Diploma Final

Ministry of Education and Science of the Republic of Kazakhstan
Al-Farabi Kazakh National University

Faculty of Biology and Biotechnology
Department of Biotechnology
DIPLOMA PROJECT
Theme: “Prediction of interactions between miRNA and target genes associated with
rheumatoid arthritis using the miRDB, miRWalk, miRTarget programs”
Specialization 5B070100 - “Biotechnology”
Performers: _____________________________________Abdirassilova Z.N.

(signature)
_____________________________________Raissova K.A.
(signature)
_____________________________________Serimova A.B.
(signature)
Scientific supervisor:
PhD____________________________________________Yurikova O.Yu
(signature)
Admitted to defense
Protocol № _________ of "___" __________20___ y
Head of the Biology

Department:______________________________________Kistaubaeva A.S.
c.b.s., docent (signature and stamp)
Normocontroller:__________________________________Bozorboyeva G.D.
(signature)
Almaty, 2022
ABSTRACT
Diploma project consists of 60 pages, 21 figures, 6 tables, 49 references, 3

appendices.
Key words: rheumatoid arthritis, miRNA-mRNA interactions, miRNA, target
gene, biomarkers.
Purpose of the study: to identify effective miRNA-target gene interactions and
their characteristics involved in pathogenesis of rheumatoid arthritis.
Study objectives:
1. to characterize miRNAs and their target genes involved in the development
of rheumatoid arthritis by miRTarget program.
of rheumatoid arthritis by miRDB program.
of rheumatoid arthritis by miRWalk program.
The object of research - nucleotide sequences of miRNAs and the genes which
are associated with rheumatoid arthritis.
Study subjects - effective miRNA-mRNA interactions associated with
rheumatoid arthritis.
Today rheumatoid arthritis takes the 3rd place as the most widespread disabilities after
cardiovascular diseases and oncological cancers [1]. The complications of
rheumatoid arthritis may lead to fatal catastrophes such as myocardial infarction,
stroke, thrombosis of other large vessels, acute and chronic renal failure, etc. In
Kazakhstan, according to the rheumatology center of Almaty city over a period of 4
years from 2013 to 2017, the growth dynamics of treated patients with seropositive
RA was increased by 19,7 % and patients with seronegative RA was risen by 30,7 %
[2]. Due to this reason, it’s necessary to reduce the incidence of RA and identify new
ways of the prediction of the chance of rheumatoid arthritis with the use of
biomarkers for diagnosis of disease. The potential for using miRNA-target gene
interactions as biomarkers is supported by many ongoing studies. As miRNAs are
extremely stable, expressed in various types of tissues and cells, can be detected by
non-invasive methods, and pathological processes in the body correlate with changes
in the regulation of miRNA expression. The changes in the regulation of miRNAs in
gene expression make them valuable precious biomarkers that facilitate early
diagnosis, prognosis, and the right therapy for diseases [3].
Results: The local database of 75 genes associated with the development of
rheumatoid arthritis was created. Effective miRNA-mRNA interactions were
determined using the special programs.
1. MiRNAs and their target genes involved in the development of rheumatoid
arthritis by miRTarget program were characterized (28 target genes)
arthritis by miRDB program were characterized (41 target genes)
2
arthritis by miRWalk program were characterized (14 target genes)
3
РЕФЕРАТ
Объем дипломной работы состоит из 60 страниц, 21 рисунков, 6 таблиц, 49

источника, 3 приложения.
Ключевые слова: ревматоидный артрит, взаимодействие miRNA -mRNA,
miRNA, ген-мишень, биомаркеры.
Цель исследования: определить эффективные взаимосвязи miRNA и
mRNA для дальнейшего изучения и применения в клинической диагностике
ревматоидного артрита
Задачи исследования:
1. Охарактеризовать miRNA и их гены-мишени, участвующие в развитии
ревматоидного артрита с помощью программы miRTarget.
ревматоидного артрита с помощью программы miRDB.
ревматоидного артрита с помощью программы miRWalk.
Объект исследования - Нуклеотидные последовательности miRNA и генов,
связанных с развитием ревматоидного артрита.
Предмет исследования - Эффективные взаимодействия miRNA-mRNA,
связанные с ревматоидным артритом.
На сегодняшний день ревматоидный артрит занимает 3-е место в мире по
инвалидизации после сердечно-сосудистых заболеваний и онкологических
заболеваний. Осложнения ревматоидного артрита могут привести к фатальным
катастрофам, таким как инфаркт миокарда, инсульт, тромбоз других крупных
сосудов, острая и хроническая почечная недостаточность и др. В Казахстане по
данным ревматологического центра г.Алматы за период четырех лет с 2013
года к 2017 г. динамика роста пролеченных больных серопозитивным РА
увеличилась на 19,7 %, а больных серонегативным РА – на 30,7 %. В связи с
этой причиной, необходимо снижать заболеваемость РА и находить новые пути
прогнозирования вероятности ревматоидного артрита с использованием
биомаркеров для диагностики заболевания. Возможность использования
взаимодействий miRNA-mRNA в качестве биомаркеров подтверждается
многими текущими исследованиями. микроРНК чрезвычайно стабильны,
экспрессируются в различных типах тканей и клеток, могут быть обнаружены
не инвазивными методами, а патологические процессы в организме
коррелируют с изменениями в регуляции экспрессии микроРНК. Изменения в
регуляции экспрессии микроРНК делают их ценными не инвазивными
биомаркерами, которые облегчают раннюю диагностику, прогнозирование и
правильную терапию заболеваний..
Результаты: Была создана локальная база данных 75 генов,
ассоциированных с развитием ревматоидного артрита. Также, были определены
эффективные взаимодействия miRNA-mRNA, которые прогнозировались с
4
помощью специальных программ. Были охарактеризованы miRNA и их гены-
мишени, участвующие в развитии ревматоидного артрита.
1. С помощью программы miRTarget охарактеризованы миРНК и их гены-
мишени, участвующие в развитии ревматоидного артрита (28 генов-
мишеней)
2. С помощью программы miRDB были охарактеризованы миРНК и их
гены-мишени, участвующие в развитии ревматоидного артрита (41
генов-мишеней)
3. С помощью программы miRWalk были охарактеризованы миРНК и их
гены-мишени, участвующие в развитии ревматоидного артрита (14
генов-мишеней)
5
РЕФЕРАТ
Дипломдық жұмыстың көлемі 60 бет, 21 сурет, 6 кесте, 49 дереккөз, 3

қосымша.
Түйін сөздер: ревматоидты артрит, миРНҚ-мРНҚ өзара әрекеттесу,
миРНҚ, мақсатты ген, биомаркерлер.
Зерттеудің мақсаты: ревматоидты артриттің клиникалық
диагностикасында әрі қарай зерттеу және қолдану үшін миРНҚ мен мРНҚ-ның
тиімді байланысын анықтау.
Зерттеу мақсаттары:
1. miRTarget бағдарламасы арқылы ревматоидты артриттің дамуына
қатысатын миРНҚ және олардың мақсатты гендерін сипаттау.
2. miRDB бағдарламасы арқылы ревматоидты артриттің дамуына қатысатын
миРНҚ және олардың мақсатты гендерін сипаттау.
3. miRWalk бағдарламасы арқылы ревматоидты артриттің дамуына
қатысатын миРНҚ және олардың мақсатты гендерін сипаттау.
Зерттеу объектісі ревматоидты артриттің дамуына байланысты миРНҚ және
гендердің нуклеотидтік тізбегі болып табылады.
Зерттеу пәні - Ревматоидты артритпен байланысты тиімді miRNA-mRNA
өзара әрекеттесуі.
Бүгінгі күні ревматоидты артрит мүгедектік бойынша әлемде жүрек-қан
тамырлары аурулары мен қатерлі ісік ауруларынан кейін үшінші орында тұр.
Ревматоидты артриттің асқынуы миокард инфарктісі, инсульт, басқа да ірі
тамырлардың тромбозы, жедел және созылмалы бүйрек жеткіліксіздігі және
т.б. сияқты өлімге әкелетін ауруларға әкелуі мүмкін. Қазақстанда Алматыдағы
ревматологиялық орталықтың мәліметі бойынша 2013 жылдан бастап төрт жыл
бойына 2017 жылы серопозитивті РА бар емделушілерде динамикалық өсу
қарқыны 19,7%-ға, ал серонегативті РА бар науқастарда – 30,7%-ға өсті. Осы
себепке байланысты РА жиілігін төмендету және ауруды диагностикалау үшін
биомаркерлерді пайдалана отырып, ревматоидты артрит ықтималдығын
болжаудың жаңа әдістерін табу қажет. МиРНҚ-мРНҚ өзара әрекеттесулерін
биомаркерлер ретінде пайдалану мүмкіндігі көптеген жүргізіліп жатқан
зерттеулермен расталады. миРНҚ-лар өте тұрақты, ұлпалардың және
жасушалардың әртүрлі түрлерінде экспрессияланады, инвазивті емес
әдістермен анықталуы мүмкін және организмдегі патологиялық процестер
миРНҚ экспрессиясының реттелуінің өзгеруімен корреляцияланады. МиРНҚ
экспрессиясының реттелуіндегі өзгерістер оларды ерте диагностикалауды,
болжауды және ауруларды дұрыс емдеуді жеңілдететін құнды инвазивті емес
биомаркерлерге айналдырады.
Нәтижелер: Ревматоидты артриттің дамуына байланысты гендердің
жергілікті деректер базасы құрылды. Сондай-ақ, арнайы бағдарламалардың
көмегімен болжанған тиімді миРНҚ-мРНҚ өзара әрекеттесулері анықталды.
6
МиРНҚ және олардың ревматоидты артрит дамуына қатысатын мақсатты
гендер сипатталған.
1. Ревматоидты артриттің дамуына қатысатын микроРНҚ және олардың
мақсатты гендері miRTarget бағдарламасы арқылы сипатталды (28
мақсатты гендер)
2. miRDB бағдарламасын пайдалана отырып, ревматоидты артриттің
дамуына қатысатын miRNA және олардың мақсатты гендері сипатталды
(41 мақсатты гендер)
3. miRWalk бағдарламасын пайдалана отырып, ревматоидты артриттің
дамуына қатысатын микроРНҚ және олардың мақсатты гендері
сипатталды (14 мақсатты гендер)
7
CONTENT
MAIN PART...............................................................................................................11
1 Literature review......................................................................................................11
1.1 History of discovery and general knowledge about miRNA..........................11
1.2 Biogenesis and regulatory functions of miRNA.............................................12
1.3 The application of miRNAs in the diagnosis and therapy of diseases...............14
1.4 General characteristics of rheumatoid arthritis..................................................15
1.4.1 Etiology and pathogenesis...............................................................................17
1.4.2 Prevalence of the disease in the world............................................................19
1.5 The role of miRNAs in the pathogenesis of rheumatoid arthritis......................21
2 MATERIALS AND METHODS.............................................................................22
2.1 Materials.............................................................................................................22
2.2 Methods..............................................................................................................25
2.2.1 Programs for analysis and formatting of nucleotide sequences......................25
2.2.2 MiRTarget program for predicting miRNA binding sites...............................26
2.2.3 miRWalk program for predicting miRNA binding sites.................................28
2.2.4 miRDB program for predicting miRNA binding sites....................................29
3 RESULTS AND DISCUSSION..............................................................................33
3.1 Characterization of miRNA-mRNA interactions predicted by miRTarget........33
3.2. Characterization of miRNA-mRNA interactions predicted by miRWalk........36
3.3. Characterization of miRNA-mRNA interactions predicted by miRDB............42
3.4 Comparative analysis of interactions obtained by MiRTarget, miRWalk and
miRDB programs.....................................................................................................46
REFERENCES............................................................................................................49
APPENDICES.............................................................................................................53
Appendix 1. Comparison of results obtained by MiRTarget, miRWalk and miRDB
programs for rheumatoid arthritis................................................................................53
Appendix 2. The list of target genes related to rheumatoid arthritis obtained by
MirTarget, miRWalk and miRDB programs...............................................................57
Appendix 3. List of the most effective target gene-miRNA interactions calculated by
MirTarget,, miRWalk and miRDB with their selection criteria..................................58
8
INTRODUCTION
Relevance. Rheumatoid arthritis continues to be one of the most relevant

pathologies in modern medical practice: on the one hand, this high prevalence of
diseases - out of every 100,000 people, 71 are diagnosed with RA every year in the
general population;
About 1.5 million Americans have RA. On the other hand, high social and
economic susceptibility is due to high resistance to work capacity in patients and the
need for treatment and the need for laboratory control. High prevalence of diseases in
patients with comorbidities and, accordingly, a burdened comorbid background,
which is of great importance for the prognosis, therapy tactics and, as a result, the
quality of life of patients with rheumatoid arthritis. The diagnosis of rheumatoid
arthritis at an early stage is a complicated and difficult process. The disease affects
0.5-1% of the population [4]. Around 58 million people worldwide suffer from
rheumatoid arthritis. Rheumatoid arthritis reduces life expectancy by an average of 3-
12 years [5]. A 2005 study by the Mayo Clinic found that those with rheumatoid
arthritis were twice as likely to have heart disease, independent of other risk factors
such as diabetes, alcoholism, high cholesterol, and obesity[6]. According to a 2019
Swedish study, risk of heart attack is 60 percent higher at 1 year following an RA
diagnosis. Besides all, Global RA Network patients organization stated that according
to 2021 worldwide statistics, up to 350 million people were confirmed to have an
arthritis.[7]
Scientific novelty. The creation of a local database of genes linked to rheumatoid
arthritis in order to compute their binding to miRNAs made it possible to focus
research only on target genes, whose involvement has been proven and can be
monitored from articles. When the results of predictions from the public platforms
MiRWalk, miRDB, and the miRTarget program are compared, it is possible to
identify miRNAs that are particularly effective in binding to target genes and hence
can be considered as prospective subjects for practical studies.
Practical significance. The resulting miRNA-mRNA interactions can be used to
learn more about miRNAs and their target genes. Effective interactions that are
previously recognized can be the subject of practical research. Furthermore, the most
effective miRNAs can be used as biomarkers in tests to predict and diagnose
rheumatoid arthritis. This could become a new primary technique for preventing
rheumatoid arthritis and other major diseases in the future. It is shown that a set of
associations is more reliable in comparison to using separate miRNA and gene. As a
result, the associations of various miRNAs and genes predicted by MirWalk, miRDB,
and miRTarget can be utilized as a tool for more precise rheumatoid arthritis
diagnosis.
Assessment of the current state of the scientific problem. The search for
effective miRNA- mRNA interactions for predicting RA is an important research
process. Because miRNAs serve as suppressors and can suppress oncogenes and their
9
detrimental effects on the body, they are a crucial component in the regulation of all
genes in the human body. Because the role of miRNA in the pathogenesis of RA has
not been fully investigated, there is no widely approved miRNA dataset that can be
used to predict the disease.
Purpose of the study - to identify effective miRNA-mRNA interactions for
further study and application in the clinical diagnosis of some types of RA.
Study objectives:
1. to characterize miRNAs and their target genes involved in the development of
rheumatoid arthritis by miRTarget program
rheumatoid arthritis by miRDB program
rheumatoid arthritis by miRWalk program
Objects of research: nucleotide sequences of miRNAs and the genes which
are associated with rheumatoid arthritis.
Theoretical and methodological basis. Studying miRNA biosynthesis, their
functions and importance in gene regulation. Studying target genes and their
participation in the development of rheumatoid arthritis. Selected genes associated
with the development of RA. Identified miRNAs that interact with the mRNA of
genes involved in the development of three types of rheumatoid arthritis. The most
effective miRNA-mRNA interactions were proposed, which were selected taking into
account some characteristics.
Using computer programs to calculate miRNA-mRNA interactions such as
miRTarget, miRDB and MiRWalk. Using the method of detailed analysis and
processing of the results obtained for their further discussion.
Practical base. The work was performed at the Department of Biotechnology
under the supervision of the scientific advisor PhD, Yurikova O.Yu.
10
MAIN PART
1 Literature review
1.1 History of discovery and general knowledge about miRNA
MiRNAs are a type of tiny non-coding RNA molecules found in animals, plants,
and some viruses that regulate gene expression through transcription and post-
transcriptional control. Nuclear DNA in plants and animals, as well as viral DNA in
some DNA-containing viruses, encode miRNAs.
A person might have up to 37 thousand distinct miRNAs in their body. To date,
there are miRNAs target 30 to 60% of protein-coding human genes, according to
various estimations [8].
MiRNAs were discovered in 1993 by a Harvard University research group led by
V. Ambros. This was sparked by the discovery of a mutation in the worm
Caenorhabditis elegant, which resulted in the pupa's metamorphosis into an adult
animal being disrupted. A tiny non-coding RNA protein termed lin-4 was discovered
to be required for the development of the phenotype of this mutation after more than
ten years of study on the protein responsible for this phenomena. Lin-4 negatively
regulates lin-14 gene expression by interacting with the 3' untranslated region (3'-
UTR) of lin-14 tRNA through a non-sense RNA-RNA interaction [9].
Historically, the first miRNAs discovered were are designated in the same style as
the "regular" genes of C. elegans: lin-4 and let-7. However, later there was the need
to introduce a special nomenclature, which makes it easy to designate hundreds of
newly discovered miRNAs. For example, in one study it was proposed spelling
"miR-" with a numerical index in opening order (miR-1, miR-2, etc. for RNA
products; mir-1, etc. for genes encoding them). Close homologues are denoted by the
same number with the addition of a small latin letter (e.g. miR-2a, miR-2b). To
indicate identical miRNAs encoded at different positions of the genome, an
additional number is added through a hyphen for example, mir-2b-1, mir-2b-2); let-7
and lin-4 retain their original names. These rules were subsequently accepted by the
scientific community and further described in a standard-setting publication
annotating newly discovered miRNAs. When it became clear that from the hairpin
structure miRNA precursor Mature miRNA can come from any chain, began to use
an additional suffix -5p or -3p in cases where both chains are equivalent, or an
asterisk (*) to indicate minor chain . There are two regions in the human genome,
producing an identical main product of a given miRNA
(UAGCAGCACGUAAAUAUUGGCG), so they are identified by the same number
hsa-miR-16 with the addition digital suffix to distinguish between genomic hsa-miR-
16-1 localization for the gene on chromosome 13 and hsa-miR-16-2 for gene on
chromosome 3. Main product miRNA in these genes is indistinguishable and is
designated miR-16 (or miR-16-5p to show which predecessor chain it came from).
Another strand of the hairpin precursor1 can also give rise to a miRNA molecule,
which is denoted by miR-16-1-3p/miR-16-2-3p (the suffixes -1/-2 are included in the
11
name, since the sequences differ at different loci), or miR-16-1*/miR-16-2* (an
asterisk means that this product is minor, i.e. present in the cell extremely rarely
compared to the main one). Due to the need to organize and systematize information
about open miRNA researchers at the Sanger Institute (Great Britain) created a
specialized base data, called miRBase [10]. Currently base maintained by the
University of Manchester and is the main centralized repository information, where
all newly discovered miRNAs, including data on their genomic localization, sequence
and expression.
1.2 Biogenesis and regulatory functions of miRNA

MiRNAs are short non-coding RNA molecules that can range in length from 16 to
25 nucleotides. The process of transforming the parent miRNA into a mature,
competent miRNA is part of their biogenesis. Drosha, a Class 2 ribonuclease III
enzyme in the cell nucleus, Exportin 5, a protein produced by the XPO 5 gene, and
the Dicer enzyme in the cell cytoplasm are involved in the conversion of pri-miRNA
to mature miRNA [11]. Furthermore, the RISC complex is generated in the
cytoplasm of the cell by binding to the Argonauts' family of proteins, which then
functions as a muffler for messenger RNA, restricting its translation. According to
Table 1, miRNA biosynthesis can take place in two distinct ways.
Table 1- miRNA biosynthesis in two ways
Pathway Stages
1 Canonical dominant pathway;
pri-miRNA + RNA binding protein DGCR8 + ribonuclease III
Drosha → pre-miRNA + exportin 5(XPO5) → (cytoplasm) pre-
miRNA + endonuclease Dicer → miRNA
Then mature miRNA binds to Argonaute proteins creating
miRNA-induced Silencing Complex (miRISC).[12]
2 Non- 1) Drosha/DGCR8 independent pathway;
canonical 2) Endonuclease Dicer independent.[12]
12
Fig.1 – Canonical and non-canonical pathways of miRNA
There are two types of miRNA biogenesis pathways: canonical and non-canonical.
A canonical miRNA biogenesis route. RNA polymerase II transcribes primary
transcripts (pri-miRNAs) from miRNA genes, which are then cleaved by
Microprocessor (Drosha+DGCR8) to generate precursor miRNAs (pre-miRNAs).
Pre-miRNAs are subsequently transported to the cytoplasm, where Dicer cleaves
them into miRNA duplexes once more. One strand of this miRNA duplex is loaded
into the Argonaute protein (AGO) to produce RISC, which regulates mRNA. In
MiRNA biogenesis through a non-canonical route. MiRNAs escape the Drosha- or
Dicer-dependent cleavage stage in the non-canonical route of miRNA synthesis, and
this step is substituted by a different cleavage process carried out by other proteins
[13].
MiRNA’s play an important role in a variety of molecular processes in the human
body. Extracellular miRNAs can act as biomarkers for the identification of different
illnesses, including rheumatoid arthritis. MiRNA’s can be present in extracellular
fluids, making them significant signaling molecules engaged in intercellular
communication[14].
MiRNAs bind to a specific section of messenger RNA, which may be found in the
3'UTR, 5'UTR, and CDS regions, as well as the promoter region, MiRNA functions
as a suppressor for gene expression by binding to mRNA in the protein-coding
regions, whereas binding in the promoter region catalyzes the transcription process
[15].
13
Posttranscriptional repression and mRNA degradation are two activities of
miRNA [16]. They control a variety of physiologic and pathological processes and
have varied expression patterns. MiRNAs' primary purpose is to prevent protein
production. They can help with this function by blocking or degrading mRNA . Each
mature mRNA interacts with a particular mRNA/mRNA, which is crucial for mRNA
function. In most cases, the miRNA seed zone interacts with the 3'-UTR of the
mRNA to inhibit the target mRNA. The miRNA binding sites differ in numerous
ways. mRNA-mRNA interaction can occur at the 5'UTR in some situations. The
tissue specificity of miRNAs is the second issue. MiRNA is expressed particularly in
tissue, and its impact is tissue-specific. The functional characterization of miRNAs
requires the identification of miRNA target genes. With certain algorithms and
bioinformatics toolsn will soon be able to forecast the target gene. TargetScan is the
most widely used program. Additional analysis may be necessary if silicon analysis is
insufficient. It is preferable to use genetic or biological approaches. Understanding
miRNA function necessitates successful prediction.
The adaptor component of miRNAs allows miRISC to detect and control the
target mRNA. miRISC controls AGO protein translation by introducing silencing
through detonation, degradation, or mRNA translation [17]. By lowering mRNA
stability or limiting mRNA translation, miRNAs incorporated into the RISCcomplex
influence gene expression at the post-transcriptional stage. miRNA can also influence
numerous epigenetic regulators (DNA methyltransferases and histone deacetylases).
Some miRNA’s have a beneficial influence on gene expression in addition to mRNA
suppression. This can be done either directly or indirectly.
The control of biological processes depends heavily on miRNAs. Deregulation of
this regulatory network can result in the development of pathological processes
including cancer and autoimmune illnesses.
miRNA’s serve critical functions in the immune response, organizing the adaptive
and innate immune processes and influencing the development of B cells,
conventional T cells, and t - lymphocytes, among other things [18].
1.3 The application of miRNAs in the diagnosis and therapy of diseases

Through the various modes of transport, miRNAs can be detected in biological
fluids such as blood, urine, cerebrospinal fluid, or saliva. In addition, the profile of
circulating miRNAs is a certain part of the cells in which they are modified and
secreted in accordance with the physiological or pathological conditions of these
cells. Therefore, miRNAs are considered as perfect biomarkers for diagnosing and
predicting the development of diseases, as well as the effectiveness of their treatment.
MiRNAs analysis in body fluids can reflect the molecular changes that occur in cells
and provide information to assist in diagnosis and therapeutic decisions. As miRNAs
plays the major role in regulation of several cellular processes, including cell
migration, proliferation, immunosuppression and apoptosis of the cells. All of these
processes in human’s body are connected with the treatment response and clinical
outcome of disease development. During malignant transformation, there is always a
change in the level of expression of some miRNAs .The diseases where the miRNAs
14
can be used as biomarkers include several types of cancers, cardiovascular diseases,
Parkinson’s disease, autoimmune diseases such as rheumatoid arthritis, etc. [19].
There are several reasons to utilize the miRNAs as the biomarkers in the possible
treatment ways. First of all, miRNAs are the molecules that are easy to be measured
and isolated from different types of biological sources as was mentioned before.
Second of all, the molecules of miRNA have the high level of stability in the
concentration of plasma and serum. Thirdly, it is comfortable and easy to store for a
long period of time in different temperature conditions.
Recent studies have demonstrated the connection of miRNA with the cancer. It
was approved that miRNAs can be oncogenic or act as tumor suppressors by acting
on mRNAs of tumor suppressors or oncogenes; oncogenic miRNAs are activated,
and tumor suppressor miRNAs are downregulated in cancer [20] [21]. The general
importance of miRNAs in cancer is underlined by the fact that approximately 50% of
all miRNA genes are located in fragile regions of the genome or in regions that are
usually amplified or deleted in human cancer.
In a treatment of rheumatoid arthritis, the miRNAs were suggested to be isolated
from synovial tissue as a synovial fluid. The studies have shown that both miRNAs
from plasma and synovial fluid are stable in a temperature at -20°C and freeze-
thawing from -20°C to 4°C [22]. The whole process of selection of miRNA can be
carried out with the use of microarray or quantitative real-time PCR for further
analysis for the prediction of rheumatoid arthritis. The study has already shown and
proven that the in RA patients, such miRNAs like miR-16, miR-132, miR-146 and
miR-155 were upregulated in plasma and synovial fluid, and the miRNA called miR-
223 is down regulated. In addition, the research revealed the results where there’s the
evidence of the involvement of miR-132 in the patients who suffer with the joint
inflammation during the systematic condition.
Besides all, the analysis of the detection of dysregulations of miRNAs of RA
patients can be carried out with the blood and plasma samples. Moreover, one of the
studies detected the reduced levels of PTEN and raised expression
of PTEN regulating miRNAs, namely miR-21-3p, miR-22-3p and miR-7-5p [23].
The miRNAs detected from serum in patients with RA are also take place in
diagnosis. For instance, there are two miRNAs of the let-7 family, including let-7d-5p
and let-7i-5p that are present to be elevated in RA serum [24].
1.4 General characteristics of rheumatoid arthritis

Rheumatoid arthritis (RA) is considered as one of the most common types of long
term inflammatory and autoimmune diseases that leads to the pain and stiffness of the
joints. According to the research, rheumatoid arthritis largely affects women rather
than men 3 times prominent [25].
In many cases, rheumatoid arthritis affects on the joint parts of hands, knees and
wrists at once. The uncontrolled inflammation of cartilage lead to the destruction and
damage of the surface of bones and deformation of joints. The main reason of the
cause of rheumatoid arthritis is the wrong attack of immune system to the body’s own
healthy tissue cells.
15
The disease characterized by the symmetrical lesion of the joints, high temperature,
weight loss, malaise, fatigue and general weakness that may appear at the beginning
of the disease even before the development of typical changes in the joints and
increase with an exacerbation of the disease [26].
In RA, internal organs such as kidneys, lungs, liver, spleen can also be affected.
The rheumatoid nodules in the lungs can be developed due to the inflammation of
pleura (pleurisy). Up to 25% of patients with RA may have subcutaneous rheumatoid
nodules (indurations under the surface of the skin), usually located on the flexion
surfaces of the joints. In addition, osteoporosis of bones is formed near the affected
joints. Approximately one third of patients with RA experience dry eyes and mouth.
This condition is called Sjögren's syndrome. The patients may have heart damage in
the form of pericarditis that caused by inflammation of the heart sac. In general, all
patients with RA have the risk of cardiovascular events compared with patients
without the disease. In 25-30% of cases of RA, anemia develops, and in less than 5%
of patients, Felty's syndrome (enlarged spleen and low white blood cell count)
progresses. It should be noted that patients with RA are also have the high risk of
developing infections. Complications of rheumatoid arthritis can be osteoporosis
(decrease in bone mineral density and, as an outcome of this condition, a fracture),
secondary osteoarthritis (degenerative changes in the joint), instability of the cervical
spine, and systemic atherosclerosis [27].
Rheumatoid arthritis develops gradually. At the initial stage, as usual, the joints of
the phalanges of the fingers are affected, and much less often the joints of the fingers
of the feet. However, at a young age, rheumatoid arthritis progresses and develops
much faster. It happens due to the fact that the immune system of young people is
very active. As a result, the production of antibodies to their own joint is in the active
phase.
Now the diagnosis of rheumatoid arthritis is based on changes occurring in the
joints, detected during x-rays, as well as on a biochemical blood test, and on the main
clinical markers, including the articular syndrome, combined with manifestations of
the general clinic like weakness, weight loss, fever and others. It should be noted that
the detection of rheumatoid factor in a blood test indicates not only the disease of
rheumatoid arthritis, but also characterizes its degree of activity.
The major tool of the diagnosis of rheumatoid arthritis is the radiography of the
joints. It can be indicated by the signs of destruction of local areas of the bone,
narrowing of the joint spaces in the diagnosis [28].
It usually takes about nine months from the onset of the disease to the time of
diagnosis. The duration of such a delay in diagnosis is associated with the non-
specificity of the earlier manifestations of this disease. The further course of the
disease depends on timely diagnosis.
There are two major types of rheumatoid arthritis, namely seropositive and
seronegative forms of rheumatoid arthritis.
Seropositive rheumatoid arthritis is the most abundant type of rheumatoid arthritis
in comparison with the seronegative one. In fact, 60-70 % of patients with the
rheumatoid arthritis belong to seropositive type of rheumatism. The main difference
16
between these two types is that in the seropositive one the rheumatoid factor is
detected in the blood sample during the analysis, while in the seronegative one
there’s the negative response in the presence of rheumatoid factor in the blood.
However, the patients who had the negative results still have the probability of
having rheumatoid arthritis. It can be detected according to the other clinical
symptoms and during the clinical diagnostics with the help of x-rays [29].
Rheumatoid factor (Rf) is the antibody that is produced from our immune system to
immunoglobulin G, which transforms into a protein foreign to the body - an antigen.
In fact, the patients with the seropositive kind of arthritis experience more pain in the
joints in contrast to seronegative type of arthritis. People who have the seropositive
rheumatoid arthritis usually have such additional symptoms, including the presence
of nodules, vasculitis (inflamed blood vessels) and rheumatoid lung issues.
1.4.1 Etiology and pathogenesis

Etiology
Although rheumatoid arthritis is mediated by autoimmune reactions, the exact
cause of the disease is unknown; many factors can contribute to its development.
Indirect data: an increase in the number of leukocytes in the blood and an erythrocyte
sedimentation rate (ESR) indicate the infectious nature of the process. It is only
known that some people are genetically predisposed to rheumatoid arthritis, but the
disease is not directly transmitted from parents to children [30].
In 20–30% of patients, the disease begins after an infection, most often
nasopharyngeal. However, long-term searches for a specific microorganism that
causes rheumatoid arthritis have not been successful, so there is no reason to consider
this disease infectious [31].
As with most autoimmune diseases, there are the main impetus for the
development of this disease may be one of the following 3 main factors or a
combination of them:
● genetic predisposition - the risk of getting rheumatoid arthritis is increased by
about 4 times in blood relatives of patients with rheumatoid arthritis. Based on
the latest scientific research, scientists associate the development of rheumatoid
arthritis with the carriage of genes such as HLA-DR4, HLA-DR1 and HLA-
DB1. There are several other genes that are associated with the formation of
antibodies [32].
Many researchers believe that the genetic factor plays a small role in the
development of the disease (15-30%). Carrying genes associated with
rheumatoid arthritis does not mean that a person will get sick. For the
development of the disease, other provoking factors are also needed [33].
● infectious agents - the triggering factor for the development of RA can be:
Epstein-Barr virus, retroviruses (including T-lymphotropic human type I virus),
rubella, herpes viruses, parvovirus B19, cytomegalovirus, mycoplasma,
mycobacteria, etc.
The mechanism of participation of viruses in the development of PA can be
different:
17
> direct damaging effect of the virus on synoviocytes;
> infection with leukocyte viruses - their penetration into joint cavity with
blood flow - destruction of leukocytes - phagocytosis of viruses by
synoviocytes - persistence of viruses in synoviocytes - activation of the
immune response [34].
● trigger factor - (hypothermia, hyper insolation, intoxication, mutagenic drugs,
endocrinopathies, stress, etc.). For women, duration of breastfeeding reduces
the likelihood of developing RA. Breastfeeding for 24 months or longer cuts
risk of developing RA by half [35].
Pathogenesis
The development of rheumatoid arthritis is based on autoimmune inflammation.
This group of diseases is characterized by a change in the behavior of defender cells -
lymphocytes. They, instead of actively recognizing foreign bacteria, fungi, viruses,
and destroying them, begin to attack their own healthy cells [36]. This pathological
process of violation of the interaction of cells of the immune system in the immune
response consists of the following steps:
● Synoviocytes acquire the features of macrophages, secrete pro-inflammatory
cytokines, primarily tumor necrosis factor alpha, interleukin 1, become
antigen-presenting cells and cause the activation of type 1 T-helpers.
● In the cells of the synovial fluid and in the synovial membrane of the joint, a
large number of T-helpers of type 1 appear, releasing gamma-interferon and
activating macrophages.
● Activated macrophages and monocytes produce pro-inflammatory cytokines:
tumor necrosis factor alpha, IL-1, IL-6.
● An increase in the concentration of IL-8 in the synovial fluid causes a high
concentration of neutrophils in it.
● IL-1 causes fever, activation of osteoclasts, which contributes to osteoporosis
of the subchondral bone plate. Tumor necrosis factor causes the appearance of
adhesion molecules on the surface of endotheliocytes, promoting exudation,
causes weight loss, anemia of chronic inflammation. I16, activating
hepatocytes, causes an increase in their production of C-reactive protein;
activates B-lymphocytes (turning them into plasma cells).
● In the blood, the concentration of plasma cells producing immunoglobulin
increases significantly.
● In the blood and synovial fluid in 80% of patients, the concentration of IgM
and IgG sharply increases to the altered Fc site of IgG (rheumatoid factors).
● The release of endothelial growth factor promotes the growth of capillaries in
the synovial tissue. Angiogenesis and proliferation of active fibroblasts,
synoviocytes lead to the formation of pannus, an aggressive tissue with signs of
tumor-like growth, capable of invading cartilage, the articular surface of the
bone, forming erosions, and into the ligamentous apparatus. The clone of
uncontrollably multiplying, aggressive synoviocytes that makes up the pannus
is formed relatively late - a few months after the onset of the disease.
18
● The formation of immune complexes in the blood as a result of the interaction
of IgG with rheumatoid factors leads to complement activation and damage to
the microvasculature, which explains the visceral manifestations of rheumatoid
arthritis [37].
Normally, the human immune system produces antibodies (proteins) that help the
body fight, destroy viruses, bacteria and other foreign substances [38]. As mentioned
before in rheumatoid arthritis, the immune system produces antibodies against
healthy cells and tissues of its own body, they are called autoantibodies ("auto" -
one's own). Arthritis causes inflammation within the joint: the synovium thickens,
which can lead to joint swelling. The swollen synovial membrane turns into a dense
mass called "pannus". As the "pannus" grows, the articular cartilage begins to be
damaged, which leads to weakening of the muscles, ligaments and tendons. Against
the background of persistent inflammation, the bones that form the joint are
destroyed. In severe RA, distal bones can come into contact and partially fuse,
causing what is known as ankylosis, in which the joint begins to lose its function.
Persistent deformities may form (the so-called "boutonniere", "swan neck"), the
functional ability of the patient and his quality of life are reduced [39].
1.4.2 Prevalence of the disease in the world

Rheumatoid arthritis is prevalent throughout the world and affects all ethnic
groups. The prevalence is 0.5-1% (up to 5% in the elderly) in developed countries.
Every year, between 5 and 50 people fall ill per 100,000 population. In 2010, about
49 thousand people died from rheumatoid arthritis in the world [40]. The global
prevalence of RA between 1980 and 2019 was 460 per 100,000 population, with
variations due to geographical location and study methodology. The average age of
onset of the disease is 40-50 years for women and somewhat more for men. Women
get sick 3-5 times more often than men [40] [41].
According to GlobalData, a prominent data and analytics company, the number
of diagnosed prevalent cases of rheumatoid arthritis (RA) in the eight major markets
(*8MM) is predicted to rise from 4.6 million in 2019 to 5.1 million in 2029, with an
annual growth rate (AGR) of 1.06 percent [42].
*8MM = The US, 5EU (France, Germany, Italy, Spain, UK), Japan and Australia.
19
Fig. 2- Worldwide prevalence of RA [42]
According to data from 2013 to 2017, the total incidence of RA in the Republic of
Kazakhstan adult population was 376.7 per 100,000, representing a 69.1% increase in
prevalence [43].
Another research showed, in Kazakhstan, the prevalence of RA was 0.36–0.38
percent in 2017–2019, with an incidence rate of 0.085–0.087 percent, which is
comparable to statistics from other Central Asian nations [43]. All data is given in
Figure 3 below.
Fig. 3- Prevalence and incidence of RA in the RK in 2017-2019 [43]
20
1.5 The role of miRNAs in the pathogenesis of rheumatoid arthritis
RA is an autoimmune illness that causes persistent inflammation of the joints. The
tiny joints of the hands and feet are the most typically afflicted, however the
condition is known to differ across people. RA affects around three times more
women (women) than men (men) in the general population, and it is more frequent in
adults between the ages of 35 and 50, as well as the elderly [44]. Inflammation that
persists leads to joint injury and dysfunction. Autoimmunity with various joint
lesions and systemic inflammation define this illness. Patients may also develop
problems that result in permanent impairment and an increased risk of death.
MiRNAs have a role in the pathophysiological pathways that underpin human illness.
Researchers have accumulated more and more data involving miRNAs in
numerous human autoimmune disorders, such as RA, during the last decade. All
current evidence suggests that miRNA-mediated control is critical in the development
of many inflammatory diseases. Thus, rheumatoid arthritis can be caused by
dysregulation of miRNA production, such as loss or suppression of miRNA owing to
mutation, mutation of the miRNA promoter region, or overexpression of miRNA,
epigenetic activation.
MiRNAs are post-transcriptional regulators of gene expression, and rheumatoid
arthritis is a polygenic illness with numerous impacts. In RA, increased miRNA
expression has been seen in synovial tissue, synovial fibroblasts, PBMCs, plasma,
synovial fluid, and activated immune cells in wounded joints, among other places and
cells [45]. The miRNA candidates for RA discovered have an important role in
crucial biological pathways. Cytokine signaling pathways and inflammation are two
of these mechanisms. In individuals with RA, many miRNAs have been identified to
be up - or down-regulated in synovial tissue and cells of the articular or blood
compartment. In RA, the loss of bones and joints is followed by alterations in cellular
miRNAs, which might impact epigenetic control. The benefits of miRNAs as RA
diagnostic tools are numerous. As a result, miRNAs are stable and may be extracted
from multiple bodily areas (synovial fibroblasts, blood, plasma). MiRNAs can be
discovered in the bloodstream without requiring a biopsy. Finally, PCR may be used
to determine miRNA expression levels.
21
2 MATERIALS AND METHODS
2.1 Materials
The following materials were used for scientific work:
● 2567 nucleotide sequences of human miRNA obtained from the miRBase
database (http: //mirbase.org);
● 75 nucleotide sequences of human genes associated with the development of
rheumatoid arthritis;
In order to create a database with the genes associated with rheumatoid arthritis,
the DisGeNET (http://www.disgenet.org) platform was utilized for the selection of
genes. DisGenet platform is considered as one of the largest freely accessible and
available database that includes the collection of genes and variants associated with
several disorders. The search was performed with the use of filter “diseases”, among
the all results, 75 genes were selected. All of the selected genes were approved to be
connected with the rheumatoid arthritis by the scientific article researches from
PubMed database ( http://www.ncbi.nlm.nih.gоv/pubmed). The nucleotide sequences
were taken from the NCBI, exactly the GenBank database (http:
//www.nсbi.nlm.nih.gоv/gеnbаnk). The longest isoforms of 75 genes were selected
and taken from it either.
The programs predicted binding sites of 2567 miRNA in the mRNA of 75
selected genes for RA as shown in Table 2. Based on the analysis of the identified
binding sites, several effective associations of miRNA and target genes have been
proposed.
Table 2- List of genes associated with RA
№ Gene Full name of gene PMID
1 ABHD6 Abhydrolase domain containing 6 28134081
2 ADAM metallopeptidase with 28850027

ADAMTS9 thrombospondin type 1 motif 9
3 AFF3 AF4/FMR2 family member 3 19359276
4 AGXT2 Alanine--glyoxylate aminotransferase 2 31062169
5 AKT2 AKT serine/threonine kinase 2 30541951
6 BCL2L12 BCL2 like 12 31217874
7 BLK proto-oncogene, Src family tyrosine 21068098

BLK kinase
8 BRD1 Bromodomain containing 1 30042400
9 BTK Bruton tyrosine kinase 31495833
22
10 31342120
CCL21 C-C motif chemokine ligand 21 28799100
11 30402834
C-C motif chemokine ligand 3
CCL3
12 CD28 CD28 molecule 27092776
15
CDK6 Cyclin dependent kinase 6 18794853
16 CLEC12A C-type lectin domain family 12 member A 22341585
17 DNM1L Dynamin 1 like 31755231
18 EFNB1 Ephrin B1 17942634
19 EMCN Endomucin 21159824
20 ENO1 Enolase 1 29997113
21 FASLG Fas ligand 25645050
22 FCGR3A Fc fragment of IgG receptor IIIa 18843786
23 32820945
FCN1 Ficolin 1 18032536
24 23883198
FCRL3 Fc receptor like 3 23463945
25 FPGS Folylpolyglutamate synthase 26652611
26 HLA-C major histocompatibility complex, class I, C 24566686
27 major histocompatibility complex, class II, 15547082

HLA-DMB DM beta
28 major histocompatibility complex, class II, 28455285

HLA-DQB1 DQ beta 1
29 IFNGR1 Interferon Gamma Receptor 2 25708927
30 Il10 Interleukin-10 30328021
33 Il23R Interleukin 23 Receptor 30924147
23
34 IL2RA Interleukin 2 Receptor Subunit Alpha 20453842
35 IL2RB Interleukin 2 Receptor Subunit Beta 31134763
36 IL6R interleukin-6 receptor gene 23143596
37 Interleukin 6 Cytokine Family Signal 22870451

IL6ST Transducer
38 IRAK1 interleukin-1 receptor-associated kinase 1 23143596
39 IRF5 Interferon Regulatory Factor 5 20453842
40 IRF8 Interferon Regulatory Factor 8 23143596
41 KDR Kinase insert domain-containing receptor 31405022
42 KIF5A Kinesin family member 5A 18794853
43 MMEL1 Membrane Metalloendopeptidase Like 1 18794853
44 MTHFR Methylenetetrahydrofolate Reductase 28175955
45 NFKBIE NFKB inhibitor epsilon 22446963
46 NKBIL1 NFKB Inhibitor Like 1 17855452
47 NLRC5 NLR family CARD domain containing 5 31694750
48 OLIG3 Oligodendrocyte transcription factor 3 20353580
49 PADI4 Peptidyl Arginine Deiminase 4 22552437
50 Phosphatidylinositol-4,5-bisphosphate 3- 26723864
PIK3CA kinase catalytic subunit alpha
51 PLD4 Phospholipase D Family Member 4 22446963
52 POUR3F1 POU class 3 homeobox 1 23143596
53 PRDM1 PR domain zinc finger protein 1 19898481
54 Protein Tyrosine Phosphatase Non-Receptor 22446963

PTN2 Type 2
55 Protein Tyrosine Phosphatase Non-Receptor 30507064

PTPN22 Type 22
56 RASGRP2 RAS guanyl releasing protein 2 30076153
57 REL REL proto-oncogene, NF-kB subunit 19503088
58 S100B S100 calcium binding protein B 31357327
59 SDC4 Syndecan 4 31309562
24
60 SIRT1 Sirtuin 1 31629819
61 SNW1 SNW domain containing 1 31824568
62 SOCS3 Suppressor of cytokine signaling 3 30854695
63 Signal transducer and activator of 30483789

STAT1 transcription 1


66 STS Steroid sulfatase 19192274
67 30562482
SUMO1 Small ubiquitin like modifier 1 30681271
68 TLR2 Toll like receptor 2 24936783
69 TNFAIP3 TNF alpha induced protein 3 22402800
70 TNFSF11 TNF superfamily member 11 27871200
71 TRAF1 TNF receptor associated factor 1 30904715
72 TYK2 Tyrosine kinase 2 25147926
73 VEGFA Vascular endothelial growth factor A 15213335
74 V-set and transmembrane domain containing 25267259

VSTM1 1
75 Zeta chain of T cell receptor associated 19136305

ZAP70 protein kinase 70
2.2 Methods
2.2.1 Programs for analysis and formatting of nucleotide sequences
To analyze and to identify effective miRNA-mRNA interactions which can be
used for further study and application in the clinical diagnosis of RA, we used 3 types
of computer programs such as miRTarget, miRDB and MiRWalk. The associations of
various miRNAs and genes given in the results predicted by these programs can be
utilized as a tool for more precise rheumatoid arthritis diagnosis.
In order to get the results from MiRTarget program, for each of the 75 selected
genes the separated text files were created. The text files were made in the format
“gene” as demonstrated on Figure 4. For the purpose of creating these files, the
special collection of Java Script programs were carried out on the freely available
website Sequence Manipulation Suite ( https://www.bioinformatics.org/sms2/).
25
Figure 4- txt file in format “gene”
Among all of these programs, only “Filter DNA” was set up to remove the blank
spaces in nucleotide sequences of the longest isoforms of gene’s miRNA. The
example is shown on the Figure 5.
Fig. 5 - “Filter DNA” program on website of Sequence manipulation suite
2.2.2 MiRTarget program for predicting miRNA binding sites

The cross platform miRTarget program was utilized first to get the calculations
of the gene interactions between miRNA and target genes. MiRTarget was created
with the help of Java programming language and used for detecting binding sites of
gene interactions [46]. The main table of miRTarget program is represented on the
Figure 6. Results obtained with the use of miRTarget reflect calculations with several
characteristics, consisting of genes and miRNAs names, position of miRNA-mRNA
binding sites. Besides all, it also detects the region of interaction (3’ UTR, 5’ UTR or
CDS). In addition, miRTarget reveals the information of the free energy of
hybridization (ΔG, kJ/mole) , a score of interaction (represents it in the percentage
26
ratio of binding energy of miRNA to the maximum value of binding energy of
miRNA with a fully complementary nucleotide sequence) and the length of miRNA.
Fig. 6 - Interface of miRTarget platfrom
MirTarget program provide the results by downloading two files, exactly the
calculations in Excel format (Figure 7) and as a text file in “mres” format, in which
we can see the gene interactions (Figure 8)
Fig. 7 - Results obtained from MirTarget in Excel format
Fig. 8 - Results obtained from MirTarget in MRES format
27
2.2.3 miRWalk program for predicting miRNA binding sites
MiRWalk is a freely accessible framework for estimating miRNA and known
gene binding predictions in humans and certain animals [47]. The following are some
of the benefits of this program:
 All known genes of humans and certain animals are stored in this database,
allowing a sophisticated search for miRNA-mRNA binding;
 Clear and easy-to-use interface, requiring simply the loading of a list of genes
into an unique loading window.
The name of the miRNA, gene symbol, start and end of the interaction, length of
miRNA, p value (the probability that the calculated gene region for interaction with
miRNA is the true target region, the higher this value, the higher the accuracy of the
result) of interaction, duplex scheme in the form of dot-bracket notation, and other
characteristics are performed by MiRWalk. For more accurate findings, the MirWalk
software allows you to filter the results by choosing a lower threshold for the values
of attributes such as p value. On systems like TargetScan and MirTarBase, filters
such as the correlation of the acquired findings with prospective computations may
be used. Open source applications for predicting miRNA-mRNA interactions include
TargetScan and MirTarBase.
Fig. 9 – Main page of miRWalk program
By choosing species, users can provide a single input of miRNA ID (e.g. hsa-
miR-215-7p) or Accession numbers (e.g. MIMAT0000785) depending on the current
version of miRBase. Short names or family miRNAs (e.g. let-8) that belong to many
miRNAs are also acceptable when looking for single miRNAs. In the case of mRNA,
users can search interaction information of input using the following IDs: Gene
symbols (e.g. GAS3), EntrezIDs (e.g. 12608), Ensembl-IDs (e.g. ENSG00000145212
or ENST00000757589), and RefseqIDs (e.g. NM 001257896), and then click on the
search option to execute the query input.
28
Fig. 10 - Summary of the obtained findings
The Figure 10 above shows a summary of the findings obtained after searching
numerous target genes. To improve the query output, you may use a variety of filter
choices. The table output has various connections to other databases, including
miRBase (miRNA-IDs), Ensemble (Ensembl Transcript IDs), and NCBI (National
Center for Biotechnology Information) (Genesymbols).
2.2.4 miRDB program for predicting miRNA binding sites

MiRDB is a web-based database that predicts miRNA targets and provides
functional annotations. Machine learning algorithms have been used to predict
miRNA targets based on common traits associated with miRNA binding and target
downregulation. MiRNA targets have been predicted in five species: human, mouse,
rat, dog, and chicken. The new prediction system allows users to specify their own
sequences for personalized target prediction.
The following features distinguish miRDB from other miRNA functional
databases:
 unique target prediction results;
 a new database design method focused on mature miRNAs;
 a wiki editing interface for community-provided miRNA annotations.
There are two ways to search miRDB for predicted miRNA targets [48].
1. Search by miRNA names. If there is more than one match, all the matched
miRNAs will be returned and you may choose from one of these miRNAs to
view their predicted targets. If there is only one match, the target prediction
result will be presented directly (Figure 11).
2. Search by gene target information. There are three options to do gene search:
GenBank Accession, NCBI Gene ID or Gene Symbol. You have to enter the
exact ID or symbol and no partial match is allowed. In this way, a single gene
record will be retrieved if it is predicted to be a miRNA target (Figure 11).
29
The search results are arranged by target score, which represents the target
prediction's confidence level. The miRNA and its gene target are described in depth
on the detailed result page. The highlighted sites are the target sites in the 3′-
untranslated region (UTR) (Figure 12).
Fig. 11 - miRNA target search with the standard query interface in miRDB
Fig. 12 - A screenshot of target prediction data retrieved from miRDB
Target prediction scores range from 50 to 100 for all projected targets. The new
computational target prediction system assigns these scores. We have more
confidence in this forecast if the score is higher. As a result, the search results are
sorted according to the prediction score. A predicted target with a prediction score
greater than 90, in our experience, is most likely to be real and confident. If the score
is less than 60, you should be wary, and extra supporting evidence is recommended.
So, by using advanced search options for multiple miRNAs or their gene targets,
we added filters with special options. As was mentioned above, we searched for gene
targets with more than 90 target prediction score, by excluding genes with less
prediction scores. The screenshot was given in Figure 13.
30
Fig. 13 - Advanced search options for multiple miRNAs or their gene targets in
miRDB
miRDB program provide the results which can be sorted by 3 options depending
on Target score, miRNA name and Gene symbol. The obtained result is able to
download, exactly the calculations in Excel format. The screen of the page is given
below in Figure 14.
Fig. 14 - The obtained result page made by using advanced search options
Results were represented by certain characteristics including the name of

miRNA and gene symbol (with ID), target rank and target with more details. In
details, it also detects the seed location, the region of interaction (3’ UTR only),
target prediction scores (these scores are assigned by the new computational target
prediction algorithm) and the length of 3’UTR. (Figure 15)
31
Fig. 15 - The results shown in details about each gene
32
3 RESULTS AND DISCUSSION
3.1 Characterization of miRNA-mRNA interactions predicted by

miRTarget
The first program that was used in detection and identifying the presence of
miRNA-mRNA interactions was the miRTarget program.
During the calculations, a database, consisting of 2567 miRNAs from miRBase
and 75 genes were compiled. As a result, 4043 binding sites were identified for the
genes associated with rheumatoid arthritis. Despite to this fact, all of the binding sites
between miRNAs and target genes were sorted according to the selection criteria that
shown on Table 3. Therefore, only the highly specific and effective interactions were
chosen by taking into account the length of miRNA (from 17 to 26 nucleotides) and
the score of the effectiveness of interaction (from 86 to 100 %). For instance, the
minimum score (ΔG / ΔGm) for the 18 nucleotides miRNA’s length must be more
than 96 %.
Table 3 - Selection criteria
MiRNA Minimum score,% (ΔG / ΔGm)

length, nt
17 98
18 96
19 94
92
20
21 91
22 90
23 89
24 88
25 87
26 86
Consequently, 28 out of 75 genes were identified as the target genes for miRNAs
associated with RA. Accordingly, 47 genes were revealed as the non-target genes.
The results can be observed by the Table 4.
33
Table 4 - MiRTarget results
Gene miRNA Position Where ΔG (kJ/m) ΔG/ΔGm, Length

%
1 2 3 4 5 6 7
ADAMTS9 miR-1976 283 5’UTR -110 98 20
AFF3 miR-5684 5806 3’UTR -98 92 20
miR-1273g- 5812 3’UTR -113 96 21

3p
miR-1972 6888 3’UTR -113 91 22
miR-6499-5p 1912 CDS -110 90 22
miR-574-5p 4191 ÷ 4207 3’UTR -110 ÷ - 91 ÷ 93 23

(7) 113
miR-1273d 5846, 6688 3’UTR -119 87 25
AKT2 miR-6124 2691 3’UTR -102 92 20
miR-3198 2699 3’UTR -110 91 22
miR-4688 1848 3’UTR -113 90 22
miR-619-5p 4558, 4694 3’UTR -110 ÷ - 91 ÷ 100 22

121
miR-191-5p 5126 3’UTR -110 90 23
miR-3614-3p 298 CDS -104 89 23
miR-658 1643 CDS -123 88 25
BCL2L12 miR-6727-3p 537 CDS -106 93 20
miR-6775-5p 698 CDS -123 84 25
BLK miR-4685-5p 785 CDS -125 86 26
BRD1 miR-4707-5p 2945 CDS -121 86 23
miR-638 70 5’UTR -121 81 25
miR-6775-5p 79 5’UTR -121 83 25
CD28 miR-1285-5p 1789 3’UTR -102 91 21
34
miR-619-5p 1556 3’UTR -117 96 22
CD38 miR-5684 5232 3’UTR -98 92 20
miR-1273g- 5238 3’UTR -108 93 21

3p
miR-1273h- 2608 3’UTR -113 90 22

3p
miR-548a-3p 1621 3’UTR -104 94 22
miR-548aq- 1621 3’UTR -100 92 22

3p
miR-5585-3p 2560 3’UTR -110 95 22
miR-548h-3p 1620 3’UTR -102 89 23
miR-548z 1620 3’UTR -102 89 23
miR-1254 5272 3’UTR -110 83 24
miR-548aa 1617 3’UTR -108 88 25
miR-548t-3p 1617 3’UTR -108 88 25
CDK6 miR-548az- 1624 3’UTR -96 92 21

3p
miR-1468-3p 10544 3’UTR -96 90 22
DNM1L miR-5095 3303 3’UTR -106 91 21
miR-5096 3383 3’UTR -104 92 21
miR-5585-3p 3450 3’UTR -106 91 22
miR-619-5p 3309, 3443 3’UTR -115 ÷ - 95 ÷ 96 22

117
EFNB1 miR-574-5p 2500 ÷ 2506 3’UTR -108 ÷-113 89 ÷ 93 23

()
EMCN miR-5096 2552 3’UTR -104 92 21
miR-5585-3p 2620 3’UTR -108 93 22
miR-619-5p 2613 3’UTR -113 93 22
FCN1 miR-1273f 3804, 6096 3’UTR -98 ÷ -102 94 ÷ 98 19
35
miR-1273g- 3771, 6063 3’UTR -113 96 21
3p
miR-4646-3p 3252 3’UTR -104 91 21
miR-5095 4587, 5044 3’UTR -106 ÷ - 91 ÷ 95 21

110
miR-5096 4667 3’UTR -106 94 21
miR-619-5p 4593, 5050 3’UTR -115 95 22
miR-1273d 6097 3’UTR -121 89 25
IL10 miR-5095 1056 3’UTR -115 98 21
miR-5096 1136 3’UTR -106 94 21
miR-619-5p 1062 3’UTR -119 98 22
IL23R miR-619-5p 2574 3’UTR -117 96 22
IL2RA miR-1285-5p 2319 3’UTR -104 92 21
miR-5585-3p 2220 3’UTR -106 91 22
miR-619-5p 2080 3’UTR -110 91 22
IL2RB miR-197-5p 2822 3’UTR -117 89 23
IL6R miR-5095 3940 3’UTR -115 98 21
miR-1273h- 3083 3’UTR -117 93 22

3p
miR-619-5p 3946 3’UTR -115 95 22
miR-6089 196 5’UTR -136 91 24
IRAK1 miR-5095 2706 3’UTR -110 95 21
miR-1273h- 2907 3’UTR -117 93 22

3p
miR-619-5p 2712 3’UTR -119 98 22
MTHFR miR-619-5p 6210, 6778 3’UTR -108 ÷ - 89 ÷ 95 22

115
miR-5095 6772 3’UTR -110 95 21
miR-5585-3p 6217, 6920 3’UTR -108 ÷ - 93 ÷ 95 22
36
110
miR-1226-5p 2215 3’UTR -121 81 26
NLRC5 miR-6794-5p 1495 CDS -108 93 20
PADI4 miR-5093 1493 CDS -113 90 23
PTPN2 miR-619-5p 2745, 3055, 3’UTR -110 ÷ - 91 ÷100 22

3188 (3) 121
miR-5096 2819 3’UTR -108 96 21
miR-5095 2739 3’UTR -110 95 21
miR-5585-3p 2887 3’UTR -106 91 22
miR-4452 2791 3’UTR -102 89 23
REL miR-5096 2441 3’UTR -110 98 21
miR-619-5p 2367, 7641 3’UTR -110 ÷ - 91 ÷ 93 22

113
miR-4452 2413 3’UTR -104 91 23
STAT3 miR-619-5p 3103 3’UTR -119 98 22
miR-5585-3p 3240 3’UTR -110 95 22
miR-5095 3097 3’UTR -106 91 21
SUMO1 miR-619-5p 391 CDS -110 91 22
miR-5096 465 CDS -102 91 21
TYK2 miR-4372-5p 3886 3’UTR -113 90 23
VEGFA miR-1277-5p 2083 3’UTR -96 88 24
Importantly, two miRNAs (miR-574-5p, miR-619-5p) were determined to have

the cluster organizations of binding sites in three genes, namely AFF3, EFNB1 and
PTPN2. Additionally, there are two interactions of miRNAs and target genes that
showed the maximum high score number with the 100 % percentage. They are the
PTPN2 and AKT2 genes with the mir-619-5p respectively.
3.2. Characterization of miRNA-mRNA interactions predicted by miRWalk

The second program that was used in detection and identifying the presence of
miRNA-mRNA interactions was the miRWalk program.
37
During the calculations on miRWalk the 75 genes which are associated with
rheumatoid arthritis a human organism were involved and checked by their
interactions with miRNAs which are found in miRWalk base.
According to these estimations, 14 out of 75 genes have efficient interactions with
various miRNAs. The most effective versions were chosen based on their p value of
>0.95. These findings were downloaded as Excel tables, which included the names of
miRNAs and genes, their lengths, the interaction area, and connections to other
trustworthy databases TargetScan and miRTarBase. These variables were used to
choose the most effective interactions. miRTarBase has acquired about 360,000
miRNA-target interactions (MTIs), which are gathered by manually surveying
relevant literature after rigorously filtering research papers related to functional
investigations of miRNAs using natural language processing (NLP). In general,
reporter assays, western blots, microarrays, and next-generation sequencing
investigations are used to verify the obtained MTIs. While the miRTarBase has the
most confirmed MTIs, it also has the most up-to-date collection when compared to
other similar, previously produced databases.
miRTarBase as a filter shows firstly shows pre-miRNA information such as
genomic coordination, description, RNA secondary structure and associated diseases.
Shown in Figure 16 below.
Fig. 16 – miRTarBase, pre-miRNA information page
Additionally it shows mature miRNA information such as its sequence, evidence,

experiments, DrVs in miRNA and SNPs in miRNA (Figure 17).
38
Fig. 17 – miRTarBase, mature miRNA information page
Also miRTarBase shows information about gene including its synonyms,

description, transcript, expression and miRNA target sites. The Figure 18
demonstrates the searching page.
Fig. 18 – The result page about gene information
Also shows miRNA target interaction DrVs in gene 3’UTRs and SNPs in gene
3’UTRs.
39
Fig. 19 – miRNA target interactions
TargetScan looks for conserved 8mer, 7mer, and 6mer sites that match the seed
region of each miRNA to predict biological targets for miRNAs. Predictions with just
badly maintained sites are also available as an option. Mismatches in the seed region
that are mitigated by conserved 3' pairing and centered sites have also been
discovered. Cause of these reasons these filters were used to find the most effective
interactions.
Filter TargetScan shows length and conserved sites for miRNA families broadly
conserved among vertebrates. Shown in figure below.
Fig. 20 – Filter TargetScan page
40
Also shows the sites with higher probability of preferential conservation in 8mer,
7 mer-m8, 7mer-A1 and noncanonical.
Fig. 21 - Filter TargetScan page with the sites with higher probability
Table 5 - mirWalk results
Gene
miRNA Score Position Binding N Pairings
site
BCL2L12
hsa-miR-24-3p 1.00 CDS 214,1239 19
CD28 hsa-miR-145-5p 1.00 CDS 303, 332 22
CDK6 hsa-miR-497-5p 1.00 3UTR 7788,7826 21
hsa-miR-20b-5p 1.00 3UTR 3688,3739 20
hsa-miR-34a-5p 1.00 3UTR 3009,303 17
hsa-miR-449a 1.00 CDS 1315,1337 17
41
NLRC5
hsa-miR-149-5p 1.00 CDS 2305,2331 21
KIF5A
hsa-miR-103a-3p 1.00 3UTR 4142,4168 20
IL6R
hsa-let-7e-5p 1.00 3UTR 1791,1814 20
hsa-let-7i-5p
1.00 3UTR 1584,1607 17
hsa-let-7b-5p
hsa-let-7c-5p 1.00 CDS 1275,1296 17
1.00 CDS 1275,1296 17
IRAK1
hsa-miR-146b-5p 1.00 CDS 1054,1075 17
PRDM1 hsa-let-7a-5p 1.00 CDS 1391,1349 17

hsa-miR-125a-5p
hsa-miR-125b-5p 1.00 CDS 1245,1294 17
1.00 CDS 1278,1304 17
IL6ST
hsa-miR-520f-3p 1.00 3UTR 5614,5642 19
hsa-miR-29b-3p 1.00 3UTR 4351,4395 20

REL hsa-miR-300
0.99 3UTR 5892,5915 17
42
hsa-miR-195-5p 1.00 3UTR 1805,183 19
VEGFA hsa-miR-16-5p
hsa-miR-20a-5p 1.00 3UTR 1804,183 19
hsa-miR-6838-5p
1.00 3UTR 1879,192 18
1.00 CDS 1064,1084 18
STAT3 hsa-let-7c-5p 1.00 CDS 2303,2326 17
hsa-miR-155-5p 1.00 3UTR 3658,3678 18

SIRT1 hsa-miR-138-5p
hsa-miR-138-5p 1.00 5UTR 185,22 20
hsa-miR-22-3p
1.00 CDS 447,471 19
1.00 CDS 834,853 18
TNFAIP3
hsa-miR-23b-3p 1.00 CDS 1077,1099 17
The BCL2L12 gene is interacting with hsa-miR-24-3p in CDS from 214 nt to

1239 nt. The gene CD28 is interacting with hsa-miR-145-5p in CDS from 303 nt to
332 nt. The CDK6 gene has four variants of interaction. First is hsa-miR-497-5p in
3’UTR starting from 7788 nt to 7826 nt. Second is hsa- miR-20b-5p in 3’UTR from
3688 nt to 3739 nt. Third is hsa-miR-34a-5p in 3’UTR from 3009 nt to 303 nt. Fourth
variant is hsa-miR-449a in CDS from 1315 nt to 1337 nt.
The gene NLRC5 is interacting with hsa-miR-149p-5p in CDS from 2305 nt to
2331 nt.
The gene KIF5A is interacting with hsa-miR-103a-3p in 3UTR from 4142 nt to
4168 nt.
The IL6R gene has four variants of interaction. First is hsa-let-7e-5p in 3’UTR
starting from 1791 nt to 1814 nt. Second is hsa- let-7i-5p in 3’UTR from 1584 nt to
1607 nt. Third is hsa-let-7b-5p in CDS from 1275 nt to 1296 nt. Fourth variant is hsa-
let7c-5p in CDS from 1275 nt to 1296 nt.
The gene IRAK1 is interacting with hsa-miR-146b-5p in CDS from 1054 nt to
1075 nt.
The PRDM1 gene has three variants of interaction. First is hsa-let-7a-5p in CDS
starting from 1391 nt to 1349 nt. Second is hsa-miR-125a-5p in CDS from 1245 nt to
1294 nt. Third is hsa-miR-125b-5p in CDS from 1278 nt to 1304 nt.
The gene IL6ST is interacting with hsa-miR-502f-3p in 3’UTR from 5614 nt to
5642 nt.
43
The REL gene has two variants of interaction. First is hsa-miR-29b-3p in 3’UTR
starting from 4351 nt to 4395 nt. Second is hsa-miR-300 in 3’UTR from 5892 nt to
5915 nt.
The VEGFA gene has four variants of interaction. First is hsa-miR-195-5p in
3’UTR starting from 1825 nt to 183 nt. Second is hsa- miR-16-5p in 3’UTR from
1804 nt to 183 nt. Third is hsa-miR-20a-5p in 3’UTR from 1879 nt to 192 nt. Fourth
variant is hsa-miR-6838-5p in CDS from 1064 nt to 1084 nt.
The gene STAT3 is interacting with hsa-let-7c-5p in CDS from 2303 nt to 2326 nt.
The VEGFA gene has four variants of interaction. First is hsa-miR-155-5p in
3’UTR starting from 3658 nt to 3678 nt. Second is hsa- miR-138-5p in 5’UTR from
185 nt to 22 nt. Third is hsa-miR-138-5p in CDS from 447 nt to 471 nt. Fourth
variant is hsa-miR-22-3p in CDS from 834 nt to 853 nt.
The gene TNFAIP3 is interacting with hsa-miR-23b-3p in CDS from 1077 nt to
1099 nt.
The miRNA hsa-let-7c-5p interacts with two genes IL6R and STAT3 in CDS
position. Most interactions are in CDS position. The genes CDK6, IL6R, PRDM1,
REL, VEGFA, SIRT1 interact with different miRNA s in different positions mostly in
3’UTR position.
3.3. Characterization of miRNA-mRNA interactions predicted by miRDB

The third program that was used in detection and identifying the presence of
miRNA-mRNA interactions was the miRDB program.
During the computer calculations, 75 genes that are associated with rheumatoid
arthritis in the human were selected to check their effective interaction sites with
2656 miRNAs which are collected from miRBase. From this amount of genes only
41 genes effectively interacted with some of the studied miRNAs. Accordingly, 34
genes were revealed as the non-target genes, including BTK, BLK, CLEC12A, HLA-
DMB, HLA-DQB1, ENO1, EFNB1, FCN1, NLRC5, etc.
There were two genes, CDK6 and PIK3CA that bind with the largest amount of
different miRNAs. They are miR-33b-5p, miR-548j-5p, miR-576-5p, miR-186-5p,
miR-26a-5p, miR-502-3p, miR-449a, miR-516b-5p, miR-541-5p, miR-186-5p, miR-
19a-3p, miR-200c-3p, miR-3121-3p, miR-664b-3p, miR-203a-3p, miR-320d, miR-
27a-3p for CDK6 and PIK3CA respectively.
In these results, there were several cases of multiple binding interactions, as well
as the interaction of one gene with several different miRNAs or interaction of one
gene with the only miRNA.
For example, the gene ADAMTS9 has interactions with several miRNAs, such as
hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-511-3p, hsa-miR-329-3p, hsa-miR-802,
hsa-miR-205-5p, hsa-miR-9-5p with target score between 90-99. Also, PRDM1 with
hsa-miR-30a-5p, hsa-miR-9-5p, hsa-miR-133a-3p, hsa-miR-874-3p, hsa-miR-145-
5p, hsa-miR-548t-3p, hsa-miR-374a-5p, while some genes have interaction with only
one miRNA.
The gene AGXT2 has interaction with only hsa-miR-514b-5p, and AKT2 with hsa-
miR-3065-3p, CCL21 with hsa-miR-608.
44
As was mentioned before, all of the interactions between miRNAs and target
genes were sorted according to the selection criteria that shown in Figure 8. As a
result, only the most particular and effective interactions were selected, with the
target score of interaction efficacy as a criterion (from 90 to 100).
Unlike MiRTarget, miRDB identified 41 of 75 genes as target genes for
miRNAs linked to RA. Other 34 genes were discovered to be non-target genes. The
final results shown on Table 6
Table 6 - miRDB results
Gene miRNA Target Seed 3' UTR

Score Location Length
1 2 4 5 6
ABHD6 hsa-miR-27a-3p 96 869, 878
hsa-miR-125a-5p 94 72 989
ADAMTS9
hsa-miR-29c-3p 99 426, 580
hsa-miR-30a-5p 98 158,172
hsa-miR-511-3p 96 121, 131, 1495
hsa-miR-329-3p 94 183
hsa-miR-802 93 377, 1188
hsa-miR-205-5p 91 36, 1247
hsa-miR-9-5p 90 1310, 1316
hsa-miR-493-5p 98 3616, 3721

AFF3 hsa-miR-200c-3p 94 496 4236
hsa-miR-3613-5p 93 3618
hsa-miR-450a-2-3p 91 513
AGXT2 hsa-miR-514b-5p 93 178 618
AKT2 hsa-miR-3065-3p 92 424, 1239 3572
BCL2L12 hsa-miR-182-5p 96 175

hsa-miR-455-3p 90 51 264
BRD1 hsa-miR-142-5p 96 589, 850

hsa-miR-30a-5p 95 740
hsa-miR-181c-5p 94 360, 389 955
hsa-miR-543 93 285
hsa-miR-550a-5p 90 640
CCL21 hsa-miR-608 94 106, 148, 407
hsa-miR-548a-3p 96 4180;
CD47
hsa-miR-15b-5p 90 4006 4194
CDK6 hsa-miR-33b-5p 99 623, 8182; 10235

hsa-miR-548j-5p 98 474, 10153;
hsa-miR-576-5p 97 91, 9115;
hsa-miR-186-5p 96 1871, , 6740;
45
hsa-miR-26a-5p 95 5877, 9018;
hsa-miR-502-3p 94 193, 4751;
hsa-miR-449a 92 1088, 9181;
hsa-miR-516b-5p 91 251, 8026;
hsa-miR-541-5p 90 1533, 8013
DNM1L
hsa-miR-449a 93 1776
hsa-miR-3192-5p 92 2172 2240
hsa-miR-544a 91 153
hsa-miR-3143 95 449, 2903; 3082

EMCN
hsa-miR-411-3p 92 1942, 2649
hsa-miR-21-5p 99 406, 853

FASLG hsa-miR-105-5p 91 84, 688 1283
hsa-miR-149-5p 90 178
FCRL3 hsa-miR-185-5p 94 54, 77 522
FPGS hsa-miR-124-3p 96 71, 170, 368 477
HLA-C hsa-miR-4524a-3p 90 247 420
IL10 hsa-miR-411-3p 95 305, 966

hsa-miR-3121-3p 93 156 1033
hsa-miR-202-3p 92 139
IL2RA hsa-miR-597-3p 91 1525 2178
hsa-miR-23a-3p 95 894, 2807; 4299

IL6R
hsa-miR-449a 92 696, 1999
IL6ST
hsa-miR-2355-3p 95 504, 5816; 7685
hsa-miR-513a-3p 94 1871, 3960;
hsa-miR-106b-5p 91 2685, 4152;
hsa-miR-450a-2-3p 90 225, 7362
IRAK1 hsa-miR-146a-5p 100 40, 56

hsa-miR-589-5p 97 41, 57 1371
IRF5 hsa-miR-3194-5p 93 85, 481, 749
1241
IRF8 hsa-miR-186-5p 95 281, 570, 1340
KDR
46
hsa-miR-665 97 23, 162, 718
hsa-miR-200c-3p 95 1031, 1381 1682
KIF5A hsa-miR-5699-5p 95 278 590
MTHFR hsa-miR-22-3p 93 132, 2854; 4950
hsa-miR-24-3p 92 617, 4910
OLIG3 hsa-miR-449a 93 285 1153

POU3F1 hsa-miR-495-3p 94 1386, 1410 1537
PRDM1 hsa-miR-30a-5p 99 408, 2383;
hsa-miR-9-5p 98 1459, 2323;
hsa-miR-133a-3p 97 907, 2259; 2453
hsa-miR-874-3p 95 168, 1601;
hsa-miR-145-5p 93 418;
hsa-miR-548t-3p 92 166;
hsa-miR-374a-5p 91 223, 368;
PTPN2 hsa-miR-331-3p 96 150 363
hsa-miR-194-5p 92 561, 1168 1976
CD28 hsa-miR-24-3p 91 524, 3303 4015
FCGR3A hsa-miR-382-3p 92 1243 1284
PIK3CA hsa-miR-186-5p 98 2219
hsa-miR-19a-3p 98 4575
hsa-miR-200c-3p 96 3446
hsa-miR-3121-3p 95 3645 5740
hsa-miR-664b-3p 93 5061
hsa-miR-203a-3p 93 5192
hsa-miR-320d 91 5170
hsa-miR-27a-3p 91 1590
REL hsa-miR-144-3p 97 92, 124 5636
SIRT1 hsa-miR-154-3p 97 281
hsa-miR-211-5p 95 384
hsa-miR-338-5p 95 656, 1634
hsa-miR-9-5p 95 404 1813
hsa-miR-22-3p 94 530
hsa-miR-543 93 64, 367
hsa-miR-539-3p 90 280
SOCS3 hsa-miR-1827 96 299, 1435
hsa-miR-30a-5p 95 1425 1641
STAT3 hsa-miR-374a-3p 95 1530, 1956
hsa-miR-21-5p 94 2040, 2353 2518
hsa-miR-590-5p 93 2040, 2353
hsa-miR-32-3p 90 606
SUMO1 hsa-miR-3918 94 332
hsa-miR-548k 93 239 1073
hsa-miR-502-3p 91 568
hsa-miR-665 90 363
TNFAIP3 hsa-miR-23a-3p 97 443, 1823
hsa-miR-18b-5p 95 674 2010
hsa-miR-19a-3p 94 1872
hsa-miR-141-3p 90 1059, 1754
TNFSF11 hsa-miR-543 97 1012, 1050 1113
hsa-miR-144-3p 94 1023
47
hsa-miR-3143 94 1012, 1051
hsa-miR-323a-3p 93 493
hsa-miR-335-5p 91 134
TRAF1 hsa-miR-3194-5p 92 107, 1173 2627
As mentioned above, the search results are sorted according to the prediction
score. As high the target score, as effective the interaction between target gene and
miRNA. So from the derived results, predicted target gene with a prediction score
greater than 90 was collected in this table.
The calculation results obtained by miRDB program shown that, the most
effective association is considered to be the gene IRAK1 and miRNA hsa-miR-146a-
5p association with target score equal to 100.
Other target gene – miRNA interactions also founded to be effective. They are
ADAMTS9 - hsa-miR-29c-3p associations with target score 99; CDK6 - hsa-miR-33b-
5p associations with target score 99; FASLG - hsa-miR-21-5p associations with target
score 99; PRDM1 - hsa-miR-30a-5p associations with target score 99;
3.4 Comparative analysis of interactions obtained by MiRTarget, miRWalk

and miRDB programs
In order to determine the effective miRNA-mRNA interactions and to check
binding sites, the comparative analysis of the calculations of three programs was
performed.
The interpretation of comparative analysis based on the results of three programs,
including miRTarget, MirWalk and miRDB is represented on the Appendix 1. The
analysis showed that there are no identical miRNAs interactions in three programs.
During the analysis and comparison of results, only 7 genes were identified as the
target genes for all of the 3 programs. They are BCL2L12, CD28, CDK6, IL6R,
IRAK1, REL and STAT3. It should be noted that 21 out of 75 genes, including BTK,
CLEC12A, ENO1, HLA-DMB, HLA-DQB1, IL17, IL21, MMEL1, NFKBIE, NKBIL1,
PLD4, RASGRP2, S100B, SDC4, SNW1, STAT1, STAT4, STS, TLR2, VSTM1 and
ZAO70, were not detected in the miRNA- mrna interactions in none of the three
programs, which make them non-target genes at all . According to the predictions,
these genes are not related with any miRNAs.
It was demonstrated that the program miRDB allocated more of the target genes
that are interacted with miRNA rather than miRTarget and miRDB. Overall 15 genes
were revealed in miRDB program to be highly associated with miRNA binding sites,
namely ABHD6, AGXT2, CCL21, CD47, FASLG, FGGR3A, FCRL3, FPGS, HLA-C,
OLIG3, POUR3F1, PTPN22, SOCS3, TNFSF11 and TRAF1. None of these genes
were not found in miRWalk and miRTarget platforms. Nevertheless, such genes like
BLK, CD38, EFNB1, FCN1, IL23R, IL23RB, PADI4, PTN2 and TYK2 were only
established in the results by miRTarget.
Referring to our results, the further research is needed to be accomplished fully
on compiling miRNAs that are associated and can be used as the prediction tools for
rheumatoid arthritis. Furthermore, more detailed work must be performed by using
48
different and various methods to justify and claim the clear and proven associations
of these miRNAs that are shown in appendix.
CONCLUSION
Accordingly, the following conclusions were reached analysis of the data

collected: the list of genes generated in the process of the RA analysis,
comprehensive prediction tools, miRTarget, MiRWalk and miRDB, identifying a
complete list of interactions and major features. The following results were revealed:
1. In the course of the work, a database of 75 genes associated with the
development of RA.
2. Using computational tools, miRTarget, miRWalk and miRDB, possible
miRNA-mRNA interactions were predicted. Employing the miRTarget
program, 4043 miRNA binding sites were identified from miRNA for the 28
genes associated with rheumatoid arthritis; the miRWalk program, 58
miRNA binding sites were identified in the mRNA of 14 genes out of 75 that
are associated with RA; by using miRDB program, 41 genes out of 75
associated with rheumatoid arthritis have shown interaction with 113 miRNA
binding sites.
3. The following miRNA-mRNA interactions were suggested to use in a
diagnosis of the development of RA according to calculations of three
programs:
 BCL2L12 with miR-6727-3p, miR-6775-5p, miR-24-3p, miR-182-5p,
miR-455-3p
 CD28 with miR-1285-5p, miR-619-5p, miR-145-5p, miR-24-3p
 CDK6 with miR-548az-3p, miR-1468-3p, miR-497-5p, miR-20b-5p,
miR-34a-5p, miR-449a, hsa-miR-33b-5p, hsa-miR-548j-5p, miR-576-5p,
miR-186-5p, miR-26a-5p, miR-502-3p, miR-449a, miR-516b-5p, miR-
541-5p
 IL6R with miR-5095, miR-1273h-3p, miR-619-5p, miR-6089, let-7e-5p,
let-7i-5p, let-7b-5p, let-7c-5p, miR-23a-3p, miR-449a
 IRAK1 with miR-5095, miR-1273h-3p, miR-619-5p, miR-146b-5p, miR-
146a-5p, miR-589-5p
 REL with miR-5096, miR-619-5p, miR-4452, miR-29b-3p, miR-300,
miR-144-3p
 STAT3 with miR-619-5p, miR-5585-3p , miR-5095, let-7c-5p, miR-374a-
3p, miR-21-5p, miR-590-5p, miR-32-3p
It should be noted that all of the three programs, including miRTarget,
miRWalk and miRDB revealed these 7 genes as target genes and determined them as
49
the most effective miRNA-mRNA interactions. Additionally, among them miRNA
was evaluated and compared which gave validity to identified miRNA and mRNA
interactions which had been associated with a number of genes linked to RA.
The mentioned miRNA-mRNA interactions are proposed to be used as
biomarkers in a diagnosis of the development of RA. Since miRNA production
signals suppression of gene expression and may be regarded a suppressor, the
existence of miRNA and gene connections is effective for predicting RA. It can also
signal the development of RA by being found in synovial fluid, blood and serum.
Besides all, these the most effective miRNAs and target genes related with the
development of RA have been identified and described, and will be employed in the
experimental section of future investigations.
All the goals and objectives set at the beginning of the work were completed.
50
REFERENCES
1. Paul B. J., Kandy H. I., Krishnan V. Pre-rheumatoid arthritis and its prevention
//European journal of rheumatology. – 2017. – Т. 4. – №. 2. – С. 161.
2. Bullock J. et al. Rheumatoid arthritis: a brief overview of the treatment
//Medical Principles and Practice. – 2018. – Т. 27. – №. 6. – С. 501-507.
3. Lee DM, Weinblatt ME. Rheumatoid arthritis. Lancet. 2001 Sep
15;358(9285):903-11.
4. Abdulqader Y., Al-Ani M., Parperis K. Rheumatoid vasculitis: early
presentation of rheumatoid arthritis //Case Reports. – 2016. – Т. 2016. – С.
bcr2016217557.
5. Nogaeva M. G., Amanzholova A. S., Tuleutaeva S. A. The prevalence of
rheumatoid arthritis in the Republic of Kazakhstan for 2013-2017 // Medicine
(Almaty). – 2019. – №. 3. - С. 1290–1301.
6. .
7. Furer V. et al. The role of microRNA in rheumatoid arthritis and other
autoimmune diseases //Clinical immunology. – 2010. – Т. 136. – №. 1. – С. 1-
15.
8. McInnes I. B., Schett G. The pathogenesis of rheumatoid arthritis //New
England Journal of Medicine. – 2011. – Т. 365. – №. 23. – С. 2205-2219.
9. Picerno V. et al. One year in review: the pathogenesis of rheumatoid
arthritis //Clin Exp Rheumatol. – 2015. – Т. 33. – №. 4. – С. 551-8.
10.Smolen J. S. et al. Rheumatoid arthritis //Nature reviews Disease primers. –
2018. – Т. 4. – №. 1. – С. 1-23.
11.Smolen J. S. et al. EULAR recommendations for the management of
rheumatoid arthritis with synthetic and biological disease-modifying
antirheumatic drugs: 2019 update //Annals of the rheumatic diseases. – 2020. –
Т. 79. – №. 6. – С. 685-699.
12. Smolen J. S. et al. Treating rheumatoid arthritis to target: 2014 update of the
recommendations of an international task force //Annals of the rheumatic
diseases. – 2016. – Т. 75. – №. 1. – С. 3-15.
13. McInnes I. B., Schett G. Pathogenetic insights from the treatment of
rheumatoid arthritis //The Lancet. – 2017. – Т. 389. – №. 10086. – С. 2328-
2337.
14. Smolen J. S. et al. Treating rheumatoid arthritis to target: 2014 update of the
recommendations of an international task force //Annals of the rheumatic
diseases. – 2016. – Т. 75. – №. 1. – С. 3-15.
51
15.McInnes I. B., Schett G. The pathogenesis of rheumatoid arthritis //New
England Journal of Medicine. – 2011. – Т. 365. – №. 23. – С. 2205-2219.
16. Agency of Strategic Planning and Reforms of the Republic of Kazakhstan
Bereau of National Statistics.
17. Combe B. et al. 2016 update of the EULAR recommendations for the
management of early arthritis //Annals of the rheumatic diseases. – 2017. – Т.
76. – №. 6. – С. 948-959.
18. Svoronos A. A., Engelman D. M., Slack F. J. OncomiR or tumor suppressor?
The duplicity of microRNAs in cancer //Cancer research. – 2016. – Т. 76. – №.
13. – С. 3666-3670.
19.Paliouras A. R., Monteverde T., Garofalo M. Oncogene-induced regulation of

microRNA expression: Implications for cancer initiation, progression and
therapy //Cancer Letters. – 2018. – Т. 421. – С. 152-160.
20.Murata K. et al. Plasma and synovial fluid microRNAs as potential biomarkers
of rheumatoid arthritis and osteoarthritis //Arthritis research & therapy. – 2010.
– Т. 12. – №. 3. – С. 1-14.
21.McGonagle D., Hermann K. G. A., Tan A. L. Differentiation between
osteoarthritis and psoriatic arthritis: implications for pathogenesis and
treatment in the biologic therapy era //Rheumatology. – 2015. – Т. 54. – №. 1.
– С. 29-38.
22. Whittle S. L. et al. Multinational evidence-based recommendations for pain
management by pharmacotherapy in inflammatory arthritis: integrating
systematic literature research and expert opinion of a broad panel of
rheumatologists in the 3e Initiative //Rheumatology. – 2012. – Т. 51. – №. 8. –
С. 1416-1425.
23.Heinicke F. et al. MicroRNA Expression Differences in Blood-Derived CD19+
B Cells of Methotrexate Treated Rheumatoid Arthritis Patients //Frontiers in
immunology. – 2021. – Т. 12.
24.Cunningham C. C. et al. Serum miRNA signature in rheumatoid arthritis and
“at-risk individuals” //Frontiers in immunology. – 2021. – Т. 12. – С. 126.
25. Gerosa M. et al. Rheumatoid arthritis: a female challenge //Women’s Health. –
2008. – Т. 4. – №. 2. – С. 195-201.
26.Cross M. et al. The global burden of rheumatoid arthritis: estimates from the
global burden of disease 2010 study //Annals of the rheumatic diseases. –
2014. – Т. 73. – №. 7. – С. 1316-1322.
27. Daien C. I. et al. Non-pharmacological and pharmacological interventions in
patients with early arthritis: a systematic literature review informing the 2016
52
update of EULAR recommendations for the management of early arthritis
//RMD open. – 2017. – Т. 3. – №. 1. – С. e000404.
28.Bartel D. P. MicroRNAs: genomics, biogenesis, mechanism, and function
//cell. – 2004. – Т. 116. – №. 2. – С. 281-297.
29.Zhang Y., de Bruin J. S., Verbeek F. J. Specificity Enhancement in microRNA
Target Prediction through Knowledge Discovery //Machine Learning. –
IntechOpen, 2010. - С. 157-171.
30.https://applbiolchem.springeropen.com/articles/10.1186/s13765-021-00624-
3/figures/1
31.Xia W., Cao G. J., Shao N. S. Progress in miRNA target prediction and
identification //Science in China Series C: Life Sciences. – 2009. – Т. 52. – №.
12. – С. 1123-1130.
32.Siomi H., Siomi M. C. Posttranscriptional regulation of microRNA biogenesis
in animals //Molecular cell. – 2010. – Т. 38. – №. 3. – С. 323-332.
33.Grishok A. et al. Genes and mechanisms related to RNA interference regulate
expression of the small temporal RNAs that control C. elegans developmental
timing //Cell. – 2001. – Т. 106. – №. 1. – С. 23-34.
34.Lytle J. R., Yario T. A., Steitz J. A. Target mRNAs are repressed as efficiently
by microRNA-binding sites in the 5′ UTR as in the 3′ UTR //Proceedings of
the National Academy of Sciences. – 2007. – Т. 104. – №. 23. – С. 9667-9672.
35.Anaparti V. et al. Whole blood microRNA expression pattern differentiates
patients with rheumatoid arthritis, their seropositive first-degree relatives, and
healthy unrelated control subjects //Arthritis research & therapy. – 2017. – Т.
19. – №. 1. – С. 1-11.
36.Simon T. A. et al. Prevalence of co-existing autoimmune disease in rheumatoid
arthritis: a cross-sectional study //Advances in therapy. – 2017. – Т. 34. – №.
11. – С. 2481-2490.
37.Rocha S. B., Baldo D. C., Andrade L. E. C. Clinical and pathophysiologic
relevance of autoantibodies in rheumatoid arthritis //Advances in
Rheumatology. – 2019. – Т. 59.
38.Croia C. et al. One year in review 2019: pathogenesis of rheumatoid
arthritis //Clin Exp Rheumatol. – 2019. – Т. 37. – №. 3. – С. 347-357.
39.McInnes I. B. et al. Land vatter SW, Strickler JE, McLaughlin MM, Siemens
IR, Fisher SM, Livi GP, White JR, Adams JL, Young PR //Nat Rev Immunol.
– 2007. – Т. 7. – С. 429-442.
40.Alamanos Y., Voulgari P. V., Drosos A. A. Incidence and prevalence of
rheumatoid arthritis, based on the 1987 American College of Rheumatology
53
criteria: a systematic review //Seminars in arthritis and rheumatism. – WB
Saunders, 2006. – Т. 36. – №. 3. – С. 182-188.
41.Gärtner M. et al. Immediate access rheumatology clinic: efficiency and
outcomes //Annals of the rheumatic diseases. – 2012. – Т. 71. – №. 3. – С.
363-368.
42.Gibofsky A. Overview of epidemiology, pathophysiology, and diagnosis of
rheumatoid arthritis //The American journal of managed care. – 2012. – Т. 18.
– №. 13 Suppl. – С. S295-302.
43.Lawrence J. S. Heberden Oration, 1969. Rheumatoid arthritis--nature or
nurture? //Annals of the Rheumatic Diseases. – 1970. – Т. 29. – №. 4. – С. 357.
44.Rubinstein G. Schizophrenia, rheumatoid arthritis and natural resistance
genes //Schizophrenia research. – 1997. – Т. 25. – №. 3. – С. 177-181.
45.Bullock J. et al. Rheumatoid arthritis: a brief overview of the treatment
//Medical Principles and Practice. – 2018. – Т. 27. – №. 6. – С. 501-507.
46.Chaudhari K. et al. Rheumatoid arthritis: current and future trends //Nat Rev
Drug Discov. – 2016. – Т. 15. – №. 5. – С. 305-6.
47.Lesk A. Introduction to bioinformatics. – Oxford university press, 2019. C.
255.
48.Bioinformatics and Biological Computing [Electronic resource]. - 2012. -
URL: http //bip.weizmann.ac.il/toolbox/overview/software_avail.html
49.Bandyopadhyay S. et al. MBSTAR: multiple instance learning for predicting
specific functional binding sites in microRNA targets //Scientific reports. –
2015. – Т. 5. – №. 1. – С. 1-12.
50.Chen Y., Wang X. miRDB: an online database for prediction of functional
microRNA targets //Nucleic acids research. – 2020. – Т. 48. – №. D1. – С.
D127-D131.
54
APPENDICES
Appendix 1. Comparison of results obtained by MiRTarget, miRWalk and

miRDB programs for rheumatoid arthritis.
miRNA, MiRTarget Gene miRNA, miRWalk miRNA, miRDB
- ABHD6 - hsa-miR-27a-3p
hsa-miR-125a-5p
miR-1976 ADAMTS9 - hsa-miR-29c-3p
hsa-miR-30a-5p
hsa-miR-511-3p
hsa-miR-329-3p
hsa-miR-802
hsa-miR-205-5p
hsa-miR-9-5p
miR-5684, AFF3 -
miR-1273g-3p, hsa-miR-493-5p
miR-1972, hsa-miR-200c-3p
miR-6499-5p, hsa-miR-3613-5p
miR-574-5p, hsa-miR-450a-2-3p
miR-1273d
- AGXT2 - hsa-miR-514b-5p
miR-6124, AKT2 -
miR-3198,
miR-4688, hsa-miR-3065-3p
miR-619-5p,
miR-191-5p,
miR-3614-3p,
miR-658
55
miR-6727-3p, BCL2L12 hsa-miR-24-3p hsa-miR-182-5p
miR-6775-5p hsa-miR-455-3p
miR-4685-5p BLK - -
miR-4707-5p, BRD1 - hsa-miR-142-5p
miR-638, hsa-miR-30a-5p
miR-6775-5p hsa-miR-181c-5p
hsa-miR-543
hsa-miR-550a-5p
- BTK - -
- CCL21 - hsa-miR-608
- CCL3 - -
miR-1285-5p, hsa-miR-145-5p hsa-miR-24-3p
miR-619-5p CD28
miR-5684, - -
miR-1273g-3p,
miR-1273h-3p,
miR-548a-3p,
miR-548aq-3p,
miR-5585-3p,
miR-548h-3p,
miR-548z,
miR-1254,
miR-548aa,
miR-548t-3p CD38
- - hsa-miR-548a-3p
CD47 hsa-miR-15b-5p
56
miR-548az-3p, hsa-miR-497-5p hsa-miR-33b-5p
miR-1468-3p hsa-miR-20b-5p hsa-miR-548j-5p
hsa-miR-34a-5p hsa-miR-576-5p
hsa-miR-449a hsa-miR-186-5p
hsa-miR-26a-5p
hsa-miR-502-3p
hsa-miR-449a
hsa-miR-516b-5p
CDK6 hsa-miR-541-5p
- CLEC12A - -
miR-5095, - hsa-miR-449a
miR-5096, hsa-miR-3192-5p
miR-5585-3p, hsa-miR-544a
miR-619-5p DNM1L
miR-574-5p EFNB1 - -
miR-5096, - hsa-miR-3143
miR-619-5p EMCN
- ENO1 - -
- - hsa-miR-21-5p
hsa-miR-105-5p
FASLG hsa-miR-149-5p
- FCGR3A - hsa-miR-382-3p
miR-1273f FCN1 - -
miR-1273g-3p,
miR-4646-3p,
miR-5095
57
miR-5096
miR-619-5p
miR-1273d
- FCRL3 - hsa-miR-185-5p
- FPGS - hsa-miR-124-3p
- HLA-C - hsa-miR-4524a-3p
- HLA-DMB - -
- HLA-DQB1 - -
- IFNGR1 - -
miR-5095 - hsa-miR-411-3p
miR-5096 hsa-miR-3121-3p
miR-619-5p Il10 hsa-miR-202-3p
Il17 - -
Il21 - -
miR-619-5p Il23R - -
miR-1285-5p, - hsa-miR-597-3p
miR-5585-3p,
miR-619-5p IL2RA
miR-197-5p IL2RB - -
miR-5095, hsa-let-7e-5p hsa-miR-23a-3p
miR-1273h-3p hsa-let-7i-5p hsa-miR-449a
miR-619-5p, hsa-let-7b-5p
miR-6089 IL6R hsa-let-7c-5p
- hsa-miR-520f-3p hsa-miR-2355-3p
hsa-miR-513a-3p
hsa-miR-106b-5p
IL6ST hsa-miR-450a-2-3p
58
miR-5095, hsa-miR-146b-5p hsa-miR-146a-5p
miR-1273h-3p, hsa-miR-589-5p
miR-619-5p IRAK1
- IRF5 - hsa-miR-3194-5p
- IRF8 - hsa-miR-186-5p
- - hsa-miR-665
KDR hsa-miR-200c-3p
- KIF5A hsa-miR-103a-3p hsa-miR-5699-5p
- MMEL1 - -
miR-619-5p - hsa-miR-22-3p
miR-5585-3p
miR-1226-5p MTHFR
- NFKBIE - -
- NKBIL1 - -
miR-6794-5p NLRC5 hsa-miR-149-5p -
- OLIG3 - hsa-miR-449a
miR-5093 PADI4 - -
- - hsa-miR-186-5p
hsa-miR-19a-3p
hsa-miR-200c-3p
hsa-miR-3121-3p
hsa-miR-664b-3p
hsa-miR-203a-3p
hsa-miR-320d
PIK3CA hsa-miR-27a-3p
PLD4 - -
59
POUR3F1 - hsa-miR-495-3p
hsa-let-7a-5p hsa-miR-30a-5p
hsa-miR-125a-5p hsa-miR-9-5p
hsa-miR-125b-5p hsa-miR-133a-3p
hsa-miR-874-3p
hsa-miR-145-5p
hsa-miR-548t-3p
PRDM1 hsa-miR-374a-5p
miR-619-5p, - hsa-miR-331-3p
miR-5095
miR-5585-3p
miR-4452 PTN2
PTPN22 - -
RASGRP2 - -
miR-5096 hsa-miR-29b-3p hsa-miR-144-3p
miR-619-5p hsa-miR-300
miR-4452 REL
S100B - -
SDC4 - -
hsa-miR-155-5p hsa-miR-154-3p
hsa-miR-22-3p
hsa-miR-543
SIRT1 hsa-miR-539-3p
60
SNW1 - -
- hsa-miR-1827
SOCS3 hsa-miR-30a-5p
STAT1 - -
miR-619-5p, hsa-let-7c-5p hsa-miR-374a-3p
STAT3 hsa-miR-32-3p
STAT4 - -
STS - -
miR-619-5p - hsa-miR-3918
miR-5096 hsa-miR-548k
hsa-miR-502-3p
SUMO1 hsa-miR-665
TLR2 - -
hsa-miR-23b-3p hsa-miR-23a-3p
hsa-miR-18b-5p
hsa-miR-19a-3p
TNFAIP3 hsa-miR-141-3p
- hsa-miR-543
hsa-miR-144-3p
hsa-miR-3143
hsa-miR-323a-3p
TNFSF11 hsa-miR-335-5p
TRAF1 - hsa-miR-3194-5p
miR-4372-5p TYK2 - -
miR-1277-5p VEGFA hsa-miR-195-5p -
61
hsa-miR-16-5p
hsa-miR-20a-5p
hsa-miR-6838-5p
VSTM1 - -
ZAP70 - -
Appendix 2. The list of target genes related to rheumatoid arthritis obtained by

MirTarget, miRWalk and miRDB programs
№ Gene MirTarget miRWalk miRDB
1 ABHD6 - - +
2 ADAMTS9 + - +
3 AFF3 + - +
4 AGXT2 - - +
5 AKT2 + - +
6 BCL2L12 + + +
7 BLK + - -
8 BRD1 + - +
9 BTK - - -
10 CCL21 - - +
11 CCL3 - - -
12 CD28 + + +
13 CD38 + - -
14 CD47 - - +
15 CDK6 + + +
16 CLEC12A - - -
17 DNM1L + - +
18 EFNB1 + - -
19 EMCN + - +
62
20 ENO1 - - -
21 FASLG - - +
22 FCGR3A - - +
23 FCN1 + - -
24 FCRL3 - - +
25 FPGS - - +
26 HLA-C - - +
27 HLA-DMB - - -
28 HLA-DQB1 - - -
29 IFNGR1 - - -
30 Il10 + - +
31 Il17 - - -
32 Il21 - - -
33 Il23R + - -
34 IL2RA + - +
35 IL2RB + - -
36 IL6R + + +
37 IL6ST - + +
38 IRAK1 + + +
39 IRF5 - - +
40 IRF8 - - +
41 KDR - - +
42 KIF5A - + +
43 MMEL1 - - -
44 MTHFR + - +
45 NFKBIE - - -
63
46 NKBIL1 - - -
47 NLRC5 + + -
48 OLIG3 - - +
49 PADI4 + - -
50 PIK3CA - + +
51 PLD4 - - -
52 POUR3F1 - - +
53 PRDM1 - + +
54 PTN2 + - -
55 PTPN22 - - +
56 RASGRP2 - - -
57 REL + + +
58 S100B - - -
59 SDC4 - - -
60 SIRT1 - + +
61 SNW1 - - -
62 SOCS3 - - +
63 STAT1 - - -
64 STAT3 + + +
65 STAT4 - - -
66 STS - - -
67 SUMO1 + - +
68 TLR2 - - -
69 TNFAIP3 - + +
70 TNFSF11 - - +
71 TRAF1 - - +
72 TYK2 + - -
64
73 VEGFA + + -
74 VSTM1 - - -
75 ZAP70 - - -
Appendix 3. List of the most effective target gene-miRNA interactions calculated

by MirTarget,, miRWalk and miRDB with their selection criteria
MirTarget miRWalk miRDB
Interaction Energy Score Interactions Score Interactions Target

s (kJ/m) score
IRAK1 -119 98 BCL2L12 IRAK1 100
miR-619- hsa-miR-24-3p 1.00 hsa-miR-146a-

5p 5p
PTPN2 -121 100 CD28 ADAMTS9 99
miR-619- hsa-miR-24-3p 1.00 hsa-miR-29c-

5p 3p
AKT2 -121 100 CDK6 CDK6 99
miR-619- hsa-miR-497-5p 1.00 hsa-miR-33b-

5p 5p
hsa-miR-20b-5p 1.00
hsa-miR-34a-5p 1.00
hsa-miR-449a 1.00
Il10 -119 98 NLRC5 FASLG 99
miR-619- hsa-miR-149-5p 1.00 hsa-miR-21-5p

5p
ADAMTS -110 98 KIF5A PRDM1 99

9
hsa-miR-103a- 1.00 hsa-miR-30a-
miR-1976 3p 5p
65
STAT3 -119 98 IL6R ADAMTS9 98
miR-619-
5p hsa-let-7e-5p 1.00 hsa-miR-30a-
5p
hsa-let-7i-5p 1.00
hsa-let-7b-5p 1.00
hsa-let-7c-5p 1.00
REL -110 98 IRAK1 PIK3CA 98
miR-5096 hsa-miR-146b- 1.00 hsa-miR-186-

5p 5p
hsa-miR-19a-
3p
CD28 -117 96 PRDM1 AFF3 98
miR-619- hsa-let-7a-5p 1.00 hsa-miR-493-

5p 5p
hsa-miR-125a- 1.00
5p
1.00
hsa-miR-125b-
5p
AFF3 -113 96 IL6ST CDK6 98
miR- hsa-miR-520f- 1.00 hsa-miR-548j-

1273g-3p 3p 5p
DNM1L -117 96 REL PRDM1 98
miR-619- hsa-miR-29b-3p 1.00 hsa-miR-9-5p

5p
hsa-miR-300 0.99
IL6R -136 91 VEGFA
miR-6089 hsa-miR-195-5p 1.00
hsa-miR-16-5p 1.00
hsa-miR-20a-5p 1.00
66
hsa-miR-6838- 1.00
5p
STAT3
hsa-let-7c-5p 1.00
SIRT1
hsa-miR-155-5p 1.00
hsa-miR-138-5p 1.00
hsa-miR-138-5p 1.00
hsa-miR-22-3p 1.00
TNFAIP3
hsa-miR-23b-3p 1.00
67

Diploma Final

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Diploma Final

Uploaded by

Copyright:

Available Formats

Ministry of Education and Science of the Republic of Kazakhstan

Al-Farabi Kazakh National University

Specialization 5B070100 - “Biotechnology”

Performers: _____________________________________Abdirassilova Z.N.

Protocol № _________ of "___" __________20___ y

Head of the Biology

Diploma project consists of 60 pages, 21 figures, 6 tables, 49 references, 3

Объем дипломной работы состоит из 60 страниц, 21 рисунков, 6 таблиц, 49

Дипломдық жұмыстың көлемі 60 бет, 21 сурет, 6 кесте, 49 дереккөз, 3

Relevance. Rheumatoid arthritis continues to be one of the most relevant

1.2 Biogenesis and regulatory functions of miRNA

Table 1- miRNA biosynthesis in two ways

1.3 The application of miRNAs in the diagnosis and therapy of diseases

1.4 General characteristics of rheumatoid arthritis

1.4.1 Etiology and pathogenesis

1.4.2 Prevalence of the disease in the world

Fig. 3- Prevalence and incidence of RA in the RK in 2017-2019 [43]

№ Gene Full name of gene PMID

1 ABHD6 Abhydrolase domain containing 6 28134081

2 ADAM metallopeptidase with 28850027

3 AFF3 AF4/FMR2 family member 3 19359276

4 AGXT2 Alanine--glyoxylate aminotransferase 2 31062169

5 AKT2 AKT serine/threonine kinase 2 30541951

6 BCL2L12 BCL2 like 12 31217874

7 BLK proto-oncogene, Src family tyrosine 21068098

8 BRD1 Bromodomain containing 1 30042400

9 BTK Bruton tyrosine kinase 31495833

12 CD28 CD28 molecule 27092776

13 CD38 CD38 molecule 24397353

14 CD47 CD47 molecule 28316886

16 CLEC12A C-type lectin domain family 12 member A 22341585

17 DNM1L Dynamin 1 like 31755231

18 EFNB1 Ephrin B1 17942634

19 EMCN Endomucin 21159824

20 ENO1 Enolase 1 29997113

21 FASLG Fas ligand 25645050

22 FCGR3A Fc fragment of IgG receptor IIIa 18843786

25 FPGS Folylpolyglutamate synthase 26652611

26 HLA-C major histocompatibility complex, class I, C 24566686

27 major histocompatibility complex, class II, 15547082

28 major histocompatibility complex, class II, 28455285

29 IFNGR1 Interferon Gamma Receptor 2 25708927

30 Il10 Interleukin-10 30328021

31 Il17 Interleukin-17 31454755

32 Il21 Interleukin-21 31366568

33 Il23R Interleukin 23 Receptor 30924147

35 IL2RB Interleukin 2 Receptor Subunit Beta 31134763

36 IL6R interleukin-6 receptor gene 23143596

37 Interleukin 6 Cytokine Family Signal 22870451

38 IRAK1 interleukin-1 receptor-associated kinase 1 23143596

39 IRF5 Interferon Regulatory Factor 5 20453842

40 IRF8 Interferon Regulatory Factor 8 23143596

41 KDR Kinase insert domain-containing receptor 31405022

42 KIF5A Kinesin family member 5A 18794853

43 MMEL1 Membrane Metalloendopeptidase Like 1 18794853

44 MTHFR Methylenetetrahydrofolate Reductase 28175955

45 NFKBIE NFKB inhibitor epsilon 22446963

46 NKBIL1 NFKB Inhibitor Like 1 17855452

47 NLRC5 NLR family CARD domain containing 5 31694750

48 OLIG3 Oligodendrocyte transcription factor 3 20353580

49 PADI4 Peptidyl Arginine Deiminase 4 22552437

51 PLD4 Phospholipase D Family Member 4 22446963

52 POUR3F1 POU class 3 homeobox 1 23143596

Protocol № _______ of "_" ________20_ y