla de zopilote” has a moderate
activity in the Artemia salina model and its antioxidant
capacity was lower than that of Echinacea
angustifolia®.
None of the studied plants have a chemical and
pharmacological profile that leads us to a standardize
treatment, for this reason; the standardization
procedure proposed by our research group in 2014
was applied. Main chemical components, antioxidant
capacity, as well as the chemical UV spectrum of the
analyzed plants are reported. These data will
contribute to the knowledge required for their
standardization to make possible their incorporation
as herbal treatments in the official medicine.
Acknowledgement
This work was partially financed by Universidad
Autónoma Metropolitana-Iztapalapa, Universidad
Autónoma de la Ciudad de México and SECITI. We
also thank CONACYT (No. 248821) for financial
support to Rayn Clarenc Aarland during his Ph.D.
studies (PNP Experimental Biology Program). This
work is part of R. Clarenc Aarland PhD (UAM-I)
dissertation and Cesar Morales Sánchez and Francisco
Parra-Bustamante LPS (UACM) dissertations.
References
1 Koehn F & Carter G, The evolving role of natural products in
drug discovery, Nat Rev Drug Disc, 4 (2005) 206-220.
2 Newman D & Cragg G, Natural Products as sources of new
drugs over the 30 years from 1981 to 2010, J Nat Prod, 75(3)
(2012) 311-335.
3 Aarland R, Rivera-Cabrera F, Perez-Flores L, Díaz de León-
Sánchez F & Mendoza-Espinoza JA, Relevance of chemical
Standardization and Innocuousness in the Process of
Development of Herbal Medicines: A Review, Asian J Plant
Sci, 13 (2014) 1-7.
4 Villaseñor JL, Los géneros de las plantas vasculares de la flora
de México, Boletín de la Sociedad Botánica de México, 75
(2014) 105-135.
5 Schlaepfer L & Mendoza-Espinoza JA, Las Plantas
Medicinales en la Lucha Contra el Cáncer, Relevancia para
México, Revista Mexicana de la Asociación Farmacéutica, 41
(2010) 18-27.
6 Calderón RG & Rzedowski J, Flora fanerogámica del Valle de
México, 2a edn, (CONABIO, Instituto de Ecología AC,
México), 2005.
7 A) Sambrook J, Fritsch E & Maniatis T, Molecular Cloning: A
Laboratory Manual, second ed. Cold Spring Harbor
Laboratory Press, NY. 1989. B) Villa-Hernández J, Dinkova
T, Aguilar-Caballero R, Rivera-Cabrera F, Sánchez de Jiménez
E, & Pérez-Flores LJ. Regulation of ribosome biogenesis in
maize embryonic axes during germination, Biochimie, 95
(2013) 1871-1879.
8 Peralta-Gómez S, Aarland R, Campos-Lara M, Jiménez-Lara M
& Mendoza-Espinoza JA, Toxicity Analysis, Phytochemical and
Pharmacological Study of the Plant Known as Mora Herb,
Collected at the Environmental Education Center of Yautlica
(CEA-Yautlica), Asian J Plant Sci, 12 (2013) 159-164.
9 Singlenton V & Rossi J, Colorimetry of total phenolics with
phosphomolyb-diphosphotungstic acid reagents, Am J Enol
Viticult, 16 (1965) 144-158.
10 Chan C, Yang M, Wen H & Chern J, Estimation of total
flavonoid content in propolis by two complementary
colorimetric methods, J Food Drug Ana, 10 (2002) 178-182.
11 Pellati F, Epifano F, Contaldo N, Orlandini G, Cavicchi L,
Genovese S, Bertelli D, Benvenuti S, Curini M, Bertaccini A
& Bellardi M G, Chromatographic methods for metabolite
profiling of virus- and phytoplasma-infected plants of
Echinacea purpurea, J Agric Food Chem, 59(19) (2011)
10425-10434.
12 Brand-Williams W, Cuvelier M & Berset C, Use of free
radical method to evaluate antioxidant activity, Lebensmittel-
Wissenschaft Technol, 28 (1995) 25-30.
13 Rivero-Pérez M, Muñiz P & González-Sanjosé L, Antioxidant
profile of red wines evaluated by total antioxidant capacity,
scavenger activity, and biomarkers of oxidative stress
methodologies, J Agric Food Chem, 55 (2007) 5476-5483.
14 Kim EY, Kim JA, Jeon HJ, Kim S, Kim YH, Kim HY &
Whang WK, Chemical fingerprinting of Codonopsis pilosula
and simultaneous analysis of its major components by HPLC-
UV, Arch Pharmacal Res, 37 (2014) 1148-1158.
15 Lin L, Liu L, Chiang L & Lin C, In vitro anti-hepatoma
activity of fifteen natural medicines from Canada, Phytother
Res, 16(5) (2002) 440- 444.
16 Aguilar-Santamaría L, Ramírez G, Nicasio P, Alegría-Reyes C
& Herrera-Arellano A, Antidiabetic activities of Tecoma stans
(l.) Juss. ex Kunth, J Ethnopharmacol, 124(2) (2009) 284-288
17 Yam-Canul P, Chirino Y, Sánchez-González D, Martínez-
Martínez, Cruz C, Villanueva C & Pedraza-Chaverri J,
Nordihydroguaiaretic acid attenuates potassium dichromate-
induced oxidative stress and nephrotoxicity, Food Chem
Toxicol, 46(3) (2008) 1089-1096.
18 Yokosuka A, Matsuo Y, Jitsuno M, Adachi K & Mimaki Y,
Larrealignans A and B, novel lignan glycosides from the aerial
parts of Larrea tridentate, Chem Pharmaceut Bull, 59(12)
(2011) 1467-1470.
19 Jitsuno M & Mimaki. Triterpene glycosides from the aerial
parts of Larrea tridentate, Phytochemistry, 71(17) (2010)
2157-2167.
 AARLAND et al.: PHARMACOLOGICAL & PHYTOCHEMICAL STUDY OF MEDICINAL PLANTS USED BY MEXICAN FOLK
20 (A) Alonso-Castro A, Miranda-Torres A, González-Chávez
M & Salazar-Olivo L, Cecropia obtusifolia Bertol and its
active compound, chlorogenic acid, stimulate 2-NBDglucose
uptake in both insulin-sensitive and insulin-resistant 3T3
adipocytes, J Ethnopharmacol, 120(3) (2008) 458-464. (B)
Revilla-Monsalve M, Andrade-Cetto A, Palomino-Garibay
M, Wiedenfeld H & Islas-Andrade S, Hypoglycemic effect
of Cecropia obtusifolia Bertol aqueous extracts on type 2
diabetic patients, J Ethnopharmacol, 111(3) (2007) 636-640.
21 Andrade-Cetto A, Becerra-Jiménez J & Cárdenas-Vázquez
R, Alfa-glucosidase-inhibiting activity of some Mexican
plants used in the treatment of type 2 diabetes, J
Ethnopharmacol, 116(1) (2008) 27-32.
22 (A) Ojewole J, Antinociceptive, anti-inflammatory &
antidiabetic effects of Bryophyllum pinnatum (Crassulaceae)
leaf aqueous extract, J Ethnopharmacol, 99(1) (2005) 13-19.
(B) Akinpelu D, Antimicrobial activity of Bryophyllum
pinnatum leaves, Fitoterapia, 71(2) (2000) 193-194.
23 (A) Vázquez R, Olguín-Martínez M, Kubli-Garfías C &
Hernández-Muñóz R, Reversing gastric mucosal alterations
during ethanol-induced chronic gastritis in rats by oral
administration of Opuntia ficus-indica mucilage, World J
View publication stats
557
Gastroenterol, 12(27) (2006) 4318-4324. (B) Godard M,
Ewing B, Pischel I, Ziegler A, Benedek B & Feistel B, Acute
blood glucose lowering effects and long-term safety of
Opuntia supplementation in pre-diabetic males and females,
J Ethnopharmacol, 130(3) (2010) 631-634.
24 (A) Al-Azzawi A, Al-Khateeb E, Al-Sameraei K & Al-
Juboori A, Antibacterial activity and the histopathological
study of crude extracts and isolated tecomine from Tecoma
stans Bignoniaceae in Iraq, Pharmacog Res, 4(1) (2012) 37-
43. (B) Hammouda Y & Khalafallah N, Stability of
tecomine, the major antidiabetic factor of Tecoma stans
(Juss.) f. bignoniaceae, J Pharmaceut Sci, 60(8) (1971)
1142-1145.
25 Rivera-Ramírez F, Escalona-Cardoso G, Garduño-Siciliano
L, Galaviz-Hernández C & Paniagua-Castro N, Antiobesity
and hypoglycaemic effects of aqueous extract of Ibervillea
sonorae in mice fed a high-fat diet with fructose, J Biomed
Biotechnol, 2011 (2011) 968-984.
26 Di Pierro F, Rapacioli G, Ferrara T & Stefan T, Use of a
standardized extract from Echinacea angustifolia
(Polinacea®) for the prevention of respiratory tract
infections, Altern Med Rev, 17(1) (2012) 36- 41