c Indian Academy of Sciences

RESEARCH NOTE

Pattern of change in histone 3 lysine 9 acetylation and histone

deacetylases in development of zebrafish embryo

YANNING LI, JUNXIA WANG, YING XIE, SHUFENG LIU∗ and YE TIAN

Hebei Key Lab of Laboratory Animal, Hebei Medical University, Shijiazhuang 050017, People’s Republic of China

[Li Y., Wang J., Xie Y., Liu S. and Tian Y. 2014 Pattern of change in histone 3 lysine 9 acetylation and histone deacetylases in development
of zebrafish embryo. J. Genet. 93, 539–544]

Introduction portion of histone proteins (Li et al. 2004). Histone acety-

Histone 3 lysine 9 acetylation (H3K9ac) is involved in devel-
opment of eukaryotic organisms, and ordered H3K9 deacety-
lation and individual histone deacetylase (HDAC) are essen-
tial during embryogenesis. However, the change patterns of
H3K9ac in development of zebrafish (Danio rerio) embryo
have not been reported yet. Although single HDAC has been
studied, the dynamic change of HDAC profile in zebrafish
embryo development is still unclear. In this study, zebrafish
embryos were collected at various times after fertilization
and the level of K9-acetylated H3 (H3K9ac) and the expres-
sion profiles of HDAC1, HDAC3, HDAC4 and HDAC6
were evaluated. The results showed that in zebrafish embryo
development, H3K9ac content significantly decreased, espe-
cially at 48 h postfertilization (hpf). The expression pro-
files of HDAC1, HDAC3, HDAC4 and HDAC6 changed
during embryo development, and, moreover, the change in
HDAC3 expression was opposite to the change in level of
H3K9ac. The level of HDAC3 protein confirmed the expres-
sion changes, indicating that HDAC3 may play a role in
H3K9 deacetylation at 48 hpf. These findings revealed the
change patterns of H3K9ac and HDACs in zebrafish embryo
development, and suggested that H3K9 deacetylation and
HDAC3 might be more important in the middle stages than
other stages of zebrafish embryo development.
Dynamic programmes of gene expression are required
for normal development, and histone modifications as epi-
genetic mechanisms of regulation of gene expression have
been investigated in the last few years (Puppin et al. 2011;
Paradowska et al. 2012). Posttranslational modifications of
histones are emerging as an important step in transcrip-
tional regulation of eukaryotic genes. Particularly important
is acetylation of specific lysine residues in the N-terminal
∗ For correspondence. E-mail: liushf@126.com
Yanning Li and Junxia Wang contributed equally to this work.
lation occurs at lysine residues and at positions that are
conserved in eukaryotes, especially for histones H3 and
H4 (Ekwall 2005). Kratz et al. (2010) found that histone
3 lysine 9 acetylation (H3K9ac) is generally associated
with transcription initiation and unfolded chromatin, thereby
positively influencing gene expression. H3K9ac has been
reported to be enriched in embryonic stem cells and may be
a member of pluripotency (Hezroni et al. 2011). Embryonic
stem cell differentiation and oocyte maturation are accom-
panied by reduced H3K9ac (Krejcí et al. 2009; Huang et al.
2012).
Histone acetylation is regulated by the opposing histone
acetyltransferase (HAT) and histone deacetylase (HDAC)
enzymes. Although histone acetylation is important for tran-
scriptional activation, removal of acetyl groups by HDACs
is equally important for gene transcription regulation (Lin
and Dent 2006). The HDAC superfamily is vast and ancient,
dating back to prokaryotes (Haberland et al. 2009). The
most studied HDACs are HDAC1, HDAC3, HDAC4 and
HDAC6. As HDACs are highly conserved in many organ-
isms, their basic functions can be investigated using less
complex and experimentally tractable model organisms such
as zebrafish (Ekwall 2005; Haberland et al. 2009; Sivasubbu
et al. 2013).
Lin and Dent (2006) reported that ordered H3K9 deacety-
lation and HDACs are required during embryogenesis.
Embryonic development depends on HDAC1, which has
a ubiquitous pattern of synthesis (Pillai et al. 2004; Noël
et al. 2008; Harrison et al. 2011). HDAC3 is essential for
proper development of many body systems (Farooq et al.
2008; Bhaskara et al. 2010; Feng et al. 2011; Sun et al.
2011). Stage-specific expression of HDAC4 is seen during
mouse and zebrafish development (Vega et al. 2004; Zhu
et al. 2012). HDAC6 is a key regulator of cytoskele-
ton, cell migration and cell–cell interactions (Dallavalle
et al. 2012; Liu et al. 2012). Although individual HDACs

Keywords. embryo development; histone 3 lysine 9 acetylation; histone deacetylase; zebrafish.

Journal of Genetics, Vol. 93, No. 2, August 2014 539

 Yanning Li et al.

have been studied in zebrafish, the expression profiles of
HDAC1, HDAC3, HDAC4 and HDAC6 in zebrafish embryo
development and the question of which HDAC plays a
more decisive role in H3K9 deacetylation have not been
clarified.
In this study, zebrafish embryos were collected at 24 hpf,
48 hpf and 72 hpf. The level of H3K9ac and the expres-
sion profiles of HDAC1, HDAC3, HDAC4 and HDAC6
during embryo development were investigated with confo-
cal microscopy, Western blotting and reverse transcription
polymerase chain reaction (RT-PCR).
Materials and methods
Zebrafish
Adult zebrafish were obtained from the Department of Lab-
oratory Animal Sciences, Hebei Medical University, China,
and maintained according to standard husbandry protocols
(Lawrence 2007; Jia et al. 2012). Adult fish were fed brine
shrimp twice daily. Temperature (28±0.5◦ C), pH (7.0±0.5),
and light cycle (14 h light / 10 h dark) were electronically
controlled and remotely monitored. The night before breed-
ing day, a baffle was placed to separate male and female
zebrafish. The following morning, fertilized eggs were har-
vested and incubated in sterile breeding system water at
28◦ C. Embryos were collected at 24, 48 and 72 hpf and used
for further detection.
Laser confocal microscopy detection
Zebrafish embryos were fixed in 4% paraformaldehyde,
washed with phosphate buffer saline (PBS), and incubated
with 1% Triton X-100 for 30 min at room temperature. Then,
after washing with PBS, they were blocked with 10% goat
serum for 1 h and incubated with the primary antibody (anti-
H3K9ac, Cell Signaling Technology, Shanghai, China; anti-
whole HDAC3, GeneTex, Irvine, USA). After again washing
with PBS, the embryos were incubated with the secondary
antibody (FITC-conjugated secondary antibody, Zhongshan,
China) for 30 min at 37◦ C. After incubation with 4 , 6-
diamidino-2-phenylindole (DAPI) for 10 min, the embryos
were placed on a microscope slide and images were taken
with a laser confocal scanning microscope (Olympus, Tokyo,
Japan). Controls (PBS instead of the first antibody) were
used.
Reverse transcription polymerase chain reaction
Levels of mRNA of HDAC1, HDAC3, HDAC4 and HDAC6
were quantified by RT-PCR. Total RNA was isolated using
Trizol reagent (Takara, Dalian, China) and reverse tran-
scribed into cDNA using RevertAid First Strand cDNA syn-
thesis kit (Fermentas, Shenzhen, China), followed by PCR
amplification using specific primers (table 1). PCR condi-
tions were 94◦ C for 5 min, followed by 94◦ C for 30 s, anneal-
ing temperature (table 1) for 30 s, and 72◦ C for 1 min for a
total of 28 cycles, and finally 72◦ C for 5 min. The amplified
DNA was visualized by electrophoresis on 1.5% agarose gel.
Actin primers were used as internal standard.
Western blotting
Levels of histone H3, H3K9ac and HDAC3 were deter-
mined by Western blotting, using the protocol previously
described (Li et al. 2010). Briefly, zebrafish embryos were
lysed in lysis buffer (RIPA, Solarbio, Beijing, China) to
extract whole protein. Protein content was determined by
NanoDrop-1000 (Thermo Scientific, Shanghai, China). Then,
samples were separated by SDS-polyacrylamide gel elec-
trophoresis (PAGE) and transferred to a polyvinylidene flu-
oride membrane (Millipore, Shanghai, China). After the
membrane was blocked with 5% skimmed milk in PBS,
anti-H3 (Cell Signaling Technology, Shanghai, China), anti-
H3K9ac (Cell Signaling Technology), anti-HDAC3 antibod-
ies (GeneTex, Irvine, USA) or anti-beta-actin (Cell Signaling
Technology) were used. Band intensity was quantified and
calculated.

Table 1. Primers used for PCR detection.

Annealing Product
Primers temperature (◦ C) size (bp)

HDAC1: sense 5 TAGCACATAACTTTACTGTCCCATC 3 53 376

Antisense 5 ACAACCACTGAACTCTGGAATAATC 3
HDAC3: sense 5 TCAAGATACACAGGTGCCTCATTAC 3 53 379
Antisense 5 TCTGGTCATCAATGCCATCTCG 3
HDAC4: sense 5 CTCTGCTAAGGAGGAAGGACGGACC 3 55 449
Antisense 5 GAGAGTGTTGTGAGCCGAGCCGC 3
HDAC6: sense 5 GTCCCGTTGTCATCGGATACCAG 3 55 495
Antisense 5 TCCTCTGAGTTTGGGAAGAATGC 3
Actin: sense 5 TTCACCACCACAGCCGAAAGAG 3 55 222
Antisense 5 ACCGCAAGATTCCATACCCAGG 3

540 Journal of Genetics, Vol. 93, No. 2, August 2014

 H3K9ac and HDAC in zebrafish embryo development

Statistical analysis (figure 2). H3K9ac level was significantly lower at 48 hpf
and 72 hpf (P < 0.01), then at 24 hpf (P < 0.05). At 72 hpf,
Statistical analysis of the data was performed using SPSS
H3K9ac was significantly higher (P < 0.05) than at 48 hpf.
software (IBM, Armonk, USA) and the results are presented
The results demonstrate that H3K9ac decreased during
as means ± SD. The experiments were repeated twice. One-
zebrafish embryo development, especially at 48 hpf.
way analysis of variance (ANOVA) was used to find differ-
ences, and multiple comparisons were conducted using Dun-
nett’s test, and significant differences identified at P < 0.05. Expression profile of HDAC genes in zebrafish embryo
development

Expression of HDAC1, HDAC3, HDAC4 and HDAC6 genes

Results
H3K9ac decreased with zebrafish embryo development
H3K9ac was detected by confocal microscopy and quanti-
fied by Western blotting. H3K9ac was widespread through
the embryo at 24 hpf, hardly detected at 48 hpf, and con-
centrated in the tail at 72 hpf (figure 1). The results were
confirmed by Western blotting and the ratio of H3K9AC to
H3 was calculated to reflect the relative level of H3K9ac
was evaluated by RT-PCR (figure 3, A&B). HDAC3 expres-
sion was higher at 48 hpf than at 24 hpf and HDAC1 expres-
sion was significantly lower at 72 hpf (P < 0.05). Expres-
sion of HDAC1 and HDAC3 was lower and that of HDAC6
higher at 72 hpf than at 48 hpf (P < 0.05). The results also
show that HDAC1 expression was high at 24 hpf and 48 hpf,
but decreased at 72 hpf. Expression of HDAC3 increased
at 48 hpf and decreased at 72 hpf. There was little diffe-
rence in HDAC4 expression, and expression of HDAC6

Figure 1. H3K9ac content detected by confocal assay. (A) H3K9ac was widespread
through the embryo at 24 hpf, hardly detected at 48 hpf, and concentrated in the tail at
72 hpf. (B) Negative controls for H3K9ac. No staining was seen in all groups.

Journal of Genetics, Vol. 93, No. 2, August 2014 541

 Yanning Li et al.

Figure 2. H3K9ac content detected by Western blotting. Ratio of

H3K9ac to H3 was calculated to reflect the relative content of
H3K9ac. **P < 0.01 or *P < 0.05 versus 24 hpf; # P < 0.05 versus
48 hpf. Experiments were repeated twice with two samples.

significantly increased at 72 hpf. The differential changes

in expression of HDAC genes indicate their distinct roles
in zebrafish embryo development. Only the changes in
HDAC3 expression were opposite to changes in levels of
H3K9ac.

HDAC3 enzyme level is higher at 48 hpf in zebrafish embryo

The HDAC3 expression results were confirmed by Western

blotting and the ratio of HDAC3 enzyme to actin was cal-
culated to reflect relative content of HDAC3 (figure 3C).
HDAC3 was significantly higher at 48 hpf (P < 0.01) than at
24 hpf, and significantly lower at 72 hpf (P < 0.01) than at
48 hpf. The distribution of HDAC3 was revealed by confo-
cal microscopy. As shown in figure 4, conspicuous HDAC3
expanded through the embryo at 48 hpf, while little HDAC3
was seen at 24 hpf and 72 hpf. The results prove that HDAC3
levels is significantly higher at 48 hpf, in accordance with
expression changes of its gene.

Discussion
Zebrafish is now emerging as a model organism in genetics
and developmental biology research (Chatterjee and Lufkin
2012; Jia et al. 2012; Yang et al. 2013). Histone acetyla-
tion processes and HDACs are conserved among species and
the patterns of changes in them in zebrafish will help clarify
their role in development. H3K9ac levels have been reported
to be high in embryonic stem cells and decrease of H3K9ac
level is closely related to differentiation (Krejcí et al. 2009;
Hezroni et al. 2011). In this study, we found that H3K9ac
content was high at 24 hpf, but hardly detected at 48 hpf
Figure 3. HDAC expression and HDAC3 content. Expressions of
HDAC1, HDAC3, HDAC4 and HDAC6 were evaluated by RT-PCR
(A) and calculated (B). (C) HDAC3 content detected by Western
blotting. Ratio of HDAC3 to actin was calculated to reflect the
relative content of HDAC3. **P < 0.01 or *P < 0.05 versus 24 hpf;
## P < .01 or # P < 0.05 versus 48 hpf. Experiments were repeated
twice.
and significantly decreased at 72 hpf. The results demon-
strated that H3K9ac decreased during zebrafish embryo

542 Journal of Genetics, Vol. 93, No. 2, August 2014

 H3K9ac and HDAC in zebrafish embryo development

Figure 4. HDAC3 content detected by confocal assay. (A) As illustrated, HDAC3

was hardly seen at 24 hpf and 72 hpf, but conspicuously increased at 48 hpf.
(B) Negative controls for HDAC3. No staining was seen in all the groups.

developmental stages and that H3K9 deacetylation might be
more important during the middle stages of zebrafish embryo
development.
Ordered H3K9 deacetylation and HDAC enzymes are
required during embryogenesis (Kageyama et al. 2006; Lin
and Dent 2006).
We have shown here that the expression profiles of
HDAC1, HDAC3, HDAC4 and HDAC6 change differentially
during zebrzfish embryo development, HDAC1 expression
was unaltered at 24 hpf and 48 hpf, but decreased at 72
hpf, indicating its role in early and middle development.
HDAC3 expression increased at 48 hpf but then decreased at
72 hpf. These changes in HDAC3 expression are consistent
with a study of zebrafish heart development, which showed
that the heart starts development at 36 hpf and is com-
pleted around 55 hpf (Kim et al. 2012). Zebrafish HDAC4
has been reported to be ubiquitously distributed in various
tissues (Zhu et al. 2012), the present study, revealed
no significant change in HDAC4 expression during the
developmental stages. HDAC6 expression increased
markedly at 72 hpf, suggesting its role in late development.
These data reveal the patterns of changes of expression of
HDACs genes in zebrafish embryo development. Only the
changes in HDAC3 expression were opposite to changes
in level of H3K9ac. Levels of HDAC3 enzyme confirmed
the expression changes, indicating a more decisive role of
HDAC3 in H3K9 deacetylation.
In conclusion, the pattern of changes of H3K9ac and
HDACs in zebrafish embryo development have been shown,
and the results suggest that HDAC3 might be more impor-
tant in the middle stages of zebrafish embryo middle
development.
Acknowledgements
This work was supported by the Research and Development Pro-
gram of Hebei (11277160) and the Construction Program of Hebei
Scientific Conditions (11965519D and 12965519D).

Journal of Genetics, Vol. 93, No. 2, August 2014 543

 Yanning Li et al.
References
Bhaskara S., Knutson S. K., Jiang G., Chandrasekharan M. B.,
Wilson A. J., Zheng S. et al. 2010 Hdac3 is essential for the main-
tenance of chromatin structure and genome stability. Cancer Cell
18, 436–447.
Chatterjee S. and Lufkin T. 2012 Regulatory genomics: Insights
from the zebrafish. Curr. Top. Genet. 5, 1–10.
Dallavalle S., Pisano C. and Zunino F. 2012 Development and ther-
apeutic impact of HDAC6-selective inhibitors. Biochem. Phar-
macol. 84, 756–765.
Ekwall K. 2005 Genome-wide analysis of HDAC function. Trends
Genet. 21, 608–615.
Farooq M., Sulochana K. N., Pan X., To J., Sheng D., Gong Z.
et al. 2008 Histone deacetylase 3 (hdac3) is specifically required
for liver development in zebrafish. Dev. Biol. 317, 336–353.
Feng D., Liu T., Sun Z., Bugge A., Mullican S. E., Alenghat T.
et al. 2011 A circadian rhythm orchestrated by histone deacety-
lase 3 controls hepatic lipid metabolism. Science 331, 1315–
1319.
Haberland M., Montgomery R. L. and Olson E. N. 2009 The many
roles of histone deacetylases in development and physiology:
implications for disease and therapy. Nat. Rev. Genet. 10, 32–42.
Harrison M. R., Georgiou A. S., Spaink H. P. and Cunliffe V. T. 2011
The epigenetic regulator histone deacetylase 1 promotes tran-
scription of a core neurogenic programme in zebrafish embryos.
BMC Genomics 12, 24.
Hezroni H., Tzchori I., Davidi A., Mattout A., Biran A., Nissim-
Rafinia M. et al. 2011 H3K9 histone acetylation predicts pluripo-
tency and reprogramming capacity of ES cells. Nucleus 2, 300–
309.
Huang J., Li T., Ding C. H., Brosens J., Zhou C. Q., Wang H. H.
et al. 2012 Insufficient histone-3 lysine-9 deacetylation in human
oocytes matured in vitro is associated with aberrant meiosis.
Fertil. Steril. 97, 178–184.
Jia S., Dai F., Wu D., Lin X., Xing C., Xue Y. et al. 2012 Protein
phosphatase 4 cooperates with Smads to promote BMP signal-
ing in dorsoventral patterning of zebrafish embryos. Dev. Cell 22,
1065–1078.
Kageyama S., Liu H., Nagata M. and Aoki F. 2006 Stage specific
expression of histone deacetylase 4 (HDAC4) during oogenesis
and early preimplantation development in mice. J. Reprod. Dev.
52, 99–106.
Kim Y. S., Kim M. J., Koo T. H., Kim J. D., Koun S., Ham H. J. et al.
2012 Histone deacetylase is required for the activation of Wnt/β-
catenin signaling crucial for heart valve formation in zebrafish
embryos. Biochem. Biophys. Res. Commun. 423, 140–146.
Kratz A., Arner E., Saito R., Kubosaki A., Kawai J., Suzuki H. et al.
2010 Core promoter structure and genomic context reflect histone
3 lysine 9 acetylation patterns. BMC Genomics 11, 257.
Received 7 March 2014, in revised form 17 April 2014; accepted 23 April 2014
Published online: 11 August 2014
544 Journal of Genetics, Vol. 93, No. 2, August 2014
Krejcí J., Uhlírová R., Galiová G., Kozubek S., Smigová J.
and Bártová E. 2009 Genome-wide reduction in H3K9 acetyla-
tion during human embryonic stem cell differentiation. J. Cell.
Physiol. 219, 677–687.
Lawrence C. 2007 The husbandry of zebrafish (Danio rerio): A
review. Aquaculture 269, 1–20.
Li J., Staver M. J., Curtin M. L., Holms J. H., Frey R. R., Edalji
R. et al. 2004 Expression and functional characterization of
recombinant human HDAC1 and HDAC3. Life Sci. 74, 2693–
2705.
Li Y., Qi J., Liu K., Li B., Wang H. and Jia J. 2010 Peroxynitrite-
induced nitration of cyclooxygenase-2 and inducible nitric oxide
synthase promotes their binding in diabetic angiopathy. Mol.
Med. 16, 335–342.
Lin W. and Dent S. Y. 2006 Functions of histone-modifying
enzymes in development. Curr. Opin. Genet. Dev. 16, 137–142.
Liu Y., Peng L., Seto E., Huang S. and Qiu Y. 2012 Modula-
tion of histone deacetylase 6 (HDAC6) nuclear import and tubu-
lin deacetylase activity through acetylation. J. Biol. Chem. 287,
29168–29174.
Noël E. S., Casal-Sueiro A., Busch-Nentwich E., Verkade H., Dong
P. D., Stemple D. L. et al. 2008 Organ-specific requirements for
Hdac1 in liver and pancreas formation. Dev. Biol. 322, 237–250.
Paradowska A. S., Miller D., Spiess A. N., Vieweg M., Cerna M.,
Dvorakova-Hortova K. et al. 2012 Genome wide identification of
promoter binding sites for H4K12ac in human sperm and its rel-
evance for early embryonic development. Epigenetics 7, 1057–
1070.
Pillai R., Coverdale L. E., Dubey G. and Martin C. C. 2004 Histone
deacetylase 1 (HDAC-1) required for the normal formation of
craniofacial cartilage and pectoral fins of the zebrafish. Dev. Dyn.
231, 647–654.
Puppin C., Passon N., Lavarone E., Di Loreto C., Frasca F., Vella
V. et al. 2011 Levels of histone acetylation in thyroid tumors.
Biochem. Biophys. Res. Commun. 411, 679–683.
Sivasubbu S., Sachidanandan C. and Scaria V. 2013 Time for the
zebrafish ENCODE. J. Genet. 92, 695–701.
Sun Z., Singh N., Mullican S.E., Everett L.J., Li L., Yuan L. et al.
2011 Diet-induced lethality due to deletion of the Hdac3 gene in
heart and skeletal muscle. J. Biol. Chem. 286, 33301–33309.
Vega R. B., Matsuda K., Oh J., Barbosa A. C., Yang X., Meadows E.
et al. 2004 Histone deacetylase 4 controls chondrocyte hypertro-
phy during skeletogenesis. Cell 119, 555–566.
Yang J., Zeng Z., Wei J., Jiang L., Ma Q., Wu M. et al. 2013 Semad4
is required for the development of the hindbrain boundary and
skeletal muscle in zebrafish. Biochem. Biophys. Res. Commun.
433, 213–219.
Zhu K., Wang H., Gul Y., Zhao Y., Wang W., Liu S. et al. 2012
Expression characterization and the promoter activity analysis of
zebrafish hdac4. Fish Physiol. Biochem. 38, 585–593.