LWT - Food Science and Technology 154 (2022) 112865

Contents lists available at ScienceDirect

LWT
journal homepage: www.elsevier.com/locate/lwt

Whey protein influences the production and activity of extracellular

protease from Pseudomonas fluorescens W3
Yu Wang , Jialei Sun , Yingwang Deng , Yuanqiang Tu , Haiyue Niu , Wenjing Cai , Xue Han *
School of Chemistry and Chemical Engineering, Harbin Institute of Technology, Harbin, 150001, China

A R T I C L E I N F O A B S T R A C T

Keywords: The heat-resistant protease secreted by Pseudomonas in raw milk is an important reason for reducing the quality
Pseudomonas fluorescens of dairy foods. Protease from Pseudomonas fluorescens W3 (P. fluorescens W3) performed higher activity in milk
Protease AprX than that in tryptic soy broth (TSB). In this study, the effects of different milk components on the activity of
Whey protein
protease from P. fluorescens W3 were explored. The results showed that whey protein was the main reason that
Hydrolysis capacity
Gene aprX
influenced the protease activity secreted by P. fluorescens W3, which exert positive correlation with the con­
centration of whey protein content (from 0.3% to 1%). The zymogram and mass spectrometry proved that the
protease secreted by P. fluorescens W3 was AprX, which had a better ability to hydrolyze casein than whey
protein. The AprX hydrolysised casein by the suquence as follows: κ-casein > β-casein > α-casein. The results of
RT-qPCR showed that whey protein could increase the expression of gene aprX by P. fluorescens W3. The results
could help us better understand how milk promoted the protease activity of Pseudomonas fluorescens. Destroying
whey protein may become the key method to inhibit the activity of protease from psychrotrophic bacteria, and
reduce the waste of dairy foods.

1. Introduction
Milk is susceptible to microbial contamination during processing and
storage due to its rich nutrients and high moisture content (Dong, Jon,
Koon Hoong, & Steve, 2020). During transported from farm to the fac­
tory, the milk can be easily contaminated by the bacteria from pasture,
equipment, soil, air and transportation equipment, thus harm to the
quality (Yuan, Sadiq, Burmolle, Wang, & He, 2019). In order to reduce
the degradation of milk by microorganisms, refrigerated transportation
and storage seems to be a good way. Refrigerated storage of milk can
effectively inhibit the growth of common mesophilic bacteria (such as
lactic acid bacteria), and avoiding the waste of raw milk caused by the
number of bacteria exceeding the standard (Hahne, Isele, Berning, &
Lipski, 2019). However, during the refrigerated storage of milk, psy­
chrotrophic bacteria represented by Pseudomonas can still grow nor­
mally although their growth ability is lower than that at room
temperature (Ribeiro Júnior et al., 2018). The presence of psychro­
trophic bacteria can cause adverse effects like precipitation, gelatin,
bitterness, and fat floating in dairy foods (Brasca et al., 2019), mainly
caused by the secretion of heat-resistant protease. These enzymes can
still retain part of the activity after heat sterilization, continue to hy­
drolyze protein and fat in milk, and affects the quality and shelf life of
dairy foods (Zhang, Palmer, Teh, & Flint, 2020).
As a representative of Pseudomonas species, Pseudomonas fluorescens
can secrete common heat-resistant protease AprX (Longhi, Bruzaroski,
Eleodoro, Poli-Frederico, & Santana, 2020), which is an alkaline met­
alloprotease with a molecular weight of about 40–50 kDa, belonging to
the serralysin family (Matéos, Guyard-Nicodème, Baglinière, Jardin, &
Gaillard, 2015). AprX hardly to hydrolyze whey protein, but easily to
hydrolysis on casein, and aggregate protein in milk causing gelation and
precipitation to reduce the quality of dairy products (C. Zhang, Bijl,
Svensson, & Hettinga, 2019; Baglinière et al., 2017; Brasca et al., 2019).
The heat-resistant protease is mainly secreted during the logarithmic
phase and the early of stationary phase (Ercolini, Russo, Ferrocino, &
Villani, 2009). There are many factors that affect the secretion of pro­
tease by Pseudomonas species (Alves et al., 2017; Rahman, Geok, Basri, &
Salleh, 2005). In order for the Pseudomonas species to secrete more
protease for experiment, milk is often used as a protease inducer and
added to the synthetic medium (Nicodème, Grill, Humbert, & Gaillard,
2005). However, there are few reports on the key components of milk

* Corresponding author. School of Chemistry and Chemical Engineering, Harbin Institute of Technology, No.92, Xidazhi Street, Nangang District, Harbin, Hei­
longjiang Province, Zip code 150001, China.
E-mail address: xhan@hit.edu.cn (X. Han).

https://doi.org/10.1016/j.lwt.2021.112865
Received 25 September 2021; Received in revised form 21 November 2021; Accepted 22 November 2021
Available online 24 November 2021
0023-6438/© 2021 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Y. Wang et al. LWT 154 (2022) 112865

that can induce Pseudomonas species to secrete protease. Tg = ln2/μ (2)

Based on the ability of milk to increase the secretion of protease by
Pseudomonas species, the influence of different components of milk on where μ is the specific growth rate (day− 1), N is the culturable cell
the activity of protease, main ingredient that promotes the activity and density (CFU/mL), t is the culture time, and Tg is the generation time
production of protease by P. fluorescens W3 were explored. The different (day).
effects of different milk components on the activity of protease secreted
by Pseudomonas may indicate that different types of dairy products are
2.4. Protease activity assay
harmed by psychrotrophic bacteria in different degrees. Exploring the
effects of different milk components on the activity and production of
Folin method was used to determine protease activity. Protease could
protease secreted by Pseudomonas will enable the dairy industry to un­
hydrolyze casein to produce amino acids containing phenolic groups,
derstand the role of dairy ingredients in triggering bacterial proteolytic
and produce tungsten blue under alkaline conditions. Tungsten blue had
activity, provide new ideas for inhibiting protease secretion, and reduce
an absorption peak at 680 nm. Tyrosine (Kermel, China) of different
the waste of dairy foods.
concentrations were used to react with Folin (Solarbio, China) to make a
standard curve, and the protease activity was calculated based on the
2. Materials and methods
standard curve.

2.1. Bacterial and culture conditions

2.5. Degree of protein hydrolysis determination
P. fluorescens W3 was isolated from raw milk collected from Hei­
O-phthaldialdehyde (OPA) method was used to determine the degree
longjiang Province, China, with protease secretion activity (Wang, Han,
of protein hydrolysis as described by Zhang, Bijl, and Hettinga (2018)
Chen, & Deng, 2021). P. fluorescens W3 was stored in the Food Science
with modifications. Briefly, 0.5 mL of sample was mixed with 0.5 mL of
and Engineering Laboratory of Harbin Institute of Technology at − 80 ◦ C.
ddH2O and 5 mL of 0.75 mol/L TCA (Kermel, China), reacted at room
Before use, the strain needed to be inoculated into skim milk medium at
temperature for 10 min, and centrifuged (6,000 g, 10 min). 10 μL of the
2% (v/v) inoculation volume, and cultured at 30 ◦ C, 150 r/min for 24 h
supernatant was mixed with 4 mL OPA (Sinopharm Chemical Reagent,
for activation.
China) and reacted for 2 min, and the absorbance of resulting solution
was read at 340 nm. L-leucine (Kermel, China) was used to draw a
2.2. Preparation and inoculation of growth media standard curve to calculate the degree of protein hydrolysis.

In order to determine the effects of whole and TSB to the bacteria

number and protease activity, P. fluorescens W3 (approximately 1.0 ×
105 CFU/mL) was inoculated into TSB (Solarbio, China) and whole milk
(Nestle, China), cultured at 4 ◦ C for 7 d, and the number of bacteria and
protease activity were measured every day. For determining the effects
of milk components to the bacteria number and protease activity,
P. fluorescens W3 (approximately 1.0 × 105 CFU/mL) was inoculated
into TSB, TSB supplemented with 2.5% (w/v) casein (Aoboxing bio-tech,
China), TSB supplemented with 0.5% (w/v) whey protein (Yuanye
Biology, China), TSB supplemented with 3.5% (w/v) butter (local su­
permarket), and TSB supplemented with 4.5% (w/v) lactose (Kermel,
China) according to the inoculation amount of 1% (v/v). The culture
system was cultured at 4 ◦ C for 7 d, and the number of bacteria and
protease activity were measured every day. For relationship between
whey protein concentration and protease activity, the strain was incu­
bated in TSB supplemented with whey protein of different concentra­
tions from 0% to 3% (w/v), protease activity was measured after 6 d of
culture at 4 ◦ C. In order to determine the ability of protease to hydrolyze
milk protein, the bacteria cultured in TSB was filtered with a 0.22 μm
filter membrane to remove bacterial cells. The supernatant was added
with 1% (w/v) casein, 1% (w/v) whey protein and 12% (w/v) skimmed
milk, the final protease activity of the system was 0.5 U/mL. The mixed
system was stored at 30 ◦ C for 5 d, and the sample was used to determine
the degree of proteolysis and SDS-PAGE. In order to determine the effect
of whey protein on the expression of the gene aprX, P. fluorescens W3 was
cultured in TSB and TSB supplemented with whey protein at 4 ◦ C for 6 d,
and total RNA of the bacterial was extracted for RT-qPCR.
2.3. P. fluorescens W3 cell counts
TSB agar was used to count bacteria as described by Gong, Sun, Lin,
Di, and Han (2018). The bacterial solution was diluted with 0.85%
(w/v) NaCl solution, and the diluted bacterial solution was spread on
TSB agar and incubated at 30 ◦ C for 60 h. The bacterial count was
expressed in log CFU/mL. The specific growth rate and generation time
were determined by the following equation (Chen et al., 2020):
μ(t2-t1) = ln(N2/N1) (1)
2.6. SDS-PAGE
SDS-PAGE was performed with a 12% polyacrylamide gel described
by Waśko, Polak-Berecka, and Targonski (2010) and Waśko,
Polak-Berecka and Targonski (2011) with modifications. The poly­
acrylamide gel was prepared by SDS-PAGE Gel kit (Solarbio, China). The
protein solution was mixed with 5X loading buffer (Solarbio, China),
and 10 μL of protein solution were loaded for electrophoresis. The
samples were run at 80 V for 30 min and then run at 120 V for 90 min on
PowerPac power supply (Bio-Rad, USA). Proteins were stained with
0.01% Coomassie Brilliant Blue R-250 solution (Kermel, China).
2.7. Zymography and mass spectrometric analysis of the protease
The zymography was performed using a 12% polyacrylamide gel and
casein as described by Zhang, Palmer, Teh, Calinisan, and Flint (2020)
with modifications. Except for adding casein as a substrate to the sep­
aration gel, the other operations were the same as SDS-PAGE. After
electrophoresis, gels were washed in 2.5% (v/v) Triton X-100 (Biosharp,
China), and then incubated at 37 ◦ C for 24 h in development Buffer
Solution (50 mmol/L Tris-HCL, pH 7.5, 200 mmol/L NaCl, 5 mmol/L
CaCl2; Kermel, China). Gels were observed after staining and bleaching.
When 12% Casein Zymogram gel with 4 mg/mL casein was used to
evaluate the protease activity of P. fluorescens W3 in TSB, the transparent
band could not be clearly seen due to low protease activity, therefore
12% Casein Zymogram gel with 2 mg/mL casein was used to evaluate
the protease activity of P. fluorescens W3 in TSB.
The band of the gel showing protease activity was cut off and hy­
drolyzed tryptically. Q-Exactive HF X (Thermo Fisher Scientific, San
Jose, CA) was used for protease identification.
2.8. RNA extraction and purifcation and cDNA synthesis
P. fluorescens W3 was cultured in TSB and TSB supplemented with
1% (w/v) whey protein for 6 d, and centrifuged at 1,2000 g for 2 min to
collect the bacteria. The total RNA of P. fluorescens W3 was extracted by
RNAprep Pure Bacteria Kit (TIANGEN, China). The total RNA was used

2
Y. Wang et al. LWT 154 (2022) 112865

to synthesis cDNA by All-in-One™ First-Strand cDNA Synthesis Kit User Table 2

Manual (GeneCopoeia, USA). The integrity and quantification of RNA The growth kinetics of P. fluorescens W3 in different culture medium at 4 ◦ C for 5
and cDNA were measured by ultradiferential photometer (Spectrum, d.
China). Culture Average specific growth rate Average generation time (d)
medium (d− 1)

2.9. Quantitative RT-PCR 1–2 2–3 3–4 4–5 1–2 2–3 3–4 4–5
d d d d d d d d
The primers 16S-F/16S-Rand AprX-F/AprX-R (Table 1) were used for TSB 2.06 1.92 2.42 0.29 0.34 0.36 0.29 2.39
qPCR. According to All-in-One ™ aPCR Kit (GeneCopoeia, USA), 20 μL Whole milk 2.00 1.48 2.83 0.23 0.35 0.47 0.24 3.01
qPCR reaction solution contains 10 μL 2 × All-in-One ™ aPCR Mix, 2 μL TSB+2.5% 2.24 1.58 2.35 0.24 0.31 0.44 0.29 2.89
casein
cDNA, 2 μL primer and 0.4 μL ROX Reference Dyed. These data were TSB+0.5% 2.42 1.50 2.30 0.41 0.29 0.46 0.30 1.69
collected by ABI 7500 Real-Time PCR System. The 16S rRNA gene was whey
used as an internal reference gene to evaluate the expression level of protein
aprX gene. TSB+3.5% 2.24 1.64 2.35 0.26 0.31 0.42 0.29 2.67
butter
TSB+4.5% 2.15 1.77 2.26 0.23 0.32 0.39 0.31 3.01
2.10. Statistical analysis lactose

All the experiments in this study were repeated three times, and the
experimental results were expressed as mean ± standard deviation (X ±
SD). SPSS Statistics 22.0 (SPSS Inc., USA) was used for statistical anal­
ysis. p < 0.05 was considered statistically significant.
3. Results
3.1. Bacterial growth and protease activity in TSB and whole milk
P. fluorescens W3 could grow normally in TSB and whole milk even at
4 ◦ C, and they had similar growth curve. In the first 4 d of culture,
P. fluorescens W3 strain was in the exponential phase in both TSB and
whole milk, and had a similar specific growth rate (Table 2). During 3–4
d, W3 strain had the strongest growth ability in TSB and whole milk, and
its specific growth rate was the largest. At this time, the number of
bacteria in whole milk was higher than that in TSB. P. fluorescens W3
reached the stationary phase after 4 d of culture, the final bacterial count
in TSB and whole milk was similar, and could reach 8–9 log CFU/mL
(Fig. 1a). P. fluorescens W3 secreted protease at the same time as it grew.
When the strain entered the stationary phase, the protease activity
increased rapidly, which indicated that the protease secretion time of
the strain was mainly in the early stable phase (Fig. 1b). Although
P. fluorescens W3 could secrete protease in both TSB and whole milk, the
protease activity in whole milk was significantly higher (p < 0.05) than
that in TSB. When cultured for 6 d, the activity of the protease secreted
by the strain was the highest. In whole milk, the protease activity could
reach the highest 2.00 ± 0.06 U/mL, while in TSB, the protease activity
could only reach 0.63 ± 0.05 U/mL (Fig. 1b). When the culture time was
extended to 7 d, the protease activity of P. fluorescens W3 in TSB and
whole milk had decreased. The results of zymogram showed that
P. fluorescens W3 could secrete a protease with a molecular weight of
about 47 kDa, and the protease activity of P. fluorescens W3 in whole
milk was higher than that in TSB (Fig. 3a and b). Mass spectrometry
results indicated that this protease belonged to protease AprX (protein
ID: tr|A0A166XGP2|A0A166XGP2_PSEFL).
3.2. Effect of milk components on the protease activity
P. fluorescens W3 had a similar growth curve in the above five media,
and it entered a stationary phase at 4 d, and the final bacterial count
Table 1
Primers used in this study.
No. Primer Sequence (5′ –3′ ) Reference
1 16S rRNA-F ACGCTAATACCGCATACG This study
2 16S rRNA-R TCATCCTCTCAGACCAGTTA This study
3 aprX-F CACCAGCCAGAACTTCAGCAAGG This study
4 aprX-R GCGTTGGAGTTGAAGCCGTAGG This study
could reached 8–9 log CFU/mL (Fig. 1c). The difference of the culture
medium did not affect the growth ability of P. fluorescens W3, the strain
had similar specific growth rate and generation time in the above five
media (Tab 2). The protease activity of P. fluorescens W3 in TSB sup­
plemented with 0.5 (w/v) whey protein was significantly higher (p <
0.05) than that of TSB and TSB supplemented with other milk compo­
nents (Fig. 1d). Butter could also increase the activity of the protease
secreted by P. fluorescens W3, but the enhancement effect was not as
good as whey protein. The protease activity secreted by P. fluorescens W3
increased rapidly in 3–6 d. The protease activity of P. fluorescens W3 in
TSB medium supplemented with whey protein reached a maximum of
1.968 ± 0.135 U/mL at 6 d, which was similar to the protease activity in
whole milk. However, the protease activity in TSB and TSB supple­
mented with other milk components was lower than that in whole milk.
3.3. Effect of whey protein concentrations on proteolytic activity
P. fluorescens W3 was grown for 6 d at 4 ◦ C in TSB supplemented with
different concentrations of whey protein. The addition of whey protein
could effect the protease activity secreted by P. fluorescens W3. With the
increase of whey protein addition, the activity of P. fluorescens W3
secreted protease gradually increased (range from 0 to 1%). When whey
protein was added at 1%, the protease activity reached the maximum
2.825 ± 0.201 U/mL, as the added amount of whey protein continued to
increase, the protease activity declined (Fig. 2). The results of zymogram
also proved that the addition of 1% (w/v) whey protein could promote
the extracellular protease activity of P. fluorescens W3 (Fig. 3a and c).
3.4. The ability of P. fluorescens W3 secretions to hydrolyze casein and
whey protein
The degree of proteolysis and SDS-PAGE were used to evaluate the
hydrolysis ability of P. fluorescens W3 secretion to casein and whey
protein. The protease secreted by P. fluorescens W3 had a stronger ability
to hydrolyze casein than whey protein (Fig. 4a and b). With the pro­
longation of storage time, the degree of hydrolysis of the casein solution
and whey protein solution with the addition of enzymes gradually
increased. During the first three days of storage, the degree of hydrolysis
of the casein solution with protease increased rapidly (from 0.18 L-Leu
mmol/L to 18.38 L-Leu mmol/L). Unlike the casein solution, the degree
of hydrolysis was lower than that of the casein solution. During the
storage period of 5 d, the degree of hydrolysis of the whey protein so­
lution gradually increased (from 0.30 L-Leu mmol/L to 6.70 L-Leu
mmol/L). Compared with whey protein, the extracellular protease
secreted by P. fluorescens W3 had a stronger hydrolysis effect on casein
and casein was hydrolyzed by protease in the order of κ-casein >
β-casein > α-casein (Fig. 4c).

3
Y. Wang et al.
3.5. The effect of whey protein on the expression of aprX gene
RT-qPCR was used to analyze the effect of whey protein on the
expression of aprX gene. Whey protein could significantly promote the
expression of aprX gene (p < 0.05). The expression level of aprX gene of
P. fluorescens W3 in TSB supplemented with 1% (w/v) whey protein was
15.805 ± 1.347 times higher than that in TSB (Fig. 5). The results of RT-
qPCR showed that whey protein could promote the expression of aprX
gene.
4. Discussion
Pseudomonas fluorescens, as a typical psychrotrophic bacteria in milk,
has important research significance because they can secrete heart-
resistant protease (Hahne et al., 2019; Yuan et al., 2017). Raw milk is
rich in nutrients and can promote the activity of heat-resistant protease.
These heat-resistant protease can often resist high temperature sterili­
zation of raw milk, even ultra-high temperature sterilization (Baur et al.,
2015; Ivanka, Akihiko, & Nobuaki, 2004). These protease will continue
to decompose milk proteins during the preservation period of the dairy
foods and cause the corruption of the dairy foods (Matéos et al., 2015).
In this study, we evaluated the growth and protease activity of repre­
sentative psychrotrophic bacteria P. fluorescens W3 isolated from raw
milk in synthetic medium and milk medium. Although there are many
literature reports on the growth and protease-producing ability of
Pseudomonas fluorescens, exploring milk components has more impor­
tant significance for the growth and protease secretion of psychrotrophic
Pseudomonas, and can better help us understand the secretion of
heat-resistant protease during the low temperature transportation of
raw milk. This research can lay the foundation for milk quality control,
and also provide a theoretical basis for further research on the influence
of psychrotrophic bacteria on milk preservation changes. Our research
showed whey protein may be the main reason that milk promotes the
secretion of protease from Pseudomonas fluorescens, and this has not been
previously reported.
In our study, P. fluorescens W3 had a similar growth curve in different
4
LWT 154 (2022) 112865
Fig. 1. The growth ability and protease activity of
P. fluorescens W3 in TSB, TSB supplement with
different milk components and whole milk at 4 ◦ C.
The growth ability (a) and protease activity (b) of
P. fluorescens W3 in TSB ( , ) and whole
milk ( , ) at 4 ◦ C. The growth ability (c)
and protease activity (d) of P. fluorescens W3 in TSB
( , ) TSB+2.5% (w/v) casein ( ,
), TSB+0.5% (w/v) whey protein ( ,
), TSB+3.5% (w/v) butter ( , )
and TSB+4.5% (w/v) lactose ( , ) at
4 ◦ C. Results are the mean ± standard deviation of
three analytical replicates. Different letters indicate
statistically significant differences, p < 0.05.
media. The activity of P. fluorescens W3 in secreting protease in whole
milk was higher than in TSB, the abundant carbon sources, nitrogen
sources and minerals in milk could explain this phenomenon. Polak-­
Berecka, Waśko, Kordowska-Wiater, Targoński, and Kubik-Komar
(2011) also found that different medium could affect the production
of metabolites. With the extension of the low-temperature culture time,
the protease activity secreted by P. fluorescens W3 in the whole milk
medium gradually increased and reached the maximum at 6 d (Fig. 1b).
Therefore, it was particularly important to shorten the storage and
transportation time of raw milk at low temperature to ensure the quality
of dairy foods. After 6 d of refrigerated storage, the activity of the pro­
tease began to decrease, the reason for this phenomenon might be the
decrease of the growth ability of the strain or the decrease of the protein
content in the culture medium, which led to the mutual hydrolysis be­
tween the proteases. The most widely studied protease secreted by
psychrotrophic bacteria is AprX. The protease secreted by lactic acid
bacteria often does not have strong heat resistance. After high temper­
ature treatment, the protease is inactivated and cannot continue to
decompose milk protein which will endanger the quality of dairy
products (Waśko, Kieliszek, & Targoński, 2012). However, AprX has
heat resistance and can retain part of its activity after high temperature
sterilization. As a result of the zymogram, the molecular weight of the
protease secreted by P. fluorescens W3 was about 47 kDa. Mass spec­
trometry proved that the protease was AprX (Fig. 3). Most of AprX has
hydrolysis effect on β-casein and κ-casein, and a few AprX has hydrolysis
effect on α-casein (C. Zhang et al., 2018). The AprX secreted by
P. fluorescens W3 preferentially hydrolyze κ-casein followed by β-casein,
and α-casein was the last casein to be hydrolyzed (Fig. 4c). Datta and
Deeth (2003) also found that the protease AprX has the strongest ability
to hydrolyze κ-casein, however, D’Incecco et al. (2019) found that the
protease AprX has the strongest ability to hydrolyze β-casein. AprX has
chymosin-like activity and can specifically hydrolyze the 105–106
peptide bonds of κ-casein to produce Casein Macro Peptide, after
κ-casein is hydrolyzed, the casein micelles are exposed, and the damaged
casein micelles aggregate with each other to form gelation (Colantuono
et al., 2019; D’Incecco et al., 2019). The hydrolysis of κ-casein by
Y. Wang et al.
Fig. 2. Protease activity of P. fluorescens W3 in TSB supplemented with
different whey protein concentrations incubation at 4 ◦ C for 6 d. Results are the
mean ± standard deviation of three analytical replicates. Different letters
indicate statistically significant differences, p < 0.05.
Fig. 3. 12% Casein Zymogram gel with 2 mg/mL (a) or 4 mg/mL (b, c) casein
of cell-free culture supernatant of P. fluorescens W3 growing in TSB, whole milk
and TSB supplemented with 1% (w/v) whey protein at 4 ◦ C for 6 d. a) Line 1
and 2: TSB. b) Line 1: TSB; line 2: whole milk. c) Line 1: TSB; line 2: TSB
supplemented with 1% (w/v) whey protein. Line M: commercial molecu­
lar marker.
protease AprX can promote the curdling of cheese and reduce the
curdling time, however, excessive protease will cause harm to cheese
quality, so it is very important to know the minimum protease concen­
tration that harms the quality of dairy products (Paludetti, O’Callaghan,
Sheehan, Gleeson, & Kelly, 2020). Protease AprX has some of the
properties of lactic acid bacteria protease, so it has good potential in the
field of fermented milk. Determining the effect of different concentra­
tions of protease on dairy products is a problem that we urgently need to
solve (Kieliszek, Pobiega, Piwowarek, & Kot, 2021).
The activity of protease secreted by Pseudomonas is affected by many
5
LWT 154 (2022) 112865
factors, such as carbon, nitrogen and minerals (Adams, Barach, & Speck,
1975). In order to further determine the influence of milk components
on the protease activity of P. fluorescens W3, we tested the influence of a
single milk component on the protease activity, and the results showed
that whey protein had the most obvious promotion effect on the protease
activity. In addition to whey protein, milk fat could also induce
P. fluorescens W3 proteolytic activity, which was consistent with previ­
ous research results (Zhang et al., 2020), but the promotion of protease
activity by fat was lower than that by whey protein (p < 0.05). The
aprX-lipA operon is a key operon for Pseudomonas protease secretion.
The promotion of protease activity by fat may be due to its promotion of
the expression of the gene lipA and then the expression of the gene aprX
through the operon (C. Zhang et al., 2019). In the study of Zhang et al.
(2020), the difference from our results was that whey protein had an
inhibitory effect on the protease activity of Pseudomonas. This may be
caused by a dose-effect relationship, when the addition amount of whey
protein exceeds 1% (w/v), the protease activity of P. fluorescens W3
began to decline (Fig. 2).
In order to explore the reason why whey protein increased the ac­
tivity of AprX from P. fluorescens W3, RT-qPCR was used to analyze the
effect of whey protein on the expression of aprX gene. Whey protein
could significantly promote the expression of aprX gene, thereby pro­
moting protease activity (Fig. 5). The hydrolysis capacity of protease
from P. fluorescens W3 to milk protein was explored, interestingly, whey
protein could promote the secretion of protease AprX, but the protease
had a weak ability to hydrolyze whey protein (Fig. 4a and b), which
might promote the expression of aprX gene to secrete more protease to
hydrolyze the protein in the environment for self-growth. It had been
reported that Pseudomonas overexpressed the protease gene to
compensate for the decrease in protease activity. Under low temperature
conditions, the activity of the protease decreased, and Pseudomonas
fluorescens 07A secreted more protease to achieve the normal growth of
the strain (Alves et al., 2017). The effect of whey protein on the secretion
of P. fluorescens W3 protease AprX has forced us to pay more attention to
dairy products with high whey content (such as whey protein drinks),
these dairy products may be more susceptible to protease secreted by
psychrotrophic bacteria.
At present, the main methods to control the harm of psychrotrophic
bacteria to dairy products are to inhibit the growth of psychrotrophic
bacteria and reduce the activity of protease. The former includes
inhibiting the growth of psychrophilic bacteria by adding lactic acid
bacteria cell-free supernatant (J. Wang, Han, et al., 2021), and the latter
includes reducing the protease activity by non-thermal atmospheric
plasma treatment (Mohammadpour et al., 2021). On the one hand, our
research has found that whey protein is a key ingredient in raw milk that
promotes the secretion of heat-resistant protease AprX from
P. fluorescens W3, which will provide us with a new idea to control the
harm to dairy products by inhibiting the secretion of protease by psy­
chrotrophic bacteria. Some treatments for whey protein may become an
important method to control the protease secreted by psychrotrophic
bacteria. On the other hand, whey protein can replace skimmed milk as a
protease inducer to increase the production of protease AprX for sub­
sequent protease separation and purification to explore the effect of
protease on dairy products, and also can provide support for its appli­
cation in fermented milk and other food fields.
Although we have concluded that whey protein can increase the
activity of the extracellular protease of P. fluorescens W3 by promoting
the expression of aprX gene, the specific regulation mechanism needs
further study. At the same time, the effect of whey protein on the pro­
tease secretion of other psychrotrophic bacteria also needs to be further
explored.
5. Conclusions
This study showed that whey protein was the main milk component
that affects the secretion of protease activity of P. fluorescens W3. Whey
Y. Wang et al.
Fig. 5. The expression of aprX gene of P. fluorescens W3 in TSB and TSB sup­
plemented with 1% (w/v) whey protein at 4 ◦ C for 6 d. Results are the mean ±
standard deviation of three analytical replicates. *Statistically significant dif­
ferences, p < 0.05.
protein promoted the extracellular protease activity of P. fluorescens W3
by promoting the expression of aprX gene. Dairy products with high
whey protein content are more susceptible to protease.
CRediT authorship contribution statement
Yu Wang: Conceptualization, Methodology, Writing – original draft,
Writing – review & editing. Jialei Sun: Methodology. Yingwang Deng:
Methodology. Yuanqiang Tu: Methodology. Haiyue Niu: Methodol­
ogy. Wenjing Cai: Methodology. Xue Han: Conceptualization, Project
administration, Supervision, Writing – review & editing.
6
LWT 154 (2022) 112865
Fig. 4. The ability of protease from P. fluorescens
W3 to hydrolyze casein and whey protein. a) The
degree of hydrolysis of casein by the
protease. : control, : casein + protease.
b) The degree of hydrolysis of whey protein by the
protease. : control, : whey protein +
protease. c) Protease from P. fluorescens W3 to hy­
drolyze skimmed milk at d 0, 1, 2, 3, 4 and 5. M:
commercial molecular marker. Results are the
mean ± standard deviation of three analytical
replicates.
Declaration of competing interest
All authors declare no conflict of interest.
Acknowledgements
This work was supported by the National Key Research and Devel­
opment Program (2018YFC1604305-01).
References
Adams, D. M., Barach, J. T., & Speck, M. L. (1975). Heat resistant proteases produced in
milk by psychrotrophic bacteria of dairy origin. Journal of Dairy Science, 58(6),
828–834. https://doi.org/10.3168/jds.S0022-0302(75)84645-5
Alves, M. P., Salgado, R. L., Eller, M. R., Dias, R. S., Paula, S. O.d., & Carvalho, A. F. D.
(2017). Temperature modulates the production and activity of a metalloprotease
from Pseudomonas fluorescens 07A in milk. Journal of Dairy Science, 101(2), 992–999.
https://doi.org/10.3168/jds.2017-13238
Baglinière, F., Tanguy, G., Locatelli Salgado, R., Jardin, J., Rousseau, F., Robert, B., et al.
(2017). Ser2 from Serratia liquefaciens L53: A new heat stable protease able to
destabilize UHT milk during its storage. Food Chemistry, 229(15), 104–110. https://
doi.org/10.1016/j.foodchem.2017.02.054
Baur, C., Krewinkel, M., Kutzli, I., Kranz, B., von Neubeck, M., Huptas, C., et al. (2015).
Isolation and characterisation of a heat-resistant peptidase from Pseudomonas panacis
withstanding general UHT processes. International Dairy Journal, 49, 46–55. https://
doi.org/10.1016/j.idairyj.2015.04.009
Brasca, M., Rosi, V., Morandi, S., Ferranti, P., Picariello, G., & Pellegrino, L. (2019).
Bacterial proteolysis of casein leading to UHT milk gelation: An applicative study.
Food Chemistry, 292(15), 217–226. https://doi.org/10.1016/j.
foodchem.2019.04.066
Chen, S., Niu, H., Wu, Y., Sun, J., Han, X., & Zhang, L. (2020). Influence of lactic acid on
cell cycle progressions in Lactobacillus bulgaricus during batch culture. Applied
Biochemistry and Biotechnology, 193, 912–924. https://doi.org/10.1007/s12010-020-
03459-8
Colantuono, A., D’Incecco, P., Fortina, M. G., Rosi, V., Ricci, G., & Pellegrino, L. (2019).
Milk substrates influence proteolytic activity of Pseudomonas fluorescens strains. Food
Control, 111, 107063. https://doi.org/10.1016/j.foodcont.2019.107063
D’Incecco, P., Brasca, M., Rosi, V., Morandi, S., Ferranti, P., Picariello, G., et al. (2019).
Bacterial proteolysis of casein leading to UHT milk gelation: An applicative study.
Food Chemistry, 292(15), 217–226. https://doi.org/10.1016/j.
foodchem.2019.04.066
Datta, N., & Deeth, H. C. (2003). Diagnosing the cause of proteolysis in UHT milk. LWT-
Food Science and Technology, 36(2), 173–182. https://doi.org/10.1016/S0023-6438
(02)00214-1
Y. Wang et al.
Ercolini, D., Russo, F., Ferrocino, I., & Villani, F. (2009). Molecular identification of
mesophilic and psychrotrophic bacteria from raw cow’s milk. Food Microbiology, 26
(2), 228–231. https://doi.org/10.1016/j.fm.2008.09.005
Gong, P., Sun, J., Lin, K., Di, W., & Han, X. (2018). Changes process in the cellular
structures and constituents of Lactobacillus bulgaricus sp1.1 during spray drying.
LWT- Food Science and Technology, 102, 30–36. https://doi.org/10.1016/j.
lwt.2018.12.005
Hahne, J., Isele, D., Berning, J., & Lipski, A. (2019). The contribution of fast growing,
psychrotrophic microorganisms on biodiversity of refrigerated raw cow’s milk with
high bacterial counts and their food spoilage potential. Food Microbiology, 79, 11–19.
https://doi.org/10.1016/j.fm.2018.10.019
Ivanka, K., Akihiko, M., & Nobuaki, F. (2004). Purification and characterization of a
protease from Pseudomonas aeruginosa grown in cutting oil. Journal of Bioscience and
Bioengineering, 98(3), 145–152. https://doi.org/10.1016/S1389-1723(04)00258-0
Kieliszek, M., Pobiega, K., Piwowarek, K., & Kot, A. M. (2021). Characteristics of the
proteolytic enzymes produced by lactic acid bacteria. Molecules, 26(7), 1858.
https://doi.org/10.3390/molecules26071858
Longhi, R. D., Bruzaroski, S. R., Eleodoro, J. I., Poli-Frederico, R. C., &
Santana, E. H. W. D. (2020). Presence of aprX gene in Pseudomonas spp. from
refrigerated raw milk and their proteolytic ability. Semina: Ciências Agrárias, 41(4),
1421. https://doi.org/10.5433/1679-0359.2020v41n4p1421
Matéos, A., Guyard-Nicodème, M., Baglinière, F., Jardin, J., & Gaillard, J. L. (2015).
Proteolysis of milk proteins by AprX, an extracellular protease identified in
Pseudomonas LBSA1 isolated from bulk raw milk, and implications for the stability of
UHT milk. International Dairy Journal, 49, 78–88. https://doi.org/10.1016/j.
idairyj.2015.04.008
Mohammadpour, H., Zarei, M., Cullen, P., Valtchev, P., Schindeler, A., & Dehghani, F.
(2021). Potential application of non-thermal atmospheric plasma in reducing the
activity of Pseudomonas-secreted proteases in milk. International Dairy Journal, 120,
105078. https://doi.org/10.1016/j.idairyj.2021.105078
Nicodème, M., Grill, J. P., Humbert, G., & Gaillard, J. L. (2005). Extracellular protease
activity of different Pseudomonas strains: Dependence of proteolytic activity on
culture conditions. Journal of Applied Microbiology, 99(3), 641–648. https://doi.org/
10.1111/j.1365-2672.2005.02634.x
Paludetti, L. F., O’Callaghan, T. F., Sheehan, J. J., Gleeson, D., & Kelly, A. L. (2020).
Effect of Pseudomonas fluorescens proteases on the quality of cheddar cheese. Journal
of Dairy Science, 103(9), 7865–7878. https://doi.org/10.3168/jds.2019-18043
Polak-Berecka, M., Waśko, A., Kordowska-Wiater, M., Targoński, Z., & Kubik-Komar, A.
(2011). Application of response surface methodology to enhancement of biomass
production by Lactobacillus rhamnosus E/N. Brazilian Journal of Microbiology, 42(4),
1485–1494. https://doi.org/10.1590/S1517-838220110004000035
LWT 154 (2022) 112865
Rahman, R. N. Z. A., Geok, L. P., Basri, M., & Salleh, A. B. (2005). Physical factors
affecting the production of organic solvent-tolerant protease by Pseudomonas
aeruginosa strain K. Bioresource Technology, 96(4), 429–436. https://doi.org/
10.1016/j.biortech.2004.06.012
Ribeiro Júnior, C. R., de Oliveira, A. M., Silva, F. de G., Tamanini, R., de
Oliveira, A. L. M., & Beloti, V. (2018). The main spoilage-related psychrotrophic
bacteria in refrigerated raw milk. Journal of Dairy Science, 101(1), 75–83. https://
doi.org/10.3168/jds.2017-13069
Wang, Y., Han, X., Chen, X., & Deng, Y. (2021). Potential harmful of extracellular
proteases secreted by Pseudomonas fluorescens W3 on milk quality. Journal of Food
Processing and Preservation, 45(3), Article e15192. https://doi.org/10.1111/
jfpp.15192
Wang, J., Su, Y., Gu, L., Chang, C., Xu, L., Yang, Y., et al. (2021). The inhibition of cell-
free supernatants of several lactic acid bacteria on the selected psychrophilic
spoilage bacteria in liquid whole egg. Food Control, 123, 107753. https://doi.org/
10.1016/j.foodcont.2020.107753
Waśko, A., Kieliszek, M., & Targoński, Z. (2012). Purification and characterization of a
proteinase from the probiotic Lactobacillus rhamnosus OXY. Preparative Biochemistry
& Biotechnology, 42(5), 476–488. https://doi.org/10.1080/10826068.2012.656869
Waśko, A., Polak-Berecka, M., & Targonski, Z. (2010). A new protein of alpha-amylase
activity from Lactococcus lactis. Journal of Microbiology and Biotechnology, 20(9),
1307–1313. https://doi.org/10.4014/jmb.1002.02005
Waśko, A., Polak-Berecka, M., & Targoński, Z. (2011). Purification and characterization
of pullulanase from Lactococcus lactis. Preparative Biochemistry & Biotechnology, 41
(3), 252–261. https://doi.org/10.1080/10826068.2011.575316
Yuan, L., Sadiq, F. A., Burmolle, M., Wang, N., & He, G. (2019). Insights into
psychrotrophic bacteria in raw milk: A review. Journal of Food Protection, 82(7),
1148–1159. https://doi.org/10.4315/0362-028X.JFP-19-032
Yuan, L., Sadiq, F. A., Liu, T., Flint, S., Chen, J., Yang, H., et al. (2017). Psychrotrophic
bacterial populations in Chinese raw dairy milk. LWT- Food Science and Technology,
84, 409–418. https://doi.org/10.1016/j.lwt.2017.05.023
Zhang, C., Bijl, E., & Hettinga, K. (2018). Destabilization of UHT milk by protease AprX
from Pseudomonas fluorescens and plasmin. Food Chemistry, 263, 127–134. https://
doi.org/10.1016/j.foodchem.2018.04.128
Zhang, C., Bijl, E., Svensson, B., & Hettinga, K. (2019). The extracellular protease AprX
from Pseudomonas and its spoilage potential for UHT milk: A review. Comprehensive
Reviews in Food Science and Food Safety, 18(5), 834–852. https://doi.org/10.1111/
1541-4337.12452
Zhang, D., Palmer, J., Teh, K. H., & Flint, S. (2020). Identification and selection of heat-
stable protease and lipase-producing psychrotrophic bacteria from fresh and chilled
raw milk during up to five days storage. LWT- Food Science and Technology, 134,
110165. https://doi.org/10.1016/j.lwt.2020.110165