Chapter 9

PCR Analysis Methods for Detection and Identification

of Beer-Spoilage Lactic Acid Bacteria
S. Asano, M. Shimokawa, and K. Suzuki

Abstract
Polymerase chain reaction (PCR) analysis enables rapid and accurate detection of beer-spoilage lactic acid
bacteria (LAB). Hop resistance genes, horA and horC, are utilized as genetic markers to determine the
spoilage ability of LAB strains. PCR analysis of horA and horC, combined with multiplex PCR methods of
12 beer-spoilage species, enables simultaneous and comprehensive detection easily and inexpensively.

Key words PCR, Multiplex, Beer, Spoilage, Lactic acid bacteria, Hop resistance, horA, horC, Lacto-
bacillus, Pediococcus

1 Introduction

Conventional PCR analysis has been widely used for species-specific

identification of microorganisms in the food and clinical industries
because it is rapid, accessible, and easy to perform. Beer is known as
a microbiologically stable beverage, and the number of spoilage
species was once thought to be limited. Lactobacillus spp. and
Pediococcus spp. have been responsible for 70–90% of spoilage
incidents in the brewing industry, causing increased acidity and
turbidity [1–3]. To identify the contaminating bacteria in brew-
eries, species-specific PCR tests targeting the gene sequences
encoding rRNA have been evaluated [4–8]. Over the past few
decades, however, the number of recognized beer-spoilage species
has been steadily increasing, and over 20 species are now recog-
nized, the majority of which are lactic acid bacteria (LAB) [9, 10].
This trend makes conducting the PCR tests in breweries excessively
laborious and time-consuming. One strategy to overcome these
difficulties is to establish multiplex PCR tests for a simultaneous
identification of known beer-spoilage species. Therefore, we devel-
oped multiplex PCR methods for a species-specific detection of
beer-spoilage microorganisms, including LAB and other beer

Makoto Kanauchi (ed.), Lactic Acid Bacteria: Methods and Protocols, Methods in Molecular Biology, vol. 1887,
https://doi.org/10.1007/978-1-4939-8907-2_9, © Springer Science+Business Media, LLC, part of Springer Nature 2019

95
96 S. Asano et al.

spoilers belonging to the Pectinatus and Megasphaera genera

[11]. The following three multiplex PCR methods were developed
to identify the following four beer-spoilage genera: L. multiplex for
Lactobacillus, P. multiplex for Pectinatus, and C. multiplex for the
beer-spoilage cocci belonging to the Pediococcus and Megasphaera.
Another strategy to minimize the PCR procedures is to utilize
hop-resistance genes, horA and horC, as genetic markers to detect
and identify newly emerging spoilage species [12–14]. Notably,
horA and horC are hypothesized to increase the number of beer-
spoilage species through horizontal gene transfer, accounting for
the emergence of novel beer-spoilage species of LAB [15, 16]. In
this chapter, the combination of the aforementioned two
approaches is described for more effective and efficient identifica-
tion of beer-spoilage bacteria.

2 Materials

1. Variable volume pipette: Preferably autoclavable and dedicated

to PCR analysis only.
2. Microtubes: 1.5 mL, autoclaved before use.
3. Pipette tips: 10 μL, 200 μL and 1000 μL, autoclaved before
use. Pre-sterilized filter tips are also available.
4. Centrifuge for microtubes. A refrigerated centrifuge is prefera-
ble but not mandatory.
5. PCR tubes: 200 μL, autoclaved before use.
6. Laminar flow clean bench.
7. Thermal cycler: Applied Biosystems GeneAmp PCR System
9700 (Thermo Fisher) or equivalent.
8. Submarine gel electrophoresis system: Mupid®-exU (Mupid
Co. Ltd.) or equivalent.
9. Transilluminator for DNA visualization.
10. Camera with an appropriate filter for photographing
stained gels.
11. Plastic container (made of polypropylene, not polyethylene)
for gel staining.
12. Shaker for gel staining.
13. DNA extraction kit: PrepMan™ Ultra Sample Preparation
Reagent (Thermo Fisher Scientific). Store at room temperature
(see Note 1).
14. PerfectShot™ Ex Taq (loading dye mix) (TaKaRa Bio Inc.):
store at
20  C.
15. 50 Tris-Acetate-EDTA buffer: commercially available 50
Tris-Acetate-EDTA buffer (Nacalai Tesque) or equivalent.
 Detection and Identification of Lactic Acid Bacteria 97

For manual preparation, add 242 g of Tris free base and

18.61 g of EDTA to approximately 700 mL deionized water
and stir until Tris and EDTA are completely dissolved. Care-
fully add 57.1 mL of glacial acetic acid and adjust the volume to
1 L. The pH of the buffer is approximately 8.5. The working
solution of 1 TAE buffer is made by diluting the solution by
50 in deionized water.
16. Agarose for electrophoresis. Precast 2% agarose gels are also
commercially available.
17. DNA ladder: 100 bp DNA Ladder (Takara Bio Inc.) or equiv-
alent. Follow the manufacturer’s instructions to obtain a work-
ing solution.
18. DNA gel stain: SYBR® Green I Nucleic Acid Gel Stain or
equivalent.
19. Sterile water: Distilled water autoclaved at 121  C for 15 min
(see Note 2).
20. Primers (see Table 1).

3 Methods

3.1 DNA Isolation 1. Pick up a small amount of a bacterial colony visible on the agar
medium using an autoclaved pipette tip, and suspend it in a
200 μL PCR tube containing 25 μL PrepMan Ultra Reagent
(see Notes 3 and 4).
2. For DNA extraction, keep the suspended PrepMan solution at
98  C for 10 min using the thermal cycler. Create and store the
program detailed in Fig. 1.
3. After heating, centrifuge the PCR tube at approximately
17,000  g for 3 min at 4  C.
4. Collect 20 μL of supernatant without collecting the sediment
and mix the supernatant with 80 μL sterile distilled water to
yield the 100 μL mixed solution.
5. Use the 100 μL mixed solution as a sample DNA extract. To
obtain positive DNA control samples for the following PCR
procedures, conduct methods 3.1–3.5 with the reference
strains listed in Table 2.

3.2 PCR Carry out all PCR preparation procedures (steps 1–4) on ice in a
laminar flow clean bench.
1. Mix the primers at each amount shown in Table 1, and add
sterile water to yield a final volume of 20 μL.
2. Add 20 μL of the preceding primer mixture to a PerfectShot Ex
Taq tube.
Table 1
98

Primers used for horA/horC PCR and multiplex PCR

Amount in one
Methods Primers Direction Primer sequences (50 to 30 ) Target species Target DNA tube (μL)a References

horA LbHC-1 Forward 5’-ATCCGGCGGTGGCAAATCA-3’ Hop resistance gene horA horA gene 0.5 [12]
carrying bacteria
S. Asano et al.

LbHC-2 Reverse 5’-AATCGCCAATCGTTGGCG-3’ 0.5 [12]

horC AORF2FX32 Forward 5’-GCGCTTTAATTCCC-3’ Hop resistance gene horC horC gene 0.5 –
carrying bacteria
AORF2RX1 Reverse 5’-TCGCATTGGAACCC-3’ 0.5 –
L. multiplex LBP2 Forward CTGATTTCAACAATGAAGC Lactobacillus brevis 16S rDNA 0.3 [17]
L74P1 Forward GGATTTTAACATCGGATGAG Lactobacillus paracollinoides 16S rDNA 0.2 [18]
LCP11 Forward GAACCGCATGGTTCTTGGC Lactobacillus casei 16S rDNA 0.2 [11]
LOP4 Forward GGGACTAGAGTAACTGTTAGTCC Lactobacillus coryniformis 16S rDNA 0.2 [17]
LPP7 Forward GTTGTTAAAGAAGAACTTATC Lactobacillus plantarum 16S rDNA 0.6 [11]
LLITSF8 Forward AACTTACACCGATCAAAATC Lactobacillus lindneri ITS region 0.4 [11]
LL23SR12 Reverse CTTAACCTTGCATGCAACT Lactobacillus lindneri 23S rDNA 0.4 [11]
UNP1 Reverse CCGTCAATTCCTTTGAGTTT Lactobacillus (consensus primer) 16S rDNA 0.5 [17]
P. multiplex 16C-F Forward CGTATGCAGAGATGCATATT Pectinatus cerevisiiphilus 16S rDNA 0.4 [5]
IC-R Reverse CACTCTTACAAGTATCTAC Pectinatus cerevisiiphilus ITS region 0.4 [5]
16F-F Forward CGTATCCAGAGATGGATATT Pectinatus frisingensis 16S rDNA 0.4 [5]
IF-R Reverse CCATCCTCTTGAAAATCTC Pectinatus frisingensis ITS region 0.4 [5]
C. multiplex PIDF1 Forward TGTGAGAGTAACTGCTCATG Pediococcus damnosus and 16S rDNA 0.4 [11]
Pediococcus inopinatus
PIDR8 Reverse ACGCCTAATCTCTTTGGTTA Pediococcus damnosus and 16S rDNA 0.4 [11]
Pediococcus inopinatus
 PCLAF3 Forward CATTTCCGTTAAAAGAATCA Pediococcus claussenii 16S rDNA 0.4 [11]
PCLAR3 Reverse GGTTAAATACCGTCACTGGG Pediococcus claussenii 16S rDNA 0.4 [11]
Mc-f4 Forward ACCGAATACGATCTAAAG Megasphaera cerevisiae 16S rDNA 0.4 [11]
Mc-r4 Reverse TTAAGACCGACTTACCGA Megasphaera cerevisiae 16S rDNA 0.4 [11]
Universal 1114f2 Forward GCAACGAGCG Bacteria (universal sequence) 16S rDNA 0.5 [11]
1392r2 Reverse ACGGGCGGTG Bacteria (universal sequence) 16S rDNA 0.5 [11]
a
Primer concentration; 100 μM
Detection and Identification of Lactic Acid Bacteria
99
100 S. Asano et al.

98℃
10min

4℃
∞

Fig. 1 DNA extraction by heating the bacterial suspension at 98  C for 10 min

Table 2
List of reference strains used in this study

Methods Target species Strain numbera

horA horA carrying bacteria JCM 11969T
horC horC carrying bacteria JCM 11969T
L. multiplex Lactobacillus lindneri DSM 20690T
Lactobacillus brevis JCM 1059T
Lactobacillus paracollinoides JCM 11969T
Lactobacillus casei ATCC 334
Lactobacillus coryniformis JCM 1164T
Lactobacillus plantarum JCM 1149T
P. multiplex Pectinatus cerevisiiphilus DSM 20467T
Pectinatus frisingensis DSM 6306T
C. multiplex Pediococcus damnosus JCM 5886T
Pediococcus inopinatus DSM 20285T
Pediococcus claussenii DSM 14800T
Megasphaera cerevisiae DSM 20462T
a
Referrence strains of target species for each PCR method are listed

3. Add 5 μL of sample DNA extracts and gently mix with the

pipette (see Note 5).
For the negative control, add sterile water instead of DNA
extracts. For the positive control, add DNA extracts of the
reference strains (see Notes 6 and 7).
4. Add sterile water to yield a final volume of 50 μL.
5. Set PCR tubes in the thermal cycler with the profiles shown in
Fig. 2 (see Note 8). Carry out the initial denaturation for
2.5 min at 94  C, followed by 30 cycles of denaturation at
94  C for 15 s, annealing at 55  C for 15 s, primer extension at
72  C for 30 s, and a final product extension at 72  C for 3 min.
 Detection and Identification of Lactic Acid Bacteria 101

← 30 cycles →
94 94
2min 15sec 72 72
30sec 3min
55 30sec
15sec
4
∞

Fig. 2 Temperature profile of the PCR analysis

3.3 Electrophoresis 1. Heat 2.0 g agarose in 100 mL 1 TAE buffer until dissolved,
agitating the solution so that agarose is completely and uni-
3.3.1 Preparation of 2%
formly dissolved (see Note 9).
Agarose Gel
2. Cool to approximately 60  C and pour the agarose solution
into the gel preparation cassette.
3. Insert the comb and let the agarose gel solidify at ambient
temperature.
4. After solidification, pour 1 TAE buffer over the agarose gel to
barely cover the top, and cool it to 4  C (see Note 10).
5. Remove the comb gently and immerse the gel in 1 TAE
buffer for storage. Store the prepared agarose gel at 4  C (see
Note 11).

3.3.2 Sample Separation 1. Set the agarose gel in the Mupid electrophoresis system, and
pour enough 1 TAE buffer over the gel to barely cover the
surface (see Note 12).
2. Mix PCR solutions and pipette 5 μL of each solution into
individual wells (see Note 13). To indicate the molecular sizes
of the separated DNA bands, pipette 5 μL of the molecular
DNA size marker into the wells appropriately positioned for
comparative purpose.
3. Perform the electrophoresis for approximately 30 min at 100 V
(see Note 14).

3.3.3 Staining Immerse the electrophoresed gel in the SYBR Green I staining
solution and shake the immersed agarose gel for 30 min in a dark
environment (see Note 15).

3.3.4 Photographing Expose the agarose gel to UV (254 nm) or blue light (470 nm) and
take a photograph. Use an appropriate filter.
102 S. Asano et al.

Table 3
Product size of each multiplex PCR method

Method Target species Predicted product size(abp)

horA horA carrying bacteria Approx. 350
horC horC carrying bacteria Approx. 380
L. multiplex Lactobacillus brevis 861
Lactobacillus lindneri 850
Lactobacillus paracollinoides 854
Lactobacillus casei 729
Lactobacillus coryniformis 453
Lactobacillus plantarum 490
P. multiplex Pectinatus cerevisiiphilus 621
Pectinatus frisingensis 701,883
C. multiplex Pediococcus damnosus 566
Pediococcus inopinatus 566
Pediococcus claussenii 462
Megasphaera cerevisiae 452
Universal Bacteria Appox. 300
a
bp base pairs

3.4 Interpretations Confirm the presence of DNA bands from the universal PCR test.
Generally, the DNA band from the positive control is observed at
around 300 bp. The absence of a positive control PCR band
indicates that PCR did not proceed properly. If a DNA band was
found in the horA, horC, and multiplex PCR tests, determine the
approximate size of the DNA fragment by comparing its position
with the molecular DNA size marker. Interpret the result as positive
for beer-spoilage bacteria if the size of the DNA band matches that
of the beer-spoilage bacterial species indicated in Table 3. In addi-
tion, electrophoresis photos are shown in Figs. 3, 4, 5, 6, and 7 as
examples (see Notes 16 and 17).

4 Notes

1. After receipt of the kit, aliquot 0.1–0.2 mL of the reagent into

sterile microtubes in a laminar flow clean bench, and use one
aliquot for each independent PCR analysis. After the PCR
analysis, discard the used aliquot. This procedure will reduce
the risk of contamination.
 Detection and Identification of Lactic Acid Bacteria 103

Fig. 3 PCR bands generated by universal PCR method. Lane 1, positive control;
lane 2, negative control; M, 100 bp ladder

Fig. 4 PCR bands generated by horA and horC PCR methods using corresponding
target species as positive controls. Lane 1, horA-carrying bacteria; lane 2, horC-
carrying bacteria; M, 100 bp ladder
Fig. 5 PCR bands generated by L. multiplex PCR methods using corresponding
target species as positive controls. Lane 1, Lactobacillus lindneri; lane
2, L. brevis; lane 3, L. paracollinoides; lane 4, L. casei; lane 5, L. plantarum;
lane 6, L. coryniformis; M, 100 bp ladder

Fig. 6 PCR bands generated by P. multiplex PCR methods using corresponding

target species as positive controls. Lane 1, Pectinatus cerevisiiphilus; lane
2, Pectinatus frisingensis; M, 100 bp ladder
 Detection and Identification of Lactic Acid Bacteria 105

Fig. 7 PCR bands generated by C. multiplex PCR methods using corresponding

target species as positive controls. Lane 1, Pediococcus damnosus; lane
2, Pediococcus inopinatus; lane 3, Pediococcus claussenii; lane
4, Megasphaera cerevisiae; M, 100 bp ladder

2. After autoclaving, aliquot 0.1–0.2 mL water into sterile micro-

tubes in a laminar flow clean bench, and follow the procedure
described in the Note 1. This will reduce the risk of
contamination.
3. A tiny amount barely observed on the point of the tip is
sufficient. When the suspended PrepMan solution is seen
against the light, the solution should look slightly cloudy.
Caution should be exercised not to add an excessive amount
of bacterial cells, as this may inhibit PCR. See also the manu-
facturer’s instruction for removing PCR inhibitors.
4. When PCR is conducted for identification purposes, collect a
single colony for each DNA extraction. When the colony is too
small, subculture the microorganism so that retesting can be
conducted. If the selected colony is no longer available for
retesting, incubate the original agarose plate until a new colony
is observed where the old colony was picked up.
5. The mixing of respective reagents must be done gently and
thoroughly to ensure homogeneity. Vigorous agitation, such as
vortexing, may lead to the loss of enzyme activity. If a portion
106 S. Asano et al.

of the PCR mixture is cohesively adhered to the underside of

the PCR tube cover, optimal PCR may be inhibited. If this
happens, centrifuge the tube briefly to settle all of the PCR
mixture to the bottom of the tube.
6. To avoid contamination, the order of preparation must be as
follows: negative control, samples, and positive control. Posi-
tive control DNA must only be handled after all the reagents
are mixed and the covers of negative control and sample tubes
are closed.
7. To increase accuracy, conduct PCR tests in duplicates or
triplicates.
8. Quickly transfer the PCR tubes on ice to the thermal cycler
preheated to the denaturation temperature (94  C) to avoid
non-specific amplification.
9. Use a microwave or autoclave (105  C, 1 min.). In case of
gushing of the heated molten gels, wear safety eyewear and
protective gloves.
10. The agarose gel must be cooled sufficiently to achieve good
resolution of DNA bands.
11. The expiration date is not specified for agarose gels unless the
gels are compromised in appearance. As long as 100 bp ladders
are clearly separated and DNA bands are clearly stained by
SYBR Green, the gels are considered suitable for use.
12. Remove any scraps or debris from the agarose gel using a
pipette.
13. PCR solution should be mixed homogenously by pipetting.
Use a 6 dye to indicate the electrophoretic mobility more
clearly.
14. Stop the electrophoresis when the faster-moving dye reaches
the third to fourth line from the bottom of the Mupid gel tray.
15. Dissolve 10 μL SYBR Green I in 100 mL 1 TAE buffer to
obtain the working SYBR Green I staining solution. The work-
ing solution cannot be stored and must be prepared before
every PCR test. SYBR Green I may pose some danger to
humans, although no such risk has been described by the
manufacturer. Just to be on the safe side, use protective gloves
and safety eyewear. The stained gels and the staining solution
must be disposed of properly, in accordance with the local
regulations.
16. The PCR amplicon sizes of L. brevis, L. paracollinoides, and
L. lindneri are very similar, ranging between 850 bp and
861 bp. The beer-spoiling abilities of these three species are
roughly identical; therefore, these species can be recognized as
one group for practical purpose. Note that the beer-spoiling
 Detection and Identification of Lactic Acid Bacteria
abilities of this group of LAB are considerably potent, and
urgent actions will be necessary if they are detected.
17. For modified multiplex PCR methods for Pectinatus haikarae,
Megasphaera suesiensis, and M. paucivorans, see ref. [19].
References
1. Back W (1980) Biersch€adliche Bakterien. Brau-
welt 120
2. Back W (1994) Einteilung der biersh€adlichen
Bakterien. In: Farbatlas und Handbuch der
Getr€ankebiologie, Verlag Hans Carl, Nürn-
berg, Germany, 1
3. Koob J, Jacob F, Grammer M, Riedl R, Hutzler
M (2014) PCR-Analysen biersch€adlicher Bak-
terien 2012 und 2013. Brauwelt 10
4. Juvonen R, Satokari R (1999) Detection of
spoilage bacteria in beer by polymerase chain
reaction. J Am Soc Brew Chem 57:99–103
5. Motoyama Y, Ogata T (2000) Detection of
Pectinatus spp. by using 16S-23S rDNA spacer
regions. J Am Soc Brew Chem 58:4–7
6. Suzuki K, Iijima K, Sakamoto K, Sami M,
Yamashita H (2006) A review of hop resistance
in beer spoilage lactic acid bacteria. J Inst Brew
112:173–191
7. Tsuchiya Y, Kaneda H, Kano Y, Koshino S
(1992) Detection of beer spoilage organisms
by polymerase chain reaction technology. J Am
Soc Brew Chem 50:64–67
8. Tsuchiya Y, Kano Y, Koshino S (1993) Detec-
tion of Lactobacillus brevis in beer using poly-
merase chain reaction technology. J Am Soc
Brew Chem 51:40–41
9. Hutzler M, Müller-Auffermann K, Koob J,
Riedl R, Jacob F (2013) Beer spoiling micro-
organisms–a current overview. Brauwelt Int
31:23–25
10. Shimokawa M, Suzuki K, Yamagishi H (2016)
Detection and identification of lactic acid bac-
teria. Brauwelt Int 34:98–103
11. Asano S, Suzuki K, Ozaki K, Kuriyama H, Kita-
gawa Y (2008) Application of multiplex PCR
to the detection of beer-spoilage bacteria. J Am
Soc Brew Chem 66:37–42
12. Suzuki K, Iijima K, Ozaki K, Yamashita H
(2005) Isolation of hop-sensitive variant from
107
Lactobacillus lindneri and identification of
genetic marker for beer spoilage ability of lactic
acid bacteria. Appl Environ Microbiol
71:5089–5097
13. Sami M, Yamashita H, Kadokura H,
Kitamoto K, Yoda K, Yamasaki M (1997) A
new and rapid method for determination of
beer-spoilage ability of lactobacilli. J Am Soc
Brew Chem 55:137–140
14. Fujii T, Nakashima K, Hayashi N (2005) Ran-
dom amplified polymorphic DNA-PCR based
cloning of markers to identify the beer-spoilage
strains of Lactobacillus brevis, Pediococcus dam-
nosus, Lactobacillus collinoides and Lactobacillus
coryniformis. J Appl Microbiol 98:1209–1220
15. Suzuki K, Yamashita H (2004) Genetic marker
for differentiating beer-spoilage ability of Lac-
tobacillus paracollinoides strains. J Appl Micro-
biol 97:712–718
16. Iijima K, Suzuki K, Asano S, Kuriyama H, Kita-
gawa Y (2007) Isolation and identification of
potential beer-spoilage Pediococcus inopinatus
and beer-spoilage Lactobacillus backi strains
carrying the horA and horC gene clusters. J
Inst Brew 113:96–101
17. Sakamoto K, Funahashi W, Yamashita H, Eto
M (1997) A reliable method for detection and
identification of beer-spoilage bacteria with
internal positive control PCR (IPC-PCR).
Proc Eur Brew Conv Proc 26:631–638
18. Funahashi W, Suzuki K, Ohtake Y, Yamashita
H (1998) Two novel beer-spoilage Lactobacil-
lus species isolated from breweries. J Am Soc
Brew Chem 56:64–69
19. Iijima K, Asano S, Suzuki K, Ogata T, Kitagawa
Y (2008) Modified multiplex PCR for compre-
hensive detection of Pectinatus and beer-
spoilage cocci. Biosci Biotechnol Biochem
72:2764–2766