Toxicology and Applied Pharmacology 263 (2012) 1–6

Contents lists available at SciVerse ScienceDirect

Toxicology and Applied Pharmacology

journal homepage: www.elsevier.com/locate/ytaap

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH

oxidase activity in rats
Joonghoon Park a, Eok Park a, Bong-Hyun Ahn a, Hyoung Jin Kim a, Ji-hoon Park b, Sun Young Koo a,
Hyo-Shin Kwak a, Heui Sul Park a, Dong Wook Kim a, Myoungsub Song a, Hyeon Joo Yim a,
Dong Ook Seo a, Soon Ha Kim a,⁎
a
LG Life Sciences Ltd., R&D Park, Daejeon, 305-380, Republic of Korea
b
Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mito-
Received 20 December 2011 chondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the pu-
Revised 15 May 2012 tative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling
Accepted 23 May 2012
and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death
Available online 31 May 2012
of H9C2 rat cardiomyocytes at EC50 = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats,
Keywords:
NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase
NecroX-7 (LDH) which were increased by DOX treatment (p b 0.05). Microarray analysis revealed that 21 genes differ-
Doxorubicin entially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’
tert-Butyl hydroperoxide (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also iden-
NADPH oxidase tified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochem-
Cardiomyopathy ical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p b 0.001). These findings
demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or
DOX via NOX-mediated cell death.
© 2012 Elsevier Inc. All rights reserved.

Introduction cardiac hypertrophy and adverse cardiac remodeling (Cave et al.,

Cardiomyopathy is a lethal disease in which the heart undergoes
morphological and functional changes. In the heart under pathologi-
cal conditions, oxidative stress plays an important role in cardiomy-
opathy (Kuroda et al., 2010). Mitochondria are the major source of
ROS primarily through respiratory chain reaction (Ide et al., 2001).
However, in the past few years NADPH oxidases have been found
to play an important role in the pathogenesis of the heart (Bendall
et al., 2002).
There are seven members identified in the NADPH family: NOX1-5
and DUOX1-2 (Graham et al., 2010). The phagocytic NOX is composed
of a catalytic NOX2/gp91phox and a p22phox. Several cytosolic sub-
units (p47phox, p67phox, p40phox, and Rac 1/2) are participated in
the complex to function (Lambeth, 2004). Non-phagocytic cells
have also been found to contain NOXs in a cell specific manner
(Lambeth et al., 2007). NOX2 and NOX4 are expressed in
cardiomyocytes, fibroblasts, and endothelial cells (Bendall et al.,
2002; Griendling et al., 2000; Li et al., 2002). NOX2 is involved in
⁎ Corresponding author at: 104-1 Moonji-dong, Yuseung-gu, Daejeon, Republic of
Korea. Fax: + 82 42 862 0333.
E-mail address: shakim@lgls.com (S.H. Kim).
2006; Looi et al., 2008). NOX4 has been well-characterized to pro-
mote apoptosis and mitochondrial dysfunction in cardiomyocytes
(Ago et al., 2010). Although NOXs are the major source of enzymatic
ROS production, their contribution to overall increases in ROS and
myocardial responses under stress is not fully understood.
NecroX is a small molecule necrosis inhibitor with a broad spec-
trum against necrotic insults (Martinet et al., 2011). It has been well
characterized that NecroX is a mitochondrial ROS and RNS scavenger
to inhibit cell death against various kinds of oxidative stresses includ-
ing tBHP, DOX, CCl4, and hypoxic injury (Kim et al., 2010). NecroX-7
has been shown to prevent the release of HMGB1 or to ameliorate he-
patic ischemic–reperfusion injury in dogs (Choi et al., 2010). Further-
more, NecroX-7 priming enhanced the transplantation efficacy of
cardiac fibroblasts to create myocardial fibrosis in mice (Lee et al.,
2011).
The major goal in this study was to investigate the effect of NecroXs
on NOX in oxidative stress-induced cardiomyopathy. To this end, we
evaluated the cardioprotective effect of NecroX-7, -13, and -14 in
tBHP-treated H9C2 cells, which is an in vitro model to study the mech-
anisms of oxidative cardiomyocyte damage. Sprague–Dawley (SD) rats
were subjected to oxidative cardiotoxicity induced by single DOX injec-
tion to evaluate the in vivo cardioprotective effect of NecroXs. Putative

0041-008X/$ – see front matter © 2012 Elsevier Inc. All rights reserved.
doi:10.1016/j.taap.2012.05.014
2 J. Park et al. / Toxicology and Applied Pharmacology 263 (2012) 1–6
mechanism of the cardioprotection by NecroX-7 was investigated by
global gene expression profiling, followed by NOX assay.
Materials and methods
Chemical reagents. Nivocasan (pan-caspase inhibitor), NecroX-7,
-13, and -14 were synthesized by LG Life Sciences (Korea). tBHP,
DOX, melatonin, DPI (NOX inhibitor), and IDN6556 (pan-caspase in-
hibitor) were purchased from Sigma-Aldrich (St. Louis, MO).
Assessment of in vitro cardioprotective effects. Rat cardiomyocyte
H9C2 cells were purchased from the American Type Culture Collec-
tion and maintained in Dulbecco's modified Eagle's medium con-
taining 10% fetal bovine serum and 1× penicillin/streptomycin under
5% CO2. If not mentioned, all reagents for cell culture were purchased
from Invitrogen (Carlsbad, CA). H9C2 cells were seeded at 1.5–2 × 104
cells per well of 96-well plates (BD Bioscience, Franklin Lakes, NJ) and
grown for 24 h. To determine the effective concentration (EC) for
cytoprotection, various concentrations of chemicals were applied to
H9C2 cells. After 30 min of treatment, oxidative damage was induced
by adding 0.5 mM tBHP for 2 h. Cell viability was measured by using sul-
forhodamine B (SRB) assay. Briefly, H9C2 cells were fixed with 50 μL of
4% (v/v) formaldehyde per well for 10 min, washed three times with
distilled water, and then dried at 50 °C. After drying, 50 μL of SRB work-
ing solution was applied into each well for 1 h, and then washed thor-
oughly with 0.1% (v/v) acetic acid solution. The plate was dried again
and filled with 100 μL of 10 mM Tris buffer. The color development
was measured at absorbance between 560 and 580 nm by using
SpectraMax microplate reader (Molecular Devices, Sunnyvale, CA).
Assessment of in vivo cardioprotective effects. Animal protocol was
approved by LG Life Sciences Institutional Animal Care and Use Com-
mittee. To evaluate the cardioprotective effect of NecroX-7 in animals,
DOX-induced acute cardiomyopathy rats was used. Briefly, male SD
rats at 6 weeks old (Orient Bio, Republic of Korea) were randomly
assigned to five different groups (N = 5/group): negative control
(no treatment), DOX, and DOX plus NecroX-7 at three different dose
levels, 25, 50, or 100 mg/kg/day. After overnight fasting, rats were
given orally NecroX-7. Another 4 h after the treatment, 15 mg/kg of
DOX was administered intraperitoneally to induce acute cardiac dam-
age, and then rats were allowed to access freely to diet and water.
NecroX-7 was administered once a day for three days. Blood was col-
lected 24 h and 72 h after the 1st treatment, and plasma were sepa-
rated by centrifugation at 10,000 ×g for 10 min and kept at −20 °C
before use. Blood chemistry was performed by using Clinical Analyzer
(Hitachi, Japan) to measure the plasma levels of lactate dehydroge-
nase (LDH) and muscle/brain type creatine kinase (CK-MB).
Global gene expression analysis. Total RNA was extracted from
H9C2 cells after 12 h exposure of tBHP, tBHP plus NecroX-7, or
NecroX-7 alone. RNA quality was evaluated by using Agilent 2100
Bioanalyzer (Santa Clara, CA), and RNA samples with A260/280 > 1.8
and intensity ratio of 28S rRNA/18S rRNA > 2.0 were used for microar-
ray analysis. Total RNA was amplified and Cy3 labeled by using
Agilent Low RNA Input Linear Amplification kit PLUS. Labeled aRNA
was hybridized onto Agilent 44K rat whole genome microarray, and
signal was extracted in Agilent DNA microarray scanner and Feature
Extraction Software. Loess normalization was applied before statisti-
cal analysis, and present calls throughout the microarrays were used
for further analysis. Differentially expressed (DE) genes were identi-
fied with fold-change cutoff = 2 by comparing with control. DE
genes were uploaded into Ingenuity Pathway Analysis (Ingenuity Sys-
tems, Redwood City, CA), and biological functions were identified
with p-value cutoff = 0.05 by using right-tailed Fisher exact test. DE
genes enriched in putative target pathways were used as the starting
point for gene-to-gene networking, and biological relevance of the
networks and interactions between genes was investigated by litera-
ture mining.
Quantitative real-time RT-PCR (qRT-PCR). Three genes differential-
ly expressed in H9C2 by tBHP, Cadherin 5 (Cdh5), neutrophil cyto-
solic factor 1 (Ncf1/p47phox), insulin-like growth factor 1 (Igf1),
and one gene with equivocal level of expression among treatment,
CCAAT/enhanced binding protein (Cebpb), were subjected to qRT-
PCR to validate the microarray results using Rotor-Gene 6000
(Qiagen, Germany). 18S rRNA was used as an internal control.
Primers for each genes were designed as follows: Cdh5 (forward)
5′‐aggacgtggtgccagtaaac-3′, (reverse) 5′‐ctgtgatgttggcggtattg-3′, Ncf1
(forward) 5′‐tccctgcatcctatttggag-3′, (reverse) 5′‐gggacacctcatcctcttca-
3′, Igf1 (forward) 5′‐ggcattgtggatgagtgttg-3′, (reverse) 5′‐gtcttgggcatgt-
cagtgtg-3′, Cebpb (forward) 5′‐aggacgtggtgccagtaaac-3′, (reverse) 5′‐
ctgtgatgttggcggtattg-3′, 18S rRNA (forward) 5′‐ctggttgatcctgccagtag,
(reverse) 5′‐cgaccaaaggaaccataact-3′. The results were analyzed using
Rotor-Gene ScreenClust HRM Software (Qiagen) with the comparative
CT method.
NADPH oxidase (NOX) activity assay. NADPH-dependent superox-
ide production was measured in H9C2 cell lysates using lucigenin-
enhanced chemiluminescence as described previously (Griendling
et al., 2000). Briefly, 2 × 10 5 cells were resuspended with 50 μL of
lysis buffer containing 50 mM KH2PO4 (pH 7.0), 1 mM EGTA, and pro-
tease inhibitor cocktail (Sigma-Aldrich). Twenty micrograms of cell
lysate was placed in reaction buffer composed of 50 mM KH2PO4
(pH 7.0), 1 mM EGTA, and 150 mM sucrose, and preincubated with
10 μM DPI or 25 μM NecroX-7 or DPI plus NecroX-7 for 30 min. The
reaction was started by adding 25 μM lucigenin and 100 μM NADPH
(Sigma-Aldrich) simultaneously, and the relative light unit (RLU) of
chemiluminescence was measured on Lumat LB9507 (Berthold Tech-
nologies GmbH & Co. KG, Germany).
Statistical analysis. Data were analyzed by one-way analysis of var-
iance (ANOVA) followed by Duncan's grouping as a post-hoc test. Sig-
nificant p-value was set at 0.05.
Results
NecroX-7 prevents tBHP- and DOX-induced cardiomyopathy
As depicted in Table 1, NecroX and DPI effectively prevented tBHP-
induced H9C2 cell death, while little or no cardioprotective effect was
observed with melatonin or IND6556. In the previous study, we dem-
onstrated that tBHP increased the accumulation of mitochondrial ROS
and RNS in H9C2 cells, and NecroX-5 inhibited overproduction of mi-
tochondrial ROS at IC25 = 0.04 μM, resulting in cytoprotection against
tBHP-induced cell death (Kim et al., 2010). In consistent with the pre-
vious findings, NecroX-7 prevented tBHP-induced cell death at
EC50 = 0.057 μM in the present study. DPI, a NOX-specific inhibitor
also prevented tBHP-induced cell death at EC50 b 0.04 μM. In contrast,
melatonin, a powerful terminal antioxidant, did not increase cell sur-
vival even at 30 μM. IDN6556, a caspase inhibitor, was not effective to
prevent tBHP-induced cell death even at 30 μM, neither.
Table 1
In vitro protective activity of NecroXs against tBHP-
induced cell death of H9C2 rat cardiomyocytes.
Test article EC50 (μM)
Melatonin >30
IDN6556 >30
DPI b 0.04
NecroX-7 0.057
NecroX-13 0.625
NecroX-14 b 0.1
 J. Park et al. / Toxicology and Applied Pharmacology 263 (2012) 1–6 3

Table 2
In vivo protective activity of NecroXs in DOX-induced acute cardiomyopathy rats.

Group Dose 24 h 72 h
(mg/kg)
LDH (IU/L) CK-MB (U/L) LDH (IU/L) CK-MB (U/L)
a a a
Negative control 0 559.0 ± 130.2 672.2 ± 141.2 148.4 ± 15.7 459.4 ± 46.1a
DOX 15 1209.6 ± 287.5b 1465.0 ± 433.6b 356.4 ± 29.6b 722.2 ± 137.9b
DOX + 15 816.8 ± 520.7a,b 933.2 ± 284.3a 384.6 ± 24.6b 771.8 ± 97.2b
NecroX-7 25
DOX + 15 709.6 ± 224.2a,b 855.0 ± 129.9a 352.6 ± 68.6b 753.6 ± 50.4b
NecroX-7 50
DOX + 15 534.6 ± 246.1a 929.0 ± 202.4a 377.4 ± 63.3b 836.0 ± 125.9b
NecroX-7 100

DOX: doxorubicin; mean ± SD, N = 5 animals/group.

a,b
Means labeled with different letters in each column were significantly different at p b 0.05.

NecroXs relieved DOX-induced cardiomyopathy in rats (Table 2).
DOX is a widely used anthracycline antibiotic in the treatment of var-
ious malignancies; however, DOX-induced cardiotoxicity from in-
creased levels of ROS (Chandran et al., 2009) and peroxynitrite
formation (Mukhopadhyay et al., 2009) is the major limiting compli-
cation for clinical application. In the present study, DOX-induced car-
diomyopathy was monitored by measuring LDH and CK-MB levels
which are specific blood markers for myocardial damage (Grande
et al., 1980; Osman et al., 2009). A single intraperitoneal administra-
tion of DOX at 15 mg/kg induced the peak release of LDH and CK-MB
at 24 h after treatment. NecroX-7 reduced DOX-induced LDH release
in a dose dependent manner, and significant reduction was observed
at a dose level of 100 mg/kg (p b 0.05). DOX-induced CK-MB release
was significantly ameliorated by NecroX-7 at all dose levels
(p b 0.05); however, it was not dose proportional.
Cardioprotective effect of NecroX-7 is potentially brought on by inhibition
of NOX complex
Global gene expression analysis revealed that NecroX-7 inhibited
ROS overproduction by regulation of NOX activity, resulting in pre-
vention of necrotic cell death. In microarray study, 32,077 present
calls were identified after filtration. Among them, 1491 genes
(4.65%) were differentially expressed in tBHP-treated H9C2 cells
when compared with control. Likewise, 1759 genes (5.48%) and
1720 genes (5.36%) were differentially expressed in tBHP plus
NecroX-7 and NecroX-7 alone-treated H9C2 cells, respectively. As
seen in Fig. 1, functional analysis revealed that 21 differentially
expressed genes (DE genes) in tBHP-treated H9C2 cells enriched in
‘Production of reactive oxygen species’ (p = 0.022) which was not
seen in concurrent NecroX-7 treatment. Five DE genes identified in
0.025
Production of reactive
oxygen species
0.020 (gene# = 21)
Pulmonary embolism
0.015 (gene# = 5)
p-value
NecroX-7 alone-treated H9C2 cells involved in ‘Pulmonary embolism’
(p = 0.00559); however, it was revealed to be false positive by litera-
ture mining (data not shown).
Subsequently, pathway analysis identified a molecular network of
11 genes from production of reactive oxygen species pathway
(Table 3). Correlating gene expression profiles with a potential phar-
macological network, as shown in Fig. 2, identified putative molecular
targets of NecroX-7 against tBHP-induced cytotoxicity in H9C2 cells.
For example, B-cell CLL/lymphoma 2 (Bcl2), Igf1 and cathelicidin an-
timicrobial peptide (Camp) were downregulated more than 2-fold in
tBHP-treated H9C2 cells compared with DMSO control, and these
changes were associated with necrosis; however, those genes ret-
urned to normal levels of expression by concurrent NecroX-7 treat-
ment. Furthermore, tBHP upregulated the expression of integrin
alpha 5 (Itga5), Ncf1/p47phox, and ras-related C3 botulinum toxin
substrate 2 (Rac2) by 4.594, 3.772, and 2.254-fold than DMSO control,
respectively, and it was associated with the activation of high mobil-
ity group B1 (HMGB1) pathway; however, those genes were normal-
ized in tBHP plus NecroX-7 treatment.
Expression levels of the putative target genes from the microarray
were validated by qRT-PCR (Table 4). Cdh5 and Ncf1, the upregulated
genes by tBHP in H9C2, tended to increase by tBHP in qRT-PCR com-
pared to control, and those tendencies were obvious when compared
to qRT-PCR results by tBHP plus Necrox-7; however, the down-
regulation of Igf1 in microarray was not matched with qRT-PCR. The
expression level of Cebpb, the control gene for equivocal expression
among treatment, was comparable among control, tBHP, and tBHP
plus NecroX-7.
Cardioprotective effect of NecroX-7 was proven by NOX assay.
NOX inhibitor DPI was compared to determine the effect of NecroX-
7 on NOX activity. Using various ranges of concentration of NexcoX-
7 (2, 10, 50, or 100 μM), 50% inhibitory concentration (IC50) of NOX
activity by NecroX-7 was estimated to be 25 μM. Based on this find-
ing, 25 μM NecroX-7, 10 μM DPI, or NecroX-7 plus DPI at same con-
centration was applied to the isolated NOX complex. Fig. 3 shows
that NecroX-7 significantly reduced NOX activity by 53.3% compared
to DMSO control (p b 0.001), which was comparable to 49.9% inhibi-
tion by DPI. Furthermore, concurrent treatment of DPI and NecroX-7

increased NOX inhibition by 25.0% (p b 0.001).

0.010
Discussion
0.005
In in vitro cardioprotection study, NecroXs appear to effectively in-
hibit tBHP-induced caspase-independent cell death. tBHP is a well
0.000 known oxidizing agent by generating tert-butoxy radicals. Exposure
tBHP tBHP/NecroX-7 NecroX-7
of various cells to tBHP is widely used to induce oxidative cell
Fig. 1. Functional analysis of differentially expressed genes in tBHP plus NecroX-7-treated death, in which cells undergo typical apoptotic changes including
H9C2 cells. Among 1491 differentially expressed genes (4.65%) in tBHP-treated H9C2 cells membrane blebbing, alteration of mitochondrial function, chromatin
when compared with control, 21 genes enriched in ‘Production of reactive oxygen species’
(p = 0.022) which were not seen in concurrent NecroX-7 treatment. Among 1720 genes
condensation and nuclear shrinkage (Brambilla et al., 1998; Chen et
(5.36%) differentially expressed in NecroX-7 alone-treated H9C2 cells, 5 genes participated al., 2000). However, an increase of the exposure time and/or the con-
in ‘Pulmonary embolism’ (p=0.00559). centration of tBHP results in a rapid loss of membrane integrity of
4 J. Park et al. / Toxicology and Applied Pharmacology 263 (2012) 1–6

Table 3
Putative target genes of NecroX-7 efficacy against tBHP-induced necrotic cell death of H9C2 rat cardiomyocytes.

Gene Fold change RefSeq Gene name Function Knockout eNorthern

symbol (tBHP/DMSO) phenotype (normal heart)

BCL2 − 2.455 NM_016993 B-cell CLL/lymphoma 2 Apoptosis CV system –

CAMP − 2.173 XM_236642 Cathelicidin antimicrobial peptide Immunity Life span +
CDH5 4.183 XM_226213 Cadherin 5, type 2 (vascular endothelium) Adhesion CV system +
DDIT3 2.748 NM_024134 DNA-damage-inducible transcript 3 Transcription NA +
IGF1 − 2.854 NM_178866 Insulin-like growth factor 1 (somatomedin C) Growth CV system +
ITGA5 4.594 XM_235707 Integrin, alpha 5 (fibronectin receptor, alpha polypeptide) Adhesion CV system +
ITGB3 − 6.194 NM_153720 Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) Adhesion CV system –
LAT 5.705 NM_030853 Linker for activation of T cells T-cell activation Immunity +
NCF1 3.772 NM_053734 Neutrophil cytosolic factor 1; neutrophil cytosolic factor 1 C pseudogene NADPH oxidase NA –
RAC2 2.254 NM_001008384 Ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) NADPH oxidase CV system –
ZAP70 2.605 NM_001012002 Zeta-chain (TCR) associated protein kinase 70 kDa T-cell activation Immunity –

H9C2 cells, which is a characteristic of necrosis (Sardao et al., 2007).
In concordance with the previous finding, H9C2 cells at 0.5 mM
tBHP used in this study resulted in cell death with a morphological
change of necrosis (Kim et al., 2010). Melatonin, an antioxidant char-
acterized by a direct free radical scavenging, stimulation of antioxi-
dant enzymes, and increasing the efficiency of mitochondrial
oxidative phosphorylation pathway (Reiter and Tan, 2003), did not
protect H9C2 cell death by tBHP. In addition, IDN-6556, an irrevers-
ible pan-caspase inhibitor that prevents effectively oxidative stress-
induced apoptosis (Hoglen et al., 2004), failed to protect H9C2 against
tBHP-induced oxidative stress. In contrast, NecroX-7 substantially
prevented tBHP-induced H9C2 cell death. To our surprise, a NOX-
specific inhibitor, DPI, also prevented tBHP-induced cell death that
was comparable to NecroX-7, implying that tBHP-induced ROS may
come from mitochondria and/or NOX which result in caspase-
independent cell death, and NecroX-7 exerts H9C2 cell protection
against tBHP-induced cell death.
The present study showed that NecroX-7 reduced DOX-induced
acute cardiotoxicity in SD rats. ROS mediated DOX cardiotoxicity
may be acute, occurring after receiving high dose while the chronic
DOX cardiotoxicity is dose-dependent (Chatterjee et al., 2010;
Zhang et al., 2009). It has been known that DOX cardiotoxicity in-
volves apoptosis of cardiomyocytes (Arola et al., 2000; Kotamraju et
al., 2000). However, recent study has shown that DOX cardiotoxicity
may be reduced not by anti-apoptotic treatment but by anti-
necrotic treatment (Ikegami et al., 2007). NecroX-7 significantly re-
duced plasma concentrations of CK-MB and LDH compared to those
of DOX-treated group. The elevation of several enzyme levels is well
known to imply DOX cardiotoxicity, where CK-MB and LDH are spe-
cific for myocardial damage (Grande et al., 1980; Osman et al.,
2009). Therefore, acute DOX cardiotoxicity model used in this study
was consistent with the previous findings, and elevated CK-MB and
LDH in 24 h of DOX treatment might be useful to determine acute
DOX cardiotoxicity. Even though we did not measure cardiac ROS
level in the animals, these results might demonstrate that DOX-
induced oxidative stress causes caspase-independent cardiac cell
death and it could be ameliorated by NecroX-7.
Global gene expression analysis followed by IPA networking iden-
tified that the ROS generation through NOX complex might be the
most important pathway regulated by NecroX-7. tBHP treatment ap-
pears to activate ROS generation pathway by alteration of the tran-
scriptional levels of 21 genes in H9C2 cells, and NecroX-7 effectively
normalized the dysregulated gene expression. Necrosis was suggested
as an important function inhibited by NecroX-7 against tBHP-induced
oxidative damage in H9C2 cells. Necrosis has been considered as an
uncontrolled form of cell death; however, accumulating evidence re-
veals that necrotic cell death might be regulated by a set of signaling
pathways (Festjens et al., 2006; Syntichaki and Tavernarakis, 2002).
The present study supports the previous findings by identification of
putative effectors of necrosis. For example, downregulation of Bcl2

Fig. 2. Gene-to-gene networking of the production of ROS-enriched genes in tBHP plus NecroX-7-treated H9C2 cells. Pathway analysis identified a molecular network of 11 genes
from production of reactive oxygen species-enriched genes. BCL2, IGF1 and CAMP were downregulated in tBHP-treated H9C2 cells which were associated with necrosis; however,
those genes returned to normal levels of expression by concurrent NecroX-7 treatment. ITGA5, NCF1, and RAC2 were upregulated by tBHP treatment, resulted in activation of
HMGB1 pathway; however, those genes were normalized in tBHP plus NecroX-7 treated H9C2 cells.
 J. Park et al. / Toxicology and Applied Pharmacology 263 (2012) 1–6 5

Table 4 oxidative cell death, and NecroX-7 might exert cardioprotection by

Validation of microarray by qRT-PCR.
Gene Fold change (treatment/DMSO)
name
tBHP tBHP + NecroX-7
Microarray qRT-PCR Microarray qRT-PCR
Cdh5 4.18 1.54 1.04 0.80
Ncf1 3.77 1.18 1.74 0.68
Cebpb 0.93 0.75 1.02 1.02
Igf1 0.35 0.71 0.76 0.64
could be served as a mediator of necrotic cell death. The Bcl2 is a well
known proto-oncogene preventing apoptotic cell death induced by var-
ious treatments; however, Bcl2 also exerts anti-necrotic cell death in-
duced by KCN indicating that Bcl2 is a common mediator in both cell
death pathways (Tsujimoto et al., 1997). Igf1 plays an important role
in development. Igf1 acts at the level of mitochondria to mediate its
anti-apoptotic stimuli through an increased expression of Bcl2 (Hilmi
et al., 2008). Integrins are essential for cell survival, and alterations in
the expression of integrins and their ligands regulate cell death in a
ligand-dependent manner (Stupack, 2005). Therefore, dysregulation
of the circuitry of Blc2, Igf1, Itgb1, Itga5, and other related molecules
might contribute to the activation of the necrosis pathway, and
NecroX-7 appears as an effective attenuator of necrosis.
Another interesting finding of the present analysis is that NecroX-7
effectively prevented tBHP-induced upregulation of Rac2 and Ncf/
p47phox which was associated with necrosis. Rac2 is an important ac-
tivator of NOX1 and 2 and possibly some other NOX isoforms, and
Ncf1/p47phox is responsible for the assembly of the complex
(Bedard and Krause, 2007). Under stress condition, levels of Rac2
gene and protein are significantly upregulated and NOX is activated
to generate ROS to cause human leukemia HL-60 cell death (Yi et al.,
2010). In addition, NOX-dependent ROS generation is regulated
through transcriptional regulation of the Ncf1/p47phox gene (Berasi
et al., 2004). Therefore, Rac2 and Ncf1/p47phox activities appear to
be regulated at transcriptional level, and they play an important role
for ROS generation and/or oxidative cell death through NOX activa-
tion. Although we identified that NecroX is a mitochondrial ROS/RNS
scavenger (Kim et al., 2010), accumulated lines of evidence indicate
that mitochondria and NOXs might interact for ROS generation. For
example, NOX4 has a mitochondrial targeting signal leading NOX4 lo-
calization into the mitochondria to generate excessive ROS under
stress (Graham et al., 2010). Therefore, tBHP-induced upregulation
of Ncf1/p47phox and Rac2 appears to play an important role of
125
a W.E., Zielonka, J., Srinivasan, S., Avadhani, N.G., Kalyanaraman, B., 2009. Doxorubicin
100
% inhibition of NOX
modulation of NOX activity in part.
Ratio NOX activity assay supports this hypothesis by demonstrating that
NecroX-7 could inhibit NOX activity comparable to DPI. DPI is a well
tBHP/(tBHP+NecroX-7)
characterized NOX2/gp91phox inhibitor and a recent study revealed
Microarray qRT-PCR
that DPI significantly inhibited NOX-dependent ROS production in
4.02 1.93 the mitochondrial fraction (Ago et al., 2010). Interestingly, concur-
2.17 1.74
rent treatment of NecroX-7 and DPI increased the inhibitory effect
0.91 0.74
0.46 1.11
against NOX than stand alone treatment, implying that NecroX-7
might have different target in NOX complex like Ncf1/p47phox and
Rac2 identified by global gene expression analysis, resulting in syner-
gic effect on NOX by simultaneous treatment with DPI. Therefore, these
results imply that tBHP-induced upregulation of Ncf1/p47phox and
Rac2 activates NOX complex followed by HMGB1 release and necrosis,
and NecroX-7 might act as a necrosis inhibitor by attenuating these
detrimental pathways.
In conclusion, these findings demonstrate that NecroX-7 provides
substantial protection against cardiomyopathy induced by tBHP or
DOX via NOX-mediated cell death in part, and NecroX-7 may have
clinical implications for the treatment of ischemic cardiomyopathy.
Conflict of interest statement
The authors do not have any conflict of interest to disclose.
Acknowledgment
The authors would like to thank Dr. Dongchul Lim for proof read-
ing the manuscript, Doo-Hee Park and Young Ja Choi for the assess-
ment of in vivo cardioprotective effects.
Reference
Ago, T., Kuroda, J., Pain, J., Fu, C., Li, H., Sadoshima, J., 2010. Upregulation of Nox4 by hy-
pertrophic stimuli promotes apoptosis and mitochondrial dysfunction in cardiac
myocytes. Circ. Res. 106, 1253–1264.
Arola, O.J., Saraste, A., Pulkki, K., Kallajoki, M., Parvinen, M., Voipio-Pulkki, L.M., 2000.
Acute doxorubicin cardiotoxicity involves cardiomyocyte apoptosis. Cancer Res.
60, 1789–1792.
Bedard, K., Krause, K.H., 2007. The NOX family of ROS-generating NADPH oxidases:
physiology and pathophysiology. Physiol. Rev. 87, 245–313.
Bendall, J.K., Cave, A.C., Heymes, C., Gall, N., Shah, A.M., 2002. Pivotal role of a
gp91(phox)-containing NADPH oxidase in angiotensin II-induced cardiac hyper-
trophy in mice. Circulation 105, 293–296.
Berasi, S.P., Xiu, M., Yee, A.S., Paulson, K.E., 2004. HBP1 repression of the p47phox gene:
cell cycle regulation via the NADPH oxidase. Mol. Cell. Biol. 24, 3011–3024.
Brambilla, L., Sestili, P., Guidarelli, A., Palomba, L., Cantoni, O., 1998. Electron transport-
mediated wasteful consumption of NADH promotes the lethal response of U937
cells to tert-butylhydroperoxide. J. Pharmacol. Exp. Ther. 284, 1112–1121.
Cave, A.C., Brewer, A.C., Narayanapanicker, A., Ray, R., Grieve, D.J., Walker, S., Shah,
A.M., 2006. NADPH oxidases in cardiovascular health and disease. Antioxid.
Redox Signal. 8, 691–728.
Chandran, K., Aggarwal, D., Migrino, R.Q., Joseph, J., McAllister, D., Konorev, E.A., Antholine,
inactivates myocardial cytochrome c oxidase in rats: cardioprotection by Mito-Q.

Biophys. J. 96, 1388–1398.

Chatterjee, K., Zhang, J., Honbo, N., Karliner, J.S., 2010. Doxorubicin cardiomyopathy.
75 Cardiology 115, 155–162.
Chen, H.W., Chiang, T., Wang, C.Y., Lii, C.K., 2000. Inhibition of tert-butyl
b hydroperoxide-induced cell membrane bleb formation by alpha-tocopherol and
b glutathione. Food Chem. Toxicol. 38, 1089–1096.
50 Choi, J.M., Park, K.M., Kim, S.H., Hwang, D.W., Chon, S.H., Lee, J.H., Lee, S.Y., Lee, Y.J.,
2010. Effect of necrosis modulator necrox-7 on hepatic ischemia–reperfusion inju-
c ry in beagle dogs. Transplant. Proc. 42, 3414–3421.
25 Festjens, N., Vanden Berghe, T., Vandenabeele, P., 2006. Necrosis, a well-orchestrated
form of cell demise: signalling cascades, important mediators and concomitant im-
mune response. Biochim. Biophys. Acta 1757, 1371–1387.
Graham, K.A., Kulawiec, M., Owens, K.M., Li, X., Desouki, M.M., Chandra, D., Singh, K.K.,
0 2010. NADPH oxidase 4 is an oncoprotein localized to mitochondria. Cancer Biol.
DMSO DPI NecroX-7 DPI + NecroX-7 Ther. 10, 223–231.
Grande, P., Pedersen, A., Schaadt, O., Corfitsen, T., Andersen, B.T., 1980. Cardio-specific
Fig. 3. Inhibition of NOX activity by NecroX-7. NOX activity was determined in the serum enzyme CK‐MB following physical exercise in acute myocardial infarction.
presence of DMSO, DPI (10 μM), NecroX-7 (25 μM), or DPI plus NecroX-7. Triplicate Eur. J. Cardiol. 11, 161–167.
data are presented as % mean inhibitions ± standard deviation. Means labeled with dif- Griendling, K.K., Sorescu, D., Ushio-Fukai, M., 2000. NAD(P)H oxidase: role in cardio-
ferent letters were significantly different at p b 0.05. vascular biology and disease. Circ. Res. 86, 494–501.
6 J. Park et al. / Toxicology and Applied Pharmacology 263 (2012) 1–6
Hilmi, C., Larribere, L., Giuliano, S., Bille, K., Ortonne, J.P., Ballotti, R., Bertolotto, C., 2008.
IGF1 promotes resistance to apoptosis in melanoma cells through an increased ex-
pression of BCL2, BCL-X(L), and survivin. J. Invest. Dermatol. 128, 1499–1505.
Hoglen, N.C., Chen, L.S., Fisher, C.D., Hirakawa, B.P., Groessl, T., Contreras, P.C., 2004.
Characterization of IDN-6556 (3-[2-(2-tert-butyl-phenylaminooxalyl)-amino]-
propionylamino]-4-oxo-5-(2,3,5,6-tetrafluoro-phenoxy)-pentanoic acid): a liver-
targeted caspase inhibitor. J. Pharmacol. Exp. Ther. 309, 634–640.
Ide, T., Tsutsui, H., Hayashidani, S., Kang, D., Suematsu, N., Nakamura, K., Utsumi, H.,
Hamasaki, N., Takeshita, A., 2001. Mitochondrial DNA damage and dysfunction as-
sociated with oxidative stress in failing hearts after myocardial infarction. Circ. Res.
88, 529–535.
Ikegami, E., Fukazawa, R., Kanbe, M., Watanabe, M., Abe, M., Kamisago, M., Hajikano,
M., Katsube, Y., Ogawa, S., 2007. Edaravone, a potent free radical scavenger, pre-
vents anthracycline-induced myocardial cell death. Circ. J. 71, 1815–1820.
Kim, H.J., Koo, S.Y., Ahn, B.H., Park, O., Park, D.H., Seo, D.O., Won, J.H., Yim, H.J., Kwak,
H.S., Park, H.S., Chung, C.W., Oh, Y.L., Kim, S.H., 2010. NecroX as a novel class of mi-
tochondrial reactive oxygen species and ONOO scavenger. Arch. Pharm. Res. 33,
1813–1823.
Kotamraju, S., Konorev, E.A., Joseph, J., Kalyanaraman, B., 2000. Doxorubicin-induced
apoptosis in endothelial cells and cardiomyocytes is ameliorated by nitrone spin
traps and ebselen. Role of reactive oxygen and nitrogen species. J. Biol. Chem.
275, 33585–33592.
Kuroda, J., Ago, T., Matsushima, S., Zhai, P., Schneider, M.D., Sadoshima, J., 2010. NADPH
oxidase 4 (Nox4) is a major source of oxidative stress in the failing heart. Proc.
Natl. Acad. Sci. U. S. A. 107, 15565–15570.
Lambeth, J.D., 2004. NOX enzymes and the biology of reactive oxygen. Nat. Rev.
Immunol. 4, 181–189.
Lambeth, J.D., Kawahara, T., Diebold, B., 2007. Regulation of Nox and Duox enzymatic
activity and expression. Free Radic. Biol. Med. 43, 319–331.
Lee, D.W., Lee, T.K., Cho, I.S., Park, H.E., Jin, S., Cho, H.J., Kim, S.H., Oh, S., Kim, H.S., 2011.
Creation of myocardial fibrosis by transplantation of fibroblasts primed with sur-
vival factors. Am. J. Physiol. Heart Circ. Physiol. 301, H1004–H1014.
Li, J.M., Gall, N.P., Grieve, D.J., Chen, M., Shah, A.M., 2002. Activation of NADPH oxidase
during progression of cardiac hypertrophy to failure. Hypertension 40, 477–484.
Looi, Y.H., Grieve, D.J., Siva, A., Walker, S.J., Anilkumar, N., Cave, A.C., Marber, M.,
Monaghan, M.J., Shah, A.M., 2008. Involvement of Nox2 NADPH oxidase in adverse
cardiac remodeling after myocardial infarction. Hypertension 51, 319–325.
Martinet, W., Schrijvers, D.M., De Meyer, G.R., 2011. Necrotic cell death in atherosclero-
sis. Basic Res. Cardiol. 106, 749–760.
Mukhopadhyay, P., Rajesh, M., Batkai, S., Kashiwaya, Y., Hasko, G., Liaudet, L., Szabo, C., Pacher,
P., 2009. Role of superoxide, nitric oxide, and peroxynitrite in doxorubicin-induced cell
death in vivo and in vitro. Am. J. Physiol. Heart Circ. Physiol. 296, H1466–H1483.
Osman, A.M., Nemnem, M.M., Abou-Bakr, A.A., Nassier, O.A., Khayyal, M.T., 2009. Effect
of methimazole treatment on doxorubicin-induced cardiotoxicity in mice. Food
Chem. Toxicol. 47, 2425–2430.
Reiter, R.J., Tan, D.X., 2003. Melatonin: a novel protective agent against oxidative injury
of the ischemic/reperfused heart. Cardiovasc. Res. 58, 10–19.
Sardao, V.A., Oliveira, P.J., Holy, J., Oliveira, C.R., Wallace, K.B., 2007. Vital imaging of H9c2
myoblasts exposed to tert-butylhydroperoxide—characterization of morphological
features of cell death. BMC Cell Biol. 8, 11.
Stupack, D.G., 2005. Integrins as a distinct subtype of dependence receptors. Cell Death
Differ. 12, 1021–1030.
Syntichaki, P., Tavernarakis, N., 2002. Death by necrosis. Uncontrollable catastrophe, or
is there order behind the chaos? EMBO Rep. 3, 604–609.
Tsujimoto, Y., Shimizu, S., Eguchi, Y., Kamiike, W., Matsuda, H., 1997. Bcl-2 and Bcl-xL
block apoptosis as well as necrosis: possible involvement of common mediators
in apoptotic and necrotic signal transduction pathways. Leukemia 11 (Suppl. 3),
380–382.
Yi, L., Ji, X.X., Tan, H., Lin, M., Tang, Y., Wen, L., Ma, Y.H., Su, Q., 2010. Role of Ras-related
C3 botulinum toxin substrate 2 (Rac2), NADPH oxidase and reactive oxygen spe-
cies in diallyl disulphide-induced apoptosis of human leukaemia HL-60 cells.
Clin. Exp. Pharmacol. Physiol. 37, 1147–1153.
Zhang, Y.W., Shi, J., Li, Y.J., Wei, L., 2009. Cardiomyocyte death in doxorubicin-induced
cardiotoxicity. Arch. Immunol. Ther. Exp. (Warsz.) 57, 435–445.