micromachines
Article
Syngas Fermentation to Acetate and Ethanol with Adaptative
Electroactive Carboxydotrophs in Single Chambered Microbial
Electrochemical System
Athmakuri Tharak 1,2 and S. Venkata Mohan 1,2, *
Citation: Tharak, A.; Mohan,
S.V. Syngas Fermentation to Acetate
and Ethanol with Adaptative
Electroactive Carboxydotrophs in
Single Chambered Microbial
Electrochemical System.
Micromachines 2022, 13, 980.
https://doi.org/10.3390/
mi13070980
Academic Editors: Jesús
Rodríguez Ruiz, Jonas Gurauskis
and Simonetta Palmas
Received: 31 March 2022
Accepted: 17 June 2022
Published: 21 June 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Micromachines 2022, 13, 980. https://doi.org/10.3390/mi13070980
1 Bioengineering and Environmental Science Lab, Department of Energy and Environmental Engineering,
CSIR-Indian Institute of Chemical Technology (CSIR-IICT), Hyderabad 500007, India;
tharakathmakuri527@gmail.com
2 Academy of Scientific & Innovative Research (AcSIR), Ghaziabad 201002, India
* Correspondence: svmohan@iict.res.in or vmohan_s@yahoo.com
Abstract: Microbial electrosynthesis system (MES; single-chambered) was fabricated and evaluated
with carbon cloth/graphite as a working/counter electrode employing an enriched microbiome.
Continuous syngas sparging (at working electrode; WE) enabled the growth of endo electrogenic
bacteria by availing the inorganic carbon source. Applied potential (−0.5 V) on the working elec-
trode facilitated the reduction in syngas, leading to the synthesis of fatty acids and alcohols. The
higher acetic acid titer of 3.8 g/L and ethanol concentration of 0.2 g/L was observed at an active
microbial metabolic state, evidencing the shift in metabolism from acetogenic to solventogenesis.
Voltammograms evidenced distinct redox species with low charge transfer resistance (Rct ; Nyquist
impedance). Reductive catalytic current (−0.02 mA) enabled the charge transfer efficiency of the
cathodes favoring syngas conversion to products. The surface morphology of carbon cloth and
system-designed conditions favored the growth of electrochemically active consortia. Metagenomic
analysis revealed the enrichment of phylum/class with Actinobacteria, Firmicutes/Clostridia and
Bacilli, which accounts for the syngas fermentation through suitable gene loci.
Keywords: microbial fuel cell; electro/gas fermentation; DNA library; 16S V3–V4 amplicon;
electro kinetics
1. Introduction
Climate change issues, biosphere alteration and biodiversity loss are some of the criti-
cal challenges [1–4]. Some industrial activities release synthesis gas composed of carbon
monoxide (CO), carbon dioxide (CO2 ) and hydrogen (H2 ) in different fractions [5–8]. Varies
conventional strategies such as capture and storage are employed to mitigate the green-
house gas (GHG) emissions [3,8–10]. Microbial mediated process of carbon sequestration,
which is considered a potential strategy, can also play a crucial role in this regard [11,12].
Syngas fermentation through the Wood–Ljungdahl pathway (WLP) owned microbes con-
tributes to the synthesis of short-chain carboxylic acids [9,13] and can sustain the toxic
effects of CO [14]. However, desired product synthesis from the crude syngas fermenta-
tion is still challenging [15–17]. Slow fermentation rates, difficulty in threshold barrier
breakdown, inconsistency in metabolic action of biocatalyst, restricted efficiency of WLP at
higher CO concentrations and slow gas–liquid mass transfer due to the low solubility of CO
are some of the limitations to the syngas fermentation [18,19]. Microbial electrochemical
systems (MESs) mediated syngas conversion facilitates electrochemically assisted fermenta-
tion for the synthesis of metabolic products from gaseous feedstock [19,20]. Integration of
inert conductive material (electrode) and electric poised conditions can augment additional
gas conversion rates in the gas electro fermentation [14,20].
Several acetogenic and solventogenic carboxydotrophs utilize the C1 fraction of the
syngas and produce metabolites (acetate and ethanol) [5,18]. As fermentation is influenced
https://www.mdpi.com/journal/micromachines
Micromachines 2022, 13, x FOR PEER REVIEW 2 of 18

Micromachines 2022, 13, 980 2 of 17

Several acetogenic and solventogenic carboxydotrophs utilize the C1 fraction of the
syngas and produce metabolites (acetate and ethanol) [5,18]. As fermentation is influenced
by
bythe
theactivity
activityofofmicrobes,
microbes,selection
selectionandandadaptation
adaptation of of
thethe
suitable biocatalyst
suitable is aiscritical
biocatalyst a crit-
factor. Gas phased
ical factor. electrofermentation
Gas phased with adequate
electrofermentation biocatalyst
with adequate activity provides
biocatalyst feasibil-
activity provides
ity to the syngas
feasibility to thefermentation with the with
syngas fermentation synthesis of the value-added
the synthesis compounds.
of the value-added Adapta-
compounds.
tion of the biocatalyst
Adaptation to the electrode-circuit
of the biocatalyst environmentenvironment
to the electrode-circuit is one major factor that
is one influences
major factor
syngas electrofermentation.
that influences The current study The
syngas electrofermentation. was current
designedstudyto evaluate the single-cham-
was designed to evalu-
ate the
bered single-chambered
system system for syngas
for syngas transformations transformations
to metabolites, to metabolites,
specifically specifically
using syngas-enriched
using syngas-enriched
cultures cultures as gaseous
as biocatalysts. Continuous biocatalysts.
feedingContinuous gaseous feeding
with semi-continuous modewith semi-
operation
continuous
was employed. mode operationefficiency
Fermentation was employed. Fermentation
was assessed efficiency
with biological was assessed with
and bioelectrochemical
biological and
parameters bioelectrochemical
as well parameters
as product formation. The as well
fate of as
theproduct
inorganic formation. The fatein
carbon fraction ofthe
the
inorganic
syngas wascarbon
tracedfraction in the for
and depicted syngas was traced abilities
the conversion and depicted
of thefor the conversion abilities
system.
of the system.
2. Materials and Methods
2. Materials and Methods
2.1. Design and Fabrication of MES
2.1. Design and Fabrication of MES
Single-chambered microbial electrosynthesis system (electrofermentation) was de-
Single-chambered microbial electrosynthesis system (electrofermentation) was de-
signed and fabricated with electrodes (inert) as the primary components (Figure 1). A
signed and fabricated with electrodes (inert) as the primary components (Figure 1). A screw
screw cap glass bottle (Borosilicate ®, Mumbai, India) was used with a working/total vol-
cap glass bottle (Borosilicate® , Mumbai, India) was used with a working/total volume of
ume of 85/100 mL. Three electrodes in the system were arranged by using a butyl rubber
85/100 mL. Three electrodes in the system were arranged by using a butyl rubber stop-
stopper. The graphite plate (surface area 282cm2; counter electrode, CE) was placed verti-
per. The graphite plate (surface area 28 cm ; counter electrode, CE) was placed vertically
cally through
through the rubber
the rubber stopper.
stopper. Ag/AgCl
Ag/AgCl (3.5
(3.5 MM KCl)and
KCl) andcarbon
carboncloth
cloth(CC;
(CC; 36
36 cm
cm2)) were
2
were
employed
employed as as aa reference,
reference, and
and working
working electrodes
electrodes were
were situated
situated perpendicularly
perpendicularly to to CE
CE
through
through the the lateral
lateral port
port of
of the
the system.
system. Both
Boththetheworking
workingand and reference
reference electrodes
electrodes werewere
situated
situatedat at~1.5
~1.5cm cmdistance.
distance.

Diagrammaticrepresentation
Figure1.1.Diagrammatic
Figure representationof
ofthe
thesingle-chambered
single-chambered MES.
MES.

2.2. Microbiome, Electrolyte and Feed Stock

2.2. Microbiome, Electrolyte and Feed Stock
Selectively enriched carboxydotrophic microbiome from the previously operated lab-
scaleSelectively enrichedwas
C1 gas fermenter carboxydotrophic microbiome
used as seed culture in thefrom
MESthe
[3].previously operated
Culture (10%; v/v) lab-
was
scale C1 gas fermenter was used as seed culture in the MES [3]. Culture
inoculated prior to the experimental operation. Phosphate buffer (0.1 M; pH 7.0(10%; v/v) was
± 0.02)
inoculated
was used as prior
the to the experimental
electrolyte. Gaseousoperation.
feedstock Phosphate
(Syngas) ofbuffer (0.1 M; CO
composition pH (35%),
7.0 ± 0.02)
CO2
(30%), H2 (20%) and N2 (13.3%) were sparged into the system as an inorganic carbon source
during experimental operation.
 was used as the electrolyte. Gaseous feedstock (Syngas) of composition CO (35%), CO2
(30%), H2 (20%) and N2 (13.3%) were sparged into the system as an inorganic carbon
Micromachines 2022, 13, 980source during experimental operation. 3 of 17

2.3. System Operation

2.3. System
Selected Operation
consortia were adapted to the polarized environment by poising the poten-
tial (−0.5 V) on electrodes.
Selected After
consortia werefour feed replacements,
adapted to the polarized attachment
environment of by
cellpoising
was observed
the potential
on carbon (−0.5 V) electrodes
cloth on electrodes. After fourbiofilm
by forming feed replacements, attachment
(Figure 2), which of cell
was also was observed
observed with on
the naked carbon clothformation
eye. The electrodesofby forming
biofilm onbiofilm (Figure
the surface 2), which
of the was and
electrodes also the
observed
growthwith
of the
the suspension cells increases the turbidity of the electrolyte, which can be considered as of
naked eye. The formation of biofilm on the surface of the electrodes and the growth
the suspension
the adaptation cells increases
of the inoculated the turbidity
biocatalyst of the electrolyte,
in the polarised environment.whichAfter
can be
theconsidered
adap-
tation, carbon cloth was used as a working electrode in the single-chambered MES. After
as the adaptation of the inoculated biocatalyst in the polarised environment. Fur- the
adaptation, carbon cloth was used as a working electrode in the single-chambered MES.
ther MES was operated by poising the potential (−0.5 V) on the working electrode against
Further MES was operated by poising the potential (−0.5 V) on the working electrode
the reference electrode. In order to ensure and assist the growth of biocatalyst, semi-con-
against the reference electrode. In order to ensure and assist the growth of biocatalyst, semi-
tinuous batch mode operation with continuous syngas feeding at a rate of 0.3 standard
continuous batch mode operation with continuous syngas feeding at a rate of 0.3 standard
cubic centimeter per minute
cubic centimeter (sccm) (sccm)
per minute was employed.
was employed. Syngas feeding
Syngas was performed
feeding was performednearnear
the interspace of the working electrode for effective availability of the inorganic
the interspace of the working electrode for effective availability of the inorganic carbon carbon to to
the culture. MES was
the culture. operated
MES for a total
was operated for aoftotal
6 cycles with 96
of 6 cycles h of
with 96retention time.time.
h of retention

(a) (b)

(c) (d)

Figure 2. Figure
SEM images
2. SEM representing the working
images representing the electrode morphology
working electrode (Carbon (Carbon
morphology clothe) before
clothe)op-
before
eration (abiotic): (a) ×100 and (b) ×500; after operation (biofilm): (c) ×250 and (d) ×500.
operation (abiotic): (a) ×100 and (b) ×500; after operation (biofilm): (c) ×250 and (d) ×500.

2.4. Performance
2.4. Performance AnalysisAnalysis
Fermentation
Fermentation efficiency
efficiency of MESofwas
MES was monitored
monitored in terms
in terms of metabolic
of metabolic process
process parame-
param-
ters such as pH and volatile fatty acids (VFA) by sampling electrolytes once in
eters such as pH and volatile fatty acids (VFA) by sampling electrolytes once in 24 h. The 24 h. The
pH of the electrolyte was evaluated using the pH meter (Hanna Instruments, Woonsocket,
RI, USA), and the fermentation product (VFA) profile was assessed with high-performance
liquid chromatography (HPLC) system (Shimadzu LC20A, Santa Clara, CA, USA) with a
Micromachines 2022, 13, 980 4 of 17

refractive index detector (RID20A; Shimadzu, Santa Clara, CA, USA) employing RezexTM
RHM-Monosaccharide H+ column (Phenomenex, Kondapur, India). Samples were di-
luted and subjected to filtration (0.2 micron) prior to HPLC analysis. Elution at a rate of
0.5 mL/min in isocratic mode was employed by using ultrapure water as the eluent (mobile
phase) with 20 µL of injected sample volume [3,10].
The growth of the culture in the electrolyte was measured by using a UV-visible
spectrophotometer (Jasco V-750, Europe, Cremella, Italy) at optical density (OD600nm ). The
surface morphology of the carbon cloth (WE) was studied before and after the experiments
using the FE190 SEM (JOEL, JSM-7610F, Tokyo, Japan) with a voltage range of 1 to 15 kV. The
gold coating was performed on the sample stub before the SEM analysis for better visibility.

2.5. Electrochemical Characteristics

MES was connected to the potentiostat (EC-lab, Biologic VMP3, Seyssinet-Pariset,
France) with a continuous poising of −0.5 V on the WE (vs. Ag/AgCl). The electrochemical
response of the biocatalyst was evaluated through electrochemical techniques such as cyclic
voltammetry (CV), chrono amperometry (CA), differential pulse voltammetry (DPV) and
electrochemical impedance spectroscopy (EIS). CVc and LSV were performed with a scan
rate of 10 mV/s within the potential stretch of 0.8 to −1.0 V. Differential pulse voltammetry
was drawn at 1st and 4th days of operation with starting potential of −1.0 V to limit
potential 0.8 V followed by reverse scan to −1.0 V. A pulse height of 2.5 mV and a width of
100 mV was maintained with step height and step time of 5 mV and 500 ms, respectively.
EIS measurements were conducted at the end of the experiment in the frequency range of
100 kHz to 100 mHz with the voltage amplitude of 10 mV in the open-circuit voltage (OCV)
state of the system.

2.6. Substrate Fixation and Conversion

Fermentation efficiency of the biocatalyst was interpreted by the inorganic carbon
fixation rate (ICFR; mg·L−1 ·h−1 ) and conversion efficiency of inorganic carbon (CEIC; %)
to the respective fermentation products [21] using the Equations (1) and (2).

M1 − M0
ICFR = × 103 (1)
t1 − t0

(M1 − M0) × V
CEIC = × 100% (2)
Mc
αc × qv × (t1 − t0) × 60 × 10−3
Vm
where M1 is the mass volume of fermentation products (TOC; g·L−1 ) at t1 (h) and M0 is
the mass volume of fermentation products (g·L−1 ) at t0 (h). V represents the volume of
fermentation broth (0.085 L), MC is the relative molecular mass of carbon (12.01), αc is the
proportion of carbon-containing gas (65% in syngas), qv is the gas flow rate (0.3 sccm), 60 is
the gas flow rate change from minutes to hours, and Vm is the molar volume of gas at
standard temperature and pressure (22.4 L·mol−1 ).

2.7. Metagenomic Analysis

Microbial community analysis was performed by extracting the genomic DNA of
the system according to the manufacturer’s protocols (DNeasy PowerSoil Pro Kit, QIA-
GEN, Germantown, MD, USA). Extracted DNA quality and concentration were checked
by using the nano drop spectrophotometer (Thermo Scientific™, Waltham, MA, USA).
Libraries of the extracted genomic DNA were performed using the Qubit DNA HS As-
say Kit (Invitrogen, Carlsbad, CA, USA), and the size of the prepared library by DNA
was estimated through 1000 Screen Tapes (Tapestation, Agilent, Santa Clara, CA, USA).
V3–V4 regions of 16S rRNA sequence were synthesized by using the V3 forward and V4 re-
verse primers (P7 adapter read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;
 (Invitrogen, Carlsbad, CA, USA), and the size of the prepared library by DNA was esti-
mated through 1000 Screen Tapes (Tapestation, Agilent, Santa Clara, CA, USA). V3–V4
regions of 16S rRNA sequence were synthesized by using the V3 forward and V4 reverse
primers (P7 adapter read1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; P5
Micromachines 2022, 13, 980 5 of 17
adapter read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT). The 16S sequenc-
ing amplicon was performed by illumine Miseq 300PE plot form (Life cell International
Pvt Ltd., Chennai, India). Raw sequences obtained were subjected to the FASTQC and
P5 adapter read2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT). The 16S sequenc-
Multi QC software (Version 0.11.9) for quality checks. High-quality reads were obtained
ing amplicon was performed by illumine Miseq 300PE plot form (Life cell International Pvt
by trimming the sequences by Trimgalore v0.6.7 with standard parameters. Filtered con-
Ltd., Chennai, India). Raw sequences obtained were subjected to the FASTQC and Multi
tigs with more than
QC software 300 bp0.11.9)
(Version were for
clustered
quality into the High-quality
checks. operational taxonomical units (OTUs)
reads were obtained by trim-
basedming
on the
the sequences by Trimgalore v0.6.7 with standard parameters. Filteredtocontigs
GREENGENE v.13.8-99. The abundance of OTUs was estimated check the
with
diversity
moreofthan
the microbial
300 bp werepopulation.
clustered into the operational taxonomical units (OTUs) based on
the GREENGENE v.13.8-99. The abundance of OTUs was estimated to check the diversity
3. Results
of the microbial population.
3.1. Productivity and Composition of Fermentation Products
3. Results
Metabolic fermentation
3.1. Productivity productofmonitoring
and Composition FermentationatProducts
regular intervals of time revealed the
activity of the biocatalyst. Acetate production was observed after 30 h of operation during
Metabolic fermentation product monitoring at regular intervals of time revealed the
the initial batch, which persisted (0.3 ± 0.06 g/L) and increased until the end of the cycle
activity of the biocatalyst. Acetate production was observed after 30 h of operation during
period (Figure 3a). The observed initial lag phase in the acetate production might be due
the initial batch, which persisted (0.3 ± 0.06 g/L) and increased until the end of the cycle
to theperiod
time required
(Figure 3a). forThetheobserved
adaptability oflag
initial thephase
biocatalyst to the production
in the acetate redox environment
might be due in
MES. to Enhancement in the biosynthesis of acetate was seen from the third
the time required for the adaptability of the biocatalyst to the redox environment in day (first cycle)
onwardsMES. and reached maximum
Enhancement titer (0.7 ± 0.02
in the biosynthesis g/L; 96
of acetate h).seen
was Microbial
from thesynthesis
third dayof the
(firstacetic
cycle)
acid correlates
onwards and withreached
the growthmaximum of thetiter
mixed(0.7cultures as it96
± 0.02 g/L; canh).utilize the acetyl-CoA
Microbial synthesis ofre- the
duction pathway
acetic for theirwith
acid correlates reductive metabolism.
the growth Electrolyte
of the mixed culturesreplacement at a the
as it can utilize specific time
acetyl-CoA
interval favoredpathway
reduction the growth of thereductive
for their electroactive bacteriaElectrolyte
metabolism. and facilitated an increase
replacement in the
at a specific
time interval
metabolic rates that favored
resembledthe growth of the electroactive
the biosynthesis bacteria
of the syngas and facilitated
fermentation an increase
products. Ace-in
theofmetabolic
tic acid 0.9 ± 0.02rates that resembled
g/L was produced in thethe
biosynthesis of the
second cycle, syngas
which fermentation
reached a maximum products.
of
Acetic acid of 0.9 ± 0.02 g/L was produced in the second cycle, which
3.82 ± 0.4 g/L during the sixth cycle with a linear increment in the number of cycles oper- reached a maximum
ated (3rd 1.3;±4th
of 3.82 0.42.3;
g/Land during the g/L).
5th 3.1 sixth Cumulative
cycle with a (volumetric)
linear increment in the number
productivity of cycles
of acetate (1
operated (3rd
± 0.02 g·L ·day ) suggested
−1 −1 1.3; 4th 2.3; and 5th 3.1 g/L). Cumulative (volumetric) productivity
the stabilized fermentation of the biocatalyst, which also in- of acetate
(1 ± 0.02 g·L−1 ·day−1 ) suggested the stabilized fermentation of the biocatalyst, which
fluences the syngas conversions (Figure 3a). Though there were linear and steady incre-
also influences the syngas conversions (Figure 3a). Though there were linear and steady
ment metabolite concentrations, retention time was maintained at 96 h to overcome the
increment metabolite concentrations, retention time was maintained at 96 h to overcome
potential of MES due to syngas causing an imbalance of the electron flux and sink.
the potential of MES due to syngas causing an imbalance of the electron flux and sink.

(a) (b)
4.5 8.0 2.0
4.0 MES MES
3.5 7.5 pH
Fermented products (g/L)

Acetic acid 1.6

3.0 Biomas
Optical density (OD)
Ethanol
2.5
7.0
2.0 1.2
1.5
pH

1.0 6.5
0.5 0.8

0.2 6.0
0.4
0.1 5.5

0.0 0.0
5.0
0 4 8 12 16 20 24 0 4 8 12 16 20 24

Time (Days) Time (Days)

FigureFigure
3. (a) 3.
Profile of the
(a) Profile of fermentation metabolites
the fermentation metabolitesacetate
acetateand
and ethanol; (b)pH
ethanol; (b) pHofofthe
the electrolyte
electrolyte and
and biomass
biomassgrowth
growthwith
withfunction
function days operated.
days operated.

An increase in the acidic charged product concentration in the electrolyte tends to

imbalance the ionic transport of bacterial cell membrane, leading to cell lysis [21]. In the
process of self-defense metabolism, electroactive bacteria transform the acidic charged fer-
mentation products (acetate) into the neutrally charged fermentation products (aldehydes
and alcohols) [19,21]. Similar to acetic acid, ethanol production followed steady increments
Micromachines 2022, 13, 980 6 of 17

after the second cycle and attained a peak during the sixth cycle (0.23 ± 0.04 g/L). As a
result of the shift in the metabolism, in addition to acetic acid, ethanol production was also
observed in the second cycle of operation. A relatively slow phase of ethanol synthesis
was observed due to the time lap to reach the threshold accumulation of primary products
(acetate). Cumulative (volumetric) ethanol production of 0.08 g·L−1 ·day−1 was depicted
during operation. A stable maximum product titer of acetate and ethanol might indicate
the adaptation of the electroactive consortia in MES. Stoichiometry of Wood–Ljungdahl
pathway for syngas to acetate and ethanol is depicted in Equations (3) and (4) [21,22].

4CO + 2H2 O + 2CO2 + 4H2 → 2CH3 COOH + 2CO2 + 2H2 O (3)

6CO + 3H2 O + 2CO2 + 6H2 → 2CH3 CH2 OH + 4CO2 + 3H2 O (4)

3.2. Biomass and pH

Initially maintained neutral pH of the electrolyte turned to slightly acidic pH upon
experimental operation. The shift in the pH of the medium might be due to the accumula-
tion of synthesized acetate and the acidic nature of sparged gas (CO2 ). Overall maximum
pH drop (5.0 ± 0.2) was observed from the fifth cycle onwards (Figure 3b). However,
irregularity in the pH profiles was noticed with sharp increased and decreased trends,
which might be regulated by the water gas shift of the syngas and conversion of the acids
into the alcohols in solventogenic phase. Biomass of culture at the point of inoculation
was maintained at an OD of 0.5 (active log phase). A reduction in biomass growth was
depicted in the first cycle of operation (Figure 3b). The reduction trend of biomass growth
in initial cycles might be due to the adaptation to syngas-induced inhibitory effect and
acidic fermentation product accumulation. Similar kinds of observations were reported
in other studies [12,21]. Unlike acetogenic activity, solventogenic metabolism by the car-
boxydotrophs favors the biomass growth by converting the acid-charged molecules into
neutral-charged compounds [21]. Growth of the biomass increased after ethanol pro-
duction, indicating the start of solventogenic metabolism that facilitated conversion to
aldehydes and finally to alcohols. The growth of the biocatalyst in the solventogenic phase
was evidenced by the change in the morphology (appearance of microbial adherence) of
the working electrode before and after operations (Figure 2). The attachment of biofilm on
carbon cloth also depicted the system adaptation and performance.

3.3. Fixation and Conversion Efficiencies

Continuous syngas feeding to the MES enhances the growth and metabolism of the
gas-feeding carboxydotrophs. As the biomass growth and concentration of the aceto-
genic/solventogenic metabolic products increased with the number of cycles operated, the
fixation rate of the inorganic carbon was also enhanced. ICFR with the given syngas (35%
CO and 30% CO2 ) becomes fixed by the electrochemically active carboxydotrophs through
the acetyl-CoA reduction pathway and is ultimately reduced to acetate and alcohols. ICFR
of 17 mg·L−1 ·h−1 was observed in the first cycle, and it was followed by progressive
increments with addon fixated inorganic carbon (Figure 4). A 25 and 27 mg·L−1 ·h−1 of
ICFR was observed in the second and third cycles, respectively, revealing the enrichment
and adaptation to the reduced poised potential microenvironments. Higher ICFR was
observed in the sixth cycle (86 mg·L−1 ·h−1 ) with significant increment in the preceding
cycles (49/74 mg·L−1 ·h−1 ; 4th/5th cycle). Continuous water and gas interaction in the
electrolytes leads to a shift between gas and water, enabling the intake of gaseous feedstock
into the cell prior to becoming fixed to acetyl-CoA in WLP. CEIC in the reduced electro-
environment was 59% (excluding inorganic carbon fixated for biomass growth) towards
the fermentation products (Figure 4). The continuous flow rate of the syngas facilitated
efficient substrate availability. Higher dissipation of inorganic carbons (CO/CO2 ) in the
electrolyte assists the conversion efficiencies of the electroactive biocatalyst.

Micromachines 2022, 13, 980
a shift between gas and water, enabling the intake of gaseous feedstock into the cell prior
to becoming fixed to acetyl-CoA in WLP. CEIC in the reduced electro-environment was
59% (excluding inorganic carbon fixated for biomass growth) towards the fermentation
products (Figure 4). The continuous flow rate of the syngas facilitated efficient substrate
availability. Higher dissipation of inorganic carbons (CO/CO2) in the electrolyte assists7the
of 17
conversion efficiencies of the electroactive biocatalyst.

90 MES
ICFR
64
80 86.3
CEIC
70 62

ICFR (mg.L-1.h-1)

CEIC (%)
60 60
59
50
58
40
56
30

20 54

10
C1 C2 C3 C4 C5 C6 CEIC
Figure 4. Inorganic carbon fixation rates (ICFR) with respect to the number of cycles operated and
Figure
overall4.cumulative
Inorganic carbon fixation
conversion rates (ICFR)
efficiency with respect
of inorganic carbonto(CEIC).
the number of cycles operated and
overall cumulative conversion efficiency of inorganic carbon (CEIC).
3.4. Electrotrophy of Biocathode
3.4. Electrotrophy
Voltammogramsof Biocathode
recorded with respect to the working electrode show the faradaic elec-
troactive species involved
Voltammograms in the
recorded gaseous
with respectfeedstock reduction
to the working into fermentation
electrode products.
show the faradaic
Pseudo electrochemical
electroactive (non-faradaic)
species involved response
in the gaseous errors reduction
feedstock were minimized and suppressed
into fermentation prod-by
recording
ucts. Pseudo theelectrochemical
electrochemical(non-faradaic)
readings of theresponse
non-turnover (with
errors were uninoculated
minimized electrolyte)
and sup-
condition.
pressed Non-turnover
by recording redox current readings
the electrochemical (oxidative ofcatalytic current (OCC)/reductive
the non-turnover (with uninoculated cat-
alytic current (RCC)) of 0.2 mA/ − 0.56 mA was recorded. Non-faradaic
electrolyte) condition. Non-turnover redox current (oxidative catalytic current (OCC)/re- double-layer
currentcatalytic
ductive responses were(RCC))
current observed with
of 0.2 plain voltammograms
mA/−0.56 mA was recorded. with no indication
Non-faradaic of elec-
double-
troactive redox species presence. Non-faradaic double-layer current
layer current responses were observed with plain voltammograms with no indication of in the non-turnover
might be due
electroactive to the
redox interaction
species of the
presence. working electrode
Non-faradaic and electrolyte
double-layer current in(Figure 5a). After
the non-turno-
inoculation, redox currents (0.67/ − 0.71 mA) increased the voltammograms
ver might be due to the interaction of the working electrode and electrolyte (Figure 5a). representing
the electroactive
After inoculation, redox
redox(especially reduction) mA)
currents (0.67/−0.71 capabilities
increasedof the
thebiocatalyst.
voltammograms An increase
repre-in
voltammograms covering the area of turnover when compared with
senting the electroactive redox (especially reduction) capabilities of the biocatalyst. Annon-turnover showed
the enhanced
increase capacitance ofcovering
in voltammograms the biocathode,
the area which can bewhen
of turnover attributed to thewith
compared biofilm growth
non-turn-
on the electrode (Figure 5a) [23–25]. Specific peaks were observed
over showed the enhanced capacitance of the biocathode, which can be attributed to the on voltammogram
biofilm −0.6 V on
at the growth −0.49
andthe V (vs.(Figure
electrode Ag/AgCl), representing
5a) [23–25]. Specific the
peaks H2were
evolution reaction
observed and
on volt-
CO, CO2 /acetate
ammogram redox
at the −0.6 potentials,
V and respectively.
−0.49 V (vs. Ag/AgCl),Peak intensities
representing theatH−2 0.49 V (0.43
evolution mA; vs.
reaction
Ag/AgCl) inferred the conversion of syngas to acetate. Along with
and CO, CO2/acetate redox potentials, respectively. Peak intensities at −0.49 V (0.43 mA; the reduction species,
oxidative peaks were observed at 0.2 V, which might represent the involvement of mem-
vs. Ag/AgCl) inferred the conversion of syngas to acetate. Along with the reduction spe-
brane cytochromes (cytochrome c-1 and c-a) in an oxidized state [24,25]. Distinct oxidation
cies, oxidative peaks were observed at 0.2 V, which might represent the involvement of
peaks in the voltammograms reveal the electroactivity of the biocatalyst slimy layer on
membrane cytochromes (cytochrome c-1 and c-a) in an oxidized state [24,25]. Distinct ox-
biocathode in MES [25]. No specific changes were observed in the voltammograms (for
idation peaks in the voltammograms reveal the electroactivity of the biocatalyst slimy
4 days), revealing the electrochemical activity of the biocatalyst remains stable (Figure 5b).
layer on biocathode in MES [25]. No specific changes were observed in the voltammo-
A marginal shift in the position of the redox peaks was observed with progressive cycle
grams (for 4 days), revealing the electrochemical activity of the biocatalyst remains stable
operations, which might be due to altering the activities of the respective redox species
(Figure 5b). A marginal shift in the position of the redox peaks was observed with pro-
(Figure 5c). The structural morphology of the working electrode (carbon cloth) was ob-
gressive cycle operations, which might be due to altering the activities of the respective
served to provide an adequate surface area for microbial biofilm formation in a shorter
redox species (Figure 5c). The structural morphology of the working electrode (carbon
period of time (Figure 2).
 Micromachines 2022, 13, x FOR PEER REVIEW 8 of 18

Micromachines 2022, 13, 980 8 of 17

cloth) was observed to provide an adequate surface area for microbial biofilm formation
in a shorter period of time (Figure 2).
(a) (b)
0.8
MES 0.8 MES
0.6 Turnover
Day 1 Day 2
0.6
Day 3 Day 4
Non turnover
0.4 0.4
Current (mA)

Current (mA)
0.2 0.2
0.0 0.0
-0.2 -0.2
-0.4 -0.4

-0.6 -0.6

-0.8 -0.8
-1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 -1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0
Potential (V) Potential (V)

(c) (d)
1.2 MES 3.0 MES
1.0
Cycle 1 Cycle 2 Cycle 3 2.5
0.8 Cycle 4 Cycle 5 Cycle 6 Turnover
2.0 Non turnover
0.6
Current (mA)

Current (mA)

0.4 1.5
0.2
1.0
0.0
0.5
-0.2
-0.4 0.0
-0.6 -0.5
-0.8
-1.0
-1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 1.0 -1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8
Potential (V) Potential (V)

(e) (f)
10 12
MES MES

8 Day 1 Day 2 10 Cycle 1 Cycle 2 Cycle 3

Day 3 Day 4 Cycle 4 Cycle 5 Cycle 6
8
6
Current (mA)
Current (mA)

6
4
4
2
2
0
0

-2 -2
-1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 -1.0 -0.5 0.0 0.5 1.0
Potential (V) Potential (V)

Figure5.5. (a)
Figure (a) Cyclic
Cyclicvoltammograms
voltammograms (Ewe vs.vs.
(Ewe Ag/AgCl (3.5 M
Ag/AgCl KCl))
(3.5 of the working
M KCl)) electrode
of the working in CC-
electrode
MES turnover and non-turnover comparison; (b) number of days operated single cycle;
in CC-MES turnover and non-turnover comparison; (b) number of days operated single cycle; (c) compar-
ison of each cycle cyclic voltammograms; (d) linear sweep voltammograms (Ewe vs. Ag/AgCl (3.5
(c) comparison of each cycle cyclic voltammograms; (d) linear sweep voltammograms (Ewe vs.
Ag/AgCl (3.5 M KCl)) of working electrode in MES turnover and non-turnover comparison;
(e) number of days operated in single cycle; (f) comparison of each cycle sweep voltammograms.
Micromachines 2022, 13, 980 9 of 17

In order to study the reduction abilities of the biocathode, linear sweep voltammetry
(LSV) was recorded along with the CV. LSV (turnover) depicts higher reduction currents
than the non-turnover average reduction value (−0.18 mA) (Figure 5d). A maximum of
−0.6 mA (average of −0.41 mA) reduction current was noticed in the sixth cycle oper-
ation. Enhanced reduction currents in LSV suggest the syngas reduction capabilities of
biocathode. Decreased oxidized stretch was observed on the LSV profile, which might be
due to relatively lower counter electrode activity after the 96 h of operation (Figure 5e,f).
Rapid reduction current with decreased oxidation window indicates reduction ability of
the biocatalyst, which can consume the negatively charged moieties for the conversion
of inorganic fraction of syngas. The formation of the fermentation product profile was
correlated well with the electroactive reduction abilities of the biocatalyst observed in CV
and LSV.

3.5. Kinetics of Charge Transfer-Biocathode Response

Electrode kinetics and biocompatibility of the electrodes were evaluated through the
Tafel plots (drawn from the LSV) based on the Butler–Volmer equation [22,25–29] (Figure 6).
Log integration of the generated reduction current in LSV depicts the kinetics of the charge
transfer, which accounts for the substrate (Syngas) utilization and product formation [22].
Oxidative (βa) and reductive (βc) slope values of 240.3 mV/dec and 398.8 mV/dec were
observed, respectively, in the non-turnover condition, which decreased (118.3 mV (βa);
213.9 mV (βc)) with the turnover operation indicating higher transfer of charge from the
working electrode. In order to avoid errors in the kinetic charge transfers, blank Tafel
slopes were drawn from the abiotic LSV. As relations between the slope constants and
reduced equivalents transfer are inverse, the higher constant slope values represent the
lower charge transfer efficiency. This is well correlated with system C1 gas fermentation
performance [22]. Redox slope constant values describe the nature and efficiency of the
electrochemical process that occurs in the MES. Bidirectional transfer of the charged species
from the electrode to catalyst/electrolyte was increased when the constant slope resistance
was decreased. Lowering the redox slope constant values in biotic operation suggests
the increased electrocommunication between the biocatalyst and biocathode [25]. Higher
charge communication accounts for the overall fermentation performance of the systems by
consuming the transferred charge species. Higher product synthesis was observed in the
MES, where lower slope constants were recorded. Lower the reduction (βc, 213.9 mV/dec)
and oxidation (βa, 118 mV/dec) slope constants in turnover plots showed the tendency
of biocathode towards reduction (in syngas) and the oxidation of CO to CO2 , respectively.
Detection of both oxidized and reduced species in the CV relates to these decreased slope
constant tendencies. In addition to charge transfer kinetics, the biocompatibility of the
electrodes was analyzed by taking the corrosion properties derived from the Tafel corrosion
analysis as a marker. Corrosion currents (Icorr) and corrosion potential (Ecorr) attributes to
the deteriorated characteristics of the electrodes. Lower corrosion current (Icorr = 24 µA;
Ecorr = 206 mV) of biocathode than the non-turnover (Icorr = 27 µA; Ecorr = 292 mV)
operation can be able to show the stability and biocompatibility of the biocathode [22,25].
Lower the corrosion rates (currents and potential) may also depict the persistent conversion
of the biocathodes, which might also assist the rate of fermentation.
Micromachines 2022, 13,
Micromachines2022, 13, x980
FOR PEER REVIEW 10 of 18 10 of 17

Micromachines 2022, 13, x FOR PEER REVIEW 10 of 18

MES
0 Turnover
MES Non turnover

(Log<i>/mA)

ch
0 Turnover

an
-1

br
Non turnover

e
(Log<i>/mA)

od
Ca

ch
An
th

an
-1

od

br
e
-2

e
br

od
Ca

an

An
th

ch
Current

od
βa = 118.3 mV βa = 240.3 mV

e
-2

br
-3

an
βc = 213.9 mV βc = 398.8 mV

ch
Current

βa = 118.3 mV βa = 240.3 mV
I corr = 24 μA I corr = 27 μA
-3 βE
c= 213.9
corr mVmV
= 206 βcE=corr
398.8 mV mV
= 292
-4
I corr = 24 μA I corr = 27 μA
E corr = 206 mV E corr = 292 mV
-4 0.0 0.1 0.2 0.3 0.4 0.5

0.0 0.1 0.2

Potential
0.3
(V) 0.4 0.5
Figure
Figure6. Tafel diagrams
6. Tafel of turnover
diagrams and non-turnover
ofPotential
turnover (V) operations.
and non-turnover operations.

3.6.Electrochemically
Figure
3.6. Electrochemically
6. Active
Tafel diagramsActive
of turnoverSubstrate
ProfileProfileoperations.
and non-turnover
Substrate
Electrochemically
Electrochemically active substrate
active fate during
substrate the fermentation
fate during process was
the fermentation further
process was further
3.6. Electrochemically Active Substrate Profile
investigated
investigated by the
by differential
the differentialpulse voltammograms
pulse voltammograms (DPV). The pulse wave
(DPV). form ofwave
The pulse the form of
Electrochemically
potential results in the active
current substrate
response fate during the fermentation process active
was further
the potential results in the currentgenerated
response bygenerated
the electrochemically compo-
by the electrochemically active
investigated
nents in the by the differential
system. The pulse voltammograms
proportional relation between (DPV).the The pulse wave
generated peaks form
and of the
electro-
components
potential in the system. The proportional relation between the generated peaks and elec-
chemicalresults in the
substrate current response
suggested higher peak generated byrepresenting
currents the electrochemically
the higher active compo-
concentration
trochemical
nents substrate
in the system. suggested higher peak currents representing the higher concentration
of substrate [30,31]. The proportional
Non-turnover DPV relation
showed between the generated
a straight peaks the
line indicating andabsence
electro- of
of substrate
chemical [30,31].
substrate suggestedNon-turnover
higher peak DPV showed
currents a straight
representing the line indicating
higher concentration the absence of
electrochemically active substrate, whereas the turnover voltammogram depicted the
ofelectrochemically active
substrate [30,31]. Non-turnover substrate, whereas
DPV showed a the turnover
straight voltammogram
line indicating the absencedepicted
of the sym-
symmetric peaks near the −0.31 V with 1.8 mA current intensity (Figure 7). The distinct
electrochemically
metric peaks active
near the −
substrate,
0.31 V whereas
with 1.8 the turnover
mA current voltammogram
intensity
peak at 0.3 V represents the presence of electroactive carbonic ion concentration in the (Figure depicted
7). The the
distinct peak at
symmetric
0.3 V peaks near
represents the the −0.31 V with
presence of 1.8 mA current
electroactive intensity
carbonic ion (Figure 7). The distinct
concentration in the electrolytes.
electrolytes. Dissipation of the gaseous substrates into the electrolyte results in the for-
peak at 0.3 V represents
Dissipation of theand the presence
gaseous substratesof electroactive
into the carbonic results
electrolyte ion concentration
inwas in the
the formation
mation of carbonic bicarbonate ions. Peak intensity on the first day high, whichof carbonic
electrolytes. Dissipation of the gaseous substrates into the electrolyte results in the for-
and bicarbonate
reduced at the end of ions.
cyclePeak intensity
operation on the
(1.1 mA), first day
indicating thewas high, which
reduction reduced at the end
in the concentra-
mation of carbonic and bicarbonate ions. Peak intensity on the first day was high, which
of
tion cycle
of the operation
substrate over (1.1 mA),
the indicating
period the
of operation. reduction
A decreaseininthe theconcentration
reduced at the end of cycle operation (1.1 mA), indicating the reduction in the concentra-
electrochemically of the
ac- substrate
tive
oversubstrate
the in MES
period of proportionally
operation. A correlatesinwith
decrease the increased product formation,
electrochemically active inor- in MES
substrate
tion of the substrate over the period of operation. A decrease in the electrochemically ac-
ganic carbon fixation
proportionally and conversion
correlates efficiencies by the formation,
with increased biocatalyst. inorganic carbon fixation and
tive substrate in MES proportionally correlatesproduct
with increased product formation, inor-
conversion
ganic efficiencies
carbon fixation by the biocatalyst.
and conversion efficiencies by the biocatalyst.
MES
0.3
MES Day 1 Day 4 Non turnover
0.3
Day 1 Day 4 Non turnover
(I delta/mA)

0.2
(I delta/mA)

0.2
0.1
0.1
0.0
Current

0.0
Current

-0.1
-0.1
-0.2
-0.2
-1.0 -0.5 0.0 0.5 1.0
-1.0 -0.5 Potential
0.0 (V)0.5 1.0
Potential (V)
Figure 7. Differential pulse voltammogram plots (initial and 4th day).
Figure 7. Differential
Figure pulsepulse
7. Differential voltammogram plots (initial
voltammogram plotsand 4th day).
(initial and 4th day).
Micromachines 2022, 13, 980 11 of 17

Micromachines 2022, 13, x FOR PEER REVIEW 11 of 18

3.7. Internal Resistance-Charge Transfer Mechanics
Charge transfer becomes influenced by electrolytes and electrodes, which include char-
acteristic features such as
3.7. Internal Resistance-Charge individual
Transfer Mechanics ohmic resistance [23,31]. Electrochemical impedance
spectroscopy (EIS) provides the semicircle plots representing the cumulative internal resis-
Charge transfer becomes influenced by electrolytes and electrodes, which include
tance. Blank EIS was performed, and
characteristic features such as individual ohmic resistance Nyquist impedance was plotted
[23,31]. Electrochemical to study the ohmic
imped-
(Ω
anceohm ) and charge transfer (Ω ) resistance (Figure 8). A higher
spectroscopy (EIS) provides thectsemicircle plots representing the cumulative internal radius of the non-turnover
Z fit represents
resistance. Blank EIS more charge transfer
was performed, resistance
and Nyquist (Ωct 1.1
impedance waskΩ), whereas
plotted to studythetheZ fit at the end
ohmic
of the(Ωexperimental
ohm) and charge operation
transfer (Ωct)showed
resistancea (Figure
decrease 8). Ainhigher radius of the
the semicircle non- with narrow
radium
turnover Z fit represents more charge transfer resistance (Ω ct 1.1 kΩ), whereas the Z fit at
charged transfer resistances (Ωct 0.8 kΩ). Higher charge transfer resistance hinders the
the end of the experimental operation showed a decrease in the semicircle radium with
charge diffusion from the electrode to the electrolyte. Ohmic resistance (Ωohm ) of the abiotic
narrow charged transfer resistances (Ωct 0.8 kΩ). Higher charge transfer resistance hinders
operation
the depictsfrom
charge diffusion a higher resistance
the electrode to the 500 Ω than
ofelectrolyte. the biotic
Ohmic operation
resistance the Ω). Reduced
(Ωohm) of(16.8
charge transfer and ohmic resistances of biocathode depict
abiotic operation depicts a higher resistance of 500 Ω than the biotic operation (16.8 Ω). the effective flux of charged
species,charge
Reduced which assistand
transfer theohmic
growth of theofelectroactive
resistances biocathode depict biofilm on the flux
the effective cathode.
of Increased
growthspecies,
charged of biocatalyst
which assist on the working
the growth of electrode surface
the electroactive triggers
biofilm ancathode.
on the efficientIn-
reduction in the
creased
syngasgrowth of biocatalyst
by higher electron onflux
the working
with the electrode surface
feasibility of triggers
forming anproducts
efficient reduc-
of interest. Higher
tion in the syngas by higher electron flux with the feasibility of forming
charge communication minimizes the internal charge transfer resistances that facilitate products of inter-
est. Higher charge communication minimizes the internal charge transfer resistances that
the active metabolism of the electroactive bacteria [32]. Lower charge losses influence
facilitate the active metabolism of the electroactive bacteria [32]. Lower charge losses in-
the performance
fluence the performance of the system
of the systemby by promoting electroactive
promoting electroactive microbial
microbial growthgrowth
[23]. [23]. Lesser
resistances
Lesser resistances of of
thethebiocathode
biocathode atatthe the
endend of operation
of operation indicated indicated
the activethe active adaptation of
adaptation
ofthe
the cultures towards
cultures towards thetheredoxredox environment.
environment. An in
An increase increase in the fermentation
the fermentation product product
(acetate/ethanol)
(acetate/ethanol) titer at the end
titer of the
at the end experimental operation relates
of the experimental to a decrease
operation in re-
relates to a decrease in
sistances/impedances
resistances/impedances of the MES. of the MES.

600
Turnover
500 Non turnover

Z Fit
400
Im(Z)/Ohm

300

200

100

0
Nyquist Impedance

0 200 400 600 800 1000 1200

Re(Z)/Ohm
Figure
Figure 8. Comparative
8. Comparative impedance
impedance and
and Z-fit Z-fit(non-turnover
of MES of MES (non-turnover and turnover).
and turnover).

3.8.Cathodic
3.8. Cathodic Reduction
Reduction Responses
Responses
Chronoamperometry
Chronoamperometry (CA)
(CA) was was recorded
recorded against
against the appliedthe applied
potential potential
with function with function
time.
time. Applied
Applied potential
potential on theonworking
the working electrode
electrode drives
drives the the electrochemical
electrochemical reduction inreduction in in-
inorganic
organic carbon
carbonofofsyngas
syngasin response to the
in response tocatalytic current.
the catalytic The current
current. Theprofile
current(mar-
profile (marginal)
ginal) recorded in the abiotic operation might be due to the non-faradaic electrical double
recorded in the abiotic operation might be due to the non-faradaic electrical double layer
layer current (Figure 9). In order to infer the reductive capabilities of abiotic operation,
current (Figure 9). In order to infer the reductive capabilities of abiotic operation, amperom-
amperometry was performed with an applied potential of −0.5 V. Reductive catalytic cur-
etry(RCC)
rent was generations
performedwere withrecorded
an applied potential
with an average of −0.5mA.
of −0.03 V. Reductive catalytic current (RCC)
Generated reductive
generations were recorded with an average of − 0.03 mA. Generated
currents illustrate the syngas reduction tendencies [14,21,22]. Consistent charge transferreductive currents
illustrate the syngas reduction tendencies [14,21,22]. Consistent charge transfer from the
cathode surface to the outer membrane electroactive components of the microbe depicts
the substrate reduction capability of the carboxydotrophic biocatalyst [14,22]. Continuous
syngas sparging into the medium with optimal flow rate enabled the electrogenic activity of
the biocatalyst towards product formation by consuming the externally discharged charge.
 Micromachines 2022, 13, x FOR PEER REVIEW 12 of 18
Micromachines 2022, 13, 980 12 of 17

from the cathode surface to the outer membrane electroactive components of the microbe
depicts the substrate reduction capability of the carboxydotrophic biocatalyst [14,22].
Generated reductive catalytic currents due to the poised potential depicts the proportional
Continuous syngas sparging into the medium with optimal flow rate enabled the electro-
electrochemical
genic activitiestowards
activity of the biocatalyst of theproduct
biocatalyst, which
formation correlated
by consuming the with substrate conversion
externally
and fixation
discharged charge.efficiencies. Generated
Generated reductive catalyticreductive
currents duecatalytic current
to the poised utilization
potential de- towards the
fermentation
picts products
the proportional reflectsactivities
electrochemical the capacity of charge
of the biocatalyst, utilization
which correlatedby
withbiocatalyst [33–36].
substrate
Coulombicconversion and fixation efficiency
consumption efficiencies. (CE)
Generated
and reductive
electroncatalytic
recoverycurrent utili-
in fermentation products
zation towards the fermentation products reflects the capacity of charge utilization by bi-
were calculated. The ratio to provide coulombs in terms of reductive current on the working
ocatalyst [33–36]. Coulombic consumption efficiency (CE) and electron recovery in fer-
electrode that is involved in the product was calculated using the Equation (5)
mentation products were calculated. The ratio to provide coulombs in terms of reductive
current on the working electrode that is involved in the product was calculated using the
Equation (5) CE (%) = b ∗ n ∗ F/CT (5)
CE (%) = b ∗ n ∗ F/CT (5)
where b is the number of electrons transferred in the products (eight in the case of ac-
where b is the
etate), n isnumber of electrons
the number of transferred
moles of in the products (eight
fermentation in the case
product, andofFacetate),
is the faraday constant
n is the number
(96,485 C·mol of −
moles of fermentation
1 ). The product, and
CT total coulombs areFcalculated
is the faraday byconstant (96,485the current gener-
integrating
C·mol−1). The CT total coulombs are calculated by integrating the current generated. Spe-
ated. Specific to acetate production, the Coulombic efficiency of 111.6% was observed with
cific to acetate production, the Coulombic efficiency of 111.6% was observed with syngas
syngas The
feedstock. feedstock. The higher
higher Coulombic Coulombic
efficiency indicatedefficiency indicated
the effective the effective
charge transfer from charge transfer
thefrom the reductive
reductive catalytic
catalytic current current toproducts.
to fermentation fermentation products.
Triple charge Triplei.e.,
availability, charge
in availability, i.e.,
theinform
theofform
reductive current, oxidation
of reductive current, of CO and gaseous
oxidation H2 fraction
of CO in the syngas
and gaseous mix-
H2 fraction in the syngas
ture, led to higher
mixture, led toCoulombic efficiency than
higher Coulombic usual (100%)
efficiency [24,37–39].
than usual (100%) [24,37–39].

0.04
MES
0.02 Turnover
Non turnover
0.00
Current (mA)

-0.02

-0.04

-0.06

-0.08

-0.10

-0.12

0 1 2 3 4 5
Time (Days)
Figure 9. Reductive catalytic current generations (turnover and non-turnover).
Figure 9. Reductive catalytic current generations (turnover and non-turnover).

3.9. Microbial Community Distribution

3.9. Microbial Community Distribution
A total
A total number
number of 99,302
of 99,302 amplicon
amplicon readswere
reads (OTU) (OTU) were obtained,
obtained, with an average length
with an average
of 301
length base
of 301 pairs
base pairswith 55%GC
with 55% GC content.
content. Phylum
Phylum level distributions
level distributions of the microbes in the
of the microbes
in enriched
the enriched culturerevealed
culture revealed thethedominance
dominance of Firmicutes, Actinobacteria
of Firmicutes, and Proteo-and Proteobacteria
Actinobacteria
bacteria
with awith a relative
relative abundanceof
abundance of 42.87,
42.87, 33.18
33.18and
and20.8%, respectively
20.8%, (Figure(Figure
respectively 10a), 10a), followed
followed by Bacteroidetes, Acido bacteria and Chloroflexi distribution. Phylum abun-
by Bacteroidetes, Acido bacteria and Chloroflexi distribution. Phylum
dance directly evidenced the efficient syngas fermentation to acetate with the presence of
abundance directly
theevidenced the efficient
gene set encoded syngas
for different fermentation
biological to acetate
steps of acetyl-CoA with
reduction the presence
pathway in the of the gene set
encoded for different biological steps of acetyl-CoA reduction pathway in the spore-forming
phylums such as Firmicutes and Actinobacteria [40,41]. Insights into the gene lineages
responsible synthesis of acetyl CoA were encoded in the Actinobacteria phylum that
highly contributed to the conversion efficiency of inorganic carbon fractions of syngas
into the WLP metabolites [40]. Loci of the hydrogenase genes account for the redox
reactions of the molecular hydrogens and release the charged molecules for the reduction
in C1 gases owned by the actinobacteria cultures [41]. Enriched cultures of MES reveal the
presence of the Actinobacteria phylum with a fraction of 33.18%. Evidence of the higher
substrate conversion rates with increased Coulombic efficiencies was related to the presence
Actinobacteria phylum, which accounted for the higher fermentation rates by providing
adequate reducing equivalents through enzymatic functions [40,41]. Further study on
Micromachines 2022, 13, 980 13 of 17

the diversified taxonomic profile of cultures provided a phylum level synergy between
the identical communities (oxidation by Proteobacteria and reduction by Firmicutes) in
Micromachines 2022, 13, x FOR PEER REVIEW 13 of 18
converting the supplemented gaseous feedstock. Mediated and Direct interspecies electron
transfer (DIET/MIET) might have attributed to the synergy of microbial communities
accounts for the high substrate conversion rates. The appearance of several redox species
spore-forming phylumsstudy
in the electrochemical such as Firmicutes
might andcharge
assist the Actinobacteria [40,41]. Insights
communications through into the
DIET/MIET
gene lineages responsible synthesis of acetyl CoA were encoded
between the diversified microbiota Acid bacteria phylum plays a critical role in furtherin the Actinobacteria
phylum that highly contributed to the conversion efficiency of inorganic carbon fractions
synthesis of acetate from acetyl-CoA, which was synthesized by the homoacetogenic
of syngas into the WLP metabolites [40]. Loci of the hydrogenase genes account for the
phylum (Firmicutes) [41].
redox reactions of the molecular hydrogens and release the charged molecules for the re-
Class-level taxonomic distributions represent the relative dominance of Bacilli (37.5),
duction in C1 gases owned by the actinobacteria cultures [41]. Enriched cultures of MES
Alpha proteobacteria
reveal the presence of the (28.52), Actinobacteria
Actinobacteria phylum (20.63),
with Clostridia
a fraction of (5.4) (Figure
33.18%. 10b) and
Evidence of others
in minor fraction. Class Bacilli belonging to the Bacillota (Firmicutes)
the higher substrate conversion rates with increased Coulombic efficiencies was related phylum has the capa-
to the presence Actinobacteria phylum, which accounted for the higher fermentation rates carbon
bility to fix the inorganic carbon in non-photosynthetic routes [42]. Gene loci of the
monoxide
by providing dehydrogenase
adequate reducing (CODH) and acetyl
equivalents throughCo-A synthasefunctions
enzymatic (ACS) are predominant
[40,41]. Further in the
microbial
study on the families of Bacillaceae
diversified taxonomic and Clostridiaceae
profile (Figure a10c,d),
of cultures provided phylum which
level account
synergy for the
C1 fixation
between the [40]. Involvement
identical communities of (oxidation
identical clostridial class microbes
by Proteobacteria (Krona
and reduction byanalysis
Firmic- chart)
evidenced
utes) the accumulation
in converting the supplemented of acetate
gaseousand ethanolMediated
feedstock. as a result andofDirect
clostridial metabolism.
interspecies
electron transferof(DIET/MIET)
The presence might have
C1 fixing microbial attributed
diversity intodifferent
the synergy of microbial
taxonomical commu-
order assists the
nities accountsoffor
biosynthesis thethe high substrate
acetate and ethanol conversion
throughrates.
WLP.The Theappearance
distribution of of
several redox
carboxydotrophic
species
community in theinelectrochemical
the system evidencedstudy might assist the charge
the synthesis communications
of fermentation productsthrough
and syngas
DIET/MIET between the diversified microbiota Acid bacteria phylum plays a critical role
fixation/conversions.
in further
The synthesis of acetatedifference
intercommunity from acetyl-CoA, which investigated
was further was synthesized by by
thethe homoace- of the
α-diversity
togenic phylum (Firmicutes) [41].
biocatalyst (Figure 10e). Three kinds of α-diversity indices (Observed, Shannon and
Class-level taxonomic distributions represent the relative dominance of Bacilli (37.5),
Simson) were analyzed to the culture and compared to predict variance spread in the
Alpha proteobacteria (28.52), Actinobacteria (20.63), Clostridia (5.4) (Figure 10b) and oth-
community. Observed α-diversity ranges between 300 and 420 in the duplicate analysis of
ers in minor fraction. Class Bacilli belonging to the Bacillota (Firmicutes) phylum has the
the samples. Lower Simpson (2.5) and Shannon (0.6) index values were observed in the
capability to fix the inorganic carbon in non-photosynthetic routes [42]. Gene loci of the
enriched
carbon culture,dehydrogenase
monoxide evidenced by the distributions
(CODH) and acetyl of Co-A
the selected
synthase community dominance that
(ACS) are predomi-
nant in the microbial families of Bacillaceae and Clostridiaceae (Figure 10c,d), which ac- of the
drives the specific metabolic reactions. Low variance and evenness distributions
carboxydotrophic
count for the C1 fixationmicrobes
[40]. account
Involvementfor the specific clostridial
of identical acetogenicclass andmicrobes
solventogenic
(Kronaprocess
in whichchart)
analysis syngas feedstock
evidenced converted into
the accumulation the WLP
of acetate andpathway
ethanol asmetabolites account for the
a result of clostridial
microbiomeThe
metabolism. assisting
presence theof dominant growth diversity
C1 fixing microbial of the specific microbiome
in different taxonomical(C1-fixing)
order [43].
Cho1 and
assists abundance-based
the biosynthesis coverage
of the acetate and estimators
ethanol through(ACE) species
WLP. The richness was
distribution ofdepicted
car- in
boxydotrophic
the median ofcommunity530 and 480, in the system evidenced
respectively. the synthesis
Low indices of fermentation
of the α-diversity, Cho1 prod-
and ACE
ucts and syngas
represent fixation/conversions.
the selective abundance in the diversity of the mixed culture [40].

(a)

MES Nitrospirae
100 TM7
TM6
WS2
20.8
Relative abundance (%)

Verrucomicrobia
80 OP9
NKB19
Chlamydiae
Spirochaetes
WS6
60 Acidobacteria
42.87 Thermotogae
Planctomycetes
Cyanobacteria
40 Euryarchaeota
Synergistetes
OP8
Chloroflexi
Caldiserica
20 Bacteroidetes
33.18 Actinobacteria
Firmicutes
Proteobacteria
0
Phylum distribution

Figure 10. Cont.

Micromachines 2022,13,
Micromachines2022, 13,980
x FOR PEER REVIEW 14 of 17
14 of 18

(b)

MES
100 Nitrospira
Thermoleophilia

5.4 Verrucomicrobiae
Coriobacteriia

Relative abundance (%)

TM7-3
Erysipelotrichi
SJA-4

80 Thermomicrobia
4C0d-2
SHA-109
vadinHA49
37.5 noFP_H4
OPB46
Methanobacteria

60 Chlamydiia
Planctomycetia
SC72
Thermotogae
Chloroplast
OPB41
WCHB1-03

40 20.64 Methanomicrobia
Synergistia
Deltaproteobacteria
OP8_1
Anaerolineae
Caldisericia
Clostridia
Bacteroidia
20 Betaproteobacteria

28.52 Bacilli
Actinobacteria
Alphaproteobacteria
Gammaproteobacteria

0
Class distribution

(c)

Figure 10. Cont.

Micromachines 2022, 13,
Micromachines2022, 13, 980
x FOR PEER REVIEW 15 of 17
15 of 18

(d)

(e)
800 4.0
MES Alpha diversity index
3.5
700 Shannon
3.0

600 2.5
Range

2.0
Range

500
1.5

400 1.0
0.5
300 Simpson
0.0

200 -0.5
Observed Chao 1 ACE

Figure 10. (a) Relative abundance of microbial community in phylum level; (b) class distribution;
Figure 10. (a) Relative abundance of microbial community in phylum level; (b) class distribution;
(c) family level; (d) krona plot representing the total community; (e) normal boxplots of alpha diversity.
(c) family level; (d) krona plot representing the total community; (e) normal boxplots of alpha di-
versity.
4. Conclusions
A single-chambered
The MES system
intercommunity difference with carbon
was further cloth by
investigated (CC)
theas the working
α-diversity electrode
of the bi-
was studied
ocatalyst for 10e).
(Figure syngas fermentation
Three employing
kinds of α-diversity enriched
indices carboxydotrophic
(Observed, Shannon andconsortia
Simson) with
a semi-continuous
were analyzed to the operation
culture and(batch mode
compared to operation with continuous
predict variance spread in thegaseous sparging
community.
in the electrolyte). CC provides an adequate surface for biofilm formation within
Observed α-diversity ranges between 300 and 420 in the duplicate analysis of the samples. a short
period. Higher acetic and ethanol product titers in the medium after the third cycles of
operation correlate well with the biofilm formation. Electrochemical parameters of the MES
revealed the reductive capabilities of the biocatalyst, and microbe with low charge transfer
Micromachines 2022, 13, 980 16 of 17

resistance with higher Coulombic efficiencies enabled the cathodes biocatalyst commu-
nications towards syngas conversion. An abundance of syngas fixing microbe phylum
and class abundance (Actinobacteria, Firmicutes/Clostridia and Bacilli) assist the syngas
fermentation through gene loci responsible for reduction metabolism. Supplementation of
syngas in regulated flow into the electrolyte of designed MES enables bioconversion of the
CO2 /CO.

Author Contributions: Conceptualization, S.V.M.; research methodology, S.V.M. and A.T.; supervi-
sion, S.V.M.; original draft preparation, S.V.M. and A.T.; experimental work, A.T. All authors have
read and agreed to the published version of the manuscript.
Funding: The Department of Biotechnology (DBT), Government of India funded the research by a
grant (No. BT/PR20759/BCE/8/1218/2016).
Institutional Review Board Statement: Manuscript no: IICT/Pubs./2022/114.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Acknowledgments: The authors would like to thank the Director of CSIR-IICT for providing the
facilities to perform the study.
Conflicts of Interest: The authors have no conflict of interest.

References
1. Sivalingam, V.; Ahmadi, V.; Babafemi, O.; Dinamarca, C. Integrating syngas fermentation into a single-cell microbial electrosyn-
thesis (MES) reactor. Catalysts 2020, 11, 40. [CrossRef]
2. Timmis, K.; de Vos, W.M.; Ramos, J.L.; Vlaeminck, S.E.; Prieto, A.; Danchin, A.; Verstraete, W.; de Lorenzo, V.; Lee, S.Y.;
Brüssow, H.; et al. The contribution of microbial biotechnology to sustainable development goals. Microb. Biotechnol. 2017,
10, 984–987. [CrossRef] [PubMed]
3. Katakojwala, R.; Tharak, A.; Sarkar, O.; Venkata Mohan, S. Design and evaluation of Gas fermentation system for CO2 reduction
to C2 and C4 fatty acids: Metabolic regulation with pressure, pH and reaction time. Bioresour. Technol. 2022, 351, 126–937.
[CrossRef] [PubMed]
4. Arantes, A.L.; Moreira, J.P.; Diender, M.; Parshina, S.N.; Stams, A.J.; Alves, M.M.; Alves, J.I.; Sousa, D.Z. Enrichment of anaerobic
syngas-converting communities and isolation of a novel carboxydotrophic Acetobacterium wieringae strain JM. Front. Microbiol.
2020, 11, 58. [CrossRef] [PubMed]
5. Surywanshi, G.D.; Pillai, B.B.K.; Patnaikuni, V.S.; Vooradi, R.; Anne, S.B. 4-E analyses of chemical looping combustion based
subcritical, supercritical and ultra-supercritical coal-fired power plants. Energy Convers. Manag. 2019, 200, 112050. [CrossRef]
6. Barbosa, S.G.; Peixoto, L.; Alves, J.I.; Alves, M.M. Bioelectrochemical systems (BESs) towards conversion of carbon monox-
ide/syngas: A mini-review. Renew. Sustain. Energy Rev. 2021, 135, 110–358. [CrossRef]
7. Sinharoy, A.; Pakshirajan, K.; Lens, P.N. Syngas Fermentation for Bioenergy Production: Advances in Bioreactor Systems. Renew.
Energy Technol. Energy Effic. Sustain. Dev. 2022, 325–358.
8. Liu, C.; Wang, W.; Yang, Z.; Zhang, S.; Liu, G.; Luo, G. Microbial insights of enhanced anaerobic conversion of syngas into volatile
fatty acids by co-fermentation with carbohydrate-rich synthetic wastewater. Biotechnol. Biofuels 2020, 13, 1–14. [CrossRef]
9. Liu, C.; Luo, G.; Liu, H.; Yang, Z.; Angelidaki, I.; Sompong, O.; Liu, G.; Zhang, S.; Wang, W. CO as electron donor for efficient
medium chain carboxylate production by chain elongation: Microbial and thermodynamic insights. Chem. Eng. J. 2020,
390, 124–577. [CrossRef]
10. Modestra, J.A.; Katakojwala, R.; Venkata Mohan, S. CO2 fermentation to short chain fatty acids using selectively enriched
chemolithoautotrophic acetogenic bacteria. Chem. Eng. J. 2020, 394, 124759. [CrossRef]
11. Dang, J.; Wang, N.; Atiyeh, H.K. Review of dissolved CO and H2 measurement methods for syngas fermentation. Sensors 2021,
21, 2165. [CrossRef]
12. Chakraborty, S.; Rene, E.R.; Lens, P.N.; Veiga, M.C.; Kennes, C. Enrichment of a solventogenic anaerobic sludge converting carbon
monoxide and syngas into acids and alcohols. Bioresour. Technol. 2019, 272, 130–136. [CrossRef] [PubMed]
13. Gunes, B. A critical review on biofilm-based reactor systems for enhanced syngas fermentation processes. Renew. Sustain. Energy
Rev. 2021, 143, 110–950. [CrossRef]
14. Ayol, A.; Peixoto, L.; Keskin, T.; Abubackar, H.N. Reactor designs and configurations for biological and bioelectrochemical C1 gas
conversion: A review. Int. J. Environ. Res. Public Health 2021, 18, 11683. [CrossRef] [PubMed]
15. Parera Olm, I.; Sousa, D.Z. Conversion of Carbon Monoxide to Chemicals Using Microbial Consortia. In One-Carbon Feedstocks for
Sustainable Bioproduction; Springer International Publishing: Cham, Switzerland, 2021.
Micromachines 2022, 13, 980 17 of 17

16. Amulya, K.; Venkata Mohan, S. Augmenting succinic acid production by bioelectrochemical synthesis: Influence of applied
potential and CO2 availability. Chem. Eng. J. 2021, 411, 128377. [CrossRef]
17. Chiranjeevi, P.; Mohanakrishna, G.; Mohan, S.V. Rhizosphere mediated electrogenesis with the function of anode placement for
harnessing bioenergy through CO2 sequestration. Bioresour. Technol. 2012, 124, 364–370. [CrossRef]
18. Kim, D.; Chang, I.S. Electricity generation from synthesis gas by microbial processes: CO fermentation and microbial fuel cell
technology. Bioresour. Technol. 2009, 100, 4527–4530. [CrossRef]
19. Grimalt-Alemany, A.; Ł˛eżyk, M.; Lange, L.; Skiadas, I.V.; Gavala, H.N. Enrichment of syngas-converting mixed microbial consortia
for ethanol production and thermodynamics-based design of enrichment strategies. Biotechnol. Biofuels 2018, 11, 198. [CrossRef]
20. He, Y.; Cassarini, C.; Marciano, F.; Lens, P.N. Homoacetogenesis and solventogenesis from H2 /CO2 by granular sludge at 25,
37 and 55 C. Chemosphere 2021, 265, 128649. [CrossRef]
21. Tang, Y.; Huang, Y.; Gan, W.; Xia, A.; Liao, Q.; Zhu, X. Ethanol production from gas fermentation: Rapid enrichment and
domestication of bacterial community with continuous CO/CO2 gas. Renew. Energy 2021, 175, 337–344. [CrossRef]
22. Tharak, A.; Venkata Mohan, S. Electrotrophy of biocathodes regulates microbial-electro-catalyzation of CO2 to fatty acids in
single chambered system. Bioresour. Technol. 2021, 320, 124–272. [CrossRef] [PubMed]
23. Modestra, J.A.; Mohan, S.V. Microbial electrosynthesis of carboxylic acids through CO2 reduction with selectively enriched
biocatalyst: Microbial dynamics. J. CO2 Util. 2017, 20, 190–199. [CrossRef]
24. Mohanakrishna, G.; Seelam, J.S.; Vanbroekhoven, K.; Pant, D. An enriched electroactive homoacetogenic biocathode for the
microbial electrosynthesis of acetate through carbon dioxide reduction. Faraday Discuss. 2015, 183, 445–462. [CrossRef] [PubMed]
25. Srikanth, S.; Mohan, S.V. Influence of terminal electron acceptor availability to the anodic oxidation on the electrogenic activity of
microbial fuel cell (MFC). Bioresour. Technol. 2012, 123, 480–487. [CrossRef]
26. Sravan, J.S.; Mohan, S.V. Bioelectrocatalytic Reduction of Tellurium Oxyanions toward Their Cathodic Recovery: Concentration
Dependence and Anodic Electrogenic Activity. ACS EST Water 2021, 2, 40–51. [CrossRef]
27. Pasupuleti, S.B.; Srikanth, S.; Mohan, S.V.; Pant, D. Continuous mode operation of microbial fuel cell (MFC) stack with dual gas
diffusion cathode design for the treatment of dark fermentation effluent. Int. J. Hydrog. Energy 2015, 40, 12424–12435. [CrossRef]
28. Velvizhi, G.; Mohan, S.V. Biocatalyst behavior under self-induced electrogenic microenvironment in comparison with anaerobic
treatment: Evaluation with pharmaceutical wastewater for multi-pollutant removal. Bioresour. Technol. 2011, 102, 10784–10793.
[CrossRef]
29. Mukherjee, T.; Mohan, S.V. Magnetite-Bacillus subtilis Synergy on the Metabolic Selection of Products in Electrofermentation
System. Bioresour. Technol. 2022, 357, 127267. [CrossRef]
30. Chu, N.; Liang, Q.; Zhang, W.; Ge, Z.; Hao, W.; Jiang, Y.; Zeng, R.J. Waste C1 gases as alternatives to pure CO2 improved the
microbial electrosynthesis of C4 and C6 carboxylates. ACS Sustain. Chem. Eng. 2020, 8, 8773–8782. [CrossRef]
31. Adeloju, S.B.; Bond, A.M.; Briggs, M.H. Multielement determination in biological materials by differential pulse voltammetry.
Anal. Chem. 1985, 57, 1386–1390. [CrossRef]
32. Hassan, Q.; Ahmadi, S.; Kerman, K. Recent advances in monitoring cell behavior using cell-based impedance spectroscopy.
Micromachines 2020, 11, 590. [CrossRef] [PubMed]
33. Modestra, J.A.; Venkata Mohan, S. Capacitive biocathodes driving electrotrophy towards enhanced CO2 reduction for microbial
electrosynthesis of fatty acids. Bioresour. Technol. 2019, 294, 122–181. [CrossRef]
34. Mohanakrishna, G.; Reesh, I.M.A.; Vanbroekhoven, K.; Pant, D. Microbial electrosynthesis feasibility evaluation at high bicarbon-
ate concentrations with enriched homoacetogenic biocathode. Sci. Total Environ. 2020, 715, 137003. [CrossRef] [PubMed]
35. Mohan, S.V.; Srikanth, S.; Raghuvulu, S.V.; Mohanakrishna, G.; Kumar, A.K.; Sarma, P.N. Evaluation of the potential of various
aquatic eco-systems in harnessing bioelectricity through benthic fuel cell: Effect of electrode assembly and water characteristics.
Bioresour. Technol. 2009, 100, 2240–2246.
36. Mohan, S.V.; Srikanth, S.; Chiranjeevi, P.; Arora, S.; Chandra, R. Algal biocathode for in situ terminal electron acceptor (TEA)
production: Synergetic association of bacteria–microalgae metabolism for the functioning of biofuel cell. Bioresour. Technol. 2014,
166, 566–574. [CrossRef]
37. Bajracharya, S.; Vanbroekhoven, K.; Buisman, C.J.; Pant, D.; Strik, D.P. Application of gas diffusion biocathode in microbial
electrosynthesis from carbon dioxide. Environ. Sci. Pollut. Res. 2016, 23, 22292–22308. [CrossRef]
38. Rago, L.; Ruiz, Y.; Baeza, J.A.; Guisasola, A.; Cortés, P. Microbial community analysis in a long-term membrane-less microbial
electrolysis cell with hydrogen and methane production. Bioelectrochemistry 2015, 106, 359–368. [CrossRef]
39. Van Eerten-Jansen, M.C.; Heijne, A.T.; Buisman, C.J.; Hamelers, H.V. Microbial electrolysis cells for production of methane from
CO2 : Long-term performance and perspectives. Int. J. Energy Res. 2012, 36, 809–819. [CrossRef]
40. Vavourakis, C.D.; Andrei, A.S.; Mehrshad, M.; Ghai, R.; Sorokin, D.Y.; Muyzer, G. A metagenomics roadmap to the uncultured
genome diversity in hypersaline soda lake sediments. Microbiome 2018, 6, 1–18. [CrossRef]
41. Roy, M.; Yadav, R.; Chiranjeevi, P.; Patil, S.A. Direct utilization of industrial carbon dioxide with low impurities for acetate
production via microbial electrosynthesis. Bioresour. Technol. 2021, 320, 124289. [CrossRef]
42. He, P.; Han, W.; Shao, L.; Lü, F. One-step production of C6–C8 carboxylates by mixed culture solely grown on CO. Biotechnol.
Biofuels 2018, 11, 1–13. [CrossRef]
43. Heitkamp, K.; Latorre-Pérez, A.; Nefigmann, S.; Gimeno-Valero, H.; Vilanova, C.; Jahmad, E.; Abendroth, C. Monitoring of seven
industrial anaerobic digesters supplied with biochar. Biotechnol. Biofuels 2021, 14, 1–14. [CrossRef]