Applied Microbiology and Biotechnology (2021) 105:1837–1859

https://doi.org/10.1007/s00253-021-11170-9

MINI-REVIEW

Diagnosis of histoplasmosis: current status and perspectives

María Agustina Toscanini 1 & Alejandro David Nusblat 1 & María Luján Cuestas 2

Received: 2 December 2020 / Revised: 29 January 2021 / Accepted: 3 February 2021 / Published online: 15 February 2021
# The Author(s), under exclusive licence to Springer-Verlag GmbH, DE part of Springer Nature 2021

Abstract
Histoplasmosis is a worldwide-distributed systemic mycosis caused by the dimorphic fungus Histoplasma capsulatum. Its
clinical manifestations range from subclinical or mild respiratory illness to progressive disseminated histoplasmosis (PDH), a
life-threatening disease, whose accurate diagnosis is still challenging and limited in many countries, where this disease is highly
endemic. In this regard, Histoplasma antigen testing is now included in the WHO Essential Diagnostics List. The final diagnosis
of histoplasmosis is established by culture and/or visualization of the yeast cells by cytology or histopathology using specific
stains. However, both procedures have limited sensitivity to detect the disease and cultures are time-consuming. Antibody
detection assays are effective for the subacute and chronic clinical forms of histoplasmosis. However, their sensitivity is low
in the immunocompromised host. Several molecular “in-house” tests were also developed and showed promising results, but
none of these tests are commercially available and their standardization and validation are still pending. Antigen detection assays
have high sensitivity in PDH cases and are of great value for the follow-up of patients with histoplasmosis; however, cross-
reactivity with other related fungi are common. In addition, this assay is expensive and only performed in few laboratories. Novel
protein antigen candidates have been recently identified and produced by DNA-recombinant techniques in order to obtain
standardized and specific reagents for the diagnosis of histoplasmosis, as opposed to the unspecific antigens or crude extracts
currently used. This review describes the currently available assays, highlighting their strengths and limitations and reports the
latest approaches to achieve reliable and rapid diagnostic tests for histoplasmosis.

Key points
• PDH causes thousands of deaths per year globally.
• Rapid accurate diagnosis of PDH is unfeasible in many regions.
• Fast, accurate, and low-cost diagnostic alternatives are currently under development.

Keywords Histoplasmosis . Histoplasma capsulatum . Diagnosis . Antigen assays . Antibody assays . Molecular assays

Introduction Billings 1971), but is also distributed in Africa (Klugman

Histoplasmosis is a systemic mycosis caused by the dimorphic
fungus Histoplasma capsulatum. This disease is highly en-
demic in the Americas (Bahr et al. 2015; Edwards and
* María Luján Cuestas
marilucuestas@gmail.com
1 Netherlands, and Africa clades (Kasuga et al. 2003).
Facultad de Farmacia y Bioquímica, CONICET, Instituto de
Nanobiotecnología (NANOBIOTEC), Universidad de Buenos Aires,
Buenos Aires, Argentina
2
CONICET, Instituto de Investigaciones en Microbiología y
Parasitología Médica (IMPaM), Universidad de Buenos Aires,
Buenos Aires, Argentina
and Lurie 1963; Oladele et al. 2018), India (Randhawa and
Gugnani 2018), Australia (McLeod et al. 2011), China (Pan
et al. 2013), Southeastern Asia (Baker et al. 2019), and some
regions of Europe (Confalonieri et al. 1994; Sotgiu et al.
1970). At least seven phylogenetic species within
H. capsulatum have been proposed, with distinct geographical
distribution: North America clade 1, North America clade 2,
Latin America clade A, Latin America clade B, Australia,
Infection with H. capsulatum occurs by inhaling aerosol-
ized microconidia found in nitrogen/phosphate-enriched soils.
Clinical manifestations of the disease depend on the size of
inoculum, age, and immune status of the host and the presence
of underlying lung disease (Wheat et al. 1982a, 2016).
1838
Immunocompetent hosts mostly suffer subclinical or mild re-
spiratory illness although acute pulmonary disease may occur
in high-inoculum infections. Patients with underlying lung
conditions, such as chronic obstructive pulmonary disease,
may contract chronic pulmonary histoplasmosis, and patients
with a compromised immune system may suffer progressive
life-threatening disseminated histoplasmosis, which requires
prompt diagnosis and treatment (Wheat et al. 1982a). The
most common population at risk of progressive disseminated
histoplasmosis includes those individuals with cellular immu-
nity deficiencies, such as patients with HIV/AIDS infection,
although patients receiving immunosuppressive therapies, in-
cluding solid-organ and bone marrow transplantation and
tumor-necrosis-factor inhibitors, are also at risk (Homei and
Worboys 2013). In fact, extrapulmonary or disseminated his-
toplasmosis became an AIDS-defining infection in 1987
(Centers for Disease Control 1987).
The real global burden of histoplasmosis remains un-
known; not only because its notification is not mandatory
(Nacher et al. 2018), but also because it presents nonspecific
clinical symptoms and radiological findings that may be con-
fused with tuberculosis (Adenis et al. 2014; Nacher et al.
2013; Wheat 1995). This misdiagnosis may lead to a delayed
diagnosis, lack of adequate treatment, and subsequent patient
death. An annual incidence of over 100,000 cases of PDH in
AIDS patients was estimated worldwide, approximately 80%
of whom had died from it (Denning 2016). One of the major
causes of this high mortality rate is the lack of an early and
accurate diagnosis and treatment.
The definitive diagnosis of histoplasmosis is performed by the
isolation of H. capsulatum on specific media or by visualization
of the yeast cells in direct examination or histopathological sam-
ples using specific stains (Donnelly et al. 2020). However, these
procedures have several drawbacks: both have limited sensitivi-
ty, cultures are time-consuming, and microscopy identification is
sometimes difficult (Falci et al. 2017; de Freitas et al. 2018).
Antibody detection assays have played an important role in the
diagnosis of histoplasmosis; however, their sensitivity mainly
depends on the patient’s immune status and the stage and type
of the disease (Kauffman 2008). Antigen detection assays have
high sensitivity in PDH cases and great value for patient follow-
up, but it is only performed in few laboratories (Hage et al.
2011a, b). Although the molecular methods for the identification
of fungi play a significant and growing role in clinical mycology
due to their high sensitivity and specificity and rapid turnaround
time, these methods still lack standardization and a more exten-
sive validation.
There is high variability in the performance and clinical
utility of the laboratory tests available for the diagnosis of
histoplasmosis. The aim of this article is to review the current-
ly available assays, highlighting their strengths and limita-
tions, as well as to address the latest approaches to achieve
reliable and rapid diagnostic tests.
Appl Microbiol Biotechnol (2021) 105:1837–1859
Culture and microscopy
Histopathologic or direct microscopic identification of
H. capsulatum or its recovery in culture from clinical speci-
mens are considered a definitive diagnosis of histoplasmosis
(Donnelly et al. 2020). Special stains, such as Wright, periodic
acid–Schiff, or Grocott-Gomori’s methenamine silver, are
used to identify the microscopic features of H. capsulatum
in respiratory samples, tissue biopsies, skin scrapes, and bone
marrow smears. In clinical samples, the fungus is found as
yeast-like cells within macrophages or histiocytes, often in
clusters of numerous cells, and, occasionally, in the extracel-
lular compartment.
The sensitivity and specificity of the microscopic examina-
tion are limited and depend on the operator’s expertise
(Cáceres et al. 2015) as well as on the clinical form of the
disease (Table 1). Patients with chronic pulmonary or dissem-
inated histoplasmosis have a higher rate of positive results (<
75%) than patients with acute or subacute pulmonary disease
(< 47%). In addition, false positive results may occur due to
the similar structure of the yeast form of H. capsulatum and
other fungi such as Candida spp., Cryptococcus spp.,
Talaromyces marneffei, Pneumocystis jirovecii, and
Blastomyces dermatitidis, and the protozoa Leishmania spp.
and Toxoplasma gondii (Guimarães et al. 2006; Wheat 2006).
H. capsulatum isolation from clinical specimens is often
performed on a nutrient-poor medium such as Sabouraud agar
at 28 °C or on a nutrient-rich medium such as brain-heart infu-
sion agar supplemented with blood at 37 °C in order to obtain
the mold and yeast phase of this dimorphic fungus, respective-
ly. Once the fungus has grown, identification is based on the
macroscopic and microscopic characteristics of the colonies.
Fungal cultures are time-consuming; H. capsulatum commonly
grows within 2 to 3 weeks, but it may take up to 8 weeks. This
represents a major drawback since most disseminated histo-
plasmosis patients usually die after 10–14 days from the onset
of the disease if not treated (Denning 2016). Another limitation
of this technique is that clinical laboratories must have trained
physicians and biosafety level 3 equipment and facilities due to
the infectious risk of H. capsulatum.
The sensitivity of a culture-based diagnosis mainly depends
on the clinical form of the disease and the specimen tested
(Table 1). The lowest sensitivity values are observed in the acute
and subacute forms of pulmonary histoplasmosis, whereas
higher values can be found in chronic pulmonary and dissemi-
nated histoplasmosis due to the patients’ higher fungal burden
(Wheat and Kauffman 2003). In a recent meta-analysis study,
the overall sensitivity of a culture-based diagnosis of dissemi-
nated histoplasmosis in patients with HIV/AIDS was calculated
in 77% (Cáceres et al. 2019b). This study also reported that
cultures from respiratory samples have poor sensitivity (0–
60%); however, greater values can be obtained from bone mar-
row or blood cultures using the lysis centrifugation method (60–
Appl Microbiol Biotechnol (2021) 105:1837–1859 1839

Table 1 Sensitivity of diagnostic

tests for the different forms of Assay Acute Subacute Chronic Meningeal Disseminated Reference
histoplasmosis pulmonary pulmonary pulmonary

Microscopy 0–47% 9–67% 10–75% - 12–85% (Hage et al. 2011a;

Wheat 2006)
Culture 0–34% 9–82% 65–85% 19–33% 75–92% (Bloch et al. 2018;
Hage et al.
2011a; Wheat
et al. 1989b,
2006)
Antibody 40–80% 78–92% 65–100% 59–89% 58–73% (Cáceres et al.
detection (in 2019b; Hage
CSF) et al. 2011a;
Schestatsky
et al. 2006;
Wheat 2006,
Wheat et al.
2018),
Antigen 43–65% 39% 25–80% 42–78% 90–98% (Bloch et al. 2018;
detection (in Cáceres et al.
CSF) 2018; Hage et al.
2010, 2011a;
Richer et al.
2016;
Swartzentruber
et al. 2009a;
Wheat 2006)
Nucleotide 50% (3/6) - - 33% (1/3) 95% (Cáceres et al.
amplifica- 2019b; Maubon
tion et al. 2007;
Muñoz et al.
2010; Muraosa
et al. 2016;
Ohno et al.
2013)

90%). Although the latter has shown to have an improved ana-
lytical performance than conventional blood cultures, few labo-
ratories performed the lysis centrifugation method because it is
laborious and difficult to standardize (Murray 1991; Santiago
et al. 2004).
Some molecular assays have been developed to identify
H. capsulatum from culture. The commercially available
AccuProbe test (Gen-Probe Inc, CA, USA) uses a single-
stranded DNA probe with a chemiluminescent label targeting
the H. capsulatum rRNA (Gen-Probe Incorporated 2011).
Although this test identifies H. capsulatum, it requires a
sonicator and a luminometer and is not commercially avail-
able in developing countries. A fluorescently labeled probe
complementary to the rRNA was also developed to detect
H. capsulatum in blood cultures (Moreira da Silva et al.
2015). The assay showed good performance in the 33 samples
tested but further evaluation is still pending. Recently, protein
profile databases were constructed for the identification of
H. capsulatum and other clinically relevant molds by matrix-
assisted laser desorption ionization–time of light mass spec-
trometry (MALDI-TOF MS) (Lau et al. 2013; Valero et al.
2018). MALDI-TOF MS is a rapid and powerful proteome-
based technique for the highly accurate identification of many
clinical pathogens; however, as well as the hybridization test,
requires a fungal isolate and thus the turnaround time is high.
Antibody detection assays
Detection of specific antibodies to H. capsulatum has played an
important role in the diagnosis of subacute and chronic pulmo-
nary histoplasmosis, offering a sensitive and rapid diagnosis.
Serological tests can also be helpful in Histoplasma meningitis,
where detection of antibodies in cerebrospinal fluid (CSF) may
be the only positive indicator of the diagnosis. However, their
utility may be undermined since anti-Histoplasma antibodies
emerge 4 to 8 weeks after exposure and may persist for years
after infection (Wheat 1992). Additionally, their sensitivity is
limited in immunocompromised patients whose ability to pro-
duce antibodies is reduced (Hage et al. 2011a) (Table 1).
The two most extensively used antibody detection methods
are complement fixation (CF) and double immunodiffusion
1840
(ID); however, enzyme-linked immunosorbent assays
(ELISA) and immunoblotting may also be used (Almeida
et al. 2019; Guimarães et al. 2004; Richer et al. 2016). The
antigen commonly used in these assays is histoplasmin, a
soluble filtrate of mycelial-phase broth cultures of
H. capsulatum. The primary immunoreactive constituents of
histoplasmin are the H (~ 120 kDa), M (~ 90 kDa), and C
(~ 60 kDa) antigens. The H and M antigens are cell wall
glycoprotein homologues to a β-glucosidase and a catalase,
respectively (Deepe and Durose 1995; Zancopé-Oliveira et al.
1999) whereas the C antigen is a galactomannan (GM) carbo-
hydrate found in the major genera of systemic dimorphic fungi
(Wheat et al. 1997).
The ID test is inexpensive and simple to perform and de-
tects precipitating antibodies to M and H antigens. Antibodies
directed to the M antigen are the first to arise (Kaufman et al.
1997) and may persist for several years after disease resolution
(Kauffman 2008), whereas antibodies to the H antigen emerge
later and less frequently (< 25%) and usually clear within the
first 6 months after the infection (Wheat 1992; Wheat et al.
1982b). Although the presence of both M and H bands is
highly suggestive of active Histoplasma infection, the pres-
ence of solely the M band may represent previous exposure to
H. capsulatum (Kauffman 2008).
The CF assay detects and titers specific antibodies against
two antigens: histoplasmin and a yeast antigen, which is a
suspension of merthiolate-killed whole H. capsulatum yeast
cells. Titers of 1:32 or above with either antigen are suggestive
of active histoplasmosis while titers of 1:8 and 1:16 are gen-
erally considered presumptive evidence of histoplasmosis and
require further testing (Lindsley 2013). Titering can be useful
in patient follow-up since a fourfold increase in CF antibodies
titers suggests progression of the disease (Kaufman 1971).
The CF assay is more sensitive but less specific than the ID
assay (Wheat et al. 1982b); false-positive results may occur in
patients with coccidioidomycosis, paracoccidioidomycosis,
aspergillosis, blastomycosis, cryptococcosis, and tuberculosis
as well as in healthy subjects from endemic areas (George and
Lambert 1984; Picardi et al. 1976; Raman et al. 1990).
Another drawback is that the CF test has a tedious procedure
and requires a complex standardization, being unsuitable for
low-volume laboratories. In addition, commercial kits are un-
available for either the ID or the CF test, although individual
reagents can be purchased from diagnostic companies.
Histoplasmin has also been used as antigen in several
ELISA tests (Alvarado et al. 2020; Brock et al. 1984;
Guimarães et al. 2004; Raman et al. 1990; Sharma et al.
1982; Torres et al. 1993; Zimmerman et al. 1990) and
Western blotting protocols (Almeida et al. 2016, 2019;
Pizzini et al. 1999). Since it was observed that native
histoplasmin limited the sensitivity and specificity of the as-
says due to the presence of cross-reactive carbohydrate com-
ponents, it was treated with different protocols before being
Appl Microbiol Biotechnol (2021) 105:1837–1859
used as a reagent. One approach included the chromatography
purification of histoplasmin, which removed the GM present
in the C antigen. Additionally, purified histoplasmin was
chemically (with NaOI4) or enzymatically (e.g., with N-
glycosidase F or endo-β-N-acetylglucosaminidase H) degly-
cosylated in order to remove the carbohydrate moieties of the
H and M glycoproteins (Almeida et al. 2019; Alvarado et al.
2020; Guimarães et al. 2004, 2010). These treatments in-
creased assay sensitivity by exposing the epitopes in the H
and M antigens that were hidden by the carbohydrate chains
as well as decreased the cross-reactivity produced by the GM
and the glycosylation of the H and M proteins. However, false
positives still occurred in patients with coccidioidomycosis,
paracoccidioidomycosis, blastomycosis, aspergillosis, and tu-
berculosis (Alvarado et al. 2020; Guimarães et al. 2010;
Zancopé-Oliveira et al. 1994).
Most of the ELISA and Western Blot tests were developed
in-house and, although histoplasmin is commercially available,
it was produced, purified and deglycosylated following differ-
ent protocols. These variabilities make standardization difficult
since histoplasmin can differ greatly in its quality and relative
content of H, M, or C antigens depending on the protocol of
antigenic preparation and the strain of H. capsulatum used (de
Freitas et al. 2018). In fact, it was suggested that the choice of
the fungal strain is the most critical step (Pine et al. 1966),
which is perhaps of some significance, given that various phy-
logenetic species of H. capsulatum circulate in different
regions.
The only currently available ELISA assay cleared by the
Clinical Laboratory Improvement Amendments is the fee-for-
service test offered by MiraVista Diagnostics, which is a semi-
quantitative ELISA for IgM and IgG antibodies to Histoplasma
antigen in serum and CSF that reported 88.8% sensitivity in
serum samples from patients with acute pulmonary histoplas-
mosis and 91.0% specificity, with false positive results in pa-
tients with blastomycosis, coccidioidomycosis and cryptococ-
cosis (Richer et al. 2016).
Antigen detection assays
MiraVista antigen detection assays
An enzyme immunoassay (EIA) for the detection of
Histoplasma polysaccharide antigen (HPA) in urine, serum,
bronchoalveolar lavage (BAL), and CSF samples is offered
as a service test in a single central laboratory in the USA
(MiraVista Diagnostics, USA). The assay was first described
in 1986 as a solid-phase radioimmunoassay (RIA) and since
then, has undergone various modifications (Table 2) (Wheat
et al. 1986). The HPA is a poorly characterized GM polysac-
charide of the fungal cell wall with a molecular weight of less
than 10 kDa in urine and a higher molecular weight in serum.
Table 2 Summary of antigen detection assays for the diagnosis of histoplasmosis

Assay Specimen Patients with Control patients (n) Sensitivity Specificity Cross-reactions Commercially References
histoplasmosis (n) available

MiraVista Urine, PDH (22), Other fungal infections (30 u), pulmonary infections U: 90.9% (PDH), U: 100% NR No Wheat et al.
RIA serum self-limited (65 u), urinary tract infections (100 u); bacteremia 18.8% S: 100% 1986
(32), cavitary (30 u); other patients (70 u); healthy donors (50 s) (self-limited),
(32), 6.3% (cavitary)
sarcoid-like (8) Serum: 50%
(PDH), 0%
(self-limited,
cavitary)
Urine PDH (19), Cryptococcosis (4), candidiasis (12), aspergillosis 94.7% (PDH), 97.5% B. dermatitidis Zimmerman et
self-limited (3), blastomycosis (3), Scopulariopsis brevicaulis 63.3% al. 1989
Appl Microbiol Biotechnol (2021) 105:1837–1859

(11), cavitary infection (1), coccidioidomycosis (1), healthy (self-limited),

(9) donors (17) 33,3%
(cavitary)
Urine, PDH + AIDS (35 AIDS patients with pneumocystis pneumonia (19), U: 97.1% 100% - Wheat et al.
serum u, 21 serum) tuberculosis (4), cryptococcosis (3), S: 90.5% 1989a
toxoplasmosis (1)
Urine, Meningitis (12) Cryptoccocal (17) and coccidioidal (11) meningitis U: 58.3% 96.4% C. immitis Wheat et al.
serum, S: 33.3% 1989a
CSF CSF: 35.7%
BAL PDH + AIDS (25), Cryptococcosis (5), aspergillosis (1), candidiasis (1) 70.3% 100% - Wheat et al.
pulmonary (2) and other conditions (115) 1992
MiraVista Urine PDH (50), Cryptococcosis (3), candidiasis (12), aspergillosis 89.3% (PDH) 99.0% P. brasiliensis (1/1) No Durkin et al.
1st Non-dissemina- (3), blastomycosis (2), paracoccidioidomycosis 1997
genera- ted (30) (1), coccidioidomycosis(1), Pneumocystis
tion EIA pneumonia (1), other fungal infections (4),
non-fungal pulmonary infections (24), urinary
tract infections (24), healthy donors (20)
Urine - Blastomycosis (19), paracoccidiodomycosis (9), - - B. dermatitidis (12/19), Wheat et al.
penicilliosis (18), coccidiodomycosis (6) P. brasiliensis (8/9) 1997
and T. marneffei
(17/18)
MiraVista Urine, PDH + AIDS (56 Allograft recipients treated with rATG (21 s) U: 83.9% S: 95.2% Human anti-rabbit No Wheat et al.
2st serum us) antibodies (1/21) 2006
genera- Urine, PDH + AIDS (48 Healthy donors (50 u, 50 s), patients without U: 97.9% U: 100% NR Wheat et al.
tion EIA serum u, 39 s) evidence of histoplasmosis (12 s) S: 79.5% S: 99.1% 2007b
BAL Histoplasmosis Blastomycosis (6), other fungal infections (16), 84.2% 98.2% B. dermatitidis (5/6) Hage et al. 2007
(19) non-fungal infections (38)
MiraVista Urine, PDH + AIDS (65 Blastomycosis (10 u), paracoccidioidomycosis (5 u), U: 100% U: 99.0% (in B. dermatitidis (7/10), C. No Connolly et al.
3st serum s, u) penicillosis (5 u), coccidioidomycosis (10 u), S: 92.3% non-fungal immitis (6/10), P. 2007
genera- aspergillosis (9 s), mycoplasma pneumonia (25 u), controls) brasiliensis (4/5) and
tion EIA other diseases (25 u), healthy donors (25 u, s) S: 100% T. marneffei (4/5)
Urine, PDH + AIDS (21) - U: 95.2% - - Gutierrez et al.
serum S: 94.7% 2008
1841
Table 2 (continued)
1842

Assay Specimen Patients with Control patients (n) Sensitivity Specificity Cross-reactions Commercially References
histoplasmosis (n) available

MiraVista Urine, APH (130) - U: 64.6% (130)S: - - No, Swartzentruber

4th se- 68.6% (35)U+ fee-for-- et al. 2009a
genera- rum* S: 82.8% service
tion EIA Serum* PDH + AIDS (37) Blastomycosis (9), clinical controls (48), healthy 94.6% 99.0% B. dermatitidis (8/9) Swartzentruber
donors (55) (excluding et al. 2009b
blastomyco-
sis)
Urine, PDH (21), cavitary - U: 95.0% (PDH), - B. dermatitidis (8/10), Hage et al. 2010
seru- (5), APH (4), 25.0% patients with positive
m*, mediastinal (1) (cavitary), Aspergillus GM (6/60)
BAL* 75.0% (APH),
0% mediastinal
S: 85.7% (PDH),
25.0%
(cavitary), 0%
(APH,
mediastinal)
BAL: 95.2%
(PDH), 100%
(cavitary),
75.0% (APH),
100%
mediastinal
Urine, PDH (111 us, 31 blastomycosis (30), non-fungal infections (130) and U: 90.1 (PDH), 99.0% B. dermatitidis (27/30) Hage et al. 2011a
se- s), SAP (17 u), healthy donors (69) 38.9% (SAP), (excluding
rum* CP (5 u) 80.0% (CP) blastomyco-
S: 100% (PDH) sis)
Urine, APH (80) Blastomycosis (25), coccidioidomycosis (25), U: 42.7% NR NR Richer et al. 2016
se- healthy donors (98) S: 63.3% U+S:
rum* 67.5%
MiraVista Serum* PDH + AIDS (24) Mycobacterium disease (24), cryptococcosis (10), Manual reading: Manual reading: P. brasiliensis (2/2), Yes; CE Cáceres et al.
LFA pneumocystis pneumonia (3), 96%Automated 90%Automa- Salmonella infection certified 2020 -
paracoccidioidomycosis (2), aspergillosis (1), reader: 92% ted reader: (2/2) and in a patient evaluation of
candidiasis (1), salmonella disease (2), 94% with toxoplasmosis
toxoplasmosis (2), non-HIV individuals (6) and tuberculosis
CDC EIA Urine Histoplasmosis - 100% - - No Lindsley et al.
(12) 2007
Urine HD + AIDS (48) HIV patients with other fungal infections: 81% 95% P. brasiliensis (7/25) Scheel et al. 2009
Cryptococcosis (7), coccidioidomycosis (3),
aspergillosis (20), candidiasis (12),
paracoccidioidomycosis (25), other molds (4);
bacterial infections (34); parasitic infections (9);
healthy donors (83)
Appl Microbiol Biotechnol (2021) 105:1837–1859
Table 2 (continued)

Assay Specimen Patients with Control patients (n) Sensitivity Specificity Cross-reactions Commercially References
histoplasmosis (n) available

Urine PDH + AIDS (28) cryptococcosis (15), coccidioidomycosis (3), 86% 94% P. brasiliensis (8/32) Cáceres et al.
aspergillosis (22), candidiasis (13), 2014
paracoccidioidomycosis (32), Pneumocystis
pneumonia (3), sporotrichosis (1), other infections
(41), healthy donors (44)
PDH + HIV (8) HIV patients without histoplasmosis (70) 100% 91.4% NR Hoffmann et al.
2017
IMMY Urine Patients with Patients with negative UAg by MiraVsta 2nd gen EIA 92% positive 98% negative B. dermatitidis, C. No longer Cloud et al. 2007
ALPHA positive (38) (50), culture filtrate antigens of B. dermatiditis, C. agreement agreement immitis, P. brasiliensis available;
EIA UAg by immitis and P. brasiliensis FDA
Appl Microbiol Biotechnol (2021) 105:1837–1859

MiraVista 2nd approved;

gen EIA CE certified
Patients with Patients without histoplasmosis (25), healthy donors 44-52% positive 56-84% NR LeMonte et al.
positive UAg (25) agreement negative 2007
by MVista 2° agreement
gen EIA (50)
PDH (10), Patients without histoplasmosis (57), healthy donors 61.9% 79.3% B. dermatitidis Zhang et al. 2013
pulmonary (4) (70)
PDH (38), Patients without fungal infection (50) 26.3% (PDH), 84% (excluding NR Zhang et al.
pulmonary (12) 8.3% fungal 2015
(pulmonary) controls)
PDH + HIV (8) HIV patients without histoplasmosis (70) 100% 92.9% NR Hoffmann et al.
2017
PDH + HIV (85) HIV patients without histoplasmosis (203) 67.1% 97.5% C. neoformans (1), Torres-Gonzalez
tuberculosis (2) et al. 2018
IMMY GM Urine Patients with Patients with negative UAg by MiraVista 2nd gen 64.5% positive 99.8% negative NR Yes; FDA Theel et al. 2013
ASR positive UAg EIA (941) agreement agreement approved;
by MiraVista CE certified
2nd gen EIA
(62)
PDH (10), Patients without histoplasmosis (57), healthy donors 90.5% 96.3% B. dermatitidis Zhang et al. 2013
pulmonary (4) (70)
Patients with Patients with negative UAg by MiraVista 2nd gen 82.3% positive 100% negative B. dermatitidis Theel et al. 2015
positive UAg EIA (121) agreement agreement
by MiraVista
2nd gen EIA
(17)
PDH (38), non-fungal infections (50), aspergillosis (13), 76.3% (PDH), 98% (excluding B. dermatitidis (6/10) Zhang et al. 2015
pulmonary (12) blastomycosis (10) 58.3% fungal
(pulmonary) controls)
IMMY GM Histoplasmosis + Mycobacterium disease (87), cryptococcosis (12), 95-98% 97-98% P. brasiliensis (3/3) Cáceres et al.
EIA HIV (63) pneumocystis pneumonia (3), 2018
paracoccidiodomicosis (3), aspergillosis (2),
1843
 1844 Appl Microbiol Biotechnol (2021) 105:1837–1859

APH Acute pulmonary histoplasmosis; BAL Bronchoalveolar lavage; CP Cavitary pulmonary; CSF Cerebrospinal fluid; EIA Enzyme immunoassay; NR Not reported; PDH Progressive disseminated
Falci et al. 2019
Specific antibodies to HPA were obtained by immunizing rab-

Persaud et al.
Commercially References bits with whole formalin-killed yeast cells of H. capsulatum
followed by boosters with live yeast cells. Then, the IgG frac-

2019
tion from anti-serum positive for both H and M precipitins was
purified by ion-exchange chromatography and used as a cap-
ture antibody and as a 125I labelled detection antibody.
In order to avoid the inherent safety problems of radiolabeled
available

reagents, the Histoplasma antigen RIA was adapted to an

No ELISA. After an unsatisfactory attempt using a detection anti-
body conjugated to alkaline phosphatase or horseradish peroxi-

histoplasmosis; rATG Rabbit anti-thymocyte globulin; RIA Radioimmunoassay; S serum; SAP Subacute pulmonary; U Urine; UAg Urinary H. capsulatum antigen
dase (Zimmerman et al. 1989), the MiraVista 1st-generation
B. dermatitidis (3/3)

EIA was developed using a biotin-conjugated detection anti-

Cross-reactions

body recognized by a horseradish peroxidase probe (Durkin

et al. 1997). A 2nd-generation EIA was developed in order to
reduce the false antigenemia caused by human anti-rabbit anti-
NR

bodies observed in patients receiving rabbit anti-thymocyte

globulin to prevent allograft rejection (Wheat et al. 2004,
99.6% negative

2006). For this purpose, a biotinylated F(ab)’2 fragment of rabbit

agreement
Specificity

anti-H. capsulatum IgG diluted in normal rabbit serum was used

as the detection antibody. However, false positive results were
NR

still observed in urine and serum samples (Wheat et al. 2006;

Wheat et al. 2007b). A quantitative 3rd-generation EIA was
described (Connolly et al. 2007) using antigen calibrators made
Patients with negative UAg by MVista 4th gen EIA 90.5% positive
agreement

of a pool of patients’ urine samples with a known concentration

Sensitivity

of H. capsulatum yeast GM. Finally, a 4th-generation EIA was

71.5%

reported pretreating serum, BAL and CSF samples at 104°C in

the presence of EDTA to increase antigen detection sensitivity,
probably by the dissociation of antigen-antibody complexes and
toxoplasmosis (1), cytomegalovirus disease (1),

denaturation of the freed antibody (Bloch et al. 2018; Hage et al.

HIV patients without other infection (371),

2010; Swartzentruber et al. 2009b).

candidiasis (1), salmonella disease (2),

The detection of urinary antigen has been a sensitive and

convenient alternative since other methods such as culture, pa-
thology or nucleotide amplification techniques often require in-
vasive procedures to collect specimens (e.g., BAL or biopsy),
non-HIV patients (43)

which may be contraindicated for patients suffering from severe

disease. However, the detection of HPA in CSF (Wheat et al.
Control patients (n)

1989b) and BAL samples (Wheat et al. 1992) has been an aid for
Controls (447)

the diagnosis of Histoplasma meningitis and acute pulmonary

histoplasmosis, respectively. Most studies evaluated the effec-
(229)

tiveness of the MiraVista Histoplasma Antigen Quantitative

EIA in patients with AIDS and disseminated histoplasmosis
4th gen EIA (21)
histoplasmosis (n)

(Table 2) (Connolly et al. 2007; Gutierrez et al. 2008; Hage

positive UAg
by MiraVista
Histopasmosis

et al. 2011a; Swartzentruber et al. 2009b), in which sensitivity

Patients with
Specimen Patients with

was 94.6–100% in urine and 92.3–100% in serum with antigen

(123)

*pretreated with EDTA and heat

levels correlating with severity. Sensitivity was lower in patients

with disseminated histoplasmosis and no underlying immuno-
suppression (63.3%) (Hage et al. 2011a) and with chronic (25–
80%), subacute (38.9%), or acute (0–68.6%) pulmonary histo-
Table 2 (continued)

Urine

plasmosis (Hage et al. 2010, 2011a; Swartzentruber et al. 2009a).

In acute pulmonary histoplasmosis, higher sensitivity was
Diagnost-
ics EIA

achieved by testing both urinary and serum antigen (Richer

Assay

et al. 2016; Swartzentruber et al. 2009a) and by testing BAL

Niche

samples (Hage et al. 2010). However, quantification of antigen

Appl Microbiol Biotechnol (2021) 105:1837–1859
in BAL fluids is inaccurate due to the variations in the amount of
liquid used in the lavage process (Hage et al. 2010). Finally,
detection of HPA in CSF has been an aid for the diagnosis of
Histoplasma meningitis, a clinically relevant entity that requires
longer treatments and higher doses of antifungal drugs than
others clinical forms (Wheat et al. 2007a). In a recent retrospec-
tive multicenter study of Histoplasma meningitis cases occur-
ring, mostly between 1997 and 2010, HPA was detected in
CSF samples of 30/37 (81%) and 5/16 (31%) patients with and
without immunosuppression.
One limitation of HPA detection is its poor specificity in
patients with other fungal infections. The MiraVista
Histoplasma quantitative EIA exhibits 80% cross-reactivity
with Paracococcidioides brasiliensis and T. marneffei, 70%
with B. dermatitidis, and 60% with Coccidioides immitis
(Connolly et al. 2007). Less frequently, false-positive results
have also been reported in infections with other unrelated
fungi, such as in aspergillosis (Hage et al. 2010) and sporotri-
chosis (Assi et al. 2011). Nevertheless, the authors argued that
the assay is still highly valuable for the rapid diagnosis of the
most severe clinical forms of histoplasmosis since the antifun-
gal treatment for all the aforementioned mycoses is generally
similar (Wheat et al. 1997).
In addition, quantification of HPA levels in serum and/or
urine is useful for antifungal therapy monitoring and for re-
lapse detection (Wheat et al. 1991). Antigenemia provides a
more sensitive and early marker for therapy response than
antigenuria, since antigen clearance is more rapid in serum
than in urine after successful therapy (Hage et al. 2011b). It
was reported that HPA levels in urine may not decline signif-
icantly during the first 2 weeks of effective treatment in some
patients (Hage et al. 2011b), and may remain positive in low
levels even in asymptomatic patients with completed antifun-
gal treatment (Wheat et al. 2007a).
MiraVista Histoplasma Quantitative Antigen EIA has also
been used in veterinary medicine, especially in cats and dogs,
as a complementary tool for the diagnosis of histoplasmosis
(Cook et al. 2012; Cunningham et al. 2015; Fielder et al. 2019;
Hanzlicek et al. 2016; Rothenburg et al. 2019). Noteworthy, a
retrospective study in cats suggested that a compromised renal
function may lower urinary antigen levels (McGill et al.
2018).
In recent years, MiraVista developed the first point-of-care
test for the diagnosis of histoplasmosis (Histoplasma Urine
Antigen LFA, MiraVista Diagnostics, USA). The assay is an
immunochromatographic lateral flow assay (LFA) for the vi-
sual and rapid detection of Histoplasma GM antigen in urine.
Minimal laboratory equipment is needed and results can be
available in less than 1 h. Although the LFA kit package insert
indicated its use in urine, it has been evaluated in 24 serum
samples from Colombian patients with AIDS and disseminat-
ed histoplasmosis (Cáceres et al. 2020). High analytical per-
formance was observed either by the naked eye or with an
1845
automated reader; however, higher sensitivity values (96%
vs 92%) were achieved using the former. Cross-reactions were
observed among patients with paracoccidioidomycosis and
salmonellosis and in one patient with toxoplasmosis and tu-
berculosis. Further studies should be carried out to assess the
performance of this test in both urine and serum samples of a
larger population including patients with other clinical forms
of histoplasmosis and other fungal infections. The LFA kit
was CE-certified and became commercially available in some
regions in 2020 at a cost of US$10–17 per test. Hopefully, this
would constitute a step forward in the possibility of diagnosis
in other regions of the world where this mycosis is endemic.
CDC antigen detection assay
Although the MiraVista Histoplasma ELISA represents a
milestone in the development of a rapid diagnostic test of
histoplasmosis, this assay is expensive (US$80 per test) and
is an unviable option for laboratories outside the USA
(Couppié et al. 2006). Specimen transportation to the refer-
ence laboratory highly increased the cost of the assay as well
as the diagnostic turnaround time. However, since detection of
HPA in urine has proven to be useful as an aid to the diagnosis
of disseminated histoplasmosis in HIV/AIDS patients, several
attempts were made to develop alternative assays with differ-
ent degrees of success. In this regard, in 2007 the Centers for
Disease Control and Prevention (CDC) developed an in-house
H. capsulatum antigen-capture quantitative ELISA (Lindsley
et al. 2007). The capture and detection antibodies were pro-
duced by immunizing rabbits intravenously with whole, killed
H. capsulatum yeast cells. The concentration of relative
H. capsulatum antigen was quantified using a calibration
curve of a common cell wall antigen, the C antigen, which is
a heterogeneous polysaccharide purified by cation-exchange
chromatography from mycelial culture filtrates. The assay was
evaluated in urine samples from patients with HIV/AIDS and
disseminated histoplasmosis from Guatemala, Colombia and
Brazil (Cáceres et al. 2014; Hoffmann et al. 2017; Scheel et al.
2009). Although good sensitivity (81–100%) and specificity
(91.4–95%) values were reported, this assay is no longer
available and no further validation studies were carried out
(Table 2).
IMMY antigen detection assays
In 2006, a diagnostic kit for HPA detection in urine samples
was approved for clinical use by the Food and Drug
Administration (FDA), becoming commercially available a
year later (IMMY ALPHA Histoplasma Antigen EIA,
IMMY, USA). The assay was a “sandwich” ELISA that used
rabbit polyclonal IgG antibodies for both capture and detec-
tion (Cloud et al. 2007). Antibodies were developed in New
Zealand rabbits immunized with a mixture of three clinical
1846
isolates of H. capsulatum in the yeast form. Several laborato-
ries of different countries have evaluated the assay and report-
ed low performance, thus limiting its clinical utility in the
diagnosis of histoplasmosis (Table 2) (LeMonte et al. 2007;
Torres-González et al. 2018; Zhang et al. 2015; Zhang et al.
2013). Noteworthy, false-positive results were observed in
two patients with disseminated Cryptococcus neoformans in-
fection and in one patient with tuberculosis (Torres-González
et al. 2018).
In 2013, another ELISA for the detection of HPA in urine
samples became commercially available with FDA clearance
at a cost of approximately US$400 per kit (IMMY/Clarus
Histoplasma GM EIA, IMMY, USA). This ELISA kit, orig-
inally developed as an analyte-specific reagent, is a single-
monoclonal-antibody sandwich ELISA that detects
Histoplasma GM. Urine samples are run untreated and results
can be quantitative using a 7-point standard curve or semi-
quantitative using one calibrator, although with reduced sen-
sitivity (Cáceres et al. 2018).
Three studies (Theel et al. 2013, 2015; Zhang et al. 2013)
reported that despite the high overall agreement, the
Histoplasma GM EIA results showed low positive agreement
with those from the MiraVista assay, and no good correlation
of quantitative values. This variability could be due to the
different nature of the antibodies used for the detection of
Histoplasma GM in both assays. While the MiraVista test uses
a polyclonal antibody that probably detects various epitopes
of the GM antigen, the IMMY GM EIA uses a monoclonal
antibody, and thus a single epitope as target. Furthermore,
variable clinical performance was observed in studies with
clinically characterized patients from the USA, Guatemala
and Colombia. Sensitivity and specificity values ranged from
72 to 98% and from 75.3 to 98% respectively, with important
cross-reactions with B. dermatitidis and P. brasiliensis, and
lower cross-reactions with T. marneffei and Candida species
(Cáceres et al. 2018; Zhang et al. 2015; Zhang et al. 2013).
Differences in these values could be due to various reasons.
The study conducted by Zhang et al in 2013 reported high
sensitivity and specificity values but since a small population
was evaluated, its values are not reliable. The difference in
histoplasmosis and control cases may be the cause of the het-
erogeneous sensitivity and specificity observed between the
two other studies. While in one study (Zhang et al. 2015)
many patients with blastomycosis—known to cross-react with
H. capsulatum GM—were included, in the other study many
non-fungal controls were evaluated (Cáceres et al. 2014). The
different sensitivities observed between both assays may be
caused by variations in sample size and patient characteristics.
Despite the variances, the monoclonal-based assay im-
proved Histoplasma antigenuria detection sensitivity and
specificity, compared with the polyclonal IMMY ALPHA
EIA. The Histoplasma GM EIA assay can even be performed
in middle equipped laboratories in less than 3 h, significantly
Appl Microbiol Biotechnol (2021) 105:1837–1859
reducing the time for PDH diagnosis. However, results must
be thoroughly analyzed since a negative result does not rule
out histoplasmosis and false-positive results may occur in pa-
tients with other mycoses. Further studies are needed in order
to fully evaluate its clinical performance in other clinical sam-
ples (e.g., CSF, BAL and serum), in patients with other clin-
ical forms of histoplasmosis as well as in other non-HIV im-
munocompromised patients at risk for PDH. The applicability
of the Histoplasma GM EIA in the monitoring of antifungal
therapy deserves further investigation.
Other antigen detection assays
An inhibition ELISA has also been developed for the detection
of a 69–70 kDa cytoplasmatic H. capsulatum yeast antigen in
urine and serum using a species-specific murine monoclonal
antibody (Gomez et al. 1997). The test overall sensitivity was
moderate (71.4%) in serum and low in urine (44%) and exhib-
ited cross-reactions in patients with paracoccidioidomycosis,
aspergillosis, cryptococcosis, and tuberculosis. Another report
showed that monitoring antigenemia by this assay was useful
for the follow-up of non-AIDS patients during the treatment of
acute pulmonary and disseminated histoplasmosis (Gómez
et al. 1999). However, no further studies validating this assay
in a larger number of patients were published.
A recent study evaluated the performance of a monoclonal
antibody-based Histoplasma urine antigen ELISA manufactured
by Niche Diagnostics (Niche Diagnostics, LLC, Scarborough,
USA) in a collection of 250 specimens previously tested by the
MiraVista assay, 21 of which belonged to patients with histoplas-
mosis. The assay showed 90.5% positive agreement and 99.6%
negative agreement with the MiraVista assay. However further
evaluation is needed in order to fully established its clinical utility.
Potential novel antigens
The utilization of native antigens (e.g., histoplasmin or HPA)
in diagnostic tests may be problematic in terms of standardi-
zation, reproducibility, and specificity (de Freitas et al. 2018).
Much of the cross-reactivity observed among various fungal
species is due to nonprotein determinants such as carbohy-
drates. In this regard, recombinant proteins may improve the
performance of diagnostic tests by offering a defined antigen
that can be produced in large quantities with little variability in
quality. Hence, recombinant proteins could be used as re-
agents in serologic tests or as reagents for the production of
specific antibodies for the development of novel antigen de-
tection assays.
Histoplasmosis is an infectious disease that may produce
increased levels of protein in urine. Thus, the search and iden-
tification of Histoplasma-specific proteins in urine appears to
be an innovative strategy for the discovery of novel
Appl Microbiol Biotechnol (2021) 105:1837–1859
biomarkers for the diagnosis of histoplasmosis. In this regard,
Crockett et al. (2012) analyzed urine samples from patients
with Histoplasma antigenuria and negative controls by
nanospray tandem mass spectrometry. Comparing the se-
quence of the urine peptides found against known human
and Histoplasma proteins, they identified 52 unique peptides
from 37 Histoplasma known and predictive proteins. The util-
ity of this Histoplasma-specific urine proteome as antigens for
diagnostic tests remains to be explored.
Analyzing the extracellular proteome of the fungus consti-
tutes another approach to find potential antigenic candidates.
In this regard, Holbrook et al. (2011) identified 33 proteins
that form the extracellular proteome of the yeast phase of
H. capsulatum by capillary-liquid chromatography-nanospray
tandem mass spectrometry. One of the most abundant yeast-
phase secreted protein was Cfp4, a culture filtrate protein
without a homologue in other organisms. This exoantigen of
unknown role was found to be expressed and secreted by yeast
strains of the H. capsulatum phylogenetic species NAm1,
NAm2, and Panama, and proved to be reactive against 8 sera
of patients with probable acute or subacute histoplasmosis
after deglycosylation treatment (Holbrook et al. 2014).
Although a monoclonal antibody against Cfp4 was produced,
no further studies evaluating its utility as a diagnostic reagent
for histoplasmosis were reported.
Another study (Toyotome et al. 2015) explored the poten-
tial diagnostic utility of several proteins from 50 to 100 kDa
obtained by vigorous mixing of H. capsulatum yeast cells in
the presence of 0.1% Triton X-100. Eight seroreactive pro-
teins from the mixture were identified by mass spectrometry
and expressed in E. coli as His-tagged proteins. Among them,
only the partial fragment of the N-acetylated α-linked acidic
dipeptidase allowed to differentiate patients with histoplasmo-
sis from healthy controls by an ELISA test. Further evalua-
tions including a larger sample size with clinically character-
ized patients with histoplasmosis as well as other infectious
diseases should be performed to evaluate its utility in the se-
rological detection of histoplasmosis.
Recently, a recombinant protein of 100 kDa of H. capsulatum,
Hcp100, has been expressed in Pichia pastoris and purified in
order to obtain reagents for the diagnosis of histoplasmosis
(Toscanini et al. 2020). Hcp100, first described by Colonna-
Romano et al in 1998, is a regulatory protein that plays an essen-
tial role in the survival and replication of the fungi inside the
macrophages (Colonna-Romano et al. 1998). The recombinant
Hcp100 proved to be useful in the serological diagnosis of all five
patients with chronic histoplasmosis tested by immunodiffusion.
In addition, this antigen was detected in all urine samples from six
AIDS patients with PDH without being detected in those from
healthy controls. Despite the small sample size, Hcp100 appears
to be a promising antigen to be used in both serological and
antigen diagnostic tests. Further studies are needed to continue
validating the use of this antigen in diagnosis.
1847
Nucleic acid amplification assays
In the last two decades, numerous nucleotide amplification as-
says have been developed for the identification of H. capsulatum
in human, animal, or environmental samples. The reported as-
says varied in the target gene, the sample tested, the DNA ex-
traction and purification protocol and the amplification tech-
nique. These assays target multi-copy genes, such as the ribo-
somal DNA (rDNA) genes (18S, 28S, and 5.8S) and the inter-
vening internal transcribed spacer (ITS) regions; and single-copy
genes, such as those coding for the Hcp100 protein, the H and M
antigens, the NAALADase, the GAPDH, and the 1281-1283220
SCAR marker (Table 3).
The nested PCR assay is one of the most widely used
methods for targeting the gene that codes for the Hcp100
protein, which is essential for the adaptation and survival of
H. capsulatum inside the macrophages (Porta et al. 1999). In
2001, Bialek et al first (2001) reported this assay, which de-
tected H. capsulatum in 69% of formalin-fixed, paraffin-
embedded tissues from histoplasmosis patients and in none
of the negative controls. This assay was further validated in
respiratory samples achieving excellent sensitivity and speci-
ficity values (Muñoz et al. 2010), and in bone marrow and
blood samples with moderate diagnostic performance (Collela
et al. 2007; Dantas et al. 2018; Maubon et al. 2007; Da Silva
Zatti et al. 2019; Toranzo et al. 2009). Despite these good
results, the nested PCR has the disadvantage of being a labo-
rious technique that involves two amplification steps with the
consequent increased risk for contamination.
Real-time PCR (rt-PCR) assays have significant advan-
tages over nested PCR in terms of the amount of time for
analysis and cross-contamination. Lopez et al standardized
three rt-PCR protocols for the detection of H. capsulatum in
fresh and formalin-fixed, paraffin-embedded lung tissues from
infected mice targeting the gens of Hcp100 and the H and M
antigens (López et al. 2017). They designed de novo each set
of primers and probes based on high conservation regions
among the six clades of H. capsulatum described by Kasuga
et al. (2003). The assay exhibited 100% analytical sensitivity
and specificity using isolates from H. capsulatum and other
medically relevant pathogens. The results of the Hcp100 and
H antigen rt-PCR highly agreed with colony-forming unit
counts and histopathological analysis but their clinical utility
for the diagnosis of histoplasmosis still has to be evaluated.
Different research groups have used the rDNA gene com-
plex as target for molecular assays. This locus presents highly
conserved regions in the kingdom fungi as well as species-
specific regions; thus the target sequence has to be thoroughly
selected in order to avoid nonspecific amplifications (Bialek
et al. 2002). Some groups developed rt-PCR assays targeting
the ITS region designing their own primers and probes
(Buitrago et al. 2006; Martagon-Villamil et al. 2003; Simon
et al. 2010).
1848 Appl Microbiol Biotechnol (2021) 105:1837–1859

Table 3 Summary of nucleic acid amplification assays for the detection of H. capsulatum

Assay type Molecular Primers Sample type Sensitivity Specificity Reference

target (n) (n)

Nested-PCR ITS Outer PF 5′-TCCGTAGTAACCTG Soil with added - - Reid and Schafer
CGG-3′ (ITS1), outer PR 5′-TCCT H. capsulatum spores 1999
CCGCTTATTGATATGC-3′ (ITS4),
inner PF 5′-GGAGCCTCTGACCG
GGAC-3′ (HC-1), inner PR 5′-
GCACGTCCCACCGGTCAG-3′
(HC-2)
Outer and inner PF ITS1, outer PR ITS4, Blood, serum Blood: 70% Blood: Dantas et al. 2018
Inner PR 5′-GCATCGATGAAGAA (20) 80%
CGCAGC-3′ (ITS2) Serum: 65% (20)
(20) Serum:
80%
(20)
Outer PF 5′-TGTCTACCGGACCT Bone marrow, blood Bone Bone Da Silva Zatti et al.
GTTGC-3′ (ITS_HcI), outer PR marrow: marrow: 2019
5′-CCACCCATTTGGAGCTGCA-3′ 60% (10) 100%
(ITS_HcII), inner PF 5′-AGAG Blood: 100% (15)
CGATAATAATCCAGTC-3′ (ITS_ (1) Blood:
HcIII), inner PR 5′-GATA 100%
TGCTTAAGTTCAGCG-3′ (ITS_ (5)
HcIV),
DNAr 18s Outer PF 5′-GTTAAAAAGCTCGT Biopsy (murine model) 58.4% (113) Bialek et al. 2001
AGTTG-3′ (fungusI), outer PR
5′-TCCCTAGTCGGCATAGTTTA-3′
(fungusII), inner PF 5′-GCCG
GACCTTTCCTCCTGGGGAGC-3′
(histoI), inner PR 5′-CAAG
AATTTCACCTCTGACAGCCGA-3′
(histoII)
Primers fungus I and II and histo I and II FFPE tissue 69% (29) 45.5% (33) Bialek et al. 2002
described by Bialek et al. 2001
Primers fungus I and II and histo I and II Blood, serum Blood: 60% Blood: Dantas et al. 2018
described by Bialek et al. 2001 (20) 90%
Serum: 25% (20)
(20) Serum:
85%
(20)
Hcp100 Outer PF 5′-GCGTTCCGAGCCTT FFPE tissue 69% (29) 100% (33) Bialek et al. 2002
CCACCTCAAC-3′ (HcI), outer PR
5′-ATGTCCCATCGGGCGCCGTG
TAGT-3 (HcII), inner PF 5′-GAGA
TCTAGTCGCGGCCAGGTTCA-3′
(HcIII), inner PR 5′-AGG
AGAGAACTGTATCGGTGGCT
TG-3′ (HcIV)
Primers HcI, HcII, HcIII and HcIV Bone marrow, blood, Overall: 100% (14) Maubon et al. 2007
described by Bialek et al. 2002 biopsy 100% (15)
Primers HcI, HcII, HcIII and HcIV Blood 89% (19) 96% (21) Toranzo et al. 2009
described by Bialek et al. 2002
Primers HcI, HcII, HcIII and HcIV BAL, BL, sputum, CSF, 100% (67) 93.6% Muñoz et al. 2010
described by Bialek et al. 2002 other body fluids (109)
Primers HcI, HcII, HcIII and HcIV Bone marrow, blood Bone 100% (7) Collela et al. 2007
described by Bialek et al. 2002 marrow:
100% (7)
Blood: 0%
(2)
Primers HcI, HcII, HcIII and HcIV Serum 85.7% (7) - Frías De León et al.
described by Bialek et al. 2002 2017
Primers HcI, HcII, HcIII and HcIV Blood. serum Blood: 54% Dantas et al. 2018
described by Bialek et al. 2002 (20)
Appl Microbiol Biotechnol (2021) 105:1837–1859 1849

Table 3 (continued)

Assay type Molecular Primers Sample type Sensitivity Specificity Reference

target (n) (n)

Serum: 18% Blood:

(20) 100%
(20)
Serum:
100%
(20)
Primers HcI, HcII, HcIII and HcIV Bone marrow, blood Bone Bone Da Silva Zatti et al.
described by Bialek et al. 2002 marrow: marrow: 2019
50% (10) 100%
Blood: 100% (15)
(1) Blood:
100%
(5)
M antigen Outer PF 5′-ACAAGAGACGACGG Serum, tissue, BAL, CSF Serum: 50% - Ohno et al. 2013
TAGCTTCACG-3′ (Msp1F), outer PR (2)
5′-GCGTTGGGGATCAAGCGATG Tissue: 100%
AGCC-3′ (Msp1R), inner PF 5′-CGGG (3)
CCGCGTTTAACAGCGCC-3′ BAL: 100%
(Msp2F), PR: 5′-ATAA (2)
GGACGTCACGAAGGGC-3′ CSF: 0% (1)
(Msp3R)
Semi-nested H antigen PF 5′-GCGGGGTTGGCTCTGCTCT-3′ Biopsy, blood, mucosal Biopsy: Biopsy: Bracca et al. 2003
PCR (Hc2), outer PR 5′-TTGG scrapes 100% (1) 100%
AAACCCCGGGCTTG-3′ (Hc3), inner Blood: 100% (1)
PR 5′-TCATAGTAGGCTGT (2) Blood:
TCACCCCCG-3′ (Hc1) Mucosal 91.7%
scrape- (24)
s100% (3) Mucosal
scrapes:
100%
(1)
PCR M antigen Pair 1: PF 5′-ACAAGAGACGACGG Fungal isolates 100% (31) 100% (31) de Matos Guedes
TAGCTTCACG-3′ (Msp1F) PR et al. 2003
5′-GCGTTGGGGATCAAGCGATG
AGCC-3′ (Msp1R)
Pair 2: PF 5′-CGGGCCGCGTTTAA
CAGCGCC-3′ (Msp2F)
PR: 5′-ACCAGCGGCCATAAGGACGT
C-3′ (Msp2R)
SCAR PF 5′-CATTGTTGGAGGAA Human clinical samples, Human - Frías De León et al.
marker CCTGCT-3′, PR 5′-GAGC animal clinical clinical 2012
1281-128- TGCAGGATGTTTGTTG-3′ samples, soil samples:
3220 41.2% (17)
Animal
clinical
samples:
78.9 (19)
Soil: 40%
(10)
Primers described by Frías De León et al. Serum 85.7% (7) - Frías De León et al.
2012 2017
Multiplex Hcp100 and Primers HcI and HcII described by Bialek Fungal isolates 100% (51) 100% (9) Elías et al. 2012
PCR ITS et al. 2002 and primers ITS1 and ITS4
PCR-EIA ITS Primers ITS1 and ITS4 and probe Fungal isolates 100% (3) 100% (14) Lindsley et al.
5′-ACCATCTCAACCTCCTTTTT 2001
CACACCAGG-3′ (Hc)
Hcp100 PF 5′-CGCAGTTTTCCGTGCAGAA-3′ Urine 7.8 % (51) 100% (25) Tang et al. 2006
(Hc447F), PR 5′-CCAC
AGCATCACGGAGGTATT-3′
(Hc545R), probe 5′-CCAC
1850 Appl Microbiol Biotechnol (2021) 105:1837–1859

Table 3 (continued)

Assay type Molecular Primers Sample type Sensitivity Specificity Reference

target (n) (n)

CGATACAGTTCTCTCCTTCTTG
CAACTC-3′ (Hc480P)
rt-PCR ITS PF 5′-TTGTCTACCGGACCTG-3′ Fungal isolates and Fungal Fungal Martagon-Villamil
(Hcap-F), PR 5′-TTCT clinical samples (BAL, isolate: isolate: et al. 2003
TCATCGATGTCGGAAC-3′ lung biopsy, blood, 100% (34) 100%
(Hcap-R) and probes 5′-ACGA bone marrow) Clinical (73)
TTGGCGTCTGAGC-3′-fluorescein samples:
isothiocyanate and RED640-5′-GAGA 75% (4)
GCGATAATAATCCAGTCAAAAC
-3′-P
Primers Hcap-F and Hcap-R and the BAL, blood, bone 95.4% (71) 96% (277) Simon et al. 2010
probes described by Martagon-Villamil marrow, lymphatic
et al. 2003 nodes and tissue
biopsy
PF 5′-CCACCCTTGTCTACC-3′ Serum 70% (10) 100% (25) Buitrago et al.
(Hcits1-1), PR 5′-GGAA 2006
CCAAGAGATCCGT-3′ (Hcits1-2),
probes 5′-GTCGGTGAACGATT
GGCGT-3′-LCFluorescein
(HC1-Fluos) and
5′-LCRED640-GAGCATGA
GAGCGATAATAATCCAGT
-3′-(Tibmolbiol) (HC1-Red)
Primers Hcits1-1 and Hcits1-2 and probes Blood, serum, plasma, Overall: 100% (30) Buitrago et al.
described by Buitrago et al. 2006 BAL, bone marrow, 77.3% (22) 2007
urine, sputum Blood: 100%
(1)
Serum: 70%
(10)
Plasma:
100% (1)
BAL: 100 (5)
Bone
marrow:
100% (3)
Urine: 0% (1)
Sputum:
100% (1)
Primers Hcits1-1 and Hcits1-2 and probes Blood, serum, plasma, Overall: 74% - Buitrago et al.
described by Buitrago et al. 2006 respiratory samples, (54) 2011
bone marrow, lymph Blood: 37.5%
node biopsy, tissue Serum: 69%
biopsy Plasma: 75%
Respiratory
samples:
100%
Bone
marrow:
67%
Lymph
nodes:
67%
Biopsies:
100%
GAPDH PF 5′-AAATTGCTGGGTACGGA-3′ Respiratory samples, 73% (15) 100% Babady et al. 2011
(Hc1), PR 5′-GTTCTACAGCCTAG blood, bone marrow, (782)
CCTCG-3′ (Hc2), probes 5′-CGAG peritoneal fluid, other
AGGATGCAAGGTTGA-3′-FL (Hc3) body fluids.
and LCRED640-5′-CTCA
GTGAACGATAATTGGGG-3′-P
(Hc4)
Appl Microbiol Biotechnol (2021) 105:1837–1859 1851

Table 3 (continued)

Assay type Molecular Primers Sample type Sensitivity Specificity Reference

target (n) (n)

Hcp100 PF 5′-CGCAGTTTTCCGTGCAGAA-3′ FFPE tissue 88.9% (9) - Koepsell et al.

(Hc447F), PR 5′-CCAC 2012
AGCATCACGGAGGTATT-3′
(Hc545R), and probe 5′-CCAA
GCCACCGATACAGTT-3′
PF 5′-GCAGARAATTCGAC Fungal isolates 100% (30) 100% (36) López et al. 2017
CYCAAGCC-3′ (84R22), PR
5′-GTATCCCACAGCAT
CMYGGAGGT-3′ (15F23), probe
5′-6FAM-CCTTCTTG
CAACTYCCYGCGTCT-BBQ-3′
(45L23)
H antigen PF 5′-CACCGAGATAAAGG Fungal isolates 100% (30) 100% (36) López et al. 2017
TGTCGA-3′ (2F), PR 5′-GGAT
CAGGGCTGAAACCTTC-3′ (2R),
probe 5′-6FAM-CTGCCCAA
CGGTCCAACCACA-BBQ-3′ (2P)
M antigen PF 5′-CGCCRACGGGCTTTCCAT-3′ Fungal isolates 100% (30) 100% (36) López et al. 2017
(F1), PR 5′-CATCGCTTGATCCC
CAACG-3′ (R1), probe
5′-6FAM-ACCYSTTGGGTATT
GCGTTGAGG-BBQ-3′ (TM)
Nested NAALADase NA Serum, FFPE tissue, BAL Overall: 100% (4) Muraosa et al.
rt-PCR 77.8% (9) 2016
Serum: 50%
(4)
FFPE: 100%
(4)
BAL: 100%
(1)
Multiplex ITS NA Respiratory samples, Overall: 100% (29) Gago et al. 2014
rt-PCR blood, bone marrow, 82.4%
serum, biopsy Respiratory
samples:
100% (6)
Blood: 100%
(2)
Bone
marrow:
33.3% (3)
Serum: 50%
(2)
Biopsy:
100% (4)
LAMP Hcp100 Inner FP 5′-TCCCCGCGTCTCCC Urine 67% (6) 100% (10) Scheel et al. 2014
GAATACCGATCCAATGTC
CGTTCACC-3′ (FIP), Inner PR
5′-TCTGCACGGAAAACTGCGGC
CTACGGCAACTCCGAAACC-3′
(BIP), outer PF 5′-GTAG
TCGACGTTCGCAACT-3′ (F3), and
outer PR 5′-GCCGACGTCGTTTA
CATCG-3′ (B3)
ITS Outer PF 5′-TACCCGGCCACCCT Bone marrow, blood Overall: 54% Overall: Da Silva Zatti et al.
TGTC-3′ (Hc_F3), outer PR 5′-ATGT (11) 95% 2019
CGGAACCAAGAGATCC-3′ (Hc_ Bone (20)
B3), inner PF marrow: Bone
5′-GGAIAAGITCCCCCGGCAGTAC 50% (10) marrow:
CGGACCTGTTGCITCG-3′ (Hc_FIP) Blood: 100% 93.3%
CCGTCGGTGAAYGATTGGCG (1) (15)
1852
Table 3 (continued)
Assay type Molecular Primers
target
GTTGTTGAAAGTTTTGACTGGA
(Hc_BIP)
RCA ITS Primers ITS1 and ITS4
NGS - -
- -
- -
BAL bronchoalveolar lavage; BL bronchial lavage; CSF cerebrospinal fluid, FFPE formalin-fixed, paraffin-embedded, NA not available
Martagon-Villamil and colleagues evaluated a real-time
LightCycler® PCR assay in 107 fungal isolates, achieving
100% analytical sensitivity and specificity. However, the
assay only detected H. capsulatum DNA in three of the four
clinical samples tested. Buitrago et al. (2006, 2007, 2011)
developed another rt-PCR assay using the LightCycler®
probe system, achieving 100% specificity and a sensitivity
that varied depending on the sample type tested (37,5-
100%). Despite the limited number of samples tested, the
greatest sensitivity was achieved with respiratory samples
and when multiple samples from the same patient were eval-
uated (Buitrago et al. 2011). The low sensitivity values ob-
served in serum samples may be due to the fact that
H. capsulatum is an intracellular pathogen and thus, the
amount of free DNA is low.
On the other hand, Simon et al. developed an rt-PCR assay
using a TaqMan® platform, which could be used on any real-
time system, unlike the LightCycler® platform. The assay was
evaluated with 348 human samples achieving a clinical sensi-
tivity of 95.4%—among samples without PCR inhibitors—
and a specificity of 96.0% with respect to culture and a detec-
tion limit of 10 fg of H. capsulatum DNA per microliter.
The ITS region has also been used as target in a multiplex
rt-PCR to simultaneously detect in a single tube three fungal
species that frequently cause pneumonia in AIDS patients:
H. capsulatum, P. jirovecii, C. neoformans, and C. gattii
(Gago et al. 2014). The assay was evaluated in 40 HIV pa-
tients with proven fungal infections, 14 of whom suffered
from histoplasmosis, achieving 90.7% sensitivity and 100%
specificity.
Other attempts to identify multiple microorganism from a
single sample involve next-generation sequencing (NGS)
techniques (Frickmann et al. 2019; McTaggart et al. 2019;
Zhang et al. 2020). Moderate results were obtained in a limited
number of samples; H. capsulatum was identified in 2 of 5
formalin-fixed, paraffin-embedded samples with histological
evidence of histoplasmosis (Frickmann et al. 2019), and in
blood and bone marrow from one patient with histoplasmosis
Appl Microbiol Biotechnol (2021) 105:1837–1859
Sample type Sensitivity Specificity Reference
(n) (n)
Blood:
100%
(5)
Fungal isolates 100% (30) 100% (7) Furuie et al. 2016
BAL 83.3% (6) - McTaggart et al.
2019
FFPE tissue 40% (5) - Frickmann et al.
2019
Blood and bone marrow 100% (2) - Zhang et al. 2020
(Zhang et al. 2020). McTaggart et al successfully identified
C. immitis/posadasii, Scedosporium apiospermum,
Phaeoacremonium sp., and Aspergillus fumigatus in BAL
samples (McTaggart et al. 2019). Although H. capsulatum
was detected in 5 of the 6 samples tested, its relative abun-
dances were low and it was not the predominant taxa in the
samples. Further studies need to be carried out in order to
evaluate its utility in fungal diagnosis. In addition, the high
cost of NGS methods makes it difficult to implement in the
near future.
Isothermal nucleic acid amplification techniques appear to
be an appealing tool for a rapid and low-cost diagnosis. Since
amplification occurs at a single temperature, this step can be
performed in a heat block or a water bath. In addition, results
can be observed in the reaction tube by using several simple
strategies (Becherer et al. 2020). Despite its advantages, lim-
ited attempts have been made to develop these assays for the
diagnosis of histoplasmosis. Two loop-mediated isothermal
amplification (LAMP) assays targeting the ITS region (Da
Silva Zatti et al. 2019) and the Hcp100 gene (Scheel et al.
2014) were designed to detect H. capsulatum DNA in a few
clinical samples of AIDS patients with disseminated histoplas-
mosis, including urine. The ITS LAMP assay results agreed in
6 of 7 positive results obtained with ITS nested-PCR, whereas
the Hcp100 LAMP was positive in only 4 of 6 of the antigen
positive urine samples tested. The low sensitivity yield in
urine may be explained for its low content of complete fungal
DNA, making urine an unsuitable sample for DNA detection
(Scheel et al. 2014; Tang et al. 2006).
Another isothermal nucleic acid amplification technique
developed for histoplasmosis diagnosis was the rolling circle
amplification (RCA) of the ITS region (Furuie et al. 2016).
Despite the excellent analytical sensitivity and specificity
values reported, this assay involves an amplification step by
PCR, which increases the cost and contamination risk and
decreases its utility in resource-challenged regions.
Overall, nucleotide amplification techniques have demon-
strated rapid turnaround times, which is greatly important in
Appl Microbiol Biotechnol (2021) 105:1837–1859
the diagnosis of PDH. Studies reported that the theoretical
average time gained using PCR-based assays compared with
culture was 26.9–31 days (Maubon et al. 2007; Simon et al.
2010). In addition, based on the results of a recent meta-
analysis study involving the Hcp100 nested-PCR and the
ITS rt-PCR, the overall sensitivity of PDH diagnosis in
HIV+ patients of molecular methods was higher than that
calculated for culture methods (95.4% vs 77%) (Cáceres
et al. 2019b). These techniques could be effective in non-
endemic regions with inadequate culture facilities and limited
experience in isolating H. capsulatum. In these regions, the
antigen detection tests are commonly unavailable; therefore,
molecular tests could contribute to rapid diagnosis and thera-
py. Additionally, it has been suggested that nucleotide ampli-
fication methods could be useful in patient follow-up, since
there seems to be a correlation between clinical improvement
and DNA negativization (Toranzo et al. 2009).
In addition, nucleotide amplification techniques may repre-
sent a suitable alternative for the detection of H. capsulatum in
environmental samples, instead of using experimental animals,
also decreasing costs and turnaround times. Furthermore, mo-
lecular assays might allow the identification of H. capsulatum
organisms that cannot be easily identified by direct microscopic
examination and isolates with atypical phenotypic characteris-
tics (Elías et al. 2012).
A pending challenge for nucleotide amplification assays is to
obtain fungal DNA in high quality and quantity from clinical
samples. The extraction step is usually performed using com-
mercial kits—which increases costs (Da Silva Zatti et al.
2019)—and, in some cases, boiling and freezing cycles to fa-
cilitate the fungal wall rupture (Maubon et al. 2007; Toranzo
et al. 2009). This step is also important to remove polymerase
inhibitors (e.g., hemoglobin and EDTA), which would cause
false-negative results. False-positive results in molecular tests
may be due to mutations in the targeted H. capsulatum gene;
thus, primers and probes must be thoroughly designed regard-
ing the sequences of the different clades reported.
A major drawback of these in-house assays is the absence
of standardized protocols for both DNA extraction and ampli-
fication along with the lack of validation from large prospec-
tive studies. Thus, these methods merit further evaluation until
they could be widely used.
Concluding remarks
H. capsulatum has been a silent killer, causing more deaths in
people living with HIV in Latin America than tuberculosis
and evolving under the radars of healthcare systems in the vast
majority of countries (Adenis et al. 2018). The HIV/AIDS
pandemic, along with the growing number of patients under
immunosuppressive treatments, increased the population at
risk of contracting the life-threatening disseminated form of
1853
histoplasmosis. The problem is even more serious in Latin
America, where patients continue to die from a treatable dis-
ease due to the lack of accurate diagnostic methods.
Histoplasma antigen detection immunoassays have repre-
sented a step forward in the rapid diagnosis of PDH. However,
despite the fact that this assay has been included in the Model
List of Essential In Vitro Diagnostics for people with HIV in-
fection (WHO 2019), commercial kits are only used in some
highly specialized reference laboratories and are not yet regis-
tered in most countries (Cáceres et al. 2019a). Although detect-
ing Histoplasma antigen from urine samples has highly im-
proved sensitivity and represents an aid in the diagnosis of
PDH, the European Organization for Research and Treatment
of Cancer and the Mycoses consensus declared that it is not
sufficient evidence of proven histoplasmosis, because
Histoplasma antigen is also found in specimens of patients with
coccidioidomycosis and blastomycosis (Donnelly et al. 2020).
The search for novel antigens, particularly for protein
antigens, is an alternative that deserves further investiga-
tion because their production by recombinant-DNA tech-
nology would guarantee an unlimited supply of high-
quality reagents. In addition, the standardization and val-
idation of nucleotide amplification assays would also sup-
pose an advance in obtaining rapid and reliable methods
for the diagnosis of PDH, especially in high-income
laboratories.
Regardless of the technique used, efforts from commercial
companies and research laboratories should be focused on
developing high-quality reproducibly produced diagnostic
kits or reagents for the rapid diagnosis of histoplasmosis—as
well as other fungal diseases—and on making those kits com-
mercially available worldwide at reasonable cost. This coop-
eration road is necessary to achieve the goal established in the
Manaus Declaration, which aims that all laboratories in the
Americas could have access to rapid antigen or molecular tests
for the diagnosis of histoplasmosis by the year 2025 (Cáceres
et al. 2019a).
Acknowledgements ADN and MLC are members of the Argentinean
Research Council (CONICET). MAT thanks CONICET for the PhD
scholarship.
Author contribution All authors contributed to the manuscript prepara-
tion. All authors read and approved the final manuscript.
Funding This work was supported by grants from Agencia Nacional de
Promoción Científica y Técnica (ANPCyT, Grant PICT 2018-02186) and
from Universidad de Buenos Aires (Grant UBACyT 20020190100261BA).
Declarations
Conflict of interest The authors declare that they have no conflict of
interest.
1854
References
Adenis A, Nacher M, Hanf M, Basurko C, Dufour J, Huber F, Aznar C,
Carme B, Couppie P (2014) Tuberculosis and histoplasmosis among
human immunodeficiency virus-infected patients: a comparative
study. Am J Trop Med Hyg 90(2):216–223. https://doi.org/10.
4269/ajtmh.13-0084
Adenis A, Valdes A, Cropet C, McCotter OZ, Derado G, Couppie P,
Chiller T, Nacher M (2018) Burden of HIV-associated histoplasmo-
sis compared with tuberculosis in Latin America: a modelling study.
Lancet Infect Dis 18(10):1150–1159. https://doi.org/10.1016/
S1473-3099(18)30354-2
Almeida MA, Valdes A, Cropet C, McCotter OZ, Derado G, Couppie P,
Chiller T, Nacher M (2016) Validation of Western blot for
Histoplasma capsulatum antibody detection assay. BMC Infect
Dis 16(1):1–8. https://doi.org/10.1186/s12879-016-1427-0
Almeida MA, Damasceno LS, Pizzini CV, Muniz M, Almeida-Paes R,
Zancope-Oliveira RM (2019) Role of Western blot assay for the
diagnosis of histoplasmosis in AIDS patients from a National
Institute of Infectious Diseases in Rio de Janeiro, Brazil. Mycoses
62(3):261–267. https://doi.org/10.1111/myc.12877
Alvarado P, Pérez-Rojas Y, Zambrano EA, Gonzatti MI, Roschman-
González A (2020) Improved serodiagnosis of histoplasmosis by
use of deglycosylated extracellular released antigens of
Histoplasma capsulatum. J Microbiol Methods 175:105981.
https://doi.org/10.1016/j.mimet.2020.105981
Assi M, Iass EL, Wheat LJ (2011) Cross-Reactivity in the Histoplasma
antigen enzyme immunoassay caused by sporotrichosis. Clin
Vaccine Immunol 18(10):1781–1782. https://doi.org/10.1128/CVI.
05017-11
Babady NE, Buckwalter SP, Hall L, Le Febre KM, Binnicker MJ,
Wengenack NL (2011) Detection of Blastomyces dermatitidis and
Histoplasma capsulatum from culture isolates and clinical speci-
mens by use of real-time PCR. J Clin Microbiol 49(9):3204–3208.
https://doi.org/10.1128/JCM.00673-11
Bahr NC, Antinori S, Wheat LJ, Sarosi GA (2015) Histoplasmosis infec-
tions worldwide: thinking outside of the Ohio River Valley. Curr
Trop Med Rep 2(2):70–80. https://doi.org/10.1007/s40475-015-
0044-0
Baker J, Setianingrum F, Wahyuningsih R, Denning DW (2019)
Mapping histoplasmosis in South East Asia–implications for diag-
nosis in AIDS. Emerg Microbes Infect 8(1):1139–1145. https://doi.
org/10.1080/22221751.2019.1644539
Becherer L, Borst N, Bakheit M, Frischmann S, Zengerle R, Von Stetten
F (2020) Loop-Mediated Isothermal Amplification (LAMP)-review
and classification of methods for sequence-specific detection. Anal
Methods 12(6):717–746. https://doi.org/10.1039/c9ay02246e
Bialek R, Fischer J, Feucht A, Najvar LK, Dietz K, Knobloch J, Graybill
JR (2001) Diagnosis and monitoring of murine histoplasmosis by a
nested PCR assay. J Clin Microbiol 39(4):1506–1509. https://doi.
org/10.1128/JCM.39.4.1506-1509.2001
Bialek R, Feucht A, Aepinus C, Robertson VJ, Hohle R (2002)
Evaluation of two nested PCR assays for detection of Histoplasma
capsulatum DNA in human tissue. J Clin Microbiol 40(5):1644–
1647. https://doi.org/10.1128/JCM.40.5.1644
Bloch KC, Myint T, Raymond-Guillen L, Hage CA, Davis TE, Wright
PW, Chow FC, Woc-Colburn L, Khairy RN, Street AC, Yamamoto
T, Albers A, Wheat LJ (2018) Improvement in diagnosis of
histoplasma meningitis by combined testing for Histoplasma anti-
gen and immunoglobulin G and immunoglobulin M anti-
Histoplasma antibody in cerebrospinal fluid. Clin Infect Dis 66(1):
89–94. https://doi.org/10.1093/cid/cix706
Bracca A, Tosello ME, Girardini JE, Amigot SL, Gomez C, Serra E
(2003) Molecular Detection of Histoplasma capsulatum var.
Appl Microbiol Biotechnol (2021) 105:1837–1859
capsulatum in Human Clinical Samples. J Clin Microbiol 41(4):
1753–1755. https://doi.org/10.1128/JCM.41.4.1753-1755.2003
Brock EG, Reiss E, Pine L, Kaufman L (1984) Effect of periodate oxi-
dation on the detection of antibodies against the M-antigen of
histoplasmin by enzyme immunoassay (EIA) inhibition. Curr
Microbiol 10(3):177–180. https://doi.org/10.1007/BF01576782
Buitrago MJ, Berenguer J, Mellado E, Rodríguez-Tudela JL, Cuenca-
Estrella M (2006) Detection of Imported histoplasmosis in serum
of HIV-infected patients using a real-time PCR-based assay. Eur J
Clin Microbiol Infect Dis 25(10):665–668. https://doi.org/10.1007/
s10096-006-0207-y
Buitrago MJ, Gómez-López A, Monzón A, Rodríguez-Tudela JL,
Cuenca-Estrella M (2007) Evaluación de Una Técnica de PCR
Cuantitativa Para El Diagnóstico Clínico de La Histoplasmosis
Importada. Enferm Infecc Microbiol Clin 25(1):16–22. https://doi.
org/10.1157/13096748
Buitrago MJ, Bernal-Martínez L, Castelli MV, Rodríguez-Tudela JL, Cuenca-
Estrella M (2011) Histoplasmosis and Paracoccidioidomycosis in a non-
endemic area: a review of cases and diagnosis. J Travel Med 18(1):26–
33. https://doi.org/10.1111/j.1708-8305.2010.00477.x
Cáceres DH, Scheel CM, Tobón AM, Cleveland AA, Restrepo A, Brandt
ME, Chiller T, Gómez BL (2014) Validation of an enzyme-linked
immunosorbent assay that detects Histoplasma capsulatum
antigenuria in Colombian patients with AIDS for diagnosis and
follow-up during therapy. Clin Vaccine Immunol 21(9):1364–
1368. https://doi.org/10.1128/CVI.00101-14
Cáceres DH, Zuluaga A, Arango-Bustamante K, De Bedout C, Tobón
ÁM, Restrepo Á, Gomez BL, Cano LE, González Á (2015)
Implementation of a training course increased the diagnosis of his-
toplasmosis in Colombia. Am J Trop Med Hyg 93(3):662–667.
https://doi.org/10.4269/ajtmh.15-0108
Cáceres DH, Samayoa BE, Medina NG, Tobón AM, Guzmán BJ,
Mercado D, Restrepo A, Chiller T, Arathoon EE, Gómez BL
(2018) Multicenter validation of commercial antigenuria reagents
to diagnose progressive disseminated histoplasmosis in people liv-
ing with HIV/AIDS in two Latin American countries. J Clin
Microbiol 56(6):1–10. https://doi.org/10.1128/JCM.01959-17
Cáceres DH, Antoine A, de Souza JVB, Gomez BL, Cruz KS,
Pasqualotto AC, Ravasi G, Perez F, Chiller T, Guimarares de
Lacerda MV, Nacher M (2019a) The Manaus declaration: current
situation of histoplasmosis in the Americas, Report of the II
Regional Meeting of the International Histoplasmosis Advocacy
Group. Curr Fungal Infect Rep 13(4):244–249. https://doi.org/10.
1007/s12281-019-00365-3
Cáceres DH, Knuth M, Derado G, Lindsley MD (2019b) Diagnosis of
progressive disseminated histoplasmosis in advanced HIV: a meta-
analysis of assay analytical performance. J Fungi 5(3):1–13. https://
doi.org/10.3390/jof5030076
Cáceres DH, Gómez BL, Tobón AM, Chiller TM, Lindsley MD (2020)
Evaluation of a Histoplasma antigen lateral flow assay for the rapid
diagnosis of progressive disseminated histoplasmosis in Colombian
patients with AIDS. Mycoses 63(2):139–144. https://doi.org/10.
1111/myc.13023
Centers for Disease Control (1987) Revision of the CDC Surveillance
Case Definition for Acquired Immunodeficiency Syndrome.
Council of State and Territorial Epidemiologists; AIDS Program,
Center for Infectious Diseases. MMWR Suppl 36(1):1S–15S
Cloud JL, Bauman SK, Neary BP, Ludwig KG, Ashwood ER (2007)
Performance characteristics of a polyclonal enzyme immunoassay
for the quantitation of Histoplasma antigen in human urine samples.
Am J Clin Pathol 128(1):18–22. https://doi.org/10.1309/
Q7879TYDW5D93QK7
Collela MT, Mata S, Hartung C, Pérez C, Roselló A, Olaizola C,
Fernández C, Magaldi S, Toro F (2007) Detection of Histoplasma
capsulatum by Nested-PCR in Clinical Specimens. Kasmera 35(2):
156–163
Appl Microbiol Biotechnol (2021) 105:1837–1859
Colonna-Romano S, Porta A, Franco A, Kobayashi GS, Maresca B
(1998) Identification and Isolation by DDRT-PCR of Genes
Differentially Expressed by Histoplasma capsulatum during
Macrophages Infection. Microb Pathog 25(2):55–66. https://doi.
org/10.1006/mpat.1998.0209
Confalonieri ML, Gandola L, Aiolfi S, Mazzoni A (1994) Histoplasmin
sensitivity among a student population in Crema, Po Valley, Italy.
New Microbiol 17(2):151–153
Connolly PA, Durkin MM, LeMonte AM, Hackett EJ, Wheat LJ (2007)
Detection of Histoplasma antigen by a quantitative enzyme immu-
noassay. Clin Vaccine Immunol 14(12):1587–1591. https://doi.org/
10.1128/CVI.00071-07
Cook AK, Cunningham LY, Cowell AK, Wheat LJ (2012) Clinical eval-
uation of urine Histoplasma capsulatum antigen measurement in
cats with suspected disseminated histoplasmosis. J Feline Med
Surg 14(8):512–515. https://doi.org/10.1177/1098612X12450121
Couppié P, Aznar C, Carme B, Nacher M (2006) American histoplasmo-
sis in developing countries with a special focus on patients with
HIV: diagnosis, treatment, and prognosis. Curr Opin Infect Dis
19(5):443–449. https://doi.org/10.1097/01.qco.0000244049.15888.
b9
Crockett DK, Kushnir MM, Cloud JL, Ashwood ER, Rockwood AL
(2012) Identification of Histoplasma-specific peptides in human
urine. Int J Pept 2012(621329). https://doi.org/10.1155/2012/
621329
Cunningham L, Cook A, Hanzlicek A, Harkin K, Wheat J, Goad C,
Kirsch E (2015) Sensitivity and Specificity of Histoplasma
Antigen Detection by Enzyme Immunoassay. J Am Anim Hosp
Assoc 51(5):306–310. https://doi.org/10.5326/JAAHA-MS-6202
Da Silva Zatti M, Arantes TD, Lourenço Fernandes JA, Bay MB, Milan
EP, Silva Naliato GF, Theodoro RC (2019) Loop-mediated isother-
mal amplification and nested PCR of the internal transcribed spacer
(ITS) for Histoplasma capsulatum detection. PLoS Negl Trop Dis
13(8):1–20. https://doi.org/10.1371/journal.pntd.0007692
Dantas KC, De Freitas RS, da Silva MV, Criado PR, Luiz OC, Vicentini
AP (2018) Comparison of Diagnostic Methods to Detect
Histoplasma capsulatum in Serum and Blood Samples from AIDS
Patients. PLoS One 13(1):1–12. https://doi.org/10.1371/journal.
pone.0190408
de Freitas RS, Kamikawa CK, Pardini Vicentini A (2018) Fast protocol
for the production of Histoplasma capsulatum antigens for antibody
detection in the immunodiagnosis of histoplasmosis. Rev Iberoam
Micol 35(1):27–31. https://doi.org/10.1016/j.riam.2017.04.004
de Matos Guedes HL, Guimarães AJ, Muniz Mde M, Pizzini CV,
Hamilton AJ, Peralta JM, Deepe GS Jr, Zancopé-Oliveira RM
(2003) PCR assay for identification of Histoplasma capsulatum
based on the nucleotide sequence of the M antigen. J Clin
Microbiol 41(2):535–539. https://doi.org/10.1128/jcm.41.2.535-
539.2003
Deepe GS, Durose GG (1995) Immunobiological activity of recombinant
H antigen from Histoplasma capsulatum. Infect Immun 63(8):
3151–3157. https://doi.org/10.1128/IAI.63.8.3151-3157.1995
Denning DW (2016) Minimizing fungal disease deaths will allow the
UNAIDS target of reducing annual AIDS deaths below 500 000
by 2020 to be realized. Philos Trans R Soc B BiolSci 371(1709).
https://doi.org/10.1098/rstb.2015.0468
Donnelly JP, Chen SC, Kauffman CA, Steinbach WJ, Baddley JW,
Verweij PE, Clancy CJ, Wingard JR, Lockhart SR, Groll AH,
Sorrell TC, Bassetti M, Akan H, Alexander BD, Andes D,
Azoulay E, Bialek R, Bradsher RW, Bretagne S, Calandra T,
Caliendo AM, Castagnola E, Cruciani M, Cuenca-Estrella M,
Decker CF, Desai SR, Fisher B, Harrison D, Heussel CP, Jensen
HE, Kibbler CC, Kontoyiannis DP, Kullberg B, Lagrou K, Lamoth
F, Lehrnbecher T, Loeffler J, Lortholary O, Maertens J, Marchetti O,
Marr KA, Masur H, Meis JF, Morrisey CO, Nucci M, Ostrosky-
Zeichner L, Pagano L, Patterson TF, Perfect JR, Racil Z, Roilides E,
1855
Ruhnke M, Schaefer Prokop S, Shoham S, Slavin MA, Stevens DA,
Thompson GR, Vazquez JA, Viscoli C, Walsh J, Warris A, Wheat
LJ, White PL, Zaoutis TE, Pappas PG (2020) Revision and Update
of the Consensus Definitions of Invasive Fungal Disease From the
European Organization for Research and Treatment of Cancer and
the Mycoses Study Group Education and Research Consortium.
Clin Infect Dis 71(6):1367–1376. https://doi.org/10.1093/cid/
ciz1008
Durkin MM, Connolly PA, Wheat LJ (1997) Comparison of radioimmu-
noassay and enzyme-linked immunoassay methods for detection of
Histoplasma capsulatum var. capsulatum antigen. J Clin Microbiol
35(9):2252–2255
Edwards PQ, Billings EL (1971) Worldwide Pattern of skin sensitivity to
histoplasmin. Am J Trop Med Hyg 20(2):288–319
Elías NA, Cuestas ML, Sandoval M, Poblete G, Lopez-Daneri G,
Jewtuchowicz V, Iovannitti C, Mujica MT (2012) Rapid identifica-
tion of Histoplasma capsulatum directly from cultures by multiplex
PCR. Mycopathol 174(5–6):451–456. https://doi.org/10.1007/
s11046-012-9567-2
Falci DR, Hoffmann ER, Paskulin DD, Pasqualotto AC (2017)
Progressive disseminated histoplasmosis: a systematic review on
the performance of non-culture-based diagnostic tests. Braz J
Infect Dis 21(1):7–11. https://doi.org/10.1016/j.bjid.2016.09.012
Falci DR, Monteiro AA, Braz Caurio CF, Magalhães TCO, Xavier MO,
Basso RP, Melo M, Schwarzbold AV, Ferreira PRA, Vidal JE,
Marochi JP, Godoy CSM, Soares RBA, Paste A, Bay MB,
Pereira-Chiccola VL, Damasceno LS, Leitão TDMJS, Pasqualotto
AC (2019) Histoplasmosis, an underdiagnosed disease affecting
people living with HIV/AIDS in Brazil: results of a multicenter
prospective cohort study using both classical mycology tests and
Histoplasma urine antigen detection. Open Forum Infect Dis 6(4):
ofz073. https://doi.org/10.1093/ofid/ofz073
Fielder SE, Meinkoth JH, Rizzi TE, Hanzlicek AS, Hallman RM
(2019) Feline histoplasmosis presenting with bone and joint
involvement: clinical and diagnostic findings in 25 cats. J
Feline Med Surge 21(10):887–892. https://doi.org/10.1177/
1098612X18806706
Frías De León MG, Arenas López G, Taylor ML, Acosta Altamirano G,
Reyes-Montes Mdel R (2012) Development of specific sequence-
characterized amplified region markers for detecting Histoplasma
capsulatum in clinical and environmental samples. J Clin
Microbiol 50(3):673–679. https://doi.org/10.1128/JCM.05271-11
Frías De León MG, Ramírez-Bárcenas JA, Rodríguez-Arellanes G,
Velasco-Castrejón O, Taylor ML, Reyes-Montes MDR (2017)
Usefulness of molecular markers in the diagnosis of occupational
and recreational histoplasmosis outbreaks. Folia Microbiol (Praha)
62(2):111–116. https://doi.org/10.1007/s12223-016-0477-4
Frickmann H, Künne C, Hagen RM, Podbielski A, Normann J, Poppert S,
Looso M, Kreikemeyer B (2019) Next-generation sequencing for
hypothesis-free genomic detection of invasive tropical infections in
poly-microbially contaminated, formalin-fixed, paraffin-embedded
tissue samples-a proof-of-principle assessment. BMC Microbiol
19(1):1–19. https://doi.org/10.1186/s12866-019-1448-0
Furuie JL, Sun J, do Nascimento MMF, Gomes RR, Waculicz-Andrade
CE, Sessegolo GC, Rodrigues AM, Galvão-Dias MA, de Camargo
ZP, Queiroz-Telles F, Najafzadeh MJ, de Hoog SG, Vicente VA
(2016) Molecular identification of Histoplasma capsulatum using
rolling circle amplification. Mycoses 59(1):12–19. https://doi.org/
10.1177/1098612X18806706
Gago S, Esteban C, Valero C, Zaragoza Ó, De La Bellacasa JP, Buitrago
MJ (2014) A multiplex real-time PCR assay for identification of
Pneumocystis jirovecii, Histoplasma capsulatum, and
Cryptococcus neoformans/Cryptococcus gattii in samples from
AIDS patients with opportunistic pneumonia. J Clin Microbiol
52(4):1168–1176
1856
George RB, Lambert RS (1984) Significance of serum antibodies to
Histoplasma capsulatum in Endemic areas. South Med J 77(2):
161–163
Gomez BL, Figueroa JI, Hamilton AJ, Ortiz BL, Robledo MA, Restrepo
A, Hay RJ (1997) Development of a novel antigen detection test for
histoplasmosis. J Clin Microbiol 35(10):2618–2622
Gómez BL, Figueroa JI, Hamilton AJ, Ortiz BL, Robledo MA, Restrepo
A, Hay RJ (1999) Detection of the 70-Kilodalton Histoplasma
capsulatum antigen in serum of histoplasmosis patients:
Correlation between antigenemia and therapy during follow-up. J
Clin Microbiol 37(3):675–680
Guimarães AJ, Pizzini CV, De Matos Guedes HL, Albuquerque PC,
Peralta JM, Hamilton AJ, Zancopé-Oliveira RM (2004) ELISA for
early diagnosis of histoplasmosis. J Med Microbiol 53(6):509–514.
https://doi.org/10.1099/jmm.0.05469-0
Guimarães AJ, Nosanchuk JD, Zancopé-Oliveira RM (2006) Diagnosis
of histoplasmosis. Braz J Microbiol 37(1):1–13. https://doi.org/10.
1590/S1517-83822006000100001
Guimarães AJ, Pizzini CV, Almeida MA, Mauro J, Nosanchuk JD,
Zancopé-oliveira RA (2010) Evaluation of an enzyme-linked immu-
nosorbent assay using purified, deglycosylated histoplasmin for dif-
ferent clinical manifestations of histoplasmosis. Microbiol Res 1(1):
7–14. https://doi.org/10.4081/mr.2010.e2
Gutierrez ME, Canton A, Connolly P, Zarnowski R, Wheat LJ (2008)
Detection of Histoplasma capsulatum antigen in Panamanian
Patients with disseminated histoplasmosis and AIDS. Clin Vaccine
Immunol 15(4):681–683. https://doi.org/10.1128/CVI.00358-07
Hage CA, Davis TE, Egan L, Parker M, Fuller D, Lemonte AM, Durkin
M, Connelly P, Wheat LJ, Blue-Hnidy D, Knox KS (2007)
Diagnosis of pulmonary histoplasmosis and blastomycosis by detec-
tion of antigen in bronchoalveolar lavage fluid using an improved
second-generation enzyme-linked immunoassay. Respir
med 101(1):43–47. https://doi.org/10.1016/j.rmed.2006.04.017
Hage CA, Davis TE, Fuller D, Egan L, Witt JR, Wheat LJ, Knox KS
(2010) Diagnosis of histoplasmosis by antigen detection in BAL
fluid. Chest 137(3):623–628. https://doi.org/10.1378/chest.09-1702
Hage CA, Ribes JA, Wengenack NL, Baddour LM, Assi M, McKinsey
DS, Hammoud K, Alapat D, Babady EN, Parker M, Fuller DA,
Noor A, Davis TE, Rodgers M, Connolly PA, El Haddad B,
Wheat LJ (2011a) A multicenter evaluation of tests for diagnosis
of histoplasmosis. Clin Infect Dis 53(5):448–454. https://doi.org/10.
1093/cid/cir435
Hage CA, Kirsch EJ, Stump TE, Kauffman CA, Goldman M, Connolly P,
Johnson PC, Wheat LJ, Baddley JW (2011b) Histoplasma antigen
clearance during treatment of histoplasmosis in patients with AIDS
determined by a quantitative antigen enzyme immunoassay. Clin
Vaccine Immunol 18(4):661–666. https://doi.org/10.1128/CVI.
00389-10
Hanzlicek AS, Meinkoth JH, Renschler JS, Goad C, Wheat LJ (2016)
Antigen concentrations as an indicator of clinical remission and
disease relapse in cats with histoplasmosis. J Vet Intern Med
30(4):1065–1073. https://doi.org/10.1111/jvim.13962
Hoffmann ER, Daboit TC, Paskulin DD, Monteiro AA, Falci DR,
Linhares T, Flores JM, Goldani LZ, de Melo MG, Behar PR,
Pasqualotto AC (2017) Disseminated histoplasmosis and AIDS: a
prospective and multicentre study to evaluate the performance of
different diagnostic tests. Mycoses 60(1):20–24. https://doi.org/10.
1111/myc.12536
Holbrook ED, Edwards JA, Youseff BH, Rappleye CA (2011) Definition
of the extracellular proteome of pathogenic-phase Histoplasma
capsulatum. J Proteome Res 10(4):1929–1943. https://doi.org/10.
1021/pr1011697
Holbrook ED, Kemski MM, Richer SM, Wheat LJ, Rappleye CA (2014)
Glycosylation and immunoreactivity of the Histoplasma
capsulatum Cfp4 yeast-phase exoantigen. Infect Immun 82(10):
4414–4425. https://doi.org/10.1128/IAI.01893-14
Appl Microbiol Biotechnol (2021) 105:1837–1859
Homei A, Worboys M (2013) Chapter 4, Endemic Mycoses and
Allergies: Diseases of Social Change. In: Fungal disease in Britain
and the United States 1850–2000: Mycoses and Modernity.
Basingstoke (UK): Palgrave Macmillan. Available from: https://
www.ncbi.nlm.nih.gov/books/NBK169221/
Incorporated G-P (2011) AccuProbe Histoplasma capsulatum culture
identification test. Growth (Lakeland)
Kasuga T, White TJ, Koenig G, Mcewen J, Restrepo A, Castañeda E, Da
Silva Lacaz CDA, Heins-Vaccari EM, De Freitas RS, Zancopé-
Oliveira RM, Qin Z, Negroni R, Carter DA, Mikami Y, Tamura
M, Taylor ML, Miller GF, Poonwan N, Taylor JW (2003)
Phylogeography of the fungal pathogen Histoplasma capsulatum.
Mol Ecol 12(12):3383–3401. https://doi.org/10.1046/j.1365-294X.
2003.01995.x
Kauffman CA (2008) Diagnosis of histoplasmosis in immunosuppressed
patients. Curr Opin Infect Dis 21(4):421–425. https://doi.org/10.
1097/QCO.0b013e328306eb8d
Kaufman L (1971) Serological Tests for histoplasmosis: their use and
interpretation. In: Thomas CC (ed) Histoplasmosis: Proceedings of
the Second National Conference Held at the Center for Disease
Control. Springfield, Illinois, Atlanta, pp 321–326
Kaufman L, Kovacs JA, Reiss E (1997) Clinical immunomycology. In:
de Macario EC, Folds JD, Lane HC, Nakamura RM (eds) Manual of
Clinical Laboratory Immunology, 5th edn. American Society for
Microbiology, Washington D.C, pp 575–584
Klugman HB, Lurie HI (1963) Systemic histoplasmosis in South Africa.
A review of the previous cases and a report of an additional case–the
first successfully treated. S Afr Med J 37:29–31
Koepsell SA, Hinrichs SH, Iwen PC (2012) Applying a real-time PCR
assay for Histoplasma capsulatum to clinically relevant formalin-
fixed paraffin-embedded human tissue. J Clin Microbiol 50(10):
3395–3397. https://doi.org/10.1128/JCM.01705-12
Lau AF, Drake SK, Calhoun LB, Henderson CM, Zelazny AM (2013)
Development of a clinically comprehensive database and a simple
procedure for identification of molds from solid media by matrix-
assisted laser desorption ionization-time of flight mass spectrometry.
J Clin Microbiol 51(3):828–834. https://doi.org/10.1128/JCM.
02852-12
LeMonte A, Egan L, Connolly P, Durkin M, Wheat LJ (2007) Evaluation
of the IMMY ALPHA Histoplasma antigen enzyme immunoassay
for diagnosis of histoplasmosis marked by antigenuria. Clin Vaccine
Immunol 14(6):802–803. https://doi.org/10.1128/CVI.00035-07
Lindsley MD (2013) The future of fungal serology. Curr Fungal Infect
Rep 7(3):161–170. https://doi.org/10.1007/s12281-013-0146-x
Lindsley MD, Hurst SF, Iqbal NJ, Morrison CJ (2001) Rapid identifica-
tion of dimorphic and yeast-like fungal pathogens using specific
DNA probes. J Clin Microbiol 39(10):3505–3511. https://doi.org/
10.1128/JCM.39.10.3505-3511.2001
Lindsley MD, Holland HL, Bragg SL, Hurst SF, Wannemuehler KA,
Morrison CJ (2007) Production and evaluation of reagents for de-
tection of Histoplasma capsulatum antigenuria by enzyme immuno-
assay. Clin Vaccine Immunol 14(6):700–709. https://doi.org/10.
1128/CVI.00083-07
López LF, Muñoz CO, Cáceres DH, Tobón ÁM, Loparev V, Clay O,
Chiller T, Litvintseva A, Gade L, González Á, Gómez BL (2017)
Standardization and validation of real time PCR assays for the diag-
nosis of histoplasmosis using three molecular targets in an animal
model. PLoS One 12(12):1–15. https://doi.org/10.1371/journal.
pone.0190311
Martagon-Villamil J, Shrestha N, Sholtis M, Isada CM, Hall GS, Bryne
T, Lodge BA, Barth Reller L, Procop GW (2003) Identification of
Histoplasma capsulatum from culture extracts by real-time PCR. J
Clin Microbiol 41(3):1295–1298. https://doi.org/10.1128/JCM.41.
3.1295-1298.2003
Maubon D, Simon S, Aznar C (2007) Histoplasmosis diagnosis using a
polymerase chain reaction method. Application on human samples
Appl Microbiol Biotechnol (2021) 105:1837–1859
in French Guiana, South America. Diagn Microbiol Infect Dis
58(4):441–444. https://doi.org/10.1016/j.diagmicrobio.2007.03.008
McGill JE, Hanzlicek AS, Kukanich KS, Norsworthy GD, Cook AK
(2018) Pretreatment Histoplasma capsulatum urine enzymatic im-
munoassay concentrations do not correlate with outcome but may be
influenced by renal function in cats with histoplasmosis. J Feline
Med Surg 20(12):1177–1179. https://doi.org/10.1177/
1098612X18761440
McLeod DSA, Mortimer RH, Perry-Keene DA, Allworth A, Woods ML,
Perry-Keene J, McBride WJH, Coulter C, Robson JMB (2011)
Histoplasmosis in Australia: report of 16 cases and literature review.
Med 90(1):61–68. https://doi.org/10.1097/MD.0b013e318206e499
McTaggart LR, Copeland JK, Surendra A, Wang PW, Husain S, Coburn
B, Guttman DS, Kus JV (2019) Mycobiome sequencing and analy-
sis applied to fungal community profiling of the lower respiratory
tract during fungal pathogenesis. Front Microbiol 10:1–12. https://
doi.org/10.3389/fmicb.2019.00512
Moreira da Silva R, da Silva Neto JR, Santos CS, Cruz KS, Frickmann H,
Poppert S, Koshikene D, De Souza JVB (2015) Fluorescent in situ
hybridization of pre-incubated blood culture material for the rapid
diagnosis of histoplasmosis. Med Mycol 53(2):160–164. https://doi.
org/10.1093/mmy/myu080
Muñoz CO, Gómez BL, Tobón A, Arango K, Restrepo A, Correa MM,
Muskus C, Cano LE, González A (2010) Validation and clinical
application of a molecular method for identification of
Histoplasma capsulatum in human specimens in Colombia, South
America. Clin Vaccine Immunol 17(1):62–67. https://doi.org/10.
1128/CVI.00332-09
Muraosa Y, Toyotome T, Yahiro M, Watanabe A, Shikanai-Yasuda MA,
Kamei K (2016) Detection of Histoplasma capsulatum from clinical
specimens by cycling probe-based real-time PCR and nested real-
time PCR. Med Mycol 54(4):433–438. https://doi.org/10.1093/
mmy/myv106
Murray PR (1991) Comparison of the lysis-centrifugation and agitated
biphasic blood culture systems for detection of fungemia. J Clin
Microbiol 29(1):96–98
Nacher M, Adenis A, Mc Donald S, Do Socorro Mendonca Gomes M,
Singh S, Lopes Lima I, Malcher Leite R, Hermelijn S,
Wongsokarijo M, Van Eer M, Marques Da Silva S, Mesquita Da
Costa M, Silva M, Calvacante M, do Menino Jesus Silva Leitao T,
Gómez BL, Restrepo A, Tobon A, Canteros CE, Aznar C, Blanchet
D, Vantilcke V, Vautrin C, Boukhari R, Chiller T, Scheel C,
Ahlquist A, Roy M, Lortholary O, Carme B, Couppié P, Vreden S
(2013) Disseminated histoplasmosis in HIV-infected patients in
South America: a neglected killer continues on its rampage. PLoS
Negl Trop Dis 7(11):7–9. https://doi.org/10.1371/journal.pntd.
0002319
Nacher M, Blanchet D, Bongomin F, Chakrabarti A, Couppié P, Demar
M, Denning DW, Djossou F, Epelboin L, Govender N, Leitão T,
Mac Donald S, Mandengue C, Marques da Silva SH, Oladele R,
Panizo MM, Pasqualotto A, Ramos R, Swaminathan S, Rodriguez-
Tudela JL, Vreden S, Zancopé-Oliveira R, Adenis A (2018)
Histoplasma capsulatum antigen detection tests as an essential di-
agnostic tool for patients with advanced HIV disease in low and
middle income countries: a systematic review of diagnostic accuracy
studies. PLoS Negl Trop Dis 12(10):1–12. https://doi.org/10.1371/
journal.pntd.0006802
Ohno H, Tanabe K, Umeyama T, Kaneko Y, Yamagoe S, Miyazaki Y
(2013) Application of nested PCR for diagnosis of histoplasmosis. J
Infect Chemother 19(5):999–1003
Oladele RO, Ayanlowo OO, Richardson MD, Denning DW (2018)
Histoplasmosis in Africa: an emerging or a neglected disease?
PLoS Negl Trop Dis 12(1). https://doi.org/10.1371/journal.pntd.
0006046
1857
Pan B, Chen M, Pan W, Liao W (2013) Histoplasmosis: a new endemic
fungal infection in China? Review and Analysis of Cases. Mycoses
56(3):212–221. https://doi.org/10.1111/myc.12029
Persaud SP, Lawton T, Burnham CD, Anderson NW (2019) Comparison
of urine antigen assays for the diagnosis of Histoplasma capsulatum
infection. J Appl Lab Med 4(3):370–382. https://doi.org/10.1373/
jalm.2018.028910
Picardi JL, Kauffman CA, Schwarz J, Phair JP (1976) Detection of pre-
cipitating antibodies to Histoplasma capsulatum by
counterimmunoelectrophoresis. Am Rev Respir Dis 114(1):171–
176. https://doi.org/10.1164/arrd.1976.114.1.171
Pine L, Boone CJ, McLaughlin D (1966) Antigenic properties of the cell
wall and other fractions of the yeast form of Histoplasma
capsulatum. J Bacteriol 91(6):2158–2168. https://doi.org/10.1128/
JB.91.6.2158-2168.1966
Pizzini CV, Zancopé-Oliveira RM, Reiss E, Hajjeh R, Kaufman L,
Peralta JM (1999) Evaluation of a Western blot test in an outbreak
of acute pulmonary histoplasmosis. Clin Diagn Lab Immunol 6(1):
20–23. https://doi.org/10.1128/cdli.6.1.20-23.1999
Porta A, Colonna-Romano S, Callebaut I, Franco A, Marzullo L,
Kobayashi GS, Maresca B (1999) An Homologue of the human
100-KDa protein (p100) is differentially expressed by Histoplasma
capsulatum during infection of murine macrophages. Biochem
Biophys Res Commun 254(3):605–613. https://doi.org/10.1006/
bbrc.1998.9894
Raman C, Khardori N, Tewari RP, Von Behren LA, Wheat LJ (1990)
Evaluation of an ELISA for the detection of anti-Histoplasma ribo-
somal and antihistoplasmin antibodies in histoplasmosis. J Clin Lab
Anal 4(3):199–207. https://doi.org/10.1002/jcla.1860040311
Randhawa HS, Gugnani HC (2018) Occurrence of histoplasmosis in the
Indian sub-continent: An Overview and Update. J Med Res Pract
7(3):71–83. https://doi.org/10.20936/jmrp/07/03/02
Reid TM, Schafer MP (1999) Direct detection of Histoplasma
capsulatum in soil suspensions by two-stage PCR. Mol Cell
Probes 13(4):269–273. https://doi.org/10.1006/mcpr.1999.0247
Richer SM, Smedema ML, Durkin MM, Herman KM, Hage CA, Fuller
D, Wheat LJ (2016) Improved diagnosis of acute pulmonary histo-
plasmosis by combining antigen and antibody detection. Clin Infect
Dis 62(7):896–902. https://doi.org/10.1093/cid/ciw007
Rothenburg L, Hanzlicek AS, Payton ME (2019) A monoclonal
antibody-based urine Histoplasma antigen enzyme immunoassay
(IMMY®) for the diagnosis of histoplasmosis in cats. J Vet Intern
Med 33(2):603–610. https://doi.org/10.1111/jvim.15379
Santiago AR, Hernández B, Rodríguez M, Romero H (2004) A compar-
ative study of blood voncentional method vs. a modified lysis/
centrifugation technique for the diagnosis of fungemias. Rev
Iberoam Micol 21(4):198–201
Scheel CM, Samayoa B, Herrera A, Lindsley MD, Benjamin L, Reed Y,
Hart J, Lima S, Rivera BE, Raxcaco G, Chiller T, Arathoon E,
Gómez BL (2009) Development and evaluation of an enzyme-
linked immunosorbent assay to detect Histoplasma capsulatum
antigenuria in immunocompromised patients. Clin Vaccine
Immunol 16(6):852–858. https://doi.org/10.1128/CVI.00066-09
Scheel CM, Zhou Y, Theodoro RC, Abrams B, Balajee SA, Litvintseva
AP (2014) Development of a loop-mediated isothermal amplifica-
tion method for detection of Histoplasma capsulatum DNA in clin-
ical samples. J Clin Microbiol 52(2):483–488. https://doi.org/10.
1128/JCM.02739-13
Schestatsky P, Chedid MF, Amaral OB, Unis G, Oliveira FM, Severo LC
(2006) Isolated central nervous system histoplasmosis in immuno-
competent hosts: a series of 11 cases. Scand J Infect Dis 38(1):43–
48. https://doi.org/10.1080/00365540500372895
Sharma A, Johri BN, Shriniwas (1982) An enzyme immunoassay for
yeast and mycelial phase-specific antibodies in histoplasmosis. J
Immunol Methods 50:115–121
1858
Simon S, Veron V, Boukhari R, Blanchet D, Aznar C (2010) Detection of
Histoplasma capsulatum DNA in human samples by real-time po-
lymerase chain reaction. Diagn Microbiol Infect Dis 66(3):268–273
https://doi.org/10.1016/j.diagmicrobio.2009.10.010
Sotgiu G, Mantovani A, Mazzoni A (1970) Histoplasmosis in Europe.
Mycopathol Mycol Appl 41(1–2):53–74
Swartzentruber S, Rhodes L, Kurkjian K, Zahn M, Brandt ME, Connolly
P, Wheat LJ (2009a) Diagnosis of acute pulmonary histoplasmosis
by antigen detection. Clin Infect Dis 49(12):1878–1882. https://doi.
org/10.1086/648421
Swartzentruber S, LeMonte A, Witt J, Fuller D, Davis T, Hage C,
Connolly P, Durkin M, Wheat LJ (2009b) Improved detection of
Histoplasma antigenemia following dissociation of immune com-
plexes. Clin Vaccine Immunol 16(3):320–322. https://doi.org/10.
1128/CVI.00409-08
Tang YW, Li H, Durkin MM, Sefers SE, Meng S, Connolly PA, Stratton
CW, Wheat LJ (2006) Urine Polymerase chain reaction is not as
sensitive as urine antigen for the diagnosis of disseminated histo-
plasmosis. Diagn Microbiol Infect Dis 54(4):283–287. https://doi.
org/10.1016/j.diagmicrobio.2005.10.008
Theel ES, Jespersen DJ, Harring J, Mandrekar J, Binnicker MJ (2013)
Evaluation of an enzyme immunoassay for detection of Histoplasma
capsulatum antigen from urine specimens. J Clin Microbiol 51(11):
3555–3559. https://doi.org/10.1128/JCM.01868-13
Theel ES, Harring JA, Dababneh AS, Rollins LO, Bestrom JE, Jespersen
DJ (2015) Reevaluation of commercial reagents for detection of
Histoplasma capsulatum antigen in urine. J Clin Microbiol 53(4):
1198–1203. https://doi.org/10.1128/JCM.03175-14
Toranzo AI, Tiraboschi IN, Fernández N, Ibarra-Camou B, Rivas MC,
Lee W, Davel G, Canteros CE (2009) Diagnóstico Molecular de
Histoplasmosis Humana En Muestras de Sangre Entera. Rev
Argent Microbiol 41(1):20–26
Torres M, Díaz H, Herrera T, Sada E (1993) Evaluation of enzyme linked
immunosorbent-assay and Western blot for diagnosis of histoplas-
mosis. Rev Inv Clín 45(2):155–160
Torres-González P, Niembro-Ortega MD, Martínez-Gamboa A,
Ahumada-Topete VH, Andrade-Villanueva J, Araujo-Meléndez J,
Chaparro-Sánchez A, Crabtree-Ramírez B, Cruz-Martínez S,
Gamboa-Domínguez A, Flores-Barrientos OI, Gaytán-Martínez
JE, González-Hernández LA, Hernández-León C, Lozano-
Fernandez VH, Manríquez-Reyes M, Magaña-Aquino M,
Martínez-Ayala P, Ramírez-Hinojosa JP, Rangel-Cordero A,
Rivera-Martínez NE, Reyes-Gutiérrez E, Reyes-Terán G,
Rodríguez-Zulueta P, Ruíz-Quiñones J, Santiago-Cruz J,
Velázquez-Zavala NG, Sifuentes-Osornio J, Ponce de León A
(2018) Diagnostic accuracy cohort study and clinical value of the
Histoplasma urine antigen (ALPHA Histoplasma EIA) for dissem-
inated histoplasmosis among HIV Infected patients: a multicenter
study. PLoS Negl Trop Dis 12(11):1–16. https://doi.org/10.1371/
journal.pntd.0006872
Toscanini MA, González Maglio D, Capece P, Posse G, Iovannitti CA,
Nusblat AD, Cuestas ML (2020) Histoplasma capsulatum 100-
kilodalton antigen: recombinant production, characterization, and
evaluation of its possible application in the diagnosis of histoplas-
mosis. Appl Microbiol Biotechnol 104(13):5861–5872. https://doi.
org/10.1007/s00253-020-10570-7
Toyotome T, Watanabe A, Ochiai E, Kamei K (2015) N-acetylated α-
linked acidic dipeptidase is identified as an antigen of Histoplasma
capsulatum. Biochem Biophys Res Commun 458(3):483–487.
https://doi.org/10.1016/j.bbrc.2015.01.129
Valero C, Buitrago MJ, Gago S, Quiles-Melero I, Garćia-Rodríguez J
(2018) A matrix-assisted laser desorption/ionization time of flight
mass spectrometry reference database for the identification of
Histoplasma capsulatum. Med Mycol 56(3):307–314. https://doi.
org/10.1093/mmy/myx047
Appl Microbiol Biotechnol (2021) 105:1837–1859
Wheat LJ (1992) Histoplasmosis in Indianapolis. Clin Infect Dis
14(Suppl 1):S91–S99. https://doi.org/10.1093/clinids/14-
Supplement_1-S91
Wheat LJ (1995) Endemic mycoses in AIDS: a clinical review. Clin
Microbiol Rev 8(1):146–159. https://doi.org/10.1128/cmr.8.1.146-
159.1995
Wheat LJ (2006) Improvements in diagnosis of histoplasmosis. Expert
Opin Biolog Ther 6(11):1207–1221. https://doi.org/10.1517/
14712598.6.11.1207
Wheat LJ, Kauffman CA (2003) Histoplasmosis. Infect Dis Clin N Am
17(1):1–19. https://doi.org/10.1016/s0891-5520(02)00039-9
Wheat LJ, Slama TG, Norton JA, Kohler RB, Eitzen HE, French ML,
Sathapatayavongs B (1982a) Risk factors for disseminated or fatal
histoplasmosis. Analysis of a large urban outbreak. Ann Intern Med
96(2):159–163
Wheat LJ, French MLV, Kohler RB, Zimmerman SE, Smith WR, Norton
JA, Eitzen HE, Smith CD, Slama TG (1982b) The diagnostic labo-
ratory tests for histoplasmosis. Analysis of experience in a large
urban outbreak. Ann Intern Med 97(5):680–685. https://doi.org/10.
1016/S0002-9343(89)80820-4
Wheat LJ, Kohler TB, Tewari RP (1986) Diagnosis of disseminated
histoplasmosis by detection of Histoplasma capsulatum antigen in
serum and urine specimens. New Eng J Med 314(2):83–88. https://
doi.org/10.1056/NEJM198601093140205
Wheat LJ, Connolly-Stringfield P, Kohler RB, Frame PT, Gupta MR
(1989a) Histoplasma capsulatum polysaccharide antigen detection
in diagnosis and management of disseminated histoplasmosis in
patients with acquired immunodeficiency syndrome. Am J Med
87(4):396–400
Wheat LJ, Kohler RB, Tewari RP, Garten M, French MLV (1989b)
Significance of Histoplasma antigen in the cerebrospinal fluid of
patients with meningitis. Arch Intern Med 149(2):302–304
Wheat LJ, Connolly P, Blair R, Connolly K, Garringer T, Katz BP (1991)
Histoplasmosis relapse in patients with AIDS: detection using
Histoplasma capsulatum variety capsulatum antigen levels. Ann
Intern Med 115(12):936–941
Wheat LJ, Connolly-Stringfield P, Williams B, Connolly K, Blair R,
Bartlett M, Durkin M (1992) Diagnosis of histoplasmosis in patients
with the acquired immunodeficiency syndrome by detection of
Histoplasma capsulatum polysaccharide antigen in bronchoalveolar
lavage fluid. Am Rev Respir Dis 145(6):1421–1424
Wheat LJ, Wheat H, Connolly P, Kleiman M, Supparatpinyo K, Nelson
K, Bradsher R, Restrepo A (1997) Cross-reactivity in Histoplasma
capsulatum variety capsulatum antigen assays of urine samples
from patients with endemic mycoses. Clin Infect Dis 24(6):1169–
1171. https://doi.org/10.1086/513647
Wheat LJ, Connolly P, Durkin M, Book BK, Tector AJ, Fridell J,
Pescovitz MD (2004) False-positive Histoplasma antigenemia
caused by antithymocyte globulin antibodies. Transpl Infect Dis
6(1):23–27. https://doi.org/10.1111/j.1399-3062.2004.00045.x
Wheat LJ, Connolly PA, Durkin M, Book BK, Pescovitz MD (2006)
Elimination of false-positive Histoplasma antigenemia caused by
human anti-rabbit antibodies in the second-generation Histoplasma
antigen assay. Transpl Infect Dis 8(1):219–221
Wheat LJ, Freifeld AG, Kleiman MB, Baddley JW, McKinsey DS, Loyd
JE, Kauffman CA (2007a) Clinical practice guidelines for the man-
agement of patients with histoplasmosis: 2007 update by the
Infectious Diseases Society of America. Clin Infect Dis 45(7):
807–825. https://doi.org/10.1086/521259
Wheat LJ, Witt J, Durkin JWM, Connolly P (2007b) Reduction in false
antigenemia in the second generation histoplasma antigen assay.
Med Mycol 45(2):169–171. https://doi.org/10.1080/
13693780601185947
Wheat LJ, Azar MM, Bahr NC, Spec A, Relich RF, Hage C (2016)
Histoplasmosis. Infect Dis Clin N Am 30(1):207–227. https://doi.
org/10.1016/j.idc.2015.10.009
Appl Microbiol Biotechnol (2021) 105:1837–1859
Wheat LJ, Myint T, Guo Y, Kemmer P, Hage C, Terry C, Azar MM,
Riddell J, Ender P, Chen S, Shehab K, Cleveland K, Esguerra E,
Johnson J, Wright P, Douglas V, Vergidis P, Ooi W, Baddley J,
Bamberger D, Khairy R, Vikram H, Jenny-Avital E,
Sivasubramanian G, Bowlware K, Pahud B, Sarria J, Tsai T, Assi
M, Mocherla S, Prakash V, Allen D, Passaretti C, Huprikar S,
Anderson A (2018) Central nervous system histoplasmosis. Med
97(13):1–8. https://doi.org/10.1097/MD.0000000000010245
WHO (2019) Second WHO Model List of Essential In Vitro Diagnostics.
https://www.who.int/medical_devices/publications/Standalone_
document_v8.pdf?ua=1 (July 2, 2020)
Zancopé-Oliveira RM, Bragg SL, Reiss E, Wanke B, Peralta JM (1994)
Effects of Histoplasmin M Antigen chemical and enzymatic degly-
c o s y l a t i o n o n c r o s s - r ea c t i v i t y i n t h e e n z y m e - l i n k e d
immunoelectrotransfer blot method. Clin Diagn Lab Immunol
1(4):390–393. https://doi.org/10.1128/cdli.1.4.390-393.1994
Zancopé-Oliveira RM, Reiss E, Lott TJ, Mayer LW, Deepe GS (1999)
Molecular Cloning, Characterization, and Expression of the M
Antigen of Histoplasma capsulatum. Infect Immun 67(4):1947–
1953. https://doi.org/10.1128/.67.4.1947-1953.1999
Zhang X, Gibson B, Daly TM (2013) Evaluation of commercially avail-
able reagents for diagnosis of histoplasmosis infection in immuno-
compromised patients. J Clin Microbiol 51(12):4095–4101. https://
doi.org/10.1128/JCM.02298-13
1859
Zhang C, Lei GS, Lee CH, Hage CA (2015) Evaluation of two new
enzyme immunoassay reagents for diagnosis of histoplasmosis in a
cohort of clinically characterized patients. Med Mycol 53(8):868–
873. https://doi.org/10.1093/mmy/myv062
Zhang HC, Zhang QR, Ai JW, Cui P, Wu HL, Zhang WH, Wang T
(2020) The role of bone marrow metagenomics next-generation se-
quencing to differential diagnosis among visceral leishmaniasis, his-
toplasmosis, and Talaromycosis marneffei. Int J Lab Hematol 42(2):
e52–e54. https://doi.org/10.1111/ijlh.13103
Zimmerman SE, Connolly Stringfield P, Wheat LJ, French MLV, Kohler
RB (1989) Comparison of sandwich solid-phase radioimmunoassay
and two enzyme-linked immunosorbent assays for detection of
Histoplasma capsulatum polysaccharide antigen. J Infect Dis
160(4):678–685. https://doi.org/10.1093/infdis/160.4.678
Zimmerman SE, French MLV, Kleiman MB, Wheat LJ (1990)
Evaluation of an enzyme-linked immunosorbent assay that uses fer-
rous metal beads for determination of antihistoplasmal immuno-
globulins G and M. J Clin Microbiol 28(1):59–64. https://doi.org/
10.1128/jcm.28.1.59-64.1990
Publisher’s note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.